Rapid Publication - dm5migu4zj3pb.cloudfront.net

Rapid Publication

Rearrangements of the Retinoic Acid Receptor Alpha and PromyelocyticLeukemia Zinc Finger Genes Resulting fromt(11;17)(q23;q21) in a Patient with Acute Promyelocytic LeukemiaSai-Juan Chen, * Arthur Zelent, * Jian-Hua Tong, * Huai-Qin Yu, * Zhen-Yi Wang, *

Josette Derre,1 Roland Berger,' Samuel Waxman,11 and Zhu Chen**Shanghai Institute of Hematology, Rui-Jin Hospital, Shanghai Second Medical University, and Shanghai Central Railway Hospital,Shanghai 200025, China; *Leukaemia Research Fund Center at the Institute of Cancer Research, Chester Beatty Laboratories, FulhamRoad, London SW36JB, United Kingdom; § Unite Institut National de la Sante et de la Recherche Medicale U301 and SDI No. 15954I Centre National de la Recherche Scientifique, Institut de Genetique Moleculaire, 75010 Paris, France; and I1Rochelle BelferChemotherapy Foundation Laboratory, Division of Medical Oncology, Mount Sinai Medical Center, New York 10029

Introduction

Cytogenetic study of a patient with acute promyelocytic leuke-mia (APL) showed an unusual karyotype 46,xy,t(11;17)(q23;21) without apparent rearrangement of chromosome 15.Molecular studies showed rearrangements of the retinoic acidreceptor alpha (RARa) gene but no rearrangement of the pro-myelocytic leukemia gene consistent with the cytogenetic data.Similar to t(15;17) APL, all-trans retinoic acid treatment inthis patient produced an early leukocytosis which was followedby a myeloid maturation, but the patient died too early toachieve remission. Further molecular analysis of this patientshowed a rearrangement between the RARagene and a newlydiscovered zinc finger gene named PLZF (promyelocytic leuke-mia zinc finger). The fusion PLZF-RARa gene found in thiscase, was not found in DNAobtained from the bone marrow ofnormals, APL with t(15;1t) and in one patient with AML-M2with a t(11;17). Fluorescence in situ hybridization using aPLZF-specific probe localized the PLZF gene to chromosomalband 1 1q23.1. Partial exon/intron structure of the PLZF geneflanking the break point on chromosome 11 was also estab-lished and the breakpoint within the RARagene was mapped- 2 kb downstream of the exon encoding the 5' untranslatedregion and the unique A2 domain of the RARa2 isoform. (J.Clin. Invest. 1993.91:2260-2267.) Key words: novel gene rear-rangements * retinoic acid receptor * leukemia

Address correspondence to Samuel Waxman, M.D., Rochelle BelferChemotherapy Foundation Laboratory, Division of Medical Oncol-ogy, Mount Sinai Medical Center, NewYork, NY 10029, or to Dr. ZhuChen, Shanghai Institute of Hematology, Rui-Jin Hospital, ShanghaiSecond Medical University, 197 Rui-Jin Road, Shanghai 20025,China.

Receivedfor publication 1I November 1992 and in revisedform 22January 1993.

1. Abbreviations used in this paper: APL, acute promyelocytic leuke-mia; ATRA, all-trans retinoic acid; PLZF, promyelocytic leukemiazinc finger; PML, promyelocytic leukemia; RARa, retinoic acid recep-tor alpha; RT-PCR, reverse transcription PCR.

Acute promyelocytic leukemia (APL)' is characterized by thechromosomal translocation t( 15; 17) (q22;q2 1) that is presentin almost all patients (1, 2). Recently, molecular studiesshowed that the t(15;17) results in a chimeric gene (PML-RARa) with fusion between promyelocytic leukemia (PML)and retinoic acid receptor alpha (RARa) genes normally local-ized on bands 15q22 and 17q2 1, respectively (3, 4). RARais amember of the nuclear receptor superfamily gene, whereasPMLmay be a transcription factor belonging to a new familyof DNAbinding proteins (5-7). The chimeric PML-RARagene is thought to play an important (but as yet undefined) role

in differentiation and/or proliferation of APL cells.Variant translocations have been reported in APL. They

are in most instances three way translocations involving chro-mosomes 17, 15, and a third chromosome (8). Here we presentclinical and cytogenetic data on a Chinese patient with APLand a variant translocation t( 1; 17 )(q23;2 1) between a newlydiscovered gene (9), designated as PLZF (promyelocytic leu-kemia zinc finger), and the RARa locus. The PLZF gene isnormally situated on a band 1 1q23.1 and is fused to RARaas aresult of the above reciprocal translocation to form two newchimeric genes PLZF-RARa and RARa-PLZF. Additionally,we show that both PLZF(A)-RARa and PLZF(B)-RARamRNAswere expressed in the bone marrow cells isolated fromthis patient.

Methods

Cytological and cytogenetic studies. The diagnosis of APL (M3) wasestablished according to the criteria of the FAB classification (10).Cytogenetic analysis was performed on 24 h in vitro cultures of bonemarrow cells. GTG-banding and RHG-banding techniques were ap-plied. Chromosomes were classified according to the international no-menclature ( 11).

DNAand RNAanalysis. The high molecular weight DNAwas ex-tracted according to standard procedures ( 12). For controls, a numberof DNAsamples from APL with the commont( 15;17) and one AML-M2with t( 1 1;17)(q23;q21 ) were analyzed. DNAswere digested withEcoRI, BgIII, and HindIll to completion, size fractionated on 0.7%agarose, and Southern blotted.

Molecular cloning. Using the PLZF specific cDNA probe (9), apreviously described human genomic DNAlibrary ( 13) was screened.A positive phage clone 20+ was obtained (Fig. 3 A, IV). The restrictionmap was established using a series of double digestions. A 2.3-kbBamHI-BgIII fragment (probe MB) hybridizing to the PLZF probe

2260 Chen, Zelent, Tong, Yu, Wang, Derre, Berger, Waxman, and Chen

Abstract

J. Clin. Invest.© The American Society for Clinical Investigation, Inc.0021-9738/93/05/2260/08 $2.00Volume 91, May 1993, 2260-2267

and free from repetitive sequences was isolated for in situ hybridizationand Southern analysis. Subsequently, a 2. 1-kb BgIII-EcoRI fragmentsituated just 3' to the MBprobe was generated to perform the chromo-some walking.

In situ hybridization. Fluorescence in situ hybridization to highresolution R-banded metaphase chromosomes was performed with thebiotinylated probe MB, according to ( 14). Chromosomes were exam-ined with a Leitz fluorescence microscope as previously described ( 14).

Reverse transcription PCR (RT-PCR) analysis. RNAs were ex-tracted with the guanidium thiocyanate CsCl gradient method. Thegeneral conditions of RT-PCR were according to the previously de-scribed procedure ( 15). PLZF specific primers were designed accord-ing to the PLZF cDNAsequence (9) whereas primers homologous toPMLand RARawere according to the previously published sequences(6) (see Fig. 6 A) for the positions of each oligos). In both PML-RARaand PLZF-RARa analyses, the same set of RARaderived oligonucleo-tides were used as retrotranscription primer (oligo g: 5'GTTCGTAGT-GTATTTGCCCAGCTGGCAGAG3') and the 3' PCRprimer (oligof: 5' GGCTTGTAGATGCGGGGTAG3'). The 5' primer used inPML-RARaRT-PCR was derived from PMLexon 3 (5' ATGGCT-TCGACGAGTTCAAG3') allowing the detection of both long (L)and short (S) PML-RARa isoforms (15). For analyzing the PLZF-RARa isoforms, different PLZF specific 5' primers were used: oligo a(situated upstream of the alternatively spliced exon): 5' GACAAT-GACACGGAGGCCAC3'; oligo c (situated within the alternativelyspliced exon): 5'AACCACAAGGCTGAC-GCTGT3'. Different oligo-nucleotide probes were also used including: oligo e (for RARa): 5'

GCTGGGCACTATCTCTTCA3'; oligo c (for the alternativelyspliced PLZF exon): 5' ATTGAGCATGCCGTCTTCCG3'; oligo b(upstream to the alternatively spliced PLZF exon): 5' AGGACCGCA-AGGCTCGGTAC3' and an oligo probe specific for PMLexon 3: 5'AGCTCTTGCATCACCCAGG3'.

Sequence analysis. DNAsequence was established according to thedideoxynucleotide method using the Sequenase Version II Kit (U.S.Biochemical Corp., Cleveland, OH).

Results

Clinical data. The patient was a 67-yr-old man complainingabout weakness and anorexia for 1 mo, as well as coughing andgingival bleeding for a few days. Physical examination notedpallor, signs of bronchitis, purpura of the tongue without otherobvious bleeding signs, cervical lymphadenopathy, and ab-sence of hepatosplenomegaly. The renal and hepatic functiontests were normal. Disseminated intravascular coagulation wasnot diagnosed, but occult blood in the stool was detected. Theperipheral white blood cell count was 4.1 X 109/liter. Bonemarrow was hypercellular with 69% APL-like promyelocytes,but without Auer rods. The myeloperoxidase reaction wasstrongly positive.

The patient was classified as APL and was given all-transretinoic acid (ATRA) at a dose of 60 mg/d. Onday 8, the whiteblood cell count increased to 61 X 109/liter with 72% promy-

B

'^ .:.4..tx; ,, ,- .,;Figure 1. Bone marrow sample of the patient with APL t( 11;17). (A) Hypergranular leukemic promyelocytes before treatment. (B) After 16 d ofall-trans retinoic acid treatment, the blast cells were still present while some mature myeloid cells could be observed.

Rearranged Retinoic Acid Receptor Alpha and PLZF Genes in Promyelocytic Leukemia 2261

PP m.

-4 I.. .-Jim

Figure 2. Karyotype analysis of the bone marrow ofthe patient with APL t( 11;17) (GTG bands):46,XY,t( 1 1; 17)(q23;2 1 ).

elocytes and the bone marrow contained 77% promyelocytes.The white blood count increased to 131 X 109/liter on day 11

(promyelocytes 75%) and hepatosplenomegaly was noted forthe first time. On day 16, the white blood cells decreased to 71X 109/liter with 63% promyelocytes present in bone marrow

smears, although an increase in more mature myeloid cellsbegan to appear (Fig. 1 ). The ATRAtreatment was continueduntil day 19. However, the patient developed pneumonia andrespiratory failure, and he died on day 20.

Cytogenetics. Out of 20 metaphases examined, two were

normal, 46,XY, and 16 were abnormal: 46,XY,t( 11;17)(q23;2 1) (Fig. 2). The two remaining metaphases showed thet ( 1; 1,7) and chromosome random losses.

Molecular evidence demonstrating the fusions between theRARaand PLZF genes. Southern analysis of DNAobtainedfrom the patient with t( 1 1; 17 ) APL revealed no rearrangementof the PMLgene (data not shown) and using a PLZF genomicDNAprobe (MB) (see Fig. 3 A, IV) revealed rearranged bandsfollowing EcoRI and HindIII digestion (Fig. 3 B). No rear-

rangements or PLZF were detected in bone marrow DNAs inthree normals, 10 APL patients with t( 15;17), and one AML-M2with a t( 11;17) (data not shown).

The RARagene was also rearranged in this case and therearranged bands in EcoRI and HindIII revealed by bothprobes had the same size. According to our previously estab-lished RARarestriction map (Fig. 3 A, I) ( 13), this rearrange-ment is located in the intron between exon 3 encoding the 5'untranslatable region and the unique A2 domain of the RARaisoform and exon 4 encoding the B region of RARa.

The PLZFgene is localized on chromosomal band llq23.1by in situ hybridization. In situ hybridization of the 2.3-kb MBprobe to normal metaphases showed hybridization signal as

twin spots on the chromatids of one chromosome 1 1, subband1 1q23. 1 in 18 metaphases. Only one metaphase had doublespots on both chromosome 11. Two metaphases showedaberrant double spots on bands 1p34 and 15q21 respectively,in addition to the localization on 1 1q23. It was concluded thatthe 2.3-kb MBprobe representative ofthe PLZFgene was local-ized on 1q23.1 (Fig. 4).

Molecular characterization of partial genomic PLZFgeneregion harboring the breakpoint on chromosome 11. The geno-mic studies allowed us to clone a partial PLZF region of 70 kbcontaining the 3' part exonic sequence in the open readingframe (Fig. 3 A, IV). Weidentified the exon just upstream of


s *fM::}

z..vI.

t.

J2\

*

i;RE l

. ..A6:' .

.^bkAt'

Aa 4.7s

0us7f

a

:, i ..

f; c.*

7 9

Wnor#4&A-4NM

10 11

I.,

i1 .2-t

12 x

*:f

iii13 14

0-Ir16

is

1817

; r

20

22

I a.0

.1,

t

v 4.-

A I. RARx

II. PLZ-RAa

1 1111

Hflr vTM Be M1 s 1 1;

2 (alA) 3 (o2A) 4(B) 5 6 7 8 95.5 kb EE

M En MF M MH

x p4 R4(B) 5 6 7 8 9 '

m. RAR-O(PLZFMH HEE B M v

1 2 (al A)

IV . PlZF

.Ml EE MMI B H MLI 1 111114

- 2.3kbMB_ L1 kb BE

'1620+

BEa b c Ha b c Ba b c

44O-

Ea b c Ha b c Ba b c

441--

the breakpoint and two exons downstream (Fig. 5 for se-

quence). The chromosome 11 breakpoint was within an intronwhich separate exons encoding the second and the third PLZFzinc fingers, respectively. There is an uncloned region in thisintron as shown in Fig. 3 A, predicting PLZF to be a very largegene.

Both PLZF (A)-RARa and PLZF (B)-RARa chimerictranscripts are expressed in patient with t( 1;1 7) positive APL.Recently, we have described the existence of two PLZF iso-forms (A) and (B), differing by a proline-rich 369-bp exon thatprobably resulted from an alternative splicing mechanism (9).As the proline-rich domain has been implicated in transcrip-tion regulation, it was important to see if both PLZF isoformscould be transcribed in the PLZF-RARa fusion gene mRNA.Therefore, we performed RT-PCR using primers homologousto this exon and to the RARaB region. A specific band was

obtained in the t( 1 1; 17) sample but not in two t( 15; 17) sam-

ples (Fig. 6 B). Furthermore, when the 5' primers were re-

placed by those just upstream of this exon, two amplified bands

Figure 3. Chromosomal breakpoints in the RARaand PLZF genes. (A) I. Genomic organization of theRARagene. Arrowed black boxes represent exons.

Exons 2, 3, and 4 encode the a isoform A region,a2 isoform A region, and the RARaB region respec-tively. The chromosome 17 breakpoint was locatedwithin intron 3 (arrow). The position of the 5.5 kbEcoRI-EcoRI (EE) genomic probe is shown belowthe map. Abbreviations for restriction sites: B, BgIII;E, EcoR 1; H, HindIII; M, BamHI. II. PLZF-RARarestriction map III. RARa-PLZF restriction map. II

and III are deduced from I and IV. IV. Partial restric-tion map of the PLZF gene established from theanalysis of seven phage clones (bottom). The threeopen arrowhead boxes correspond to the exons up-stream (4) and downstream (5 and 6) of the break-point (arrow). (B) Southern analysis of the RARa(1) and PLZF (II) genes in APL patients witht( 15;17) (b) and t( 1 1;17) (c), and in a control (a)with the EE and MBprobes, respectively. E, EcoRI;H, HindIII; B; BgIII. The rearranged bands are iden-tified by arrows.

were observed (Fig. 6 B). These results were confirmed bysequence analysis and demonstrated that two PLZF-RARaisoforms existed in the t( 11; 1;7) patient, which differed fromeach other by the presence or absence of one PLZF exon. Asshown in previous work, two isoforms of RARa-PLZF tran-scripts were also present in this case by the use of RARa1 or

RARa2promoters. This is consistent with the genomic struc-ture of the reciprocal fusion gene RARa-PLZF (Fig. 3 A,III) (9).

Discussion

Cytogenetic study of a patient with APL showed an unusualkaryotype 46,XY,t( 11;17)(q23;21) without apparent rear-

rangement of chromosome 15. Molecular studies showed rear-

rangement of the RARagene but no rearrangement of PMLconsistent with the cytogenetic data. The leukemic cells resem-

bled the abnormal promyelocytes seen in the usual APL, with


3 (W2A)

El HEI HM Hl lBMM

5

EM B

J1 1'I42

L.J 2Kb

BHH H H. .H Hjt11

Figure 4. Fluorescence in situ hybrid-ization of the MBprobe to controlR-banded metaphase cell. A hybrid-ization signal is visible on the twochromatids of a chromosome 11, onband I 1q23. Counterstaining by pro-pidium iodide.

GGATCCAGGGATGTGTTTCCATCGGTGCCCTCCTGTTCCCTTCCGCCTGTCACCTGCCAG60AGGGATGGCTGCCAAGCCCCCAGGTAGGGGATGGCCCTGCCTCTTGTCCAGCCAGAGCAG120

4 ZflK L ® S G M K T Y G

CAGCAACCTCTCTTTTCCTTTCCCTTACAGGAAGCTGCACAGTGGGATGAAGACGTACGG180

Zf2 Figure 5. Nucleic acid sequence of the 525-bp PstI© E L © G K R E L D S L R L R M Q L L A genomic DNAfragmentcontainingthe PLZFexon

GTGCGAGCTCTGCGGGAAGCGGTTCCTGGATAGTTTGCGGCTGAGAATGCACTTACTGGC240 4. The splicing acceptor (AG) and donor (GT) signalsI are underlined. The amino acid sequence encoded

(i)S by this exon is shown in one-letter codes above theTCATTCAGGTAGGCAAGTTCGCCTTAGTGGCCCGTTCAGATACAGGCAACCATCTCCTGC300 DNAsequence. One histidine at the end of the first

TTGCCTTTACCCCTCCTCAGAGCCTGCTGTGGCCTGCATGTGGGGACTGCCCGCTGGGGC360 PLZF zinc finger and two cysteins and two histidinesCCTGGTCCATCTTGTTCCCTGGACCCTCCCTCCAGGCTTATGACACAGAAGATCCATCCT420 Tist exongis sitatd upstream fitge arZ breakThis exon is situated upstream of the PLZF break-GATGGCGGGGCCACTTGGATGAACCCACCTTCAAGCTCTCGTGGGTTTCCCAGGCATCAG480 point and is fused to the RARaB region in PLZF-

TGGCAACCAGTGCCTGTGTGATCTACCTTCCAAAGTAGACTGCAG 525 RARachimeric transcripts.


737Pro

RARao REGIONS B - F PLZF(A)-RARa

254 300 332Gin Arg Serb

1 3 4

a b -e -f g

254 377 423 455Gin Gin Arg Ser

RARa REGIONS B - F

1 2 3 4 A

B PML-RARoX_- - -I

--1.

- - -

1353 -

PLZF (A+B)

-RAROCII

t- - t-- - -

L S

860Pro

PLZF(B)-RARa

PLZF (B)

-RAROXI

t- - t-_O _-4 _.4

L S

40

=,am..

~~~~~mI.~~~~~~~~M

603 -

310O -

1 2 3 4 5

A..

6 7 8 9

Figure 6. (A) Schematic representation of the pro-tein-coding region of the two PLZF-RARa isoformsthat differ by the presence (PLZF(B) -RARa) or ab-sence (PLZF(A)-RARa) of PLZF B isoform exon(here temporarily referred to as exon 2). The exonwhich was fused to RARaB-region is defined by ge-nomic DNAanalysis (exon 4, see Fig. 5). The se-quence between exons 2 and 4 could be one PLZFexon (exon 3). The exon composition in the region1 remains to be established. The first and last aminoacids, as well as those at the ends of exons I to 4, arerepresented by three-letter codes and are numberedaccording to Chen et al. (9). The black triangles indi-cate the junction between PLZF and RARacodingsequences. The positions of oligonucleotides used inPCRanalysis of PLZF-RARa isoforms are indicatedeither by arrows (primers) or by bars (probes). Thenucleic acid sequences of these oligonucleotides areshown in Materials and Methods. (B) RT-PCR ex-periments showing the specific presence ofPLZF(A)-RARa and PLZF(B)-RARa isoforms inleukemic cells with the t( 11;17). RNAderived fromthe t( 11;17) cells (lanes 1, 4, and 7), the t( 15;17)cells expressing the long (L, lanes 2, 5, and 8) or short(S, lanes 3, 6, and 9) PML-RARafusion transcriptswere analyzed. The retrotranscription was carried outin all cases using oligonucleotide g corresponding tothe B region of RARa. For detecting the PML-RARafusion transcripts (lanes 1-3), 5' primer homologousto the PMLexon 4 and 3' primer situated in RARaBregion (oligonucleotide f) were used. For analyzingPLZF-RARa isoforms, two different 5' primers wereused, which allow to amplify either both isoforms(oligonucleotide a, lanes 4-6) or only the PLZF(B)-RARaisoform (oligonucleotide c, lanes 7-9) whenthe same 3' primer (oligonucleotide f) were used.PCRproducts on the same blot were hybridized se-quentially to different probes specific for RARaBregion (oligonucleotide e, I); PMLexon 3 (II); PLZFregion 1 (oligonucleotide b, III); and PLZF B formexon (oligonucleotide d, IV). Molecular standards areshown in basepairs on the left. Note that the PML-RARaPCRproducts were present only in thet( 15; 17) samples, while those of the PLZF-RARawere detected only in t( 11; 17) cells. In addition, indifferent sets of PCR, two bands corresponding to thePLZF(A)-RARa and PLZF(B)-RARa (lane 4, Iand III) or one band specific for the PLZF(B)-RARa(lane 7, I and IV) were obtained when appropriateprimer pairs were used.

the exception that Auer rods were not present. Similar tot(15;17) APL, ATRA treatment exacerbated a leukocytosisthat was followed by morphologic evidence of myeloid matura-tion, but the patient died before treatment could be fully evalu-ated. These data are consistent with the diagnosis of APL, witha variant translocation.

Variant translocations have been reported in APL. Thesemay involve three or more chromosomes including 15 and 17.In other cases, only two chromosomes were apparently in-volved and the translocations were between 17 and another

chromosome in most instances. In these cases, the two 15 chro-mosomes were morphologically normal ( 16). This is reminis-cent of the variant Ph translocations in chronic myelogenousleukemia, in which a BCR-ABL rearrangement was consis-tently found even when chromosomes appeared normal underthe microscope ( 17). There is, however, no data presently avail-able describing molecular rearrangements associated with vari-ant translocations of APL. The RARagene was not rearrangedin one patient without apparent involvement of chromosome17 (5). Rearrangement of the RARaand PMLgenes was pres-


A IMet

Met

603 -

310 -

118 -

1353 -

603 -

310 -

118 -

1353 -

603 -

310 -

1353 -

ent in another patient with an unusual abnormal karyotypewithout apparent chromosome 15 rearrangement (Baranger etal., manuscript submitted for publication).

A variant t( 11; 17) positive APL was previously reported(18) but not studied for molecular rearrangements. In the pres-ent case, the t( 1 1; 17) was associated with rearrangement of theRARagene while the PMLgene was structurally intact. Thechromosome 11 gene (PLZF) involved in rearrangement withRARain this unique case of APL has recently been cloned (9).This gene has some homology with the zinc finger gene MZF- 1( 19) and is also retinoic acid responsive and preferentially ex-pressed in myeloid cells ( 19). Because of t( 1 1; 17), the PLZFgene is disrupted in its zinc finger containing region, with fu-sion of two zinc fingers to the RARaB region in the PLZF-RARafusion gene, while seven zinc fingers joined the RARaregion in the reciprocal RARa-PLZF chimeric gene. It is note-worthy that the RARagene was disrupted in its third intron ascommonly found in the standard t( 15,17). The association ofboth PML-RARaand PLZF-RARa fusions with the APL phe-notype argues for a key role for RARa in the hybrid genes. Insupport of this is the observation that two cases of myelodys-plastic syndrome transformed to APL with trisomy 11 withoutRARarearrangements, failed to respond to ATRA(20). How-ever, since the role of PMLand PLZF in leukemic cell prolifera-tion and differentiation remains largely unknown, it is alsopossible that PML and PLZF have an equivalent functionwhen rearranged with the RARagene.

Chromosomal band 1 1q23 is rearranged in several varietiesof hematopoietic malignancies (17). Breakpoints of chromo-some 11 in acute leukemias with t(4;11 ), t(6;11 ), t(9;l 1 ) andt( 11; 19) have been localized within 300 kb downstream of theCD3Dgene (21-24). The breakpoint was found more distal ina leukemia with t( 11; 19) than in leukemias with one of theother three translocations (25), suggesting that there is a hetero-geneity in the localization of the breakpoints within the band1 lq23, as already shown for the t( 11; 14)(q23p;q32) transloca-tion of lymphoid malignancies (26, 27). The localization of thePLZF gene on 1 1q23. 1, which is centrometric to the otherbreakpoint localizations of most of the recurrent translocationsof hematopoietic malignancies, also argues in favor of thebreakpoint heterogeneity of malignancies with 1 1q23 rear-rangements. Interestingly, the molecular study of anothertranslocation t( 11; 17) detected in a patient with acute myelo-blastic leukemia M2, and thus clinically and cytologically dif-ferent from APL, did not show rearrangements of the RARanor PLZF genes. In our most recent studies, we have identifieda second case of t( 11; 1;7) APL (in collaboration with WilsonMiller) which expressed the PLZF-RARa fusion gene. This isconcordant with the specificity of the gene rearrangements inAPL. The PLZF gene is a putative transcription factor thatappears to be associated with myeloid differentiation (9) andmay be deranged in other myeloid malignancies. The identifi-cation of PLZF justifies that molecular studies of other APLvariant translocations should be systematically performed todetermine if genes other than PML (or RARa) may be in-volved in these APLs.

Acknowledgments

This work was supported by the National Chinese Foundation for theNatural Sciences, the Leukaemia Research Fund of Great Britain, the

Samuel WaxmanCancer Research Foundation, and the Ligue Nation-ale Contre le Cancer.

References

1. Berger, R., A. Bernheim, and G. Flandrin. 1980. Absence d'anomalieschromosomiques et leucEmies aigues: relations avec les cellules m&dullaires nor-males. C. R. Acad Sc (Paris). 288 Sfrie D: 177-179.

2. Larson, R. A., K. Kondo, J. W. Vardiman, A. E. Butler, H. M. Golomb,and J. D. Rowley. 1984. Evidence for a t( 15;17) translocation in every patientwith acute promyelocytic leukemia. Am. J. Med. 76:827-841.

3. deThe, H., C. Chomienne, M. Lanotte, L. Degos, and A. Dejean. 1990. Thet( 15; 17) translocation of acute promyelocytic leukaemia fuses the retinoic acidreceptor a gene to a novel transcribed locus. Nature (Lond.). 347:558-56.

4. Barrow, J., A. D. Goddard, D. Sheer, and E. Solomon. 1990. Molecularanalysis of acute promyelocytic leukemia breakpoint cluster region on chromo-some 17. Science (Wash. DC). 249:1577-1580.

5. Goddard, A. D., J. Borrow, P. S. Freemont, and E. Solomon. 1991. Charac-terization of a zinc finger gene disrupted by the t( 15; 17 ) in acute promyelocyticleukemia. Science (Wash. DC). 254:1371-1374.

6. deThe, H., C. Lavau, A. Marchio, C. Chomienne, L. Degos, and A. Dejean.1991. The PML-RARafusion mRNAgenerated by the t( 15;17 ) translocation inacute promyelocytic leukemia encodes a functionally altered RAR. Cell. 66:675-684.

7. Kakizuka, A., W. H. Miller, Jr., K. Umesono, R. P. Warrell, Jr., S. R.Frankel, V. V. V. S. Murty, E. Dmitrovsky, and R. M. Evans. 1991. Chromo-somal translocation t(15;17) in human acute promyelocytic leukemia fusesRARawith a novel putative transcription factor, PML. Cell. 66:663-674.

8. Mitelman, F. 1991. Catalog of Chromosome Aberrations In Cancer. 4th ed.Wiley-Liss, Inc. New York.

9. Z. Chen, N. J. Brand, A. Chen, S.-J. Chen, J.-H. Tong, Z.-Y. Wang, S.Waxman, and A. Zelent. 1993. A t( 11; 17) translocation in acute promyelocyticleukemia joins the retinoic acid receptor-a gene to a novel Kruppel-like zincfinger gene. EMBO(Eur. Mol. Biol. Organ.) J. 12:1161-1167.

10. Bennett, J. M., D. Catovsky, M. T. Daniel, G. Flandrin, D. A. G. Galton,H. R. Gralnick, and C. Sultan. 1985. Proposed revised criteria for the classifica-tion of acute myeloid leukemia. A report of the French-American-British Cooper-ative Group. Ann. Int. Med. 103:626-629.

1 1. International System for HumanCytogenetic Nomenclature. 1991. Guide-lines for cancer cytogenetics, supplement to an international system for humancytogenetic nomenclature. F. Mitelman, editor. S. Karger AG, Basel.

12. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: ALaboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY

13. Bernard, O., P. Guglielmi, P. Jonveaux, D. Cherif, S. Gisselbrecht, M.Mauchauffe, R. Berger, C.-J. Larsen, and D. Mathieu-Mahul. 1990. Two distinctmechanisms for SCLgene activation in the t( 1:14) translocation of T-cell leuke-mia. Genes Chromosomes & Cancer. 1:194-208.

14. Cherif, D., C. Julier, 0. Delattre, J. Derre, G. M. Lathrop, and R. Berger.1990. Simultaneous localization of cosmids and chromosome R-banding by fluo-rescence microscopy: application to regional mapping of human chromosome11. Proc. Natl. Acad. Sci. USA. 87:6639-6643.

15. Chen, S.-J., Z. Chen, A. Chen, J.-H. Tong, S. Dong, Z.-Y. Wang, S.Waxman, and A. Zelent. 1992. Occurrence of distinct PML-RAR-a fusion geneisoforms in patients with acute promyelocytic leukemia detected by reverse tran-scriptase/polymerase chain reaction. Oncogene. 7:1223-1232.

16. Hagemeijer, A., C. R. Bartram, E. M. E. Smit, A. J. Van Agtoven, and D.Gootsma. 1984. Is the chromosomal region 9q34 always involved in variants ofthe Ph' translocation? Cancer Genet. Cytogenet. 13:1-16.

17. Mitelman, F., Y. Kaneko, and J. Trent. 1991. Report of the committee onchromosome changes in neoplasia. Human Gene Mapping 11. Cytogenet. CellGenet. 58:1053-1079.

18. Najfeld, V., A. Scalise, and K. Troy. 1989. A new variant translocationI1; 17 in a patient with acute promyelocytic leukemia together with t( 7; 12).Cancer Genet. Cytogenet. 43:103.

19. Hromas, R., S. J. Collins, D. Hickstein, W. Raskind, L. L. Deaven, P.O'Hara, F. S. Hagen, and K. Kaushkansky. 1991. A retinoic acid-responsivehuman zinc finger gene, MFZ-1, preferentially expressed in myeloid cells. J.Biochem. 266:14183-14187.

20. Najfeld, V., A. Chen, A. Scalise, E. Ambinder, G. Fernandez, and S.Waxman. 1992. Myelodysplastic syndrome (MDS) transforming to a variantacute promyelocytic leukemia (APL) with trisomy and rearrangement of chro-mosome I 1. Blood. 8(Suppl. 1):27a.

21. Rowley, J., M. 0. Diaz, R. Espinosa III, Y. D. Patel, E. van Melle, S.Ziemin, P. Taillon-Miller, P. Lichter, G. A. Evans, J. H. Kersey, et al. 1990.


Mapping chromosome band 1 1q23 in human acute leukemia with biotinylatedprobes: identification of I lq23 translocation breakpoints with a yeast artificialchromosome. Proc. Nail. Acad Sci USA. 87:9358-9362.

22. Das, S., F. E. Cotter, B. Gibbons, S. Dhut, and B. D. Young. 1991. CD3Gis within 200 kb of the leukemic t(4; 1 1 ) translocation breakpoint. Genes Chro-mosomes & Cancer 3:44-47.

23. Cimino, G., D. T. Moir, 0. Canaani, K. Williams, W. M. Crist, S. Katzav,L. Cannizzaro, B. Lange, P. C. Nowell, C. M. Croce, and E. Canaani. 1991.Cloning of ALL-1, the locus involved in leukemias with the t(4; II )(q21;q23),t(9;11 )(p22;q23), and t( I l;19)(q23;pl3) chromosome translocations. CancerRes. 51:6712-6714.

24. Ziemin-van der Poel, S., N. R. McCabe, H. J. Gill, R. Espinosa III, Y.Patel, A. Harden, P. Rubinelli, S. D. Smith, M. M. Le Beau, J. D. Rowley, andM. 0. Diaz. 1991. Identification of a gene, MLL, that spans the breakpoint in

1 1q23 translocations associated with human leukemias. Proc. Natl. Acad. Sci.USA. 88:10735-10739.

25. Cherif, D., H. Der Sarkisslan, J. Derr6, T. Tokino, Y. Nakamura, and R.Berger. 1992. The I Iq23 breakpoint in acute leukemia with t( 11; 19 )(q23;pl 3) isdistal to those of t( 14;1 ), t(6;1 1) and t(9; 11). Genes Chromosomes & Cancer.4:107-112.

26. Akao, Y., M. Seto, T. Takahashi, M. Saito, K. R. Utsumi, S. Nakazawa,and R. Ueda. 1991. Rearrangements on chromosome 1 1q23 in hematopoietictumor-associated t( 1 1;14) and t( 1 l;19) translocations. Cancer Res. 51:6708-6711.

27. Lu, D., and J. J. Yunis. 1992. Cloning, expression and localization of anRNAhellcase gene from a human lymphoid cell line with chromosomal break-point 1 1q23.3. Nucleic Acids Res. 20:1967-1972.


Documents

Rapid Publication - dm5migu4zj3pb.cloudfront.net