Rapid detection of Cronobacter sakazakii by real-time PCR based

Draft

Rapid detection of Cronobacter sakazakii by real-time PCR

based on cgcA gene and Taqman probe with IAC

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2015-0602.R2

Manuscript Type: Article

Date Submitted by the Author: 13-Nov-2015

Complete List of Authors: Hu, Shuangfang; South China University of Technology, College of Light Industry and Food Sciences Yu, Yigang; South China University of Technology, College of Light Industry and Food Sciences Li, Rong; Zhongshan Entry-Exit inspection and Quarantine Bureau, Wu, Xinwei; Guangzhou Center for Disease Control and Prevention,

Department of Microbiology XIAO, Xing-long; South China University of Technology Wu, Hui; South China University of Technology, College of Light Industry and Food Sciences

Keyword: Cronobacter sakazakii, cgcA, qRT-PCR, PIF, rapid detection

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Title page

Rapid detection of Cronobacter sakazakii by real-time PCR

based on cgcA gene and Taqman probe with IAC

Shuangfang Hua, Yigang Yu

a, Rong Li

b, Xinwei Wu

c,Xinglong Xiao

a*, Hui Wu

a

a. College of Light Industry and Food Sciences, South China University of Technology, Guangzhou,

Guangdong Province, 510640, China;

b. Zhongshan Entry-Exit inspection and Quarantine Bureau, Room 804, No. 2, Zhongshan 6th Road,

Zhongshan, Guangdong Province, 528403, China;

c. Department of Microbiology, Guangzhou Center for Disease Control and Prevention, Qide Road No.

2, Guangzhou, Guangdong Province, 510440, China.

*Corresponding author:

Xing-long Xiao

Postal address: Research Center of Food Safety and Detection, College of Light Industry and Food

Sciences, South China University of Technology, 381Wusan Road, Tianhe District, Guangzhou City,

Guangdong Province,510640, China.

E-mail: [email protected]

Tel.: +86-20-22236819; +86-13828797202.

Fax: +86-20-22236819

Page 1 of 21



Draft

2

Rapid detection of Cronobacter sakazakii by real-time 1

PCR based on cgcA gene and Taqman probe with IAC 2

Abstract: 3

As a severe virulent strain to infants, species Cronobacter sakazakii is frequently detected in 4

powdered infant formula (PIF). Therefore, it is necessary to develop a fast and specific detection 5

method. The specificity of our newly developed quantitative real-time PCR (qRT-PCR) was validated 6

with DNA from 46 strains. Among them, 12 C. sakazakii strains were correctly amplified, whereas no 7

positive florescent signal was observed from 34 non-target controls. The detection limit of C. sakazakii 8

was about 110 CFU/mL in broth and 1,100 CFU/g in PIF. After enrichment in BPW (buffer peptone 9

water) for 6 h, our developed qRT-PCR assay could reliably detect C. sakazakii when the inoculation 10

level was as low as 2 CFU/25 g (0.08 CFU/g) in PIF. The growth of C. sakazakii could be inhibited by 11

the presence of Lactobacillus pentosus and Bacillus cereus, which used a longer enrichment period 12

before the isolation was accomplished. However, at 5 and 50 CFU/25 g inoculation levels of C. 13

sakazakii in the presence of 4×106 CFU/25 g or 2×10

4 CFU/25 g of L. pentosus and B. cereus, the qRT-14

PCR assay could detect the presence of Cronobacter even though these artificially spiked samples were 15

negative in culture. Therefore, our results indicated that the qRT-PCR assay could detect samples 16

containing inhibitors and avoid false negatives by using an internal amplification control. 17

Key words: Cronobacter sakazakii; cgcA; qRT-PCR; PIF; rapid detection. 18

1. Introduction 19

Cronobacter spp. previously referred to as “yellow-pigmented Enterobacter cloacae”, was first 20

defined as Enterobacter sakazakii in 1980 (Farmer 1980) and this classification was based on both 21

DNA-DNA hybridization studies and phenotypic characterization. Later on, Iversen et al. (2006) 22

reviewed Famer’s work and applied f-AFLP (Fluorescent Amplified Length polymorphisms) 23

fingerprints, ribopatterns and full-length 16S rRNA gene sequences as well as DNA-DNA 24

hybridization (Iversen et al. 2007). The results support the suggestion of Farmer (1980) that E. 25

sakazakii may harbor different species, and these bacteria are subsequently classified into five species 26

within the new Cronobacter genus (Iversen et al. 2008). Currently, there are seven recognized species 27

within Cronobacter (Grim et al. 2013). Among which, there are six pathogenic Cronobacter species 28

Page 2 of 21



Draft

3

associated with food, namely C. sakazakii, C. turicensis, C. malonaticus, C. universails, C. muytjensii 29

and C. dublinensis which has three subspecies C. dublinensis sp. dublinensis, C. dublinensis sp. 30

lausannensis and C. dublinensis sp. lactatidi. These six closely related species are accepted as 31

opportunistic pathogens that have been associated with infections often in neonates and sometimes in 32

adults. Besides the six species which have medical significance, C. condimenti has no relationship with 33

human illness (Cruz-Cordova et al. 2012). With the development of taxonomy of Cronobacter, 34

detection methods obviously need to be updated accordingly. 35

Powdered infant formula (PIF) is identified as the main source of C. sakazakii infection 36

(Friedemann 2009), and C. sakazakii is frequently isolated from powdered milk products (Holy et al. 37

2014). The potential risk of bacterial contamination is very high during the preparation of dried foods, 38

such as PIF (O'Brien et al. 2009), and it is known that bacteria can survive for approximately 2 years in 39

PIF (Edelson-Mammel et al. 2005). Higher mortality rates of Cronobacter spp. infection in neonates 40

and infants seem to be especially associated with species of C. sakazakii (Joseph and Forsythe 2012, 41

Holy and Forsythe 2014). In view of its high occurrence in PIF and severe pathogenicity among infants, 42

it is quite necessary to develop a fast and species-specific method to detect C. sakazakii. 43

Conventional methods for Cronobacter spp. detection (FDA, 2002; ISO, 2006) are time-44

consuming, and they fail to specifically identify species C. sakazakii. Some newly developed methods, 45

such as loop-mediated isothermal amplification (LAMP) assay (Liu et al. 2012), PCR-enzyme-linked 46

immunosorbent assay (PCR-ELISA) (Park et al. 2012) and immunochromatographic test (Blazkova et 47

al. 2011) have been applied to the rapid detection of Cronobacter spp. in food matrices. But these 48

methods are costly and failed quantitative detection. In spite of the advantage of rapidity and simplicity, 49

real-time PCR is sensitive and specific, by which the possibility of cross contamination can be avoided. 50

Several real-time PCR methods have been developed to detect Cronobacter spp., and target sequences 51

have been utilized, including gene ompA (Dong et al. 2013), gene grxB (Dong et al. 2013), gene rpoB 52

(Stoop et al. 2009), the 16S rRNA gene (Kang et al. 2007) and the 16S-23S rRNA internal transcribed 53

spacer (ITS) (Wang et al. 2012). However, the taxonomic revisions (Krasny et al. 2014) within the 54

Cronobacter genus largely challenge the reliability of some methods, and reevaluation is required to 55

ensure compliance with international microbiological safety requirements of PIF. Moreover, the 56

species-specific method remains rarely available for the detection of C. sakazakii, since most of the 57

detection methods have been published before the new classification of C. sakazakii and could not 58

Page 3 of 21



Draft

4

distinguish C. sakazakii from other pathogenic Cronobacter species. Their ability to specifically detect 59

target Cronobacter species should be reassessed. Huang et al. (2013) simultaneously detected C. 60

sakazakii and C. dublinensis by conventional PCR using two pairs of species-specific primers based on 61

gene grxB. No real-time PCR specifically targeting C. sakazakii has been developed yet. Therefore, a 62

conservative gene sequence within genus Cronobacter is necessary. The cgcA gene (Carter et al. 2013) 63

was found to be conserved among all pathogenic species except for C. condimenti, and it possesses 64

interspecies specificity between these six pathogenic species. The cgcA gene is an appropriate PCR 65

target to design species-specific primer because it provids a significant number of species-specific sites 66

(single nucleotide polymorphisms [SNPs]) as demonstrated by (Carter et al. 2013). 67

During enrichment procedures, the growth of other organisms is considered to have an inhibitory 68

effect on target microbial flora, leading to a false negative result or an increased detection limit. 69

Compared with other detection methods, the time consumption of enrichment prior to PCR is usually 70

less, and some antibacterial substances in the sample have been found to inhibit the growth of 71

Cronobacter spp., resulting in a false negative result (Dong et al. 2013). Miled et al. (2010) showed 72

that the growth of Cronobacter spp. can be affected by acidification of the enrichment broth or by the 73

production of bacteria in background flora. Cronobacter spp., Bacillus cereus and Salmonella 74

typhimurium are the major bacterial pathogens that have been associated with food poisoning in 75

powdered weaning foods (Hong et al. 2008). The presence of S. typhimurium (Hyeon et al. 2010) and S. 76

enteritidis (Li et al. 2013) do not affect the detection limit of Cronobacter by the real-time PCR, even 77

when the inoculation level of S. typhimurium was 108 CFU/mL (Wang et al. 2012). Gram-positive 78

species may compete with enterobacteriaceae and Cronobacter in buffered peptone water (Joosten et al. 79

2008). The growth rate of Bacillus spp. can be very high in non-selective enrichment broth at 37°C, 80

and such a high growth can therefore impede the Cronobacter enrichment. Besides, the actively 81

growing cells of Lactobacillus, which is widely used in fermentation of dairy products, are able to 82

reduce the viability of C. sakazakii (Awaisheh et al. 2013). However, the effects of B. cereus or 83

Lactobacillus on the C. sakazakii detection in PIF remain unclear. 84

It is urgent to develop a technique that enables fast and reliable classification and identification of 85

C. sakazakii worldwide. In the present study, we developed a Taqman real-time PCR assay based on 86

the cgcA sequence for C. sakazakii detection with a simple enrichment process. In addition, the 87

effectiveness of the method was determined with artificially contaminated PIF samples. 88

Page 4 of 21



Draft

5

2. Materials and methods 89

2.1. Bacterial strains and growth conditions 90

A total of 46 bacterial strains used in this study are listed in Table 1. Despite of Cronobacter and 91

Enterobacter, the most common pathogenic bacteria associated with dairy product are Listeria spp., 92

Salmonella spp., Escherichia coli and Shigella spp. (Mortari and Lorenzelli 2014). All strains listed in 93

Table 1 can be potentially isolated from food samples. Strains with Strains ID (strains identification) 94

were purchased from corresponding culture collection institutes. PIF isolation was performed in our 95

cooperation institute Zhongshan Entry-Exit Inspection and Quarantine Bureau and published by Cai et 96

al. (2013) formerly. The cultures were grown on the appropriate media before DNA extraction. 97

Specifically, Enterbacter, Bacillus, Listeria spp., Salmonella spp., Escherichia coli and Shigella spp 98

were aerobically incubated at 37 °C for 24 h in Luria-Bertani broth (Guangdong Huankai Microbial 99

SCI. & Tech, Co., Ltd., China). Lactobacillus was incubated aerobically at 37 °C for 24 h in nutrient 100

broth (Guangdong Huankai Microbial SCI. & Tech, Co., Ltd., China). Cronobacter were aerobically 101

incubated at 37 °C for 24 h in Trypticase Soy Broth (Guangdong Huankai Microbial SCI. & Tech, Co., 102

Ltd., China). 103

2.2. DNA extraction for the qRT-PCR assay 104

Cell pellets from 1 mL bacteria culture was used for bacterial DNA extraction with the TIANamp 105

bacteria DNA Kit (Tiangen Biotech Beijing Co., Ltd., China). Specifically, cell pellet was resuspended 106

in 200 µL GA buffer, and lyzed using 220 µL GB containing buffer-saturated phenol in the presence of 107

proteinase K at 70°C for 10 min. The DNA was precipitated in 220 µL ice-cold ethanol. Solution was 108

transferred into Spin columns CB3 and centrifuged at 13,400 g for 30 sec. The penetrating fluid was 109

discarded, and the DNA attached on the Spin columns was washed by 500 µL GD buffer and 600 µL 110

PW buffer. DNA was eluted with 70 µL Tris-EDTA buffer and stored at -20℃. Above-mentioned 111

buffers GA, GB, CD and PW were commercially available from Tiangen Biotech Beijing Co., Ltd. For 112

PIF samples, 1 mL of resuspended PIF was centrifuged for 3 min at 12, 000 g, and the upper fat in the 113

tube was carefully removed with sterile cotton sticks. The pellet was used for bacterial DNA extraction 114

using the TIANamp bacteria DNA Kit (Tiangen Biotech Beijing Co., Ltd., China). The concentration 115

and purity of the DNA samples were determined spectrophotometrically. When the ratio of OD260/280 116

Page 5 of 21



Draft

6

of tested DNA was between 1.6 and 1.8, the DNA was considered to be pure and DNA concentration is 117

equal to OD 260/0.02. 118

2.3. Primer design based on the cgcA gene 119

The nucleotide sequences of the cgcA genes for Cronobacter sakazakii, Cronobacter turicensis, 120

Cronobacter malonaticus, Cronobacter universails, Cronobacter muytjensii and Cronobacter 121

dublinensis were obtained from the GenBank (database http://www.ncbi.nlm.nih.gov/) and compared. 122

The accession numbers of the sequences obtained from the database were C. sakazakii ES15 123

(CP003312.1), C. sakazakii ATCC BAA-894(CP000783.1), C. sakazakii ATCC29544 (CP011047.1), 124

C. turicensis z3032 (FN543093.2), C. malonaticus 681(C CALC01000087), C. malonaticus 125

507(CALD01000014), C. dublinensis 582 (CALA00000000.1), C. dublinensis subsp. lausannensis 126

LMG23824 (AJKY00000000.1), C. dublinensis subsp. lactaridi LMG23825 (AJKX00000000.1), C. 127

dublinensis subsp. dublinensis LMG23823 (AJKZ00000000.1), C. muytjensii ATCC51329 128

(AJKU00000000.1), C. universails NCTC9529 (CAKX00000000.1). Conserved sequences were used 129

to design primers with Primer Express 3.0. TaqMan probes were labeled with the reporter dye 6-130

carboxyfluorescein (FAM) at the 5′-end and with the quencher dye BHQ1 at the 3′-end. The Primer 131

combinations were evaluated for the formation of primer-dimer structures, and the putative interactions 132

among the primers were discarded. The feasibility of all primers and the probe was subsequently 133

validated by BLAST (http://www.ncbi.nlm.nih.gov/BLAST). Finally, primers and the probe were 134

synthesized by Shanghai Huirui Biotechnology Co., Ltd. (Table 2). 135

2.4. Internal amplification control (IAC) 136

The IAC nucleic acids contained primer-binding regions identical to those of the CS primer 137

sequences and contained a unique probe-binding region that was different from the amplicon (Table 2). 138

The IAC was constructed and prepared according to the method previously described by Xiao et al. 139

(2009). Briefly, two 82-mer oligonucleotides overlapping by 26 bps were hybridized, and gaps were 140

filled with Klenow fragment and dNTPs. The product was re-amplified using primers CSpf and CSpr, 141

resulting in a 138-bp fragment, which was cloned into pUCm-T vector (Sangon, China). Purified IAC 142

plasmid DNA was serially diluted in a buffered solution containing EDTA, poly (A) DNA, and sodium 143

azide to yield an IAC stock solution. 144

Page 6 of 21



Draft

7

2.5. qRT-PCR assay 145

qRT-PCR amplification of small regions of the cgcA genes was performed in 20-µL reaction 146

system containing 2 µL of template, 1 µL IAC (about 100 copies/µl), 10 µL of Premix Taq (Ex Taq 147

Version 2.0) (Takara Bio Group, Japan), 0.2 µL of Rox reference dye Ⅱ, 1 μL (10 μM) of each primer, 148

0.5 μL (10 μM) of each probe and 3.8 μL of double-distilled water. The 7500 Fast real-time PCR 149

System (Applied Biosystem) was used for thermocycling and to record changes in fluorescence. The 150

PCR reaction was initiated by pre-denaturation at 95 °C for 2 min, followed by 40 cycles of 151

denaturation at 95 °C for 5 s and annealing at 60 °C for 40 s. Fluorescence was measured at 60 °C and 152

FAM for CS and HEX for IAC. Negative controls were included, containing all the elements of the 153

reaction mixture except the template. All samples were processed in triplicate. The Ct value is 154

inversely related to the copy number of the target gene. Standard curves were generated for pure 155

culture of C. sakazakii ATCC29544 and the efficiencies for each standard curve were calculated using 156

the formula E = 10−1/S – 1 (S being the slope of the linear fit) (Wang et al. 2009). 157

2.6. Detection of C. sakazakii in artificially contaminated PIF 158

The absence of Cronobacter was tested in all PIF used in this assay by the ISO/TS 22964 standard 159

method (Anonymous 2006). According to the method reported by Almeida et al. (2009), to assess the 160

detection limit of qRT-PCR in PIF, C. sakazakii (ATCC 29544) was resuspended in reconstituted PIF 161

(Golden Infant Milk Powder; Inner Mongolia Yili Industrial Group Co., Ltd.) at concentrations ranging 162

from 1.1×109 to 1.1 CFU/g in order to assess the detection limit of qRT-PCR in PIF. The PIF was 163

reconstituted in water at 60°C (Forsythe 2005), a temperature commonly used for rehydration, at the 164

ratio of 1:9 in weight. Subsequently, 1 mL of the reconstituted PIF was used for DNA extraction as 165

section 2.2, respectively. 166

For enrichment, 25 g PIF was placed into a sterile stomacher bag and then artificially inoculated 167

with 1 mL of C. sakazakii ATCC29544 with a final concentration of 2, 20 and 200 CFU/25 g. Samples 168

were taken immediately or after 4, 6, 8, 10 and 12 h of incubation at 37°C, respectively. Each 169

experiment was performed in triplicate. For the TaqMan real-time PCR, bacteria were harvested 170

through centrifugation, and genomic DNA was extracted as previously described. According to 171

Zimmermann et al. (2014), 100 µL enrichment in BPW was directly plated onto Enterobacter sakazakii 172

isolation agar (ESIA) plate, and the colony forming unit in the artificial samples was determined 173

Page 7 of 21



Draft

8

accordingly during the enrichment procedure. Each experiment was performed in triplicate, and 174

meanwhile three homogenates were also applied to ISO/TS 22964 2006 to confirm the positive C. 175

sakazakii. 176

2.7. Detection of C. sakazakii in the presence of B. cereus or 177

Lactobacillus 178

The absence of B. cereus and Lactobacillus was tested in all PIF. To investigate the detection 179

capability of C. sakazakii in the presence of other bacteria, C. sakazakii (ATCC29544) dilutions at 180

concentrations of 5 CFU/25 g and 50 CFU/25 g were inoculated with either Lactobacillus pentosus 181

(CGMCC5172) (Fei et al. 2014) or B. cereus (laboratory preservation strain) to the final concentration 182

ranging from 0 to 106 CFU/25 g, respectively. Subsequently, incubation was carried out at 37°C, and 1 183

mL sample was taken immediately or after 4, 6, 8, 10, 12 and 24 h, respectively. DNA was extracted as 184

template for real-time PCR. 185

2.8. Detection of desiccated C. sakazakii in artificially 186

contaminated PIF 187

To assess the detection limit of desiccated Cronobacter in PIF, the test was conducted according 188

to Zimmermann et al. (2014) with slight modification. PIF used in this assay was tested to be free of 189

Cronobacter. To prepare the artificially contaminated PIF, 25 g of PIF was placed into a sterile petri 190

dish and inoculated with 100 µL of C. sakazakii ATCC29544 to the final concentration of 20 and 2 191

CFU / 25 g, and 100 µL sterilized saline was used as negative control. The inoculated powders were 192

dried for 18 h at 37 °C. To imitate the storage of PIF, the artificially contaminated PIF was preserved 193

for 4 weeks in the dark at room temperature. 194

For the detection of Cronobacter in PIF, the contaminated samples were dissolved in 225 mL 195

buffered peptone water in a stomacher bag and homogenized in a stomacher for 2 min. For the qRT-196

PCR, after 4, 6, 8 and 12 h of enrichment, bacteria were harvested through centrifugation, and genomic 197

DNA was extracted as previously described. Each experiment was performed in triplicate. The 198

genomic DNA was then subjected to qRT-PCR as described in section 2.5. 199

Page 8 of 21



Draft

9

2.9. Statistic analysis 200

All statistical data analysis was performed using Microsoft Excel. Means and standard deviations 201

(SDs) of threshold cycle (Ct) values were calculated. The accuracy of this method was estimated, by 202

linear regression analyses, as the coefficient of determination (R2) for cells in broth and PIF standard 203

curves obtained by plotting the mean Ct values versus log concentrations CFU of C. sakazakii 204

ATCC29544. 205

3. Results 206

3.1. Specificity and sensitivity of qRT-PCR assay 207

DNA samples from 46 strains isolated from PIF samples were used to assess the specificity of 208

qRT-PCR (Table 1). Among them, 12 C. sakazakii strains were correctly amplified, whereas no 209

positive florescent signal was observed from 34 non-target controls. In addition, Enterobacter cloace 210

and Cronobacter species (such as C. muytjensii), which were highly homologous to C. sakazakii, were 211

not detected yet. 212

The analytical sensitivity of our qRT-PCR protocol was determined by analyzing different 213

dilutions of purified C. sakazakii ATCC29544 in broth and PIF. The limit of detection was 110 214

CFU/mL in broth as well as in reconstituted PIF. Since the percentage of PIF in the redissolved milk 215

was 10, the detection limit in PIF was 1,100 CFU/g (Table 3). 216

3.2. Standard curves of C. sakazakii in broth and PIF 217

Fig. 1 shows that the linear range of this real-time PCR assay was 1.1×102 – 1.1×10

8 CFU/mL 218

with a correlation coefficient of 0.999 in broth, and it was 1.1×102 – 1.1×10

8 CFU/ml with a correlation 219

coefficient of 0.997 in PIF. The slope of the curve in broth for cgcA gene was -3.0775, and the 220

amplification efficiency was 113.19%. The slope of the curve in PIF for cgcA gene was -3.0758, and 221

the amplification efficiency was 114.06%. Table 3 shows that the relevant coefficients of variation of 222

both curves ranged from 0.01 to 0.11%, indicating a high precision of our qRT-PCR assays. The 223

corresponding standard deviations of both curves were always below 0.25 log10 CFU/mL, which is a 224

recognized maximum value allowed for the analytical variability. Ct values of IAC were relatively 225

stable. However, no IAC signals were detected when the C. sakazakii concentration was 1.1×107 226

CFU/mL due to the primer competition. 227

Page 9 of 21



Draft

10

3.3. Detection of C. sakazakii in artificially contaminated PIF 228

samples with enrichment step 229

After the enrichment, Ct values of C. sakazakii with concentrations of 2, 20 and 200 CFU/25 g in 230

PIF were between 30.99 and 35.98, 30.01 and 35.44 as well as 30.21 and 35.04, respectively (data not 231

shown). After enrichment of 6 h, C. sakazakii was detected in all three series of PIF samples. The 232

results were confirmed using the ESIA plate. Therefore, after enrichment of 6 h, it was possible to 233

detect C. sakazakii strain ATCC29544 in PIF with a concentration as low as 2 CFU/25 g using our 234

TaqMan qRT- PCR (Table 4). 235

3.4. Detection of C. sakazakii in the presence of B. cereus 236

Our data showed that when the inoculation level of B. cereus ranged from 2 to 2×104 CFU/25 g, it 237

did not affect the detection limit of C. sakazakii with an inoculation level of 5 CFU/25 g. However, 238

when the inoculation level of C. sakazakii was 5 CFU/25 g and the inoculation level of B. cereus was 239

as high as 2×106 CFU/25 g, it was undetectable after 6 h of enrichment. When the inoculation level of 240

C. sakazakii was 50 CFU/25 g, all the inoculated samples were found positive after enrichment of 6 h, 241

with a Ct value ranging from 32.44 to 37.41 (Table 5). The result indicated the growth of C. sakazakii 242

was slightly inhibited by the presence of B. cereus. 243

3.5. Detection of C. sakazakii in the presence of Lactobacillus 244

The presence of Lactobacillus pentosus DMDL 9010 (CGMCC5172) did not affect the detection 245

limit of the real-time PCR. Even when the inoculation level of Lactobacillus was 4×106 CFU/25 g, our 246

method was still capable of detecting C. sakazakii with a concentration as low as 5 CFU/25 g after 247

enrichment of 6 h (Table 6). The Ct values of C. sakazakii were almost stable at 34 to 35 when the 248

inoculation level of C. sakazakii was 5 CFU/25 g and at 36 to 37 when the inoculation level of C. 249

sakazakii was 50 CFU/25 g, respectively. 250

3.6. Detection of desiccated C. sakazakii in artificially 251

contaminated PIF 252

The Ct-values of the IAC were stable at 31, while the Ct values of the positive samples ranged 253

between 22.35 and 32.38 after 12 h of enrichment. After enrichment of 6 h, C. sakazakii was detected 254

Page 10 of 21



Draft

11

in all PIF samples. The results were confirmed using the ESIA plate. After 4 h of enrichment, C. 255

sakazakii without desiccation was detectable at the concentration of 2.0 and 20 CFU/25 g in PIF. While 256

C. sakazakii with 4 weeks of storage was not detectable at both inoculation levels. Therefore, after 257

enrichment of 6 h, it was possible to detect C. sakazakii strain ATCC 29544 in PIF with a 258

concentration as low as 2 CFU/25 g using our TaqMan qRT- PCR (Table 7). 259

4. Discussion 260

The detection methods obviously need to be updated accordingly with the revision of the genus 261

Cronobacter. Detection of all Cronobacter spp., especially the pathogenic species, has become more 262

and more significant in the food matrices. Conventional methods for Cronobacter spp. (FDA, 2002; 263

ISO, 2006) detection are time-consuming and fail to specifically identify C. sakazakii. qRT-PCR 264

assays using TaqMan probe have been shown to be useful for detection of pathogenic bacteria in food 265

samples. In the present study, we designed a competitive IAC to control false-negative results caused 266

by the malfunction of thermal cycler, incorrect PCR mixture and inhibitory substances. Using this 267

method, both the target DNA and IAC were amplified by the same set of primers. However, the target 268

Ct values remained unaffected in the presence of 100 copies/reaction IAC. 269

We tested the specificity of qRT-PCR with DNA from 46 strains. Among them, 12 C. sakazakii 270

strains were correctly amplified, whereas no positive florescent signal was observed from 34 non-target 271

controls. In addition, Enterobacter cloace and Cronobacter species (such as C. muytjensii), which were 272

highly homologous to C. sakazakii, were not detected. The results revealed a high specificity of the 273

qRT-PCR assay for non-target pathogens. The detection limit was about 110 CFU/mL in broth and 274

1,100 CFU/g in PIF. Our data were somewhat lower than that of a previous report (1.2×103 CFU/mL in 275

pure culture as well as infant formula, (Wang et al. 2012). Interestingly, our finding was quite similar 276

to a study of Seo and Brackett (2005), showing a detection limit of 1.0×102 CFU/mL in pure culture 277

and reconstituted infant formula. However, this newly developed qRT-PCR assay reduced the cycles 278

from 50 to 40 compared with Seo and Brackett (2005), preventing the self-degradation and fluorescent 279

signal release after 40 cycles. The standard curves showed a strict inverse correlation between Ct 280

values and concentration of C. sakazakii in broth as well as in PIF. The Ct-values of the IAC were 281

stable at 31. However, no IAC signals were detected when the C. sakazakii concentration was 1.1×107 282

CFU/mL due to the primer competition. Therefore, our results indicated that the qRT-PCR assay could 283

Page 11 of 21



Draft

12

detect C. sakazakii from samples containing inhibitors and avoid false negatives by using an internal 284

amplification control. 285

The enrichment is a key step for detection since the levels of C. sakazakii in food products are 286

very low. The level of contamination ranges from 0.36 to 66.0 CFU/100 g (Forsythe 2005). Our newly 287

developed qRT-PCR assay was reliable to detect the opportunistic pathogens C. sakazakii with the 288

enrichment for 6 h in BPW even when the inoculation level was as low as 2 CFU/25 g (0.08 CFU/g) in 289

PIF. Our detection limit was much higher than those in previous reports, 10 CFU/g in PIF after 290

enrichment of 12 h in brain heart infusion (Zimmermann et al. 2014) and 0.01 CFU/mL (0.1 CFU/g) in 291

PIF after enrichment of 8 h (Almeida et al. 2009). 292

A number of stressed cells may not sufficiently grow after a selective enrichment, yielding false 293

negative results. In contrast, an unselective enrichment would promote the propagation of background 294

flora, leading to the inhibited growth of target strain and subsequent affected detection efficiency 295

(Zimmermann et al. 2014). In this study, the enrichment was conducted in the unselective BPW, and 296

the effects of stressed cells and potential competing strains in the detection were also assessed. After 4 297

weeks of storage, C. sakazakii was detected in all PIF samples after 6 h of enrichment in BPW. 298

Therefore, after enrichment of 6 h, it was possible to detect C. sakazakii strain ATCC 29544 in PIF 299

with a concentration as low as 2 CFU/25 g using our TaqMan qRT- PCR. Almeida et al. (2009) 300

reported a reliable detection accuracy in mixed samples containing C. sakazakii cells. Our developed 301

qRT-PCR assay was able to detect 5 CFU/25 g C. sakazakii, of which the concentration was 0.4- to 302

4,000-fold compared with the B. cereus. The presence of B. cereus did not affect the detection limit of 303

the real-time PCR when the inoculation level of C. sakazakii was 50 CFU/25 g. Overall, the presence 304

of B. cereus inhibited the growth of C. sakazakii for its nutrition competition in the enrichment broth. 305

The presence of Lactobacillus pentosus DMDL9010 (CGMCC5172) significantly inhibited the growth 306

of C. sakazakii after enrichment of 6 h when the pH of enrichment broth was decreased (data not 307

shown) due to the production of lactic acid. Our result was consistent with a previous report that a 308

marked reduction in the population of C. sakazakii is detected after cultivation of 24 h in the mixed 309

culture with Lactobacillus bulgaricus (Hsiao et al. 2010). This could be because that Cronobacter are 310

susceptible to acidity, especially organic acid (Marounek et al. 2012), and the production of lactic acid 311

after 12-h enrichment (Okano et al. 2009) may inhibit the growth of C. sakazakii. 312

313

Page 12 of 21



Draft

13

Conclusions 314

In the present study, we aimed to develop and evaluate a species-specific detection system for 315

opportunistic pathogenic C. sakazakii in PIF. Our newly developed system exhibited high specificity 316

and sensitivity but significantly reduced time consumption compared with the standard method ISO/TS 317

22964. Such a system consisted of only one enrichment step and real-time PCR. Moreover, this 318

specific detection system of C. sakazakii was as reliable as the traditional method. The analysis time 319

was reduced to less than 24 h. Taken together, our newly developed system provided a fast, reliable 320

and sensitive way for the detection of opportunistic pathogenic C. sakazakii. 321

Acknowledgements 322

This work was funded by National Natural Science Foundation of China (No.31101279 and No. 323

31271867), Science and Technology Program Foundation of Guangdong Province (No. 324

2013B021100005 and No. 2014A040401011) and Fundamental Research Funds for the Central 325

Universities (2015ZZ123). 326

Compliance with Ethical Standards 327

Shuangfang Hu has no conflict of interest. 328

Yigang Yu has no conflict of interest.

329

Rong Li has no conflict of interest. 330

Xinwei Wu has no conflict of interest.

331

Xinglong Xiao has no conflict of interest. 332

Hui Wu has no conflict of interest.

333

This article does not contain any studies with human or animal subjects. 334

335

References 336

Farmer JJI, Asbury, MA.,Hickman FW. ,Brenner Don J. (1980) Enterobacter sakazakii: A New 337

Species of “Enterobacteriaceae” Isolated from Clinical Specimens. International journal of systematic 338

and evolutionary microbiology:569-584. 339

Iversen C, Waddington M, Farmer JJI and Forsythe SJ (2006) The biochemical differentiation of 340

Enterobacter sakazakii genotypes. Bmc Microbiology. 341

Iversen C, Lehner A, Mullane N, Bidlas E, Cleenwerck I, Marugg J, Fanning S, Stephan R and 342

Joosten H (2007) The taxonomy of Enterobacter sakazakii: proposal of a new genus Cronobacter gen. 343

nov and descriptions of Cronobacter sakazakii comb. nov Cronobacter sakazakii subsp sakazakii, comb. 344

nov., Cronobacter sakazakii subsp malonaticus subsp nov., Cronobacter turicensis sp nov., 345

Page 13 of 21



Draft

14

Cronobacter muytjensii sp nov., Cronobacter dublinensis sp nov and Cronobacter genomospecies I. 346

BMC Evolutionary Biology. 347

Iversen C, Mullane N, McCardel B, Tal BD, Lehner A, Fannin S, Stephan R and Joosten H (2008) 348

Cronobacter gen nov, a new genus to accommodate the biogroups of Enterobacter sakazakii, and 349

proposal of Cronobacter sakazakii gen nov, comb nov, Cronobacter malonaticus sp nov, Cronobacter 350

turicensis sp nov, Cronobacter muytjensii sp nov, Cronobacter dublinensis sp nov, Cronobacter 351

genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp dublinensis subsp nov, 352

Cronobacter dublinensis subsp lausannensis subsp nov and Cronobacter dublinensis subsp lactaridi 353

subsp nov. International journal of systematic and evolutionary microbiology:1442-1447. 354

Grim CJ, Kotewicz ML, Power KA, Gopinath G, Franco AA, Jarvis KG, Yan QQ, Jackson SA, 355

Sathyamoorthy V, Hu L, Pagotto F, Iversen C, Lehner A, Stephan R, Fanning S and Tall BD (2013) Pan-356

genome analysis of the emerging foodborne pathogen Cronobacter spp. suggests a species-level 357

bidirectional divergence driven by niche adaptation. Bmc Genomics. 358

Cruz-Cordova A, Rocha-Ramirez LM, Ochoa SA, Gonzalez-Pedrajo B, Espinosa N, Eslava C, 359

Hernandez-Chinas U, Mendoza-Hernandez G, Rodriguez-Leviz A, Valencia-Mayoral P, Sadowinski-Pine 360

S, Hernandez-Castro R, Estrada-Garcia I, Munoz-Hernandez O, Rosas I and Xicohtencatl-Cortes J (2012) 361

Flagella from five Cronobacter species induce pro-inflammatory cytokines in macrophage derivatives 362

from human monocytes. PloS one:e52091. 363

Friedemann M (2009) Epidemiology of invasive neonatal Cronobacter (Enterobacter sakazakii) 364

infections. European journal of clinical microbiology & infectious diseases:1297-1304. 365

Holy O, Petrzelova J, Hanulik V, Chroma M, Matouskova I and Forsythe SJ (2014) Epidemiology of 366

Cronobacter spp. isolates from patients admitted to the Olomouc University Hospital (Czech Republic). 367

Epidemiologie, mikrobiologie, imunologie : casopis Spolecnosti pro epidemiologii a mikrobiologii 368

Ceske lekarske spolecnosti JE Purkyne:69-72. 369

O'Brien S, Healy B, Negredo C, Anderson W, Fanning S and Iversen C (2009) Prevalence of 370

Cronobacter species (Enterobacter sakazakii) in follow-on infant formulae and infant drinks. letters in 371

applied microbiology 536-541. 372

Edelson-Mammel SG, Porteous MK and Buchanan RL (2005) Survival of Enterobacter sakazakii in 373

a dehydrated powdered infant formula. Journal of Food Protection:1900-2. 374

Joseph S and Forsythe SJ (2012) Insights into the emergent bacterial pathogen Cronobacter spp., 375

generated by multilocus sequence typing and analysis. Frontiers in Microbiology. 376

Holy O and Forsythe S (2014) Cronobacter spp. as emerging causes of healthcare-associated 377

infection. Journal of Hospital Infection:169-177. 378

Liu X, Fang J, Zhang M, Wang X, Wang W, Gong Y, Xi X and Li M (2012) Development of a loop-379

mediated isothermal amplification assay for detection of Cronobacter spp. (Enterobacter sakazakii). 380

World Journal of Microbiology & Biotechnology:1013-1020. 381

Park S, Shukla S, Kim Y, Oh S, Kim SH and Kim M (2012) Development of sandwich enzyme-linked 382

immunosorbent assay for the detection of Cronobacter muytjensii (formerly called Enterobacter 383

sakazakii). Microbiology and Immunology:472-479. 384

Blazkova M, Javurkova B, Fukal L and Rauch P (2011) Immunochromatographic strip test for 385

detection of genus Cronobacter. Biosens Bioelectron:2828-2834. 386

Dong X, Wu Q, Wu K and Zhang J (2013) Real-time PCR targeting OmpA gene for detection of 387

Cronobacter spp. in powdered infant formula. Food Science and Biotechnology:309-13. 388

Dong X, Wu Q, Zhang J, Mo S, Kou X and Guo W (2013) Sequencing of the grxB Gene of 389

Cronobacter spp. and the Development of a PCR Assay for Its Identification. Foodborne Pathogens 390

and Disease:711-717. 391

Stoop B, Lehner A, Iversen C, Fanning S and Stephan R (2009) Development and evaluation of 392

rpoB based PCR systems to differentiate the six proposed species within the genus Cronobacter. 393

International journal of food microbiology:165-168. 394

Kang, Sil E, Nam YS and Hong KW (2007) Rapid detection of Enterobacter sakazakii using TaqMan 395

real-time PCR assay. Journal of microbiology and biotechnology:516-519. 396

Wang X, Zhu C, Xu X and Zhou G (2012) Real-time PCR with internal amplification control for the 397

detection of Cronobacter spp. (Enterobacter sakazakii) in food samples. Food Control:144-149. 398

Krasny L, Rohlova E, Ruzickova H, Jiri sA, Hynek R and Hochel I (2014) Differentiation of 399

Cronobacter spp. by tryptic digestion of the cell suspension followed by MALDI-TOF MS analysis. 400

Journal of Microbiological Methods:105-113. 401

Page 14 of 21



Draft

15

Huang C-H, Chang M-T and Huang L (2013) Use of novel species-specific PCR primers targeted to 402

DNA gyrase subunit B (gyrB) gene for species identification of the Cronobacter sakazakii and 403

Cronobacter dublinensis. MOLECULAR AND CELLULAR PROBES 15-18. 404

Carter L, Lindsey LA, Grim CJ, Sathyamoorthy V, Jarvis KG, Gopinath G, Lee C, Sadowski JA, Trach 405

L, Pava-Ripoll M, McCardell BA, Tall BD and Hu L (2013) Multiplex PCR Assay Targeting a Diguanylate 406

Cyclase-Encoding Gene, cgcA, To Differentiate Species within the Genus Cronobacter. Applied and 407

environmental microbiology:734-737. 408

Miled RB, Neves S, Baudouin N, Lombard B, Deperrois V, Colin P and Besse NG (2010) Impact of 409

pooling powdered infant formula samples on bacterial evolution and Cronobacter detection. 410

International journal of food microbiology:250-259. 411

Hong Y-H, Park J-Y, Park J-H, Chung M-S, Kwon K-S, Chung K, Won M and Song K-B (2008) 412

Inactivation of Enterobacter sakazakii, Bacillus cereus, and Salmonella typhimurium in powdered 413

weaning food by electron-beam irradiation. radiation physics and chemistry:1097-1100. 414

Hyeon J-Y, Park C, Choi I-S, Holt PS and Seo K-H (2010) Development of multiplex real-time PCR 415

with Internal amplification control for simultaneous detection of Salmonella and Cronobacter in 416

powdered infant formula. International journal of food microbiology:177-181. 417

Li Y, Cao L, Zhang C, Chen Q, Lu F, Bie X and Lu Z (2013) Development and evaluation of a PCR-418

ELISA assay for the detection and quantification of Cronobacter spp. International Dairy Journal:27-33. 419

Joosten H, Marugg J, Stephan R, Klijn A, Jackson T and Iversen C (2008) A rapid and reliable 420

alternative to ISO 21528-1:2004 for detection of Enterobacteriaceae. International journal of food 421

microbiology:344-6. 422

Awaisheh SS, Al-Nabulsi AA, Osaili TM, Ibrahim S and Holley R (2013) Inhibition of Cronobacter 423

sakazakii by Heat Labile Bacteriocins Produced by Probiotic LAB Isolated from Healthy Infants. Journal 424

of Food Science:M1416-M1420. 425

Mortari A and Lorenzelli L (2014) Recent sensing technologies for pathogen detection in milk: A 426

review. Biosensors and Bioelectronics:8-21. 427

Cai X-Q, Yu H-Q, Ruan Z-X, Yang L-L, Bai J-S, Qiu D-Y, Jian Z-H, Xiao Y-Q, Yang J-Y, Thanh Hoa L and 428

Zhu X-Q (2013) Rapid Detection and Simultaneous Genotyping of Cronobacter spp. (formerly 429

Enterobacter sakazakii) in Powdered Infant Formula Using Real-time PCR and High Resolution Melting 430

(HRM) Analysis. PloS one. 431

Xiao XL, He YQ, Yu YG, Yang H, Chen G, Li HF, Zhang JW, Liu DM, Li XF, Yang XQ and Wu H (2009) 432

Simultaneous detection of human enterovirus 71 and coxsackievirus A16 in clinical specimens by 433

multiplex real-time PCR with an internal amplification control. Archives of Virology:121-5. 434

Wang L, Li Y and Mustapha A (2009) Detection of viable Escherichia coli O157:H7 by ethidium 435

monoazide real-time PCR. Journal of applied microbiology 1719-1728. 436

Anonymous (2006) ISO/TS 22964 (2006) Milk and milk products—detection of Enterobacter 437

sakazakii. The Prestandard of the Technical Specification ISO/TS:15. 438

Almeida C, Azevedo NF, Iversen C, Fanning S, Keevil CW and Vieira MJ (2009) Development and 439

Application of a Novel Peptide Nucleic Acid Probe for the Specific Detection of Cronobacter 440

Genomospecies (Enterobacter sakazakii) in Powdered Infant Formula. Applied and environmental 441

microbiology:2925-2930. 442

Forsythe SJ (2005) Enterobacter sakazakii and other bacteria in powdered infant milk formula. 443

Maternal & child nutrition:44-50. 444

Zimmermann J, Schmidt H, Loessner MJ and Weiss A (2014) Development of a rapid detection 445

system for opportunistic pathogenic Cronobacter spp. in powdered milk products. Food 446

Microbiology:19-25. 447

Fei Y-t, Liu D-m, Luo T-h, Chen G, Wu H, Li L and Yu Y-g (2014) Molecular Characterization of 448

Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity. PloS 449

one:e113792. 450

Seo KH and Brackett RE (2005) Rapid, specific detection of Enterobacter sakazakii in infant 451

formula using a real-time PCR assay. Journal of Food Protection:59-63. 452

Hsiao W-L, Chang C-H and Chou C-C (2010) Heat shock effects on the viability of Cronobacter 453

sakazakii during the dehydration, fermentation, and storage of lactic cultured milk products. Food 454

Microbiology:280-285. 455

Page 15 of 21



Draft

16

Marounek M, Putthana V, Benada O and Lukesova D (2012) Antimicrobial Activities of Medium-456

chain Fatty Acids and Monoacylglycerols on Cronobacter sakazakii DBM 3157(T) and Cronobacter 457

malonaticus DBM 3148. CZECH Journal of FOOD SCIENCE:573-580. 458

Okano K, Zhang Q, Shinkawa S, Yoshida S, Tanaka T, Fukuda H and Kondo A (2009) Efficient 459

production of optically pure D-lactic acid from raw corn starch by using a genetically modified L-460

lactate dehydrogenase gene-deficient and alpha-amylase-secreting Lactobacillus plantarum strain. 461

Applied and environmental microbiology:462-7. 462

463

464

Page 16 of 21



Draft

Table 1: Bacterial strains used in this study and results of qPCR

Bacterial strains Strains ID/sourcesa qPCR

Cronobacter sakazakii ATCC 29544 +

Cronobacter sakazakii ATCC 12868 +

Cronobacter sakazakii CMCC45401 +

Cronobacter sakazakii PIF isolation 1 +









Cronobacter muytjensii ATCC 51329 －

Cronobacter muytjensii PIF isolation 1 －



Cronobacter malonaticus LMG 23826 －

Cronobacter malonaticus PIF isolation 1 －

Cronobacter malonaticus PIF isolation 2 －

Cronobacter turicensis LMG 23827 －

Cronobacter universails NCTC 9529 －

Cronobacter dublinensis sp. dublinensis LMG23823 －

Cronobacter dublinensis sp. lausannensis LMG23824 －

Cronobacter dublinensis sp. lactatidi LMG23825 －

Cronobacter condimenti LMG 26250 －

Enterobacter cloace ATCC 13047 －

Enterbacter cloacae CICC 21539 －

Escherichia coli NCTC 12900 －

E. coli O157:H7 CICC 21530 －

Escherichia coli ATCC 9637 －

Enterbacter aerogenes CICC 10293 －

Enterobacter aerogenes ATCC 13408 －

Bacillus cereus CMCC 70331 －

Bacillus cereus CCTCC AB92023 －

Page 17 of 21



Draft

Shigella sonnei CMCC 51592 －

Salmonella typhimurium CCTCC 94018 －

Salmonella choleraesuis CMCC 50337 －

Salmonella choleraesuis CMCC 50732 －

Listeria monocytogenes CMCC 54002 －

Listeria monocytogenes CCTCC 97021 －

Listeria monocytogenes ATCC 19117 －

Lactobacillus rhamnosus CICC 6149 －

Bacillus subtilis CICC 20533 －

Bacillus thuringiensis CICC 23706 －

Lactobacillus reuteri CICC 6119 －

Lactobacillus pentosus DMDL 9010 CGMCC 5172 －

ATCC, American Type Culture Collection, Maryland,America; CMCC, National Center for

Medical Culture Collections,Beijing,China; CGMCC, China General Microbiological Culture

Collection Center, Beijing, China; CICC, China Center of Industrial Culture Collection;

NCTC, National Collection of Type Cultures; CCTCC, China Center for Type Culture

Collection.

Table 2: Primers and probes in this study

Amplicon GC (%)a Site of primers and probes (5’-3’)b

CS(138bp) 63% GCAGGTGCTGCTGCGAGCGCGCCAGGGCAGCGCCACCTGGCTGTCGGCGCTTGATCA

GGTCGTCAGAATCTACGGGTTTGCGCGCTCGACGCGTTACCCGATTGTCGTGGTGGC

CGGGTATGACAAAGACAATCTGCG

IAC(138bp) 63% GCAGGTGCTGCTGCGAGCGCGCCAGGGCAGCGCCACCTGGCTGTCGGCGCATCAGAA

TCTACAGGTGTGCGGCTTGTTTGCGCGCTCGACGCGTTACCCGATTGTCGTGGTGGC

CGGGTATGACAAAGACAATCTGCG

a GC% for each amplicon

b Nucleotides marked by a box correspond to the sequences of primers, and the probes are

indicated in bold type

Table 3: Detection limit of qRT-PCR of C. sakazakii ATCC29544 in broth and PIF

Genome or CFU

equivalent

Cell standard curve in Broth Cell standard curve in PIF

CFU / ml Mean Ct ±

SD Inter-assay

CVa CFU / ml

Mean Ct ±

SD Inter-assay

CVa

108 1.1×10

8 18.79±0.06 0.35 1.1×108 19.15±0.03 0.17

107 1.1×10

7 21.60±0.01 0.07 1.1×107 22.13±0.01 0.07

106 1.1×10

6 24.72±0.03 0.12 1.1×106 25.83±0.03 0.10

105 1.1×10

5 27.42±0.15 0.58 1.1×105 28.15±0.01 0.04

104 1.1×10

4 31.11±0.07 0.23 1.1×104 31.42±0.01 0.05

Page 18 of 21



Draft

103 1.1×10

3 34.14±0.09 0.28 1.1×103 34.12±0.01 0.04

102 1.1×10

2 37.02±0.01 0.03 1.1×102 38.08±0.07 0.02

10 1.1×101 N.D. N.D. 1.1×10

1 N.D. N.D. 1 1.1 N.D. N.D. 1.1 N.D. N.D. a Inter-assay CV: coefficient of variation expressed in %;

N.D.: not detected.

The Ct values are means standard deviation of three replicate experiments

Table 4: Detection of C. sakazakii from artificially contaminated powdered infant

Enrichment time

(h) Method Inoculation level (CFU / 25g)

2 20 200 0 qRT-PCR N.D. N.D. N.D.

ESIA 0 0 0

4 qRT-PCR N.D. 2.75±0.10a 2.87±0.01

ESIA 1.74±0.12 2.71±0.21 2.55±0.18

6 qRT-PCR 2.57±0.02 2.81±0.09 2.61±0. 04

ESIA 2.75±0.21 2.89±0.12 2.89±0.16

8 qRT-PCR 2.84±0.04 3.52±0.05 3.51±0.01

ESIA 2.95±0.15 3.34±0.22 3.74±0.20

10 qRT-PCR 3.63±0.01 3.84±0.02 3.84±0.05

ESIA 3.45±0.14 3.48±0.15 3.83±0.13

12 qRT-PCR 3.86±0.01 4.52±0.01 4.46±0.02

ESIA 3.85±0.20 5.48±0.09 4.05±0.11

a: log10 CFU / ml in dilution; the values are means standard deviation of three replicate

experiments

ESIA, Enterobacter sakazakii isolation agar plate

N.D.: not detected.

Table 5: Detection of C. sakazakii in the presence of Bacillus cereus

C. sakazakii (CFU / 25g)

Bacillus cereus (CFU / 25g)

Enrichment time (h) 0 4 6 8 10 12 24

5 0 N.D. N.D. 34.12±0.20 32.31±0.15 29.76±0.02 25.01±0.01 23.32±0.01 2 N.D. N.D. 34.33±0.07 32.01±0.10 30.29±0.09 28.67±0.13 27.82±0.05

2×102 N.D. N.D. 35.12±0.12 32.85±0.13 31.72±0.18 32.79±0.09 31.34±0.09

2×104 N.D. N.D. 36.37±0.13 33.69±0.09 31.67±0.17 34.85±0.04 35. 61±0.13

2×106 N.D. N.D. N.D. 35.01±0.05 35.06±0.06 35.06±0.10 35. 52±0.16

50 0 N.D 35.12±0.10 32.44±0.10 31.09±0.02 28.01±0.01 24.32±0.01 20.33±0.10 2 N.D. 34.33±0.09 32.36±0.13 31.05±0.10 30.17±0.14 28.64±0.10 26.32±0.06

2×102 N.D. 35.12±0.07 33.01±0.05 31.83±0.06 32.02±0.13 29.50±0.04 27.58±0.09

2×104 N.D. N.D. 34.85±0.13 33.93±0.09 32.29±0.09 31.32±0.21 33.42±0.10

2×106 N.D. N.D. 37.01±0.04 35.46±0.10 32.64±0.05 32.25±0.13 33.53±0.13

N.D.: not detected.

The Ct values are means standard deviation of three replicate experiments

Table 6: Detection of C. sakazakii in the presence of Lactobacillus

C. sakazakii (CFU / 25g)

Lactobacillus (CFU / 25g)

Enrichment time (h) 0 4 6 8 10 12 24

Page 19 of 21



Draft

5 0 N.D. N.D. 34.12±0.20 32.31±0.15 29.76±0.02 25.01±0.01 23.32±0.01 4 N.D. N.D. 34.53±0.11 33.51±0.10 30.29±0.10 28.67±0.10 27.48±0.10

4×102 N.D. N.D. 34.12±0.13 33. 06±0.04 31.72±0.15 32.79±0.17 31. 58±0.06

4×104 N.D. N.D. 35.77±0.10 34. 38±0.10 31.67±0.13 34.85±0.04 35. 61±0.10

4×106 N.D. N.D. 35.68±0.14 34. 40±0.10 34.63±0.10 35.06±0.13 35. 52±0.04

50 0 N.D 35.12±0.10 32.44±0.10 31.09±0.02 28.01±0.01 24.32±0.01 20.33±0.10 4 N.D. 35.82±0.12 32.13±0.10 32.97±0.10 30. 34±0.15 30.54±0.13 30.32±0.04

4×102 N.D. 35.44±0.15 33.62±0.13 33. 43±0.18 32.02±0.09 32.50±0.06 31.50±0.09

4×104 N.D. N.D. 36.55±0.09 34.66±0.13 34.21±0.04 34. 93±0.04 34.14±0.10

4×106 N.D. N.D. 37.02±0.07 36.43±0.06 37.01±0.10 36.25±0.06 37.13±0.13

N.D.: not detected. The Ct values are means standard deviation of three replicate experiments

Table 7: Detection of desiccated C. sakazakii in artificially inoculated PIF

C. sakazakii Inoculation level

(CFU / 25g) Enrichment time (h) 0 4 6 8 10 12

desiccated 20 N.D. N.D. 35.04±0.18 33.77±0.13 30.03±0.17 30.38±0.17

2.0 N.D. N.D. 35.84±0.15 34.34±0.05 30.95±0.09 32.03±0.05

control 20 N.D. 36.23±0.12 29.40±0.10 29.75±0.14 26.23±0.13 22.35±0.14

2.0 N.D. 38.47±0.13 32.32±0.11 31.03±0.06 27.70±0.11 23.39±0.11

N.D.: not detected. The Ct values are means standard deviation of three replicate experiments

Page 20 of 21



Draft

Fig. 1 The Standard curves of C. sakazakii in broth and PIF 226x176mm (300 x 300 DPI)

Page 21 of 21



Documents

Rapid detection of Cronobacter sakazakii by real-time PCR based