Rabbit distal convoluted tubule coexpresses NaCl cotransporterand 11b-hydroxysteroid dehydrogenase II mRNA

HEINO VELAZQUEZ, ANIKO NARAY-FEJES-TOTH, TERESA SILVA, ELEANOR ANDUJAR, ROBERT F. REILLY,GARY V. DESIR, and DAVID H. ELLISON

Rabbit distal convoluted tubule coexpresses NaCl cotransporterand 11b-hydroxysteroid dehydrogenase 2 mRNA.

Background. Although the renal cortical collecting duct (CCD)is a principal target for aldosterone, recent evidence suggests thatsalt transport by other nephron segments may also be regulated byaldosterone. Electroneutral and thiazide-sensitive NaCl cotrans-port by the distal convoluted tubule (DCT) of the rat is increasedin animals deprived of dietary NaCl. We tested the hypothesis thatthe DCT of the rabbit is an aldosterone target tissue.

Methods. The single-nephron reverse-transcriptase/polymerasechain reaction (RT-PCR) technique was used to determinemRNA expression of NaCl cotransporter and 11b-HSD 2 indissected nephron segments. The rabbit NaCl cotransporter wasfirst cloned and rabbit-specific primers selected. A micro-assaywas developed to assess 11b-HSD 2 enzyme activity in 0.5 mmsamples of the same nephron segments.

Results. NaCl cotransporter was expressed in 0 of 6 proximaltubule (PT), 6 of 6 DCT and 3 of 6 CCD samples, while 11b-HSDwas found in 0 of 7 PT, 7 of 7 DCT and 9 of 9 CCD samples.Corticosterone was converted to 11-dehydrocorticosterone at ahigh rate and to a similar extent by both the DCT and CCD, butnot the PT.

Conclusions. We conclude that the DCT is a target tissue for theaction of aldosterone. Axial heterogeneity of electroneutral (inDCT) and electrogenic (in CCD) Na transporters along the distalnephron may improve sodium recovery in low salt and volumestates.

The presence of thiazide-sensitive sodium chloride trans-port in the mammalian distal tubule (defined in the Appen-dix) is well established [1–8]. Sodium transport and chlo-ride absorption are mutually dependent, appear to beelectroneutral and inhibited by thiazide diuretics but notthe loop diuretic bumetanide [2, 3, 6].

Recently, the gene for a transporter mediating sodiumand chloride absorption was cloned from the flounder [9],and subsequently from rat and human [10, 11] and mouse(accession # U61085). The putative structure of the Na-Cl

cotransporter comprises 12 transmembrane-spanning seg-ments and cytoplasmic amino-terminal and carboxy-termi-nal tails [9].

In situ hybridization studies and single nephron hybrid-ization experiments [8, 10, 12, 13] have localized the NaClcotransporter to the convoluted portion of the distal tubule(distal convoluted tubule, DCT) in all mammalian speciesstudied to date with some expression in the beginning ofthe connecting tubule (CNT) in rats and humans [12].

High salt delivery to the DCT increases its intrinsicability to transport NaCl [14]. However, thiazide-sensitivesalt transport is not exclusively dependent on the deliveryof sodium to the distal tubule. A greater capacity to absorbNaCl was also observed in distal tubules of animals main-tained on a low salt diet even though this group did nothave increased delivery of salt out of the loop of Henle norcellular hypertrophy when compared to animals on a highsalt intake [15]. Factors other than delivery of NaCl out ofthe ascending limb to the distal nephron appear to influ-ence DCT function.

Fludrocortisone, a mineralocorticoid hormone, wasshown to increase thiazide-diuretic binding to renal corticalmembrane proteins and decrease rates of chloride excre-tion [16, 17]. Aldosterone and dexamethasone administra-tion to adrenalectomized rats each resulted in increases in3H-metolazone binding to kidney membranes [16, 18].These findings, together with the observation that feeding alow salt diet to rats results in a higher rate of thiazide-sensitive NaCl transport [15], suggest that adrenal steroidsmay control salt absorption by the DCT independent of therate of salt delivered to this segment.

If aldosterone acts via mineralocorticoid receptors in theDCT [19, 20], however, it must compete with endogenousglucocorticoids for binding. Mineralocorticoid receptorshave similar affinity for mineralocorticoids and glucocorti-coids [21]. Since glucocorticoids circulate at much higherconcentrations, mineralocorticoid receptors will be occu-pied primarily by glucocorticoids. In vivo fluctuations inaldosterone levels may, thus, not be able to regulate DCTcell salt transport unless the mineralocorticoid receptorwere protected from glucocorticoids.

The effectiveness of aldosterone in its target cells relies

Key words: aldosterone, hypertension, licorice, volume, thiazide.

Received for publication January 15, 1998and in revised form March 18, 1998Accepted for publication March 18, 1998

© 1998 by the International Society of Nephrology

Kidney International, Vol. 54 (1998), pp. 464–472

464

on the presence of 11b-hyhdroxysteroid dehydrogenase(11b-HSD), an enzyme that metabolizes and inactivatesglucocorticoids that enter these cells [22]. Intracellularmineralocorticoid receptors can then be activated specifi-cally by aldosterone when the concentration of this hor-mone in the circulation rises. The DCT of the mammaliankidney, therefore, may be an aldosterone target tissue if itis able to metabolize glucocorticoids to inactive metabo-lites.

To test the hypothesis that the DCT is an aldosteronetarget tissue, we sought to determine whether the thiazide-sensitive NaCl cotransporter and 11b-HSD 2 were co-expressed in rabbit DCT cells. First, the NaCl cotransporterwas cloned from the rabbit kidney. Second, expression ofNaCl cotransporter and 11b-HSD 2 genes in isolatednephron segments was determined by reverse transcriptionand PCR. Third, 11b-HSD 2 enzyme activity by isolatednephron segments was assayed.

METHODS

Primer selection

For the Na-Cl cotransporter, sense (TG[CT]ATG[TC]T[ATGC]AA[CT]AT[CTA]TGGGG) and antisense (GT-[CATG]GTCCA[GA]AAAAT[GCAT]GCCA) degenerateoligonucleotide primers located in putative transmembranesegments 1 and 7 were selected based on the publishedsequence of the Na-Cl cotransporter from winter flounderbladder (Gene Bank accession # L11615) [9]. Comparisonof cloned human (Gene Bank accession # U44128), and rat(Gene Bank accession # U10097) sequence permittedselection of an additional pair of degenerate primers in tworegions of 100% amino acid identity: sense (CA[CT]A-C[ACT]AA[AG]TGG[CT]T[GC]AA[CT]AA); antisense(TCCAT[CT]CT[AG]TT[AG]AT[CT]TG[AGCT]CC). Athird exact-match primer pair was selected to bridge thetwo cDNAs: sense (TAACGACATCGCATCATCGG);antisense (GTCAGAGTAGAAGGCCTTGA). Primersfor the RACE protocols are described below.

Primers for the single-nephron reverse transcriptase-polymerase chain reaction (SN-RT/PCR) experimentswere as follows: NaCl cotransporter sense, CATCGA-CATCTACTGGCTCT; NaCl cotransporter antisenseTGCCGAAGGGACTTGATTCT; NaCl cotransporter in-ternal, CCAACAAACACGCGGATCTT; 11b-HSD sense,CGTGAGCAATGTGAGCCACT; 11b-HSD antisense,AGCTCATCGAGCTCCCACTA; 11b-HSD internal, TT-GTGGATGCCATCACCGAT.

RNA preparation and cDNA synthesis

Total RNA was isolated from rabbit kidney by homoge-nizing 1 gram of tissue in Trizol Reagent (GIBCO BRL)and processing according to manufacturers instructions.Poly-A RNA was isolated subsequently from total RNAusing oligo-dT-cellulose (Boehringer Mannheim, Mann-

heim, Germany) and eluting with diethylpyrocarbonate-treated (DEPC) water [23] at 65°C. One microgram ofpolyA-RNA was primed with oligo dT and first strandcDNA synthesized using Superscript II reverse transcrip-tase (GIBCO BRL) in a final volume of 20 ml. Primers thatare gene-specific or coupled to adapter molecules were alsoused to synthesize cDNA as described below.

Polymerase chain reaction

Amplitaq DNA polymerase (Perkin Elmer) was usedaccording to manufacturers instructions to amplify cDNAfragments. One microliter of cDNA was used for eachpolymerase chain reaction (PCR). All samples were heatedto 94°C for three minutes. Forty cycles of PCR wereperformed as follows: denature at 94°C for one minute;anneal at 50 to 55°C (degenerate primers) or 60°C (exactprimers) for one minute; extend at 72°C for one minute.Cycling (Perkin Elmer DNA Thermal Cycler 480 or HybaidOmigene) was performed using block control of tempera-ture and 0.5 ml microfuge tubes.

Rapid amplification of cDNA ends

Rapid amplification of 59 and 39 cDNA ends (RACE) ofthe NaCl cotransporter transcript was performed using 59and 39 RACE kits (GIBCO BRL) according to the manu-facturer’s instructions. For 59 RACE, cDNA was synthe-sized using a rabbit NaCl cotransporter-specific antisenseprimer (GGTCCAGAAAATGGCCATGA). Two sequen-tial PCR reactions were performed using primers suppliedin the kit and rabbit-specific nested antisense primers:(TGAGGAAGTAGGTGCCACCT, outside); (GGTCAG-TACAATCGCTGCCT, nested). For 39 RACE, cDNA wassynthesized using a kit adapter primer. Two sequentialPCR reactions were performed using primers supplied inthe kit and rabbit-specific nested sense primers: (GAG-GAAGATCAAGGCCTTCT, outside); (CATCGACATC-TACTGGCTCT, nested).

Cloning

cDNA fragments from PCR reactions were separatedelectrophoretically on a 1% agarose gel (NuSieve) and theband of expected size cut out. The fragment was simulta-neously blunt-ended with T4-DNA polymerase and a 59phosphate group attached using T4-polynucleotide kinase,then purified using glass beads (Gene-clean; GIBCOBRL). The purified cDNA was ligated into pBluescript(Stratagene) previously cut at the EcoRV site and 59phosphate groups removed using calf intestinal phospha-tase. Competent E. coli cells (DH5a) were subsequentlytransformed with the vector and white colonies selectedand grown in ampicillin-containing LB medium for extrac-tion of the plasmid (QIAGEN maxi-prep). The insert wascut out of the plasmid using EcoRI and HindIII andanalyzed on an agarose gel to confirm size of the clonedcDNA fragment.

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD 465

Sequencing

Clones were sequenced using 35S -dATP incorporationand the di-deoxynucleotide termination reaction of Sanger.In addition, fluorescent sequencing was performed by theKeck Foundation at Yale University. Multiple reads wereobtained for all clones and compared. Nucleotide sequencereported in Figure 1 is a consensus of all readings.

Identification and dissection of the DCT, CCD and PT

New Zealand White rabbits (1 to 2.5 kg) were anesthe-tized with Ketamine (50 mg/kg, sq) and sodium Pentobar-bital (50 mg/kg, i.v.), kidneys removed via a flank incisionand chilled in ice-cold dissecting solution, and the rabbiteuthanized by overdose with Pentobarbital. RNAse-freemedia, beakers and instruments were used throughout. Thedissection medium had a pH of 7.4 and contained in mM:135 NaCl, 1 Na2HPO4, 1.5 MgSO4, 2 CaCl2, 5 mM KCl, 5glucose, 5 HEPES. One millimeter transverse slices of thekidney were transferred to a dissection dish that was placedon the stage of a dissecting microscope fitted with awater-chilled chamber. Sections were trans-illuminated andtubules dissected by hand at 603 magnification usingsharpened forceps. Proximal convoluted tubules (PCT, S2)and cortical collecting ducts (CCD) were dissected fromthe medullary rays in the cortex. Usually it was possible toobtain single nephron fragments 1 mm in length.

The DCT was identified by locating and dissecting thestructure consisting of a glomerulus with associated up-stream thick ascending limb and downstream DCT andCNT segments. The procedure for harvesting the DCT onlyis described below. The nephron is cut within the DCT,downstream of the transition from TAL to DCT. Thistransition usually occurs close to the glomerulus and theabrupt change in tubule diameter is not visible (when thetransition is visible, the DCT is cut downstream to this site).Within the DCT, the nephron generally makes a haripinturn and returns to its own glomerulus. Before the nephronmakes contact with the afferent arteriole [24], it undergoesa transition from DCT to CNT (DCT length is approxi-mately 0.5 mm from TAL transition to CNT transition). Toharvest the DCT only, the tubule is cut at the hairpin turn(upstream from the CNT transition) yielding approximately300 mm of DCT tissue per dissected nephron. This frag-ment of DCT does not contain TAL cells or CNT cells.

To minimize contamination of specific nephron sampleswith other cells, small bundles of tissue were separated firstfrom kidney slices and then transferred to a new dish forfinal dissection in fresh medium. For single-nephron RT/PCR experiments, a total of 1 mm of tubule (1 to 4 nephronsegments, see above) was adsorbed to a glass bead (0.5 mmdiameter) held by forceps and placed directly into a 0.5 mlmicrofuge tube containing 10 ml of Lysis Solution I (2%Triton, 5 mM dithiothreitol, 2.2 U/ml RNAsin, DEPC-treated water). For the 11b-HSD 2 activity assay, a total of

0.5 mm of tubule (1 to 2 nephron fragments) was adsorbedto a glass bead and placed in 3 ml of Lysis Solution II (5 mM

Tris, pH 7.5; 1.5 mM EDTA; 1.5 mM MgCl2). All sampleswere frozen at 270°C until the time of the experiment.

Single-nephron RT/PCR

The SN-RT/PCR technique [25] was modified as de-scribed by us previously [26]. Briefly, the rTth polymerasekit (Perkin Elmer) was used to generate cDNA and per-form PCR in the same tube. This enzyme functions as areverse transcriptase as well as DNA polymerase depend-ing on the prevalent divalent cation. RT was performed inthe presence of manganese by adding to each sample tube10 ml of a master mix containing the enzyme, nucleotides,manganese, and the antisense primer, and incubating at70°C for 15 minutes. PCR was performed in the presence ofmagnesium by adding 80 ml of master mix containing amanganese chelator, magnesium and the sense primer,then cycling 40 times: one minute 94°C; one minute 60°C.

The reagent blank consisted of a tube that contained thelysis solution and all other kit reagents but no tubulesample. A positive control to determine the quality of thekit reagents consisted of a tube with 50 ng of rabbit kidneytotal RNA and was subject to both RT and PCR steps.Finally, for tubule segments with negative results, a positivecontrol reaction was carried out to determine whether anycDNA was synthesized: primers were used to amplify asegment of the gene responsible for the oculo-cerebral-renal syndrome of Lowe [26]. This gene product is ex-pressed in all nephron segments examined from the glo-merulus to the collecting duct [26] and serves as a positivecontrol for cDNA synthesis during the RT step. In pilotexperiments for each primer pair, tubes containing tubuleswere used to test for PCR amplification from genomictemplate by omitting enzyme in the RT step and addingenzyme for the PCR step. Samples were electrophoresedon a 2% gel, photographed to record ethidium bromidestaining and transferred to a nylon membrane (GeneScreen Plus, DuPont).

Nylon membranes were Southern blotted using an inter-nal 32P-labeled oligonucleotide primer as probe. Blots wereprehybridized for at least four hours in Church Gilbert (0.5M sodium phosphate, pH 7.2, 1 mM EDTA, 7% SDS, 1%bovine serum albumin, 100 mg/ml salmon sperm DNA) at60°C then hybridized (106 CPM per ml) overnight. Blotswere rinsed once then washed for 30 minutes in 2 3 SSC(SSC composition: 0.15 M NaCl, 0.15 sodium citrate, pH 7)and 0.5% SDS at room temperature. The final wash at 45°Cwas done for 5 to 30 minutes in 0.5 3 SSC and 0.1 SDS,with periodic monitoring by a Geiger counter for lowbackground counts. Blots were exposed to film for up toseveral days.

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD466

Fig. 1. Open reading frame and predicted amino acid sequence of rabbit form of NaCl cotransporter. Numbers at left indicate amino acid position; numbers at right indicate base position.Nucleotide sequence is consensus of overlapping PCR fragments as described in text, and an additional full length clone obtained using a proofreading enzyme (XL Taq Polymerase, PerkinElmer).

Velazquez

etal:

DC

Texpresses

NaC

lcotransporterand

11b

-HSD

467

Corticosterone metabolism

Conversion of 1 nM [1,2,6,7-N-3H]-corticosterone (NewEngland Nuclear, sp. act. 101.6 Ci/mmol) to 11-dehydro-corticosterone [27, 28] by 11b-HSD 2 was determined byincubating 0.5 mm of microdissected tubule segments (seeabove for methods of dissection) permeabilized in Lysissolution II in the presence of 1 mM NAD at 37°C in a finalvolume of 60 ml with constant shaking. Aliquots wereremoved at 15 minutes, 30 minutes and one hour, and thereaction stopped by adding 2.5 volumes of 70% ethanolcontaining unlabeled corticosterone and 11-dehydrocorti-costerone (50 mg/ml each). Metabolites of corticosteronewere separated by HPLC using a Beckman UltrasphereODS 5 mm column and isocratic elution with 70% metha-nol performed as described previously [27, 28]. The rate ofthe reaction was determined from the initial velocity.Specificity of the reaction for the 11b-HSD 2 enzyme wasconfirmed by incubating paired samples in the presence ofeither 1 mM NAD or 1 mM NADP.

RESULTS

Cloning of the NaCl cotransporter

The PCR of rabbit cDNA using degenerate primersbased on flounder NaCl cotransporter sequence yielded aband of the predicted size of 712 bp, which was cloned andsequenced. Two additional cDNA fragments were clonedby PCR using two additional sets of primers as described inthe Methods section. The extreme 59 and 39 ends wereobtained by 59 and 39 RACE. These different fragmentsyielded overlapping sequence from which a consensus wasobtained. The coding region nucleotide consensus se-quence and amino acid sequence is given in Figure 1. Whenaligned with the NaCl cotransporter coding region of otherspecies (MegAlign, DNA Star, using Clustal method, gappenalty of 10 for multiple alignments, and PAM250 residueweight table), the rabbit form of the NaCl cotransporter

exhibits a high percent similarity to that of flounder(61.5%), mouse (88.5), rat (88.9%), and human (90.3%).

SN-RT/PCR

To confirm expression of the NaCl cotransporter in theDCT, SN-RT/PCR was performed using rabbit specificprimers. An ethidium bromide-stained agarose gel from anexperiment with PT, DCT, and CCD samples is shown inFigure 2. The reagent blank (Methods section) was nega-tive. A visible band was observed only in the DCT lane.PCR using the same primers and performed without RT ongenomic template from 1 mm of tubule or from 1 mg ofrabbit genomic DNA did not amplify a band (data notshown).

Samples from this and additional experiments weresubjected to gel electrophoresis, transferred to a nylonmembrane and Southern blotted using an internal oligonu-cleotide primer for the NaCl cotransporter. The data inFigure 3 show 0 of 6 positive PT samples, 6 of 6 positiveDCT samples and 3 of 6 positive CCD samples. Thereagent blank was negative and the 50 ng kidney total RNAcontrol sample was positive (see Methods for description ofcontrols). The data are consistent with NaCl cotransporterexpression in the DCT and CCD but not the PT.

To test whether 11b-HSD 2 is expressed in the DCT,SN-RT/PCR was performed using rabbit specific primers.An ethidium bromide-stained agarose gel from an experi-ment with PT, DCT and CCD samples is shown in Figure4. The reagent blank was negative and the 50 ng kidneytotal RNA control sample was positive. A visible band wasobserved in both the DCT and the CCD lane. A Southernblot of this and additional samples was probed with aninternal oligonucleotide. Figure 5 shows 0 of 7 positive PTsamples, 7 of 7 positive DCT samples and 9 of 9 positiveCCD samples. The data are consistent with 11b-HSD 2 andNaCl cotransporter coexpression in the DCT.

Fig. 2. Single nephron RT/PCR experimentusing NaCl cotransporter primers. Ethidiumbromide-stained band of expected size is visibleonly in DCT lane. Markers are pBR 322, MspIdigest.

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD468

Although the proximal tubule was negative for both theNaCl cotransporter and 11b-HSD 2, cDNA was in factsynthesized in all proximal tubule samples. We amplifiedanother gene (OCRL-oculo-cerebral-renal syndrome ofLowe) from all nephron segments including the PT usingthis method and have published these data [26]. This dataconstitutes a positive RT/PCR control for the PT segmentwhen using this method.

11b-HSD 2 activity in microdissected nephron segments

To compare the distribution patterns of 11b-HSD 2mRNA expression and the enzymatic activity of this en-zyme, the rate of conversion of corticosterone to 11-dehydrocorticosterone by dissected nephron segments wasdetermined. In preliminary experiments a micro-assay us-ing 0.5 to 5 mm of dissected CCD was developed todetermine the minimum length of tubule necessary todetect a signal. 11b-HSD 2 activity in both the DCT and

CCD was very high and significantly higher in the presenceof NAD than in the presence of NADP: values for DCT infmol/min/mm were 0.344 6 0.09 (NAD) versus 0.06 6 0.05(NADP) (N 5 4), P , 0.05; values for CCD were 0.192 60.03 (NAD) versus 0.03 6 0.02 (NADP) (N 5 4), P , 0.05.

In a separate set of experiments, 11b-HSD 2 activity wasassayed with 0.5 mm of tubule in the presence of 1 nM

corticosterone and 1 mM NAD. Figure 6 shows that bothDCT and CCD have a high 11b-HSD 2 activity andexhibited statistically significant rates of conversion ofcorticosterone. The rates of conversion by the PT sampleswere not different than vehicle alone and were numericallyequal to zero.

DISCUSSION

The mammalian distal convoluted tubule (DCT) is ashort, cytologically homogeneous (Appendix) nephron seg-ment located immediately downstream of the post-macula

Fig. 3. Southern blot of multiple SN-RT/PCRexperiments using proximal tubule (PT), distalconvoluted tubule (DCT), and corticalcollecting duct (CCD) samples (N 5 6) andNaCl cotransporter primers. Reagent blank wasnegative and positive control was positive. Noproximal tubules were positive, whereas allDCT samples and some CCD samples werepositive.

Fig. 4. Single nephron RT/PCR experimentusing 11-b-HSD primers. Ethidium bromide-stained band of expected size was visible inDCT and in CCD lanes. Markers are pBR 322,MspI digest.

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD 469

densa thick ascending limb. The data from the presentstudy show that DCT cells express message for 11b-HSD 2and also metabolize corticosterone to 11-dehydrocortico-sterone via 11b-HSD 2. Thus, the DCT segment of thenephron is likely a target for the action of aldosteronewhere this hormone may regulate electroneutral absorptionof sodium and chloride.

We cloned the rabbit isoform of the Na-Cl cotransporter(Fig. 1) and confirmed that in this species, NaCl cotrans-port mRNA is expressed in the DCT. Previous in situ

hybridization experiments also showed exclusive localiza-tion of NaCl cotransporter message to the DCT [13]. Incontrast, the present results suggest that the CCD alsoexpresses message for the NaCl cotransporter. However,only three of six CCD samples were positive by Southernanalysis (all negative by ethidium bromide), whereas allDCT samples were positive by ethidium bromide staining.Reliable quantitation of the level of expression is notpossible in this study, however, the data are fully consistentwith previous in situ hybridization experiments that may nothave been sensitive enough to detect NaCl cotransportermessage in the CCD. Messenger RNA expression of theNaCl cotransporter in nephron segments other than theDCT is also consistent with previous functional data in ratsthat provided evidence for thiazide inhibitable chloridetransport in CCD [29] and MCD [30, 31].

A previous report in the rabbit [32] suggested that theDCT is not the site of thiazide-sensitive Cl transport.Thiazide-type diuretics did not affect tracer lumen-to-bathCl flux by the DCT. It appeared instead that sodiumtraversed an amiloride-sensitive pathway [32] and not athiazide-sensitive pathway in this segment. The results ofthe present study, however, conflict with these data andsuggest that in the rabbit, the DCT is a primary site ofexpression of the NaCl cotransporter. In rats there is ageneral consensus that the DCT is the primary site ofexpression of the NaCl cotransporter. A similar view can begained from previous results in human kidney [12] and datafrom this and previous studies in rabbit [13]. We believethat in mammals in general, the DCT is the predominantsite of expression of this transporter. This view cannot bereconciled with the study cited above [32] in rabbits, whichdid not detect thiazide-sensitive Cl efflux in the DCT and

Fig. 5. Southern blot of multiple SN-RT/PCR experiments using PT (N 5 7), DCT (N 5 7) and CCD (N 5 9) samples and 11-b-HSD primers. Reagentblank was negative and positive control was positive. No proximal tubules were positive, whereas all DCT and CCD samples were positive.

Fig. 6. Rate of conversion of 1 nM 3H-labeled corticosterone to 11-dehydrocorticosterone by 0.5 mm of dissected rabbit nephron segments.Values are means 6 SE, N 5 3. Rates of conversion with vehicle and PTwere not different and numerically equal to zero. Significant rates ofconversion were observed in both DCT and CCD.

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD470

suggested that in rabbits the CNT was the primary site ofexpression of NaCl cotransport.

Previous studies in rats suggested that mineralocorticoidsinfluence salt transport by the DCT [15]. When distaltubules of rats maintained on a low salt diet for seven dayswere perfused with and without a thiazide-containing solu-tion, the fraction of salt transport sensitive to chlorothia-zide was increased compared to animals maintained on ahigh salt diet. The amount of sodium delivered out of theloop of Henle to the distal tubule and the size and numberof DCT cells was not altered by the high and low salt diets.Although plasma aldosterone was not determined, it islikely that this dietary NaCl restriction increased circulatingaldosterone levels. The data were consistent with thepossibility that high circulating aldosterone induced by alow salt diet may be involved in stimulating electroneutralthiazide-sensitive salt transport by the distal convolutedtubule. The findings of the present study strongly supportthis hypothesis.

That corticosteroids may be involved in regulating thia-zide-binding proteins is also supported by biochemicaldata. In rats, Fanestil and co-workers [16, 17] measured3H-metolazone binding to kidney membranes. The admin-istration of either fludrocortisone, a potent mineralocorti-coid agonist, or aldosterone or the synthetic glucocorticoiddexamethasone increased the binding of labeled metola-zone to kidney membrane proteins. Autoradiography of3H-metolazone in kidney sections [8] identified a minoritytubule population in the cortex suggesting that the distaltubule was the site of this mineralocorticoid action.

Thus, in order to test directly whether corticosteroidsinfluence thiazide-sensitive salt transport by the distaltubule, aldosterone and dexamethasone were infused intoadrenalectomized rats. The net rate of NaCl absorption byindividual perfused distal tubules was then measured inboth the presence and absence of luminal chlorothiazide[18]. Although aldosterone stimulated thiazide-sensitivesodium and chloride transport by the distal tubule, theglucocorticoid receptor-specific agonist dexamethasonealso stimulated thiazide-sensitive sodium and chloridetransport. Thus, the ability of both aldosterone and dexa-methasone to exert an effect suggests that both types ofreceptors are present in the DCT cell.

However, the affinity of the mineralocorticoid receptor isapproximately the same for mineralocorticoids and glu-cocorticoids [21]. Mineralocorticoid specificity can be im-parted to an aldosterone target tissue by the presence of anenzyme that breaks down endogenous glucocorticoids [22].This enzyme is 11b-hydroxysteroid dehydrogenase. Thus,when glucocorticoids, circulating at 100 to 1000 times theconcentration of aldosterone, enter a cell expressing theenzyme 11b-HSD, they are rapidly broken down to metab-olites that do not interact with the MR. This cell would nowbe responsive to mineralocorticoids and would permit a

change in the concentration of aldosterone in the circula-tion to be effective.

Two types of 11b-HSD have been identified. 11b-HSD 1is located primarily in liver and the proximal tubule, hasboth dehydrogenase and reductase activity, has a loweraffinity for corticosterone, and requires NADP. 11b-HSD 2has only dehydrogenase activity, 100-fold higher affinity forcorticosterone than the type 1 enzyme, and requires NAD[28]. The second form has been localized to the principalcells of the renal collecting duct [27, 28].

If the DCT is an aldosterone target tissue, we predictthat glucocorticoids should be broken down in this tissue aswell as in the principal cells of the CCD. In the presentstudy we sought to determine whether in the rabbit, theDCT coexpressed NaCl cotransporter and 11b-HSD 2. Theresults show that 11b-HSD 2 mRNA was expressed in 7 of7 DCT and 9 of 9 CCD. No positive lanes were detected inthe proximal tubule samples. The expression of 11b-HSD 2by the distal convoluted tubule is consistent with it being atarget tissue for aldosterone.

In order to test directly for the ability of cells tometabolize corticosterone to 11-dehydrocorticosterone,permeabilized tubules were incubated in the presence of 1nM 3H-corticosterone and NAD. These conditions shouldreveal dehydrogenase activity of the high affinity type 2enzyme and not of the type 1 enzyme. In a previous study,approximately 104 principal cells were isolated by fluores-cence activated cell sorting and assayed for activity [33]. Amicro-assay was developed that used 100- to 200-fold fewercells, the approximate number of cells present in 0.5 to 1mm of dissected nephron. Pilot experiments were per-formed in CCD samples, because 11b-HSD 2 enzymeactivity originally was described in these cells [27]. A veryhigh rate of conversion was found in as little as 0.5 mm oftubule. As depicted in Figure 6, enzyme activity in proximaltubules and in vehicle alone were not measurable. How-ever, high levels of conversion of corticosterone weredetected in both the DCT and in the CCD. This reactionwas NAD dependent, demonstrating the presence of 11b-HSD 2 activity in DCT and CCD cells. Thus, the DCT ofthe rabbit is able to metabolize endogenous glucocorticoidsto metabolites that are not able to interact with mineralo-corticoid receptors.

Taken together, these and previous data suggest that themammalian DCT expresses the NaCl cotransporter. NaClabsorption by the DCT may be regulated by aldosterone;this is facilitated via the action of 11b-HSD 2 to metabolizeglucocorticoids that enter DCT cells. We hypothesize thatthe DCT is a target tissue for aldosterone and that thishormone is involved in the regulation of electroneutralthiazide-sensitive NaCl absorption by the mammalian kid-ney. The strategic positioning of electroneutral sodiumtransport in the DCT upstream to electrogenic sodiumtransport by the collecting duct, each under the influence of

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD 471

aldosterone, may serve to improve the overall effectivenessof renal salt retention during low volume states.

ACKNOWLEDGMENTS

This work was supported in part by the Department of Veterans Affairs,and by a Grant in Aid of the American Heart Association. Part of thiswork was conducted during the tenure of an Established Investigatorshipof the American Heart Association to D. H. Ellison.

Reprint requests to Heino Velazquez, Ph. D., VA Connecticut HealthcareSystem, Research Office 151, 950 Campbell Ave., West Haven, Connecticut06516, USA.E-mail: heinove@ct1.nai.net

APPENDIX

The term “distal tubule” refers to the region of the nephron betweenthe macula densa cells and the confluence of the nephron with another toform the cortical collecting duct. The distal tubule is a heterogeneousstructure comprising a short post-macula densa thick ascending limbportion, the distal convoluted tubule (DCT), the connecting tubule (CNT)and the initial collecting tubule (ICT).

The initial portion of the DCT is homogeneous in all species. In humansand in rats intercalated cells begin to appear before the junction with theCNT. In the rat, a second type of DCT cell has been identified (DCT2),located prior to the junction with the CNT [12].

Abbreviations in this article are: 11b-HSD, 11b-hyhdroxysteroid dehy-drogenase; CCD, cortical collecting duct; CNT, connecting tubule; DCT,distal convoluted tubule; DEPC, diethylpyrocarbonate; ICT, initial col-lecting tubule; MCD, medullary collecting duct; NAD, nicotinamideadenine dinucleotide; NADP, nicotinamide adenine dinucleotide phos-phate; PCT, proximal convoluted tubule; PT, proximal tubule; RACE,rapid amplification of cDNA ends; SN-RT/PCR, single-nephron reversetranscriptase-polymerase chain reaction; TAL, thick ascending limb;

REFERENCES1. VELAZQUEZ H, WRIGHT FS, GOOD DW: Luminal influences on

potassium secretion: Chloride replacement with sulfate. Am J Physiol242:F46–F55, 1982

2. VELAZQUEZ H, GOOD DW, WRIGHT FS: Mutual dependence ofsodium and chloride absorption by renal distal tubule. Am J Physiol247:F904–F911, 1984

3. VELAZQUEZ H, WRIGHT FS: Effects of diuretic drugs on Na, Cl, andK transport by rat renal distal tubule. Am J Physiol 250:F1013–F1023,1986

4. ELLISON DH, VELAZQUEZ H, WRIGHT FS: Thiazide sensitive sodiumchloride cotransport in the early distal tubule. Am J Physiol 253:F546–F554, 1987

5. GOOD DW, VELAZQUEZ H, WRIGHT FS: Luminal influences onpotassium secretion: Low sodium concentration. Am J Physiol 246:F609–F619, 1984

6. COSTANZO LS: Localization of diuretic action in microperfused ratdistal tubules: Ca and Na transport. Am J Physiol 248:F527–F535, 1985

7. KUNAU RT JR, WELLER DR, WEBB HL: Clarification of the site ofaction of chlorothiazide in the rat nephron. J Clin Invest 56:401–407,1975

8. BEAUMONT K, VAUGHN DA, FANESTIL DD: Thiazide diuretic drugreceptors in rat kidney: Identification with [3H]metolazone. Proc NatlAcad Sci USA 85:2311–2314, 1988

9. GAMBA G, SALTZBERG SN, LOMBARDI M, MIYANOSHITA A, LYTTON J,HEDIGER MA, BRENNER BM, HEBERT SC: Primary structure andfunctional expression of a cDNA encoding the thiazide-sensitive,electroneutral sodium-chloride cotransporter. Proc Natl Acad Sci USA90:2749–2753, 1993

10. GAMBA G, MIYANOSHITA A, LOMBARDI M, LYTTON J, LEE W-S,HEDIGER MA, HEBERT SC: Molecular cloning, primary structure, andcharacterization of two members of the mammalian electroneutralsodium-(potassium)-chloride cotransporter family expressed in kid-ney. J Biol Chem 269:17713–17722, 1994

11. SIMON DB, NELSON-WILLIAMS C, BIA MJ, ELLISON D, KARET FE,MOLINA AM, VAARA I, IWATA F, CUSHNER HM, KOOLEN M, GAINZAFJ, GITELMAN HJ, LIFTON RP: Gitelman’s variant of Bartter’s syn-drome, inherited hypokalemic alkalosis, is caused by mutations in thethiazide-sensitive Na-Cl cotransporter. Nature Genet 12:24–30, 1996

12. OBERMULLER N, BERNSTEIN PL, VELAZQUEZ H, REILLY RF, MOSERD, ELLISON DH, BACHMANN S: Expression of the thiazide-sensitiveNa-Cl cotransporter in rat and human kidney. Am J Physiol 269:F900–F910, 1995

13. BACHMANN S, VELAZQUEZ H, OBERMULLER N, REILLY RF, MOSER D,ELLISON DH: Expression of the thiazide-sensitive Na-Cl cotransporterby rabbit distal convoluted tubule cells. J Clin Invest 96:2510–2514,1995

14. KAISSLING B: Structural aspects of adaptive changes in renal electro-lyte excretion. Am J Physiol 243:F211–F226, 1982

15. ELLISON DH, VELAZQUEZ H, WRIGHT FS: Adaptation of the distalconvoluted tubule of the rat. Structural and functional effects ofdietary salt intake and chronic diuretic infusion. J Clin Invest 83:113–126, 1989

16. CHEN Z, VAUGHN DA, BLAKELEY P, FANESTIL DD: Adrenocorticalsteroids increase renal thiazide diuretc receptor density and response.J Am Soc Nephrol 5:1361–1368, 1994

17. FANESTIL DD: Steroid regulation of thiazide-sensitive transport. Se-min Nephrol 12:18–23, 1992

18. VELAZQUEZ H, BARTISS A, BERNSTEIN PL, ELLISON DH: Adrenalsteroids stimulate thiazide-sensitive NaCl transport by rat renal distaltubules. Am J Physiol 270:F211–F219, 1996

19. FARMAN N: Steroid receptors: Distribution along the nephron. SeminNephrol 12:12–17, 1992

20. ROBERTSON NM, SCHULMAN G, KARNIK S, ALNEMRI E, LITWACK G:Demonstration of nuclear translocation of the mineralocorticoidreceptor (MR) using an anti-MR antibody and confocal laser scanningmicroscopy. Molec Endocrinol 7:1226–1239, 1993

21. SHEPPARD KE, FUNDER JW: Equivalent affinity of aldosterone andcorticosterone for type I receptors in kidney and hippocampus: Directbinding studies. J Steroid Biochem 28:737–742, 1987

22. FUNDER JW, PEARCE PT, SMITH R, SMITH AI: Mineralocorticoidaction: Target tissue specificity is enzyme, not receptor mediated.Science 242:583–585, 1988

23. CELANO P, VERTINO P, M, CASERO RA JR: Isolation of polyadenylatedRNA from cultured cells and intact tissues. BioTechniques 15:27–28,1993

24. DORUP J, MORSING P, RASCH R: Tubule-tubule and tubule-arteriolecontacts in rat kidney distal nephrons: A morphologic study based oncomputer-assisted three-dimensional reconstructions. Lab Invest 67:761–769, 1992

25. MORIYAMA T, MURPHY HR, MARTIN BM, GARCIA-PEREZ A: Detec-tion of specific mRNAs in single nephron segments by use of thepolymerase chain reaction. Am J Physiol 258:F1470–F1474, 1990

26. ERB BC, VELAZQUEZ H, GISSER M, SHUGRUE CA, REILLY RF: cDNAcloning and localization of OCRL-1 in rabbit kidney. Am J Physiol273:F790–F795, 1997

27. NARAY-FEJES-TOTH A, WATLINGTON CO, FEJES-TOTH G: 11B-hydrox-ysteroid dehydrogenase activity in the renal target cells of aldosterone.Endocrinology 129:17–21, 1991

28. RUSVAI E, NARAY-FEJES-TOTH A: A new isoform of 11B-hydroxys-teroid dehydrogenase in aldosterone target cells. J Biol Chem 268:10717–10720, 1993

29. TERADA Y, KNEPPER MA: Thiazide-sensitive NaCl absorption in ratcortical collecting duct. Am J Physiol 259:F519–F528, 1990

30. WILSON DR, HONRATH U, SONNENBERG H: Thiazide diuretic effect onmedullary collecting duct function in the rat. Kidney Int 23:711–716,1983

31. ROCHA AS, KUDO LH: Water, urea, sodium, chloride, and potassiumtransport in the in vitro isolated perfused papillary collecting duct.Kidney Int 22:485–491, 1982

32. SHIMIZU T, YOSHITOMI K, NAKAMURA M, IMAI M: Site and mecha-nism of action of trichlormethiazide in rabbit distal nephron segmentsperfused in vitro. J Clin Invest 82:721–730, 1988

33. NARAY-FEJES-TOTH A, RUSVAI E, FEJES-TOTH G: Mineralocorticoidreceptors and 11B-steroid dehydrogenase activity in renal principaland intercalated cells. Am J Physiol 266:F76–F80, 1994

Velazquez et al: DCT expresses NaCl cotransporter and 11b-HSD472