Quorum Sensing and Silencing in Vibrio parahaemolyticus · Quorum Sensing and Silencing in Vibrio parahaemolyticus † Cindy J. Gode-Potratz and Linda L. McCarter* Microbiology Department,

JOURNAL OF BACTERIOLOGY, Aug. 2011, p. 4224–4237 Vol. 193, No. 160021-9193/11/$12.00 doi:10.1128/JB.00432-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Quorum Sensing and Silencing in Vibrio parahaemolyticus�†Cindy J. Gode-Potratz and Linda L. McCarter*

Microbiology Department, The University of Iowa, Iowa City, Iowa 52242

Received 30 March 2011/Accepted 12 June 2011

The quorum regulatory cascade is poorly characterized in Vibrio parahaemolyticus, in part because swarmingand virulence factors—the hallmarks of the organism—are repressed by this scheme of gene control, andquorum sensing seems to be silenced in many isolates. In these studies, we examine a swarming-proficient,virulent strain and identify an altered-function allele of the quorum regulator luxO that is demonstrated toproduce a constitutively active mimic of LuxO�P. We find that LuxO* affects the expression of three smallregulatory RNAs (Qrrs) and the activity of a translational fusion in opaR, the output regulator. Tests forepistasis showed that luxO* is dominant over luxO and that opaR is dominant over luxO. Thus, information flowthrough the central elements of the V. parahaemolyticus quorum pathway is proven for the first time. Quorum-sensing output was explored using microarray profiling: the OpaR regulon encompasses �5.2% of the genome.OpaR represses the surface-sensing and type III secretion system 1 (T3SS1) regulons. One novel discovery isthat OpaR strongly and oppositely regulates two type VI secretion systems (T6SS). New functional conse-quences of OpaR control were demonstrated: OpaR increases the cellular cyclic di-GMP (c-di-GMP) level,positively controls chitin-induced DNA competency, and profoundly blocks cytotoxicity toward host cells. Inexpanding the previously known quorum effects beyond the induction of the capsule and the repression ofswarming to elucidate the global scope of genes in the OpaR regulon, this study yields many clues todistinguishing traits of this Vibrio species; it underscores the profoundly divergent survival strategies of thequorum On/Off phase variants.

Many members of the Vibrionaceae are well known for theircapacities to communicate and to control group activities suchas biofilm formation, virulence, and luminescence via cell-to-cell signaling (reviewed in reference 48). However, quorumsensing has not been intensively investigated in Vibrio para-haemolyticus. This ubiquitous marine organism is the leadingworldwide cause of seafood-borne gastroenteritis (43, 47, 60).Although its pathogenic strategies are not well understood,V. parahaemolyticus possesses a powerful arsenal of potentialvirulence factors, including proteases, hemolysins, two type VIsecretion systems (T6SS1 and T6SS2), and two type III secre-tion systems (T3SS1 and TSS2) (37). The two T3SS, which arespecially designed to inject effector virulence factors into eu-karyotic host cells, have garnered much attention recently andhave been shown to play distinct and critical roles in the patho-genicity of the organism (9, 27). Another hallmark of theorganism is a marked proficiency at surface colonization, whichis determined by its vigorous capacity to swarm and formrobust biofilms (reviewed in reference 39). Our lack of knowl-edge about quorum sensing in V. parahaemolyticus stems inpart from the fact that the archetypal V. parahaemolyticusstrains appear defective in cell density-dependent regulation.Specifically, evidence suggests that the quorum pathway re-presses the two most characteristic traits of the species, swarm-ing and virulence, and that phase variation in the quorumpathway selects for the surface-mobile and pathogenic cell type(26, 28, 40).

Nevertheless, in all genomes that have been sequenced,Vibrio species share similarity in the generally conserved cen-tral components of the quorum-sensing pathway. Moreover,for the species that have been examined, a paradigm ofinformation flow through this pathway seems to be pre-served (reviewed in reference 63). At a low cell density,when the concentrations of autoinducer molecules are alsolow, sensor histidine kinases phosphorylate the �54-dependentLuxO regulator via the small histidine phosphorelay proteinLuxU. LuxO�P induces transcription of small quorum-regu-latory RNAs (Qrrs), and the Qrrs destabilize the mRNA forthe central output regulator of the system. At a high celldensity in the presence of autoinducers, the histidine kinasesbecome LuxO phosphatases, resulting in an inactive form ofLuxO. The Qrrs are no longer transcribed, and the mRNA forthe central output regulator is then translated. Although thebackbone of the quorum-sensing system seems to work simi-larly in the vibrios that have been studied, the organisms differwith respect to the number and kinds of autoinducers andcognate sensory receptor kinases, the number of Qrr genes,and the kinds of genes in the output regulon (reviewed inreference 46).

The feature that is most distinguishing among the Vibriospecies is the composition of the output regulon. This is re-flected in the diverse names that have been assigned to thecentral terminal output regulator. The best known is V. harveyiLuxR, and its hallmark target is luminescence (55). Othercharacterized orthologs include V. cholerae HapR (hemag-glutinin [HA]/protease), V. fischeri LitR (light and symbio-ses), V. anguillarum VanT (protease, pigment, and biofilm),V. vulnificus SmcR (starvation metalloprotease), V. tubiashiiVtpR (multiple metalloproteases), and V. parahaemolyticusOpaR (colony opacity) (10, 16, 24, 29, 40, 42). Many of these

* Corresponding author. Mailing address: Microbiology Department,The University of Iowa, Iowa City, IA 52242. Phone and fax: (319) 335-9721. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

� Published ahead of print on 24 June 2011.

4224

on Septem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

quorum-controlled genes are pertinent to social activities suchas biofilm formation and virulence (reviewed in reference 48);however, even the direction of output regulation can differamong the Vibrio spp. For example, HapR represses the ex-pression of the extracellular polysaccharide locus (vps) in V.cholerae, whereas LitR and OpaR induce the expression ofextracellular polysaccharide in V. fischeri and V. parahaemo-lyticus (reviewed in reference 74).

V. parahaemolyticus undergoes reversible phase variation,resulting in different colony morphologies: opaque (OP) andtranslucent (TR) (39). OP strains form mounded, opaque col-onies, do not swarm, and possess a thick capsule. This capsularpolysaccharide (CPS) determines colony opacity and “sticki-ness,” which is apparent, for example, when a colony is touchedwith a toothpick. Producing less CPS, the TR cell type is notsticky and forms flat, translucent colonies. TR strains areswarming proficient. Although both OP and TR strains formrobust biofilms, their architecture and structural integrity aredifferent because of differences in the amounts of CPS andother cell surface molecules (13, 14).

In strain BB22, the OP/TR phenotypic variation has beenshown to be a consequence of alteration of the quorum path-way. Some TR strains have been found to contain geneticalterations in the opaR locus, specifically, small insertions anddeletions (13, 40). These TR strains can be complemented witha functional copy of opaR, and the phenotype then converts toOP; conversely, targeted introduction of a mutation in opaR issufficient to convert the OP phenotype to TR (40). OpaRrepresses the expression of the lateral flagellar genes and in-duces cps expression (21, 28). There is some evidence thatOpaR regulates T3SS1 (26) and that regulation of swarmingand T3SS gene expression are linked (19, 20). In Vibrio harveyi,LuxR has been demonstrated to repress the T3SS; it does so bydirectly binding the regulatory region controlling the expres-sion of exsA, which encodes the master transcriptional regula-tor of the T3SS (26, 66). In V. parahaemolyticus BB22, OpaR isinferred to work similarly, because a T3SS1 effector, VopD,could be detected in concentrated cell-free culture fluids pre-pared from a TR strain bearing an insertion in opaR, but couldnot be detected in the OP opaR� strain, by using an antibodydirected against V. harveyi VopD (26).

In this work we examine the quorum pathway in V. para-haemolyticus by probing the function of the upstream elementsthat regulate opaR and the output targets regulated by OpaR.Until now, we have been stymied in dissecting this pathway,due in part to the nature of its central wiring: loss of functionof luxO caused no discernible phenotype with respect toswarming, biofilm formation, or lateral flagellar or cps geneexpression (L. McCarter and S. Jaques, unpublished data).Though consistent with the predictions of the paradigm, be-cause the high-cell-density phenotype is in fact a functionallyLuxO� phenotype due to lack of phosphorylation, these werenegative results. Our findings in this report originate in thecharacterization of a TR variant that was found by sequencingto contain an intact opaR locus. This swarming-proficient,highly cytotoxic strain is demonstrated to produce an alteredform of LuxO (LuxO*) that behaves in a constitutively activemanner. By using various combinations of mutations, we testedand confirmed elements of the paradigmatic vibrio quorum-sensing circuit. Transcriptional profiling illuminated the scope

of the OpaR regulon, and new quorum-controlled activitieswere examined. Thus, this work provides the first evidence ofinformation flow through the quorum-sensing pathway in V.parahaemolyticus and offers insight into the scope of activitiescontrolled by this signaling cascade.

MATERIALS AND METHODS

Bacterial strains, media, and nomenclature. The bacterial strains and plas-mids used in this work are described in Table 1. The V. parahaemolyticus strainsare derivatives of BB22 (5). V. harveyi BB7 was obtained from Michael Silverman(4). The Vibrio strains were routinely grown at 30°C on plates unless otherwiseindicated. Heart infusion (HI) broth contained 25 g/liter heart infusion (Difco)and 15 g/liter NaCl; heart infusion plates contained HI broth with 20 g/litergranulated agar (Difco) for isolating colonies and examining OP/TR colonymorphology and 15 g/liter Bacto agar (Difco) for promoting swarming motility.Congo red medium contained 25 g/liter heart infusion, 15 g/liter granulated agar,2.5 mM CaCl2, and 250 mg/liter Congo red. The calcium and dye (solubilized inethanol) were added after the medium was autoclaved. Supplements were usedat the following concentrations: 75 �g/ml kanamycin, 25 �g/ml gentamicin, and10 �g/ml tetracycline.

Gene deletions were constructed by using the phage lambda Red recombina-tion system on plasmids carrying V. parahaemolyticus DNA in Escherichia coli(12). The �luxO mutation was created by deleting 1,094 nucleotides of the codingregion and inserting a gentamicin resistance cassette that was amplified frompUCGM (54). The gentamicin cassette and luxO are transcribed in the samedirection. The translational fusion in opaR was obtained by mutagenizing anopaR-containing plasmid in E. coli with TnlacZ/in (38). The site of insertion,identified by sequencing, occurred at nucleotide 322. Mutations were transferredto the V. parahaemolyticus chromosome after conjugation to introducethe plasmid bearing the mutant allele via allelic replacement. Introductionof the opaR::Tn mutation into OP strain LM5312 to make strain LM9738produced the TR, swarming-proficient phenotype (data not shown). With asimilar allelic exchange strategy, chromosomal mutations were repaired by trans-fer of a cosmid bearing the wild-type locus and serial passage to allow recom-binational repair (and subsequent loss of the cosmid). In this manner, the�opaR1 allele in strain LM5674 was repaired using cosmid pLM1950 to makestrain LM6633, and the laf::lux reporter in strain LM1017 was repaired usingcosmid pLM1776 to make strain LM4476. All strain constructions were verifiedby PCR.

The luxOU operons were cloned using Phusion high-fidelity DNA polymerase(New England Biolabs) and the pLM1877 vector, which contains an isopropyl-�-D-thiogalactopyranoside (IPTG)-inducible promoter (8). There is some ex-pression from this promoter in the absence of IPTG, so IPTG was not used forthe expression experiments described here. The expression plasmids were se-quenced and compared to sequences derived directly from PCRs performed onchromosomal DNA. The luxOU operon was cloned prior to our sequencing ofthe BB22 locus, and the cloning primers were designed according to the anno-tated sequence; upon analysis of the region after sequencing, we noted thepotential for an earlier start site for the coding region: 14 amino acids (aa)upstream in our strain BB22 (as well as in the sequenced RIMD strain).

Microarray growth conditions. A single colony was streaked as a lawn onto anHI plate. The following day, 5 ml of HI broth was used to suspend the cells onthe plate, and the cells were then diluted to an optical density at 600 nm (OD600)of 0.05. Fifty microliters of the diluted cells was spread onto an HI plate. After6 h of growth, cells were harvested from the plate and diluted to an OD600 of 1.0by using RNAprotect (Qiagen) that had been diluted 2-fold in 1� Dulbecco’sphosphate-buffered saline (DPBS), pH 7.1 (Gibco). Samples were checked forphase variation by plating for single colonies to visualize OP and TR colonymorphology, and the frequency of phase shifting was less than 1%. Proteinsamples were analyzed by immunoblotting for TR-specific lateral and constitu-tive polar flagellin production. RNA samples were analyzed for polar and lateralflagellin gene expression using primers specific for polar and lateral fliA genes(20).

Microarray analyses. RNA isolation, cDNA synthesis, labeling, and hybrid-ization have been described elsewhere, as has the custom Affymetrix GeneChip(20). Samples (�4.5 �g) were hybridized to the chips in the DNA Core Facilityat the University of Iowa according to the standard Affymetrix protocols forE. coli. The GeneChip (rhofispaa52026F; feature size, 11 �m) was designed usingthe V. parahaemolyticus RIMD2210633 genome. Chip annotation generally con-forms to original genome annotation, and tag numbers were assigned VP num-bers for chromosome 1 and VPA numbers for chromosome 2. Additional probe

VOL. 193, 2011 QUORUM SENSING IN V. PARAHAEMOLYTICUS 4225

on Septem


.org/D

ownloaded from

http://jb.asm.org/

TABLE 1. Bacterial strains, plasmids, and primers

Strain,plasmid, or

primerGenotype, description,a or sequenceb Parent, reference, or construction

StrainsBB7 Vibrio harveyi 55BB22 V. parahaemolyticus 5LM1017 luxO1017 flgB313L::lux (luxO* constitutive allele) (TR) 41LM4476 luxO1017 (TR) LM1017 � pLM1776 (allelic replacement)LM5312 “Wild type” (OP) BB22LM5431 opaR2 (TR) 59LM5392 flaM1P::EzKan opaR14 (TR) LM5314LM5674 �opaR1 (TR) BB22c

LM5738 flgB1L::Tn5lux(Kanr) opaR2 (TR) LM5431d

LM5949 �opaR1 flgCL3061::lacZ (Camr) (TR) LM5674e

LM6633 “Wild type” (OP) LM5674 � pLM1950 (allelic replacement)LM6693 flgB1L::lux(Kanr) (OP) LM5738 � pLM1950 (allelic replacement)LM6820 �opaR1 �swrT2::lacZ (Camr) (TR) LM5674LM7595 LM6693/pLM3286LM7919 BB7/pLM1877LM7920 BB7/pLM3286LM7921 BB7/pLM3942LM7956 LM6693/pLM1877LM8602 �opaR1 flgCL3061::lacZ (Camr) scrC292::Tn5lux(Kanr) (TR) 15LM9513 LM5674/pLM3286LM9514 LM5674/pLM1877LM9515 LM4476/pLM3286LM9516 LM4476/pLM1877LM9651 LM6633/pLM3942LM9652 LM6633/pLM3286LM9653 LM6633/pLM1877LM9655 LM6693/pLM3942LM9656 LM5674/pLM3942LM9688 �luxO::Genr (OP) LM4476 � pLM3294 (allelic replacement)LM9736 flgB313L::lux luxO1017 opaR3282::TnlacZ/in (Camr) (TR) LM1017 � pLM3282 (allelic replacement)LM9738 opaR3282::TnlacZ/in (TR) LM5312 � pLM3282 (allelic replacement)LM9752 luxO1017 opaR3282::TnlacZ/in (TR) LM4476 � pLM3282 (allelic replacement)LM9757 flgB313L::lux �luxO::Genr (OP) LM1017 � pLM3294 (allelic replacement)LM9847 �luxO::Genr (OP) LM5312 � pLM3294 (allelic replacement)LM9849 �opaR1 �luxO::Genr (TR) LM5674 � pLM3294 (allelic replacement)LM9903 �luxO::Genr opaR3282::TnlacZ/in (TR) LM9688 � pLM3282 (allelic replacement)LM9946 flgCL3061::lacZ (Camr) scrC292::Tn5lux(Kanr) (OP) LM8602 � pLM1950 (allelic replacement)LM10036 �opaR1 VPA1435::Tn5lux(Kanr) �swrT2::lacZ (Camr) (TR) LM6820f

LM10037 VPA1435::Tn5lux(Kanr) �swrT2::lacZ (Camr) (OP) LM10036 � pLM1950 (allelic replacement)

PlasmidspLM1776 Tetr flgBL

� cosmid 59pLM1877 Genr Apr IPTG-inducible expression vector 8pLM1950 Tetr cosmid containing opaR locus from LM5312 (opaR�) 40pLM3230 Tetr cosmid containing 4-kb luxO locus from LM5674 (luxO�) pLAFR3pLM3282 opaR3282::TnlacZ/in (Camr) pLM1950pLM3286 Genr Apr IPTG-inducible luxOU operon from LM5674 (luxO�) pLM1877pLM3294 �luxO::Genr pLM3230pLM3942 Genr Apr IPTG-inducible luxOU operon from LM1017 (luxO*) pLM1877

PrimersJkluxofbam CTTGGATCCGCAAAGCGTAATGCGATTATTGJkluxorpst CTGCTGCAGCACTAAGTAGCCACTTGAGACTGC�luxogen1 GATCGACATTAATATTGTCGGTACAGGTAGAGATGCCATTGAAA

GTCTCAATCATCGTGTAGGCTGGAGCTGCTTC�luxogen2 CATTCCATGCTTGTAGTTTGCGGTAAATCGTTGACGGACTGACA

TCAAGATACCCAGCGCATATGAATATCCTCCTTAGVP1386for CCAGTCAATGGTGCAAAAATTGAGGVP1386rev CGAAACTGTACATCAGCTAAATGCVPA1026for GGCATTGTCTCTGCTGCAAAGCTCGVPA1026rev GCCAAGACATATTCTTTTCCTACTCGCVP2232for CTGTGTTGGTTAAGCGTATTGCTCACVP2232rev CGTTGCATCGCTTGGCTTAAGTATTTG

a OP and TR stand for the opaque and translucent colony morphologies, respectively (14, 40).b An underlined nucleotide indicates the origin of a deletion.c See reference 13.d See reference 59.e See reference 15.f See reference 28.

4226 GODE-POTRATZ AND MCCARTER J. BACTERIOL.

on Septem


.org/D

ownloaded from

http://jb.asm.org/

sets were designed for some intergenic regions, including the 5 quorum-regulat-ing RNAs and some other potential coding regions not assigned in the originalannotation. V. parahaemolyticus strain BB22, with which these studies wereperformed, has not been sequenced; however, probing of the AffymetrixGeneChip with genomic BB22 DNA yielded present calls for �98% of the pre-dicted open reading frames (ORFs). It seems reasonable to conclude that thesetranscriptome studies provide a good reflection of genome-wide expression pat-terns in BB22, although some fraction of gene activity could not be assessed.

Each condition used to query the chips was repeated at least 2 times usingindependently isolated RNA samples. Analysis was done using the AffymetrixGeneChip operating software (version 1.2.1) and Affymetrix GeneChip genotyp-ing analysis software (GTYPE, version 4.0). Using the raw signal output gener-ated by GTYPE, processing was carried out, and comparisons were made, byusing R, version 2.8.1, GUI 1.27 Tiger build 32-bit (5301) (http://www.r-project.org/) within Bioconductor software for bioinformatics (http://www.bioconductor.org) (18). The complete data set was preprocessed using the guanine cytosinerobust multiarray analysis (GCRMA) method to perform optical adjustment,background adjustment, normalization, and summarization functions (71). Testsfor differential expression were performed using an analysis of variance(ANOVA) model with a false discovery rate (FDR) of 0.03. The P and Q valuesfor each differentially expressed gene are supplied in Table S1 in the supple-mental material. A Q value of 0.01 for a gene means that if the requirements forstatistical significance were lowered just enough to allow this gene to meet them,the overall FDR of the study would be 1% (6). Hierarchical clustering wasperformed using the normalized expression values for each gene and the Heat-map.2 package for R with Bioconductor.

RT-PCR. Reverse transcriptase PCR (RT-PCR) was carried out using thePromega (Madison, WI) Access RT-PCR system according to the manufac-turer’s instructions except that 25-�l reaction mixtures were used. The anneal-ing temperature was 56°C. Quality control reactions were performed to checkRNA for DNA contamination using primers specific for the polar and lateral fliAgenes. PCR was run for 30 cycles with a 1-min extension time. Each reactionmixture contained 50 ng of RNA and 4 primers, the gene-specific pair and acontrol pair of primers designed to amplify the constitutively expressed polarflagellar gene fliA. RNA samples were prepared from cells grown identically to,but independently of, those for the microarray experiments.

Coculture cytotoxicity assays. Chinese hamster ovary (CHO) cells (ATCCCCL-61) were used in coculture experiments as previously described (19).Briefly, the bacteria were grown overnight on HI plates at 30°C. The bacterialcells were harvested from plates and were suspended in prewarmed Ham’s F-12medium (Gibco) at 1.5 � 106/ml to yield an approximate multiplicity of infection(MOI) of 15. The cocultures were incubated at 37°C under 5% CO2 for 5 ho. Thebacterial inoculum was also serially diluted and plated in order to calculate theactual MOI and to monitor colony morphology. Cytotoxicity was assayed bymeasuring the release of lactate dehydrogenase (LDH) using the CytoTox 96nonradioactive cytotoxicity kit (Promega Corp., Madison, WI). Five replicatewells were measured per data point. The percentage of lysis was calculated bycomparison to total lysis obtained in control reactions using 0.9% Triton X-100;control wells without bacteria were used to calculate the background level oflysis. Maximal cytotoxicity for strain LM5674 was usually �70% of detergent-induced lysis.

�-Galactosidase and luminescence assays. For plate-grown cells, strains weregrown overnight on plates, suspended, and diluted to an OD600 of 0.05 in HIbroth, and 50 �l was spread on plates with supplements as indicated in the figurelegends. Cells were periodically harvested from these plates by suspension in 5 mlof medium. Activity in broth cultures was measured by periodically removing0.5-ml aliquots from 25-ml cultures grown in 250-ml flasks. �-Galactosidasemeasurements were performed according to the method of Miller (45), exceptthat Koch’s lysis solution was used to permeabilize the cells (51). Biolumines-cence was measured by using a TD20/22 luminometer (Turner Designs) and isreported as specific light units (SLU), which are relative total light units perminute per milliliter per OD600 unit. Assays were performed in triplicate, andeach experiment was performed at least three times with similar results. P valueswere calculated by using Student’s t test (2-tailed distribution with 2-sample,equal-variance calculations).

c-di-GMP measurements. Cells were grown as described under “Microarraygrowth conditions” above. Sixteen OD600 units were extracted in 375 �l and wereanalyzed as described previously (20) by the Mass Spectrometry Facility atMichigan State University using liquid chromatography–tandem mass spectrom-etry (LC–MS-MS) on a Quattro Premier XE mass spectrometer (Waters) cou-pled with an Acquity Ultra Performance LC system (Waters). Cyclic di-GMP(c-di-GMP) was detected by electrospray ionization using multiple-reactionmonitoring in negative-ion mode at m/z 689.163 344.31. In order to normalize

OD600 to milligrams of protein extracted, the protein concentration was deter-mined by using the Bradford method (Bio-Rad protein assay). A culture ofknown optical density grown as described under “Microarray growth conditions”above in liquid or on a surface was centrifuged, and the cell pellet was dissolvedin 0.1 N NaOH by heating for 15 min at 95°C as described previously (57). Theprotein standard was bovine serum albumin (BSA). The conversion factors (standard errors of the means) were 193 (14.2) and 220 (27.1) �g protein perOD600 unit for LM5674 and LM6633, respectively. The conversion factors werederived from 4 independent growth experiments and quadruplicate assays perexperiment.

Chitin transformation of LM5312 and LM5674 with chromosomal DNA.Chromosomal DNA was prepared from a 1-ml overnight culture of HI-grownstrain LM5392 (flaM::Kanr) in 300 �l (68). Recipient strains (LM5674 orLM5312) were grown overnight in minimal marine medium (MMM) supple-mented with 0.1% Casamino Acids, 5 mM MgSO4, and 0.5% chitin (final con-centrations). MMM contained 1 g/liter K2SO4, 1.1 g/liter NH4Cl, 4.7 g/literKH2PO4, 13.5 g/liter K2HPO4, and 20 g/liter NaCl. Chitin was prepared by amodification of the colloidal chitin procedure of Berger and Reynolds (7):instead of being ground during hydrolysis and filtered through glass wool, thechitin was serially decanted. Strains were subcultured by 1:100 dilution in 2.5 mland were grown for 4 h with shaking at 30°C. DNA (20 �l at �100 to 200 ng/�l)was added to 0.5-ml aliquots of culture, and the tubes were incubated staticallyfor 2 h at 30°C. Fresh medium (0.5 ml) without chitin was added, and cultureswere incubated overnight with shaking at 30°C and were then plated on selectivemedium. Transformants were selected on HI plates with 75 �g/ml kanamycin,and introduction of the disrupted polar flagellar regulatory gene was verified byexamination of the swimming motility phenotype (Swim�) and PCR. Chitintransformation experiments were repeated at least 3 times.

Statistical significance. Statistical significance was tested by using Student’s ttest (2-tailed distribution with 2-sample, equal-variance calculations).

Accession numbers. The microarray data have been submitted to the NCBIand have been assigned GEO accession number GSE28216. The GenBank ac-cession numbers for the DNA sequences of the luxO genes from LM5312 andLM1017 are JF317958 and JF317959, respectively.

RESULTS

Not all TR strains have defects in opaR. Strain BB22, whichwas isolated in Bangladesh prior to 1983, switches reversiblybetween the OP and TR colony types. Prior work demon-strated that mutations in the opaR locus of strain BB22 causethe TR phenotype. Specifically, spontaneous phase variantsarising as translucent flares from an OP colony can haveinsertion or deletion mutations in opaR, such as the 5-bpinsertion in LM5431 (opaR2), the 10-bp deletion in LM5093(�opaR6), and the 83-bp deletion in LM5674 (�opaR1) (13).Most aged TR colonies (though not LM5674, which seemsfixed due to its large deletion) will show occasional conversionof cells to OP types upon restreaking. LM5312 is a represen-tative BB22 OP strain. It is highly swarm defective and pro-duces a mounded colony that is crinkly on a Congo red plate(Fig. 1, top row). In contrast, the TR strain LM5674 is swarm-ing proficient and produces a flat colony on Congo red medium(Fig. 1, second row). Recombinational repair of LM5674 byusing allelic exchange to introduce the opaR� allele and makestrain LM6633 (Fig. 1, third row) produced a strain phenotyp-ically indistinguishable from LM5312.

However, we were intrigued by the fact that not all TRstrains derived from OP strains have a defect that could bemapped to opaR. One such strain is the laf::lux reporter strainLM1017, which has been used by our laboratory for a numberof years to study the regulation of swarming (41). LM4476(Fig. 1, bottom row) is a congenic derivative of LM1017 thathas been repaired by allelic exchange of the flgBL locus toswarming proficiency. Like opaR mutants, the strain is swarm-ing competent and forms flat, translucent colonies on Congo


on Septem


.org/D

ownloaded from

http://jb.asm.org/

red plates. Sequence analysis of the opaR locus of LM4476,obtained by using oligonucleotide primers specific for theflanking genes (hpt and lpd), revealed that this opaR sequencewas identical to that of the OP strain LM5312 (AF035967.1).

The expression profile of LM4476 suggests that OpaR hasbeen silenced. To gain an understanding of the genome-widedifferences between OP and TR strains, microarray profilingwas performed. Strains were grown on plates and were har-vested for RNA sampling at a time corresponding to the timeof induction of the swarming regulon (20). Hierarchical clus-tering created the dendrogram in Fig. 2A, showing the simi-larity of the expression profiles. Independently isolated RNAsamples were used for each hybridization query of a customAffymetrix GeneChip. The analyses included 4 samples (a to d)of LM5674 (�opaR), 2 samples (a and b) of LM4476, and 2samples (a and b) of LM6633 (opaR�). A single microarrayhybridization (c) was also performed with RNA prepared fromOP strain LM5312 (opaR�). LM4476 clustered with LM5674(�opaR), whereas the two opaR� strains, LM6633 and LM5312,clustered with each other, and their expression profiles weredistant from that of either TR strain.

The phenotype and global gene expression profile ofLM4476 were most like those of the �opaR strain; therefore, alikely hypothesis for its TR phenotype was that opaR was beingsilenced in some way other than by its mutation. The microar-ray data provided a key by revealing the altered expression ofsome of the small regulatory RNAs, the Qrrs. The V. para-haemolyticus genome contains 5 predicted Qrrs (36). The av-erage log2 expression levels for three of these, Qrr2, Qrr3, andQrr4, were elevated in LM4476 and were significantly differentfrom those in LM5674 (�opaR) and the opaR� strains LM5312and LM6633 (Fig. 2B). (The values for the LM5312 andLM6633 arrays were averaged together.) Because the se-quences of the qrr loci are quite similar and small (�100nucleotides), we note that it was not possible to generate spe-cific probes for Qrr4. As a consequence, the Qrr4 probe set islikely to reflect some cumulative level of multiple Qrr tran-scripts.

The microarray data supported the notion that OpaR wasbeing silenced in LM4476 due to an alteration in the upstream

elements of the quorum-sensing pathway. To test this notiondirectly, a translational fusion of LacZ to amino acid 107 ofOpaR (which is 202 aa long) was employed. The opaR::lacZfusion was recombined into the chromosomes of LM4476 and

FIG. 1. Swarming motility and colony morphology of V. parahae-molyticus phase variants. Three single colonies from each strain—LM5312 (opaR�), LM5674 (�opaR), LM6633 (opaR�), and LM4476(?)—were inoculated with a toothpick onto an HI swarm agar andCongo red medium. The swarm plates were photographed after over-night growth at 30°C. Congo red plates were incubated overnight at30°C and were allowed to develop for 1 week at room temperaturebefore photography. LM5312, LM5674, and LM4476 are spontaneousphase variants of strain BB22; strain LM6633 was constructed by allelicexchange to repair the opaR locus of strain LM5674. The genetic basisfor the translucent phenotype of strain LM4476 was unknown; hencethe “?” for its genotype. In this work, we demonstrate that strainLM4476 carries a missense mutation, designated luxO*.

FIG. 2. The transcriptome of LM4476 clusters with that of the�opaR strain and appears to silence OpaR. (A) Hierarchical clusteringanalysis. The microarray expression profiles were compared in thestatistical computing program R using the Heatmap.2 package. Low-ercase letters indicate that three biological replicates were carried outfor opaR� strains LM6633 (a and b) and LM5312 (c), two replicatesfor LM4476 (a and b), and four replicates for �opaR strain LM5674 (ato d). (B) Quorum-regulatory RNA expression. Each bar representsthe averaged normalized log2 expression value for the indicated qrrgene. Of the 5 predicted small quorum-regulatory RNAs (Qrrs), 3showed average expression levels for two biological replicate microar-rays of LM4476 that were statistically significantly higher than theaverages for four replicates of LM5674 (�opaR) or the averages for thethree microarrays of LM6633 and LM5312 (opaR�). All P valueswere �0.002. Error bars indicate standard errors of the means. Datafor Qrr1 and Qrr5 are not shown, because no significant changes ingene expression were detected. (C) The level of translation of opaR isdecreased in LM4476. A translational fusion of lacZ to opaR wasintroduced into the chromosomes of LM5312 and LM4476, generatingstrains LM9738 and LM9752, respectively. �-Galactosidase activitywas measured over a time course of growth on HI plates and isreported as Miller units at 6 h; the difference between the strains wasstatistically significant (P � 0.0001). Error bars represent standarddeviations for triplicate samples in a single representative experiment.The experiment was repeated three times, and the results of a repre-sentative experiment are shown.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

LM5312. The introduction of this allele had no effect on theTR phenotype of LMM4476 but converted the OP strainLM5312 to the TR phenotype (data not shown). �-Galactosi-dase levels, measured after 6 h of growth on plates, were30-fold higher in the LM5312 background (strain LM9738)than in the LM4476 background (strain LM9752) (Fig. 2C).

The luxO allele of LM4476 is different from those of otherstrains. In the paradigmatic vibrio model, the expression of theQrrs is controlled by the �54-dependent regulator LuxO. WhenLuxO is phosphorylated at a low cell density, the Qrrs areexpressed, leading to destabilization of target mRNA encodingthe terminal output regulator. Only at a high cell density, whenLuxO is believed not to be phosphorylated and hence to beinactive, is there significant production of the output regulator.For V. harveyi, the output regulator is LuxR, and the conse-quence is luminescence at a high cell density. The elevatedlevels of Qrr expression observed in LM4476 and the corre-spondingly low level of the opaR::lacZ fusion suggested thatthe LuxO protein might be altered in this strain. The luxO geneoccurs in an operon with luxU, which encodes the small quo-rum phosphorelay protein. This operon was sequenced fromLM5312 (opaR�), LM5674 (�opaR), and LM4476 (opaR�).The sequences of luxO from LM5312 and LM5674 were iden-tical, and the LM4476 sequence contained one nucleotidechange in luxO (A662C), resulting in a D221A substitution inthe amino acid sequence. We refer to this allele as luxO*. TheluxU alleles in the three strains were identical.

LuxO from LM4476 is constitutively active. Taken together,the data suggest that the altered form of LuxO in LM4476 is aconstitutively active variant of LuxO. To examine this possibil-ity, the luxOU operons from LM4476 and LM5674 were clonedinto an expression vector. The clones were transferred toVibrio harveyi. Conservation of the central components of quo-rum sensing is high enough that heterologous complementa-tion has been a useful tool for investigation of the Vibriospecies. This, for example, is how opaR and hapR were iden-tified (29, 40) and the functioning of the quorum pathway inV. cholerae explored (22, 36). Luminescence was measuredover a time course of growth in liquid culture (Fig. 3A). Thegrowth rates of the strains were similar. As the density of theV. harveyi culture increased, cultures with the vector controland the luxOU clone derived from LM5674 showed increasingluminescence, achieving maximal light outputs of �5,000,000and 8,600,000 SLU (light units normalized to OD), respec-tively. These values were not significantly different (P � 0.01). Incontrast, the strain overexpressing luxO*U derived from LM4476reached a maximal light output of only 298 SLU. This observeddegree of repression is consistent with the performance ofsite-directed mutations introduced into V. harveyi luxO thatproduce a mimic of LuxO�P: strains bearing these mutations[luxOvh(D47E) and luxOvh(F94W)] produced 100,000- to10,000-fold less light than wild-type or loss-of-function luxOstrains (17).

A similar experiment was conducted with V. parahaemolyti-cus. The expression clones were introduced into an OP straincarrying a lateral flagellar reporter (opaR� laf::lux). In thiscase, strains were grown on plates and were harvested period-ically to measure luminescence. The growth rates of the strainswere similar. The OP strain was unable to express lateral fla-gellar genes: the vector control strain produced a maximal

luminescence level of �4 SLU. Ectopic expression of luxOUelicited no effect: the luminescence profile of the strain carry-ing luxOU was similar to that of the strain with the vector. Incontrast, luxO*U expression increased lateral flagellar geneexpression to a maximal light value of �23,600 SLU (Fig. 3B).Ectopic expression of luxO*U cloned from LM4476, and notthat of the clone derived from LM5674, was sufficient toinduce a TR, swarming-proficient morphotype in the OPstrain LM5312 (data not shown). Thus, as one would predict,because wild-type LuxO should be inactive at a high cell den-sity due to lack of phosphorylation, the altered-function luxO*allele was dominant over the wild-type allele. In preventingluminescence in V. harveyi and inducing swarming gene expres-sion in V. parahaemolyticus, V. parahaemolyticus LuxO* ap-peared to effectively silence the output regulators, the posi-tively acting V. harveyi LuxR and the negatively acting V.parahaemolyticus OpaR.

LuxO-mediated regulation within the quorum-sensing path-way. The experiments described above provide the first evi-dence of roles for the elements of the quorum-sensing pathwayupstream of OpaR in V. parahaemolyticus, and they generallyconform to the paradigmatic model. To test the model andfurther substantiate the V. parahaemolyticus pathway, a dele-tion mutation in luxO was introduced into various strains via

FIG. 3. The cloned luxO* operon elicits a low-cell-density responsein V. harveyi and V. parahaemolyticus. (A) The luxO operon was clonedfrom LM5674 (luxO�) and LM4476 (luxO*) into the pLM1877 vector.The luxO expression plasmids were introduced into the wild-type V.harveyi strain BB7. Luminescence was measured periodically duringgrowth in liquid culture. The luminescence normalized to the opticaldensity (SLU) is plotted against the optical density of the liquid cul-ture. (B) The luxO clones were also expressed in V. parahaemolyticusstrain LM6693, an opaR� strain with a luminescence reporter in thelateral flagellar gene flgBL. Luminescence was measured periodicallyduring growth on plates. The luminescence normalized to the opticaldensity (SLU) is plotted against the time of growth on plates. Thegrowth of these strains was similar. Error bars represent standarddeviations for triplicate samples in a representative experiment. Theexperiments were repeated three times with similar results. In bothpanels, the values for the luxO* clone were significantly different fromthose for the vector (P � 0.005 at all time points).


on Septem


.org/D

ownloaded from

http://jb.asm.org/

allelic recombination. LM9847 (�luxO) was derived from theopaR� strain LM5312, and its phenotype with respect toswarming ability and a mounded, opaque colony type is indis-tinguishable from that of the parental strain (Fig. 4A). Such aresult was predicted and is consistent with the quorum-sensingmodel. At a high cell density, the �54-dependent LuxO regu-lator is not phosphorylated and hence is inactive; therefore, thehigh-cell-density phenotype should be effectively equivalent tothe deletion phenotype. Similarly, the introduction of the�luxO allele into the �opaR strain LM5674 to produce strainLM9849 had no effect on swarming or the flat, translucentcolony phenotype (Fig. 4A). Therefore, opaR is epistatic toluxO.

In contrast, but as predicted, the swarming proficiency andtranslucent colony morphology of strain LM4476 (luxO*) wasgreatly affected by the introduction of the �luxO allele toproduce strain LM9688 (Fig. 4B). LM9688 (�luxO) was se-verely defective in swarming and produced mounded, opaquecolonies on swarm-restrictive medium. Mutations were alsorecombined into the chromosome of the laf::lux reporter strainLM1017, allowing the quantification of the effects on swarminggene expression (Fig. 4C). Luminescence in LM9757 (�luxOopaR� laf::lux) was severely repressed compared to that inLM1017 (luxO* opaR� laf::lux) After 7 h of growth, LM1017produced �1,200,000 SLU, while LM9757 emitted �8,000

SLU. In contrast, the introduction of a mutation in opaR intoLM1017 had little effect on laf::lux expression. The reporterstrains LM1017 and LM9736 (luxO* opaR3282 laf::lux) dis-played similar profiles of laf::lux induction during growth onsurfaces. The introduction of an opaR mutation into the luxO*strain was superfluous, since OpaR was already being silencedin LM1017.

Consistent with the prediction from these phenotypes, theintroduction of the �luxO allele into LM4476 relieved therepression of an opaR::lacZ fusion that was recombined ontothe chromosome (Fig. 4D). �-Galactosidase activity, measuredafter 6 h of growth on plates, was �35-fold higher in LM9903(in which the luxO* allele was replaced with the �luxO allele)than in LM9752 (luxO*); the activity in LM9903 was similar tothe degree of expression observed in LM9738 (LM5312 luxO�)(Fig. 2C). Thus, these results support the paradigmatic vibriomodel for the role of LuxO and its relation to the other coreelements of the quorum-signaling pathway.

Quorum-sensing output control: the OpaR regulon. Themicroarray analyses provided insight into the conserved ele-ments of the quorum-sensing pathway upstream of and con-trolling OpaR. It was also designed to begin to establish theoutput regulon, which is unique to each Vibrio species. By useof a 4-fold discriminator, 210 genes were expressed at higherlevels and 113 genes were expressed at lower levels in the

FIG. 4. Epistasis tests with luxO and opaR alleles. (A and B) (Left) Schemes of strain construction. Arrows indicate strain lineages; filled circles,strains with an OP colony type; open circles, strains with a TR colony type. (Right) Strains were grown on HI media permissive or restrictive forswarming (with low or high agar concentrations) (left and right panels, respectively). Shown are the swarming motilities and colony morphologiesof opaR� and �opaR strains (A) and of LM4476 (B) with and without the �luxO allele. (C) laf::lux gene expression in the LM1017 (luxO*)background. Strains LM1017 (luxO* opaR� laf::lux), LM9736 (luxO* opaR3282 laf::lux), and LM9757 (�luxO opaR� laf::lux) were grown on platesand were harvested periodically in order to measure luminescence, reported as SLU. The introduction of an opaR mutation into strain LM1017to produce LM9736 had no significant effect on luminescence, whereas the luminescence profile of LM9757, which was derived from LM1017 byintroducing the �luxO allele, was significantly different from those of the other strains (P � 0.001 at all time points). Error bars represent standarddeviations of triplicate measurements in one representative experiment of three. (D) The introduction of the �luxO allele into LM4476 increasesthe level of OpaR translation. A translational fusion of lacZ to opaR was introduced into the chromosomes of LM4476 and LM9688, generatingstrains LM9752 and LM9903, respectively. �-Galactosidase activity was measured over a time course of growth on HI plates and is reported asMiller units at 6 h. The difference between strains was statistically significant (P � 0.0001). Error bars represent standard deviations of triplicatesamples in a single representative experiment. The experiment was repeated three times, and the results of a representative experiment are shown.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

�opaR strain (LM5674) than in the opaR� strains (LM6633and LM5312). The complete list of differentially regulatedgenes (4-fold or greater change; FDR, 0.03) with P and Qvalues is provided in Table S1 in the supplemental material. Agraphical representation of the expression profiles for selectedgenes is shown in Fig. 5. The profiles for the luxO* strainLM4476 are provided for comparison: they generally resemblethose of the �opaR strain. The data are plotted as the normal-ized expression values (log2) for each strain and give an indi-cation of significance for some genes, i.e., the magnitude ofexpression as well as the differences between strains. Genesexpressed at high levels, such as those encoding lateral flagellinor ribosomal proteins, have expression values of �10 to 12, andgenes that are not transcribed or are very poorly transcribedhave values of �3 or lower. We note that many of the genesregulated by OpaR are expressed at high levels.

The microarray data replicated gene expression patterns forgene sets that were known to be OpaR controlled, providingvalidation of the robustness of the transcriptome comparison.For example, genes in the capsular polysaccharide operon(VPA1403 to VPA1412) showed �5- to 8-fold induction byOpaR. This is consistent with the sticky, mounded colony phe-notype of the OP cell type (Fig. 1) and with prior studiesdemonstrating that capsule and cps reporter gene levels arehigher in OP (opaR�) than in TR (opaR-defective) strains (14,21). Similarly, lateral flagellar genes were derepressed 14- to229-fold in the �opaR strain. This degree of regulation is inkeeping with the ability of TR and not OP strains to swarmover surfaces (Fig. 1) and with laf reporter expression data(28).

Recently, by examining a swarming-proficient strain (�opaR),we defined the surface-sensing regulon, a set of �70 genes thatare specifically regulated by the polar flagellum-mediated sur-face-sensing mechanism (20). These genes are not expressedduring growth in liquid culture; they include the lateral flagel-lar gene system and diverse nonflagellar genes, some of whichencode potential sensory and virulence factors. These geneswere OpaR controlled (see Table S1 in the supplementalmaterial). For example, VPA0459, encoding a collagenase,showed �60-fold higher expression in the �opaR strain than inthe opaR� strain (Fig. 5). Thus, the comparison of the opaR�

to the �opaR transcriptome reveals an expanded role forOpaR: not only acting as the master negative regulator of thelateral flagellar gene system, but also controlling the entiresurface-sensing regulon.

New members of the OpaR regulon include genes pertinentto c-di-GMP, T6SS, and competence. Some of the newly iden-tified members of the OpaR regulon were examined further(Fig. 6). One differentially regulated operon, VPA1435 toVPA1438, encodes a predicted TonB-dependent iron trans-port system, which was derepressed �5-fold in the �opaR celltype compared to the opaR� strain (Fig. 5). OpaR control ofthis operon was confirmed by using a luminescence reporterfusion to VPA1435 (Fig. 6A). The �opaR strain containingVPA1435::lux produced �26-fold more light than the congenicopaR� strain.

The genes in the scrABC operon (VPA1513 to VPA1511)were also derepressed in the �opaR strain. For example, thedifference in expression for scrA (VPA1513), the first gene inthe operon, was �20-fold between the �opaR and opaR�

strains. (Fig. 5). OpaR-dependent repression of this operonwas confirmed by using a scrC::lux reporter; luminescence was25-fold higher in the �opaR strain after 6 h of growth (Fig. 6B).This finding seems consistent, because scrABC is known to bepart of the surface-sensing regulon. The scrABC operon posi-tively regulates swarming motility by modulating cellular c-di-GMP levels (15). In fact, many genes pertinent to c-di-GMPmodulation display differential regulation between the opaR�

and �opaR cell types. Eighteen genes predicted to have thecapacity to influence c-di-GMP signaling by virtue of contain-ing highly conserved EAL, GGDEF, or HD-GYP domainswere observed to be �2-fold differentially expressed. We rea-soned that opaR� and �opaR strains might have measurabledifferences in their cellular nucleotide pools. LM6633 (opaR�)and LM5674 (�opaR) were grown as for the microarray exper-iments. The harvested cells were extracted with formic acid foranalysis by high-performance liquid chromatography-coupledmass spectrometry. The mean observed c-di-GMP concentra-tion for LM6633 (20.7 pmol mg of total bacterial protein�1)was significantly higher (P � 0.0001) than that for LM5674(7.64 pmol mg of total bacterial protein�1) (Fig. 6C).

VP0922 was induced more than 12-fold in the opaR�

FIG. 5. Microarray expression profiles of select OpaR-regulated genes. Bars indicate the average log2 normalized expression level of each genein the �opaR (LM5674), opaR� (LM6633 and LM5312), or luxO* (LM4476) strains. The array data for the two opaR� strains examined were highlysimilar (see Fig. 2A), so expression values were averaged together (2 microarray experiments for LM6633 and 1 for LM5312). Error bars representstandard errors of the means.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

strain (Fig. 5). Its V. cholerae homolog (VC1917) is requiredfor natural, chitin-induced competency (44); moreover,some other genes demonstrated to play roles in competencywere also induced in the opaR� strain, though not as strongly.For example, the expression of VP1241, encoding a TfoX ho-molog (VC1153), was 3.1-fold higher in the opaR� strain thanin the �opaR strain. Since HapR regulates the competence ofV. cholerae, we wondered if this was true of V. parahaemolyti-cus. Chromosomal DNA was prepared from a swimming-de-fective strain carrying the flaMP::Kanr mutation. DNA wasadded to cultures of LM5312 (opaR�) and LM5674 (�opaR)that were growing in medium with chitin. After time was al-lowed for phenotypic expression, cells were plated on selectivemedium with kanamycin. Colonies were obtained only for theopaR� strain, never for the �opaR strain (Fig. 6D). The kana-

mycin-resistant transformants were unable to swim. This ex-periment and permutations using donor DNA with differentlymarked mutations (and with different drug resistance cas-settes), as well as with recipient strains with other opaR alleles,were repeated with the same results. The opaR� strain consis-tently exhibited the capacity to acquire DNA, whereas the�opaR strain was deficient.

Two additional large gene sets were regulated stronglyand oppositely. Each encodes components of predicted T6SS.These sets were located on separate chromosomes. Twenty-nine linked genes forming 7 predicted operons encodingT6SS1 were expressed in the �opaR strain but not the opaR�

cell type. The expression of VP1386, a representative T6SS1gene, was 36-fold increased in the �opaR strain (Fig. 5). Othergenes in this region were expressed 4- to 41-fold more stronglyin the �opaR strain (see Table S1 in the supplemental ma-terial). On chromosome 2, 22 linked genes in 3 predictedoperons were expressed most highly in the opaR� strain; forexample, VPA1026, a representative T6SS2 gene, displayed�70-fold induction (Fig. 5). The other predicted (on the basisof homology or operon structure) T6SS2 genes were induced4- to 94-fold by OpaR (see Table S1 in the supplementalmaterial). To confirm this regulation observed in the microar-ray analysis, reverse transcriptase PCR (RT-PCR) was per-formed using RNA prepared independently of the microarrayRNA samples with primers specific for VPA1026 and VP1386.A control set of primers was included in each reaction mixtureto amplify the constitutively expressed polar flagellar mRNAfor fliA. The results of the RT-PCR corroborate the reciprocalcontrol of these genes by OpaR: a product for the T6SS2 genewas observed only in the opaR� strain, and a strong product forT6SS1 was observed in the �opaR strain (Fig. 6E).

OpaR-silenced strains are more cytotoxic than OpaR�

strains. V. parahaemolyticus OpaR and its V. harveyi orthologLuxR have been found to negatively affect the secretion of theT3SS substrate VopD by immunoblotting of concentrated cell-free supernatants (26), and LuxR has been demonstrated torepress directly the exsBA operon of V. harveyi (66); however,neither the effects of OpaR on the entire T3SS1 regulon northe biological significance of OpaR regulation with respect tovirulence has been assessed. Genes encoding type III secretioncomponents on chromosome 1 (T3SS1) were derepressed4.7- to 13.6-fold in the �opaR strain LM5674 compared tothe opaR� strains in the microarray analysis (see Table S1 inthe supplemental material). One example is VP1701 (en-coding the regulator ExsC), expression of which was 13.6-foldhigher in the �opaR strain; it was similarly derepressed in theluxO* strain LM4476 (Fig. 5). To test the functional signifi-cance of the repression by OpaR, cytotoxicity toward host cellsin coculture was examined (Fig. 7). Host cell lysis in this assayis dependent on T3SS1 (19, 49). The OpaR� strains LM5312and LM6633 (LM5674 repaired to opaR�) displayed little tox-icity toward the host Chinese hamster ovary (CHO) cells asmeasured by release of the host enzyme lactate dehydroge-nase. Both OpaR-silenced strains (LM5674 and LM4476) weresignificantly more cytotoxic than the OpaR� strains. LM4476appeared more cytotoxic than LM5674. Introduction of the�luxO allele to replace luxO* in strain LM4476 to makeLM9688 resulted in a significant reduction in cytotoxicity. Thedifferences in virulence between LM4476 and LM9688 were

FIG. 6. Examination of select OpaR-regulated genes. (A) Lumi-nescence reporter in VPA1435, an iron acquisition gene, measured instrains LM10036 (�opaR) and LM10037 (opaR�) after 6 h of growthon plates. (B) Luminescence reporter in scrC, measured in strainsLM8602 (�opaR) and LM9946 (opaR�) after 6 h of growth on plates.For both reporter gene analyses, the error bars represent standarddeviations for triplicate samples in one representative experiment ofthree. Light emission was significantly different for the two strains (P �0.0001 for each reporter). (C) Cyclic di-GMP levels measured instrains LM5674 (�opaR) and LM6633 (opaR�) after 6 h of growth onplates. The average concentrations of two replicates were calculated aspicomoles per milligram of bacterial protein by using an experimen-tally derived conversion factor from optical density to milligrams ofprotein for each strain. Error bars represent standard deviations of thereplicates. The differences in c-di-GMP levels between the two strainsare statistically significant (P � 0.0001). (D) Chitin-induced compe-tence. LM5674 (�opaR) and LM5312 (opaR�) were grown in mediumwith chitin and were transformed with chromosomal DNA (�1 �g)prepared from the polar flagellar mutant strain LM539 (flaMP::Kanr).The y axis shows the average number of kanamycin-resistant coloniesobtained from three independent transformations. Error bar, standarderror. No Kanr transformants were obtained for LM5674. (E) Reversetranscriptase PCR of a T6SS1 gene (VP1386) and a T6SS2 gene(VPA1026) using RNA prepared from LM6633 (opaR�) and LM5674(�opaR). Primers for the constitutively expressed polar flagellar sigmafactor gene fliA were used to generate the loading control band in eachRT-PCR mixture.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

largest at early times of coculture; for example, after 2 h ofcoculture with CHO cells, the normalized level of lysis causedby LM4476 was 51%, compared to 7% lysis induced byLM9688. At the same time point, the OpaR� strains LM5312and LM6633 elicited 15% and 7% killing, respectively. At latertimes of coincubation, the cytotoxicity of LM9688 increased, aresult consistent with the accumulation of some basal level oftoxicity; nevertheless, throughout the coculture, LM9688 dis-played significantly less host cell lysis than its parent, LM4476(P � 0.0001). Thus, strains that produce OpaR displayed re-duced virulence compared to strains in which OpaR produc-tion is silenced, either by opaR mutation or by expression ofthe luxO* allele.

DISCUSSION

The gammaproteobacterium V. parahaemolyticus is found indiverse aquatic habitats, freely swimming or attached to avariety of abiotic and biotic surfaces, including plankton andshellfish, or within a host organism (32). Effective and versatileat colonization, the organism can become a pathogen of manydifferent marine hosts, e.g., shrimp, crab, and sea otters (2, 33).In addition, as the major cause of seafood-borne gastroenteri-tis and occasionally a lethal agent of infection, it is a significantpathogen of humans (47, 72). The variety of conditions underwhich V. parahaemolyticus persists presumably require diversemechanisms for survival. One extreme mechanism is a phasevariation that profoundly alters colony morphology and, as wedemonstrate here, controls global gene expression.

Prior work has established that phase variation in V. para-haemolyticus can be the consequence of genomic alterations inthe locus encoding the central terminal output regulator of

quorum sensing, OpaR. In this work, we demonstrate thatanother mutation in the quorum-sensing pathway can have thesame consequence. Specifically, a single missense mutation inluxO was found to create a quorum-regulatory protein with analtered, constitutively active function. A variety of constitutivemutations (missense mutations and small deletions) have beendiscovered or created in other vibrio LuxO proteins; some mapto the presumed site of phosphorylation, whereas others occurat various other locations in the protein and are thought toswitch it to an “open” conformation (17, 52, 62). Our newlydiscovered allele belongs to the latter class. In V. parahaemo-lyticus, this luxO* allele resulted in elevated expression of threesmall Qrr RNAs and reduced OpaR activity. Although it isassumed to play roles similar to those investigated in otherVibrio species, the discovery of this allele in V. parahaemolyti-cus provides proof for the first time of the functionality of thecentral components of yhe quorum pathway of this species,because they can act to silence the production of OpaR.

Although the colony morphology and swarming phenotypesof LM4476 (luxO*) closely resemble the phenotype of LM5674(a �opaR strain) (Fig. 1), and the kinetics of swarming geneinduction in LM1017 (luxO*) resemble laf::lux induction inopaR mutants (data not shown), they are not identical. TheLM4476 genetic background displays a slightly more translu-cent and more swarm permissive phenotype than LM5674.Correspondingly, the virulence profile of LM4476 with respectto cytotoxicity is also slightly more enhanced (Fig. 7). Thesedifferences are not large, and it seems likely that small differ-ences in gene expression produce detectable phenotypic dif-ferences, since the effects are cumulative with time. The opac-ity and swarming phenotypes of the two �luxO strains, LM9688(derived from LM4476) and LM9847 (derived from LM5312),differ similarly from each other. Although both are �luxOstrains, the colonies of LM9688 (derived from LM4476) areless opaque, i.e., more glistening and swarm permissive, thanthose of than LM9847 (Fig. 4). As with LM4476 versusLM5674, LM9688 seems more cytotoxic than the other OPstrains examined (Fig. 7). Thus, the backgrounds of strainsLM4476 and LM5674 may have additional genotypic differ-ences that will be interesting to explore. It will also be inter-esting to probe whether alterations of the quorum pathway atdifferent points have particular consequences for the cell. Forexample, some strains of V. cholerae possess an alternate path-way bypassing the output regulator HapR (23).

Some clues to the divergent survival strategies of the OP andTR cell types are provided by the nature and scope of the genescontrolled by OpaR (summarized in Fig. 8; see also Table S1 inthe supplemental material). OpaR regulates, directly or indi-rectly, approximately 5.2% of the genome of V. parahaemolyti-cus. In some respects, the quorum-sensing On and Off states inV. parahaemolyticus, surprisingly, seem inverse to those inother bacteria (1, 50). Swarming is generally considered agroup activity (11), and yet it is in the Off state (high celldensity and OpaR� phenotype) that V. parahaemolyticus dif-ferentiates to the swarmer cell and moves over surfaces (28,40). We find that the TR cell type seems particularly primedfor detecting and responding to environmental cues. It cansense its physical environment and program the expression of�70 genes in response to growth on a surface (20). The RNAabundance profiles in this work reveal that OpaR controls not

FIG. 7. OpaR-silenced strains are more cytotoxic than OpaR�

strains. V. parahaemolyticus strains LM4476 (OpaR� luxO*), LM5674(�opaR), LM5312 (OpaR�), LM6633 (OpaR�), and LM9688(LM4476 OpaR� �luxO) were grown overnight on HI plates and wereused to infect Chinese hamster ovary cells at an MOI of 15. Cytotox-icity was measured periodically by lactate dehydrogenase release and isshown as a normalized percentage of maximal lysis for LM5674, whichwas equivalent to 80% of the lysis achieved using 0.9% Triton X-100.Error bars are obscured by the symbols and represent standard errorsof the means for 5 replicate coculture samples in one representativeexperiment; the experiment was repeated 3 times with similar results.Differences in cytotoxicity were statistically significant when LM5674was compared to LM5312 or LM6633 (P � 0.0001 at 3, 4, and 5 hand �0.05 at 2 h). The cytotoxicity of LM4476 was significantly dif-ferent from that of LM9688 (P � 0.0001 at 2, 3, 4, and 5 h); it was alsodifferent from that of LM5674 (P � 0.0001 at 3, 4, and 5 h and �0.01at 2 h). The cytotoxicities of LM5312 and LM6633 were not signifi-cantly different from each other.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

only the lateral flagellar system, as had been demonstratedpreviously, but also the expression of the entire surface-sensingregulon. The expression of some of the genes in this regulon,e.g., those encoding the chitin and N-acetyl binding protein,collagenase, and T3SS1, may prepare this cell type for contactwith a potential host. Two operons encoding predicted extra-cytoplasmic function (ECF)-type sigma factors are more highlyexpressed in the TR cell, perhaps further equipping this cell toalter global gene expression in response to environmentalchanges. In keeping with its capacity for mobility, 12 of the 29genes predicted to encode methyl-accepting chemotaxis pro-teins have higher levels of expression in the �opaR cell type,and none of the remaining chemosensory genes were morehighly expressed in the opaR� background.

In contrast, the OP cell type, with its quorum signalingcascade intact, seems well adapted for a sessile, communitylifestyle. This cell type has increased expression levels of genesencoding several cell surface and potential bacterial cell

surface/interaction molecules, e.g., capsular polysaccharide(VPA1403 to -1412; 5- to 8-fold increased) and a predictedphosphorylcholine-modifying protein, LicD1, and other pro-teins potentially involved in membrane biogenesis (VP1318 to-1322; �10-fold regulation). OpaR regulates a number of tran-scription factors, including an AraC-type transcription factor(VPA0606) previously identified as playing a role in biofilmdevelopment, which is 5-fold induced (13). We demonstrate, ashas been shown for V. cholerae (44), that OpaR is required forcells to become competent, an activity that is probably mostefficient when the local bacterial population is high.

V. parahaemolyticus harbors two T6SS, and their regulationis strikingly different. OpaR represses T6SS1 genes as much as40-fold, while T6SS2 genes are upregulated as much as 100-fold; moreover, when these large sets are expressed, the abun-dance of each is as great as those of some of the most highlyexpressed RNAs in the cell. Although it will be challenging todiscern the roles of each of these systems, it seems quitelikely—given the profoundly different On/Off states in thetwo cell types—that the T6SS may predicate specific bacterialinteractions, whether among cells of the same type, with otherbacteria, or with diverse hosts. In previous work (13), we iden-tified a biofilm mutant in the �opaR background with a trans-poson insertion in one of the T6SS1 genes, hcp (VP1393),which encodes a protein thought to be part of the extracellularsecretion apparatus. This mutant produces a biofilm pelliclewith altered structural integrity and is severely impaired in3-dimensional biofilm development. We think that the pheno-type probably does not reveal the full function of this T6SS1;rather, given its remarkably high level of expression, the bio-film phenotype may be indicative simply of loss of a major cellsurface determinant impacting cell-cell interactions.

The expression profiles of the particular panel of sensoryenzymes present in the two cell types that our microarraystudies provide also underscore how diversely programmed OPand TR strains seem to be. In possessing a different comple-ment of c-di-GMP pertinent enzymes that are coupled to di-verse sensory and signal transduction domains (i.e., 18 with�2-fold expression differences), the two cell types seem wiredto respond differently to their environments. To examine this,we measured cellular c-di-GMP concentrations and found a�3-fold higher level of this second messenger in the opaR� celltype than in the �opaR cell type during growth on a surface.This trend conforms to the paradigmatic role for c-di-GMP inrepressing motility and enhancing community-associated phe-notypes, such as increasing the extracellular matrix, sticking,and biofilm formation (reviewed in reference 25).

Our findings lay the foundation for studying the complexrelationship between quorum sensing and pathogenicity inV. parahaemolyticus. Acting as a master switch, the productionof OpaR is a profound point of gene control for the expressionof many potential virulence factors. It may even dictate hosttarget cell specificity, given the distinctive T6SS expressionpatterns. We find that OpaR represses cytotoxicity toward hostcells in culture. Although the expression of virulence factors ata low cell density rather than a high cell density seems inverseto the pattern for many pathogenic bacteria, this is the direc-tion of control that is also observed for V. cholerae and V.harveyi. V. harveyi LuxR represses the expression of the T3SSmaster regulator exsA and prevents the secretion of virulence

FIG. 8. Quorum-sensing control in V. parahaemolyticus. The strainsanalyzed in this work support the general Vibrio model of the quorum-sensing pathway for information flow in V. parahaemolyticus. Low celldensity can be mimicked by a constitutively active LuxO* or �opaRstrains; high cell density is mimicked by �luxO. The constitutive formof LuxO results in elevated expression of at least three small RNAs(Qrrs). Functioning as the downstream regulator in the pathway, opaRis epistatic to luxO. Transcriptome analyses reveal that OpaR regulates�210 genes negatively and 113 genes positively (�4-fold). The se-lected subset of regulated genes shown in the model include those forwhich we have experimental evidence or those displaying very highdegrees of regulation in the array analyses (i.e., 10-fold or greaterchanges in gene expression). Previous work showed that OpaR re-presses swarming and induces capsular polysaccharide gene expres-sion; here we demonstrate that OpaR regulates the level of c-di-GMPin the cell, represses cytotoxicity for host cells in coculture, and inducescompetence for DNA uptake. Motility and/or virulence may driveselection toward strains in the quorum-silenced state, either via loss offunction of the output regulator OpaR or via altered function of thequorum regulator LuxO.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

effectors (26, 66). Quorum control of virulence in V. cholerae isused to precisely tune the organism to a cycle of infection anddissemination. Many virulence factors, including cholera toxin,the toxin-coregulated pilus, and the HlyA hemolysin are ex-pressed at a low cell density and then repressed at a high celldensity by HapR. However, HapR also positively regulates theexpression of other virulence genes, such as the HA/proteaseand a T6SS, and represses the extracellular polysaccharidelocus and biofilm development (29, 34, 61, 76–78).

The nature of the genes regulated by the central outputregulator of the quorum pathway has been examined for a fewother Vibrio species. HapR regulates approximately 4.1% ofthe V. cholerae El Tor genome (73). For V. vulnificus, a 121-gene SmcR regulon has been predicted by using a consensusbinding sequence that was generated by DNA footprintingassays (35). A screen of random genomic V. harveyi DNA fusedto promoterless green fluorescent protein (GFP) identified 71autoinducer-regulated genes, all of which were LuxR depen-dent (64). The scope of each output network is similarly wide,but the specific sets of genes controlled are different. In gen-eral, there is very little overlap of specific gene regulation whenour OpaR regulon is compared to the network of genes regu-lated by the central output regulators of other vibrios. Com-parison with V. cholerae provides the best example of howdifferent the consequences of quorum sensing can be, eventhough the central wiring is similar. For example, the high-cell-density state in V. cholerae results in low c-di-GMP and extra-cellular polysaccharide levels (65), exactly the opposite of itseffects in V. parahaemolyticus. Our analysis begins to define thescope of output control in V. parahaemolyticus, and futurework must sort out direct and indirect regulation by determin-ing the cascade of post-OpaR gene control. Furthermore, weemphasize that these studies provide only a snapshot of RNAabundance profiles at a particular time and under specificconditions (growth on a surface); moreover, the particularstrain with which this work was done, BB22, is not the se-quenced strain whose genome information was used to derivethe GeneChip. Thus, new OpaR-controlled genes are certainlyyet to be discovered.

Phase shifting and variable colony morphology are not pe-culiarities of strain BB22, (53). Swarming proficiency seems adominant phenotype of the V. parahaemolyticus strains thathave been studied. For example, Baumann et al. reported that125 out of 132 strains collected throughout the world that wereisolated variously from infected gastrointestinal systems, sea-food, and seawater produced lateral flagella (3). In our smallcollection of environmental and clinical V. parahaemolyticusstrains, 18 of 22 are swarming proficient. Accordingly, we pre-dict that quorum silencing is a general phenomenon found formany V. parahaemolyticus strains. Consistent with this hypoth-esis, ectopic expression of opaR in some of our various swarm-ing-proficient strains converted about half to a more opaqueand swarming defective phenotype; furthermore, the introduc-tion of an opaR deletion into the well-studied first sequencedstrain RIMD2210633, isolated in Japan from a patient withtraveler’s diarrhea (37), had no effect on colony opacity,swarming, or cytotoxicity (data not shown). Whether theseobserved frequencies of the prevalence of the translucent phe-notype are the consequence of isolation biases or are a truereflection of the distribution of the morphotypes in nature is

not known and will be interesting to learn—as will the molec-ular basis for the swarming permissiveness of a variety of iso-lates. Sequence gazing at the few V. parahaemolyticus strainswhose genomes have been sequenced suggests some variabilityin the coding region for luxO; comparative analysis of the opaRlocus is more difficult, since the majority of the silencing mu-tations that we have found for strain BB22 occur in the pro-moter rather than the coding region. This is probably becausethere is a sequence repeat in this region.

We emphasize that OP/TR phase variation is also not apeculiarity of this species. Reversible switching in colony mor-phology has long been reported for other Vibrio species (67).In many cases, the variation in colony opacity is a consequenceof the amount of extracellular polysaccharide produced. Theencapsulated opaque strains of V. vulnificus are the more vir-ulent form of the organism (56, 69, 70, 75). Interestingly, high-frequency opacity shifting is observed for V. vulnificus duringoyster infections (58). Non-O1 V. cholerae strains produce in-terconverting OP and TR types, and the encapsulated OP formalso displays increased virulence (31). In many cases, V. chol-erae strains have been shown to have alterations in the quo-rum-sensing cascade. For example, some V. cholerae strainscontain mutations in the coding region of hapR, while otherstrains have been found to harbor a variety of constitutive luxOalleles (17, 23, 30, 52, 62). For each Vibrio species, there maybe a particular balance in the benefits conferred by the abilityor inability to sense and communicate. Quorum silencing maybe particularly favored in V. parahaemolyticus due to the cou-pling of the asocial phenotype with robust surface motility,which seems a highly powerful driving force for cell type;however, certain advantages of sociability must help preservethe reversible switching mechanism.

ACKNOWLEDGMENTS

We thank Sandford Jaques for constructing the luxO and opaRalleles, David Weiss and Ryan Kustusch for help with the microarraydata collection, Patrick Breheny for designing the analysis of the mi-croarray data, Jessica King for sequencing and cloning luxOU, and EricRansom for developing the chitin transformation protocol. We alsothank the University of Iowa Carver College of Medicine DNA CoreFacility and the Mass Spectrometry Facility at Michigan State Univer-sity for the expert resources provided.

This work was supported by NIH grant 5 R21 AI065526, NSF grant0817593, and a Medical Research Initiative Grant from the CarverCollege of Medicine. C.G.-P. was supported by NIH Training Grant 5T32 GM077973, “Statistics in Microbiology, Infectious Diseases &Bioinformatics.”

REFERENCES

1. Antunes, L. C., R. B. Ferreira, M. M. Buckner, and B. B. Finlay. 2010.Quorum sensing in bacterial virulence. Microbiology 156:2271–2282.

2. Austin, B. 2010. Vibrios as causal agents of zoonoses. Vet. Microbiol. 140:310–317.

3. Baumann, P., L. Baumann, and J. L. Reichelt. 1973. Taxonomy of marinebacteria: Beneckea parahaemolytica and Beneckea alginolytica. J. Bacteriol.113:1144–1155.

4. Belas, R., et al. 1982. Bacterial bioluminescence: isolation and expression ofthe luciferase genes from Vibrio harveyi. Science 218:791–793.

5. Belas, R., M. Simon, and M. Silverman. 1986. Regulation of lateral flagellagene transcription in Vibrio parahaemolyticus. J. Bacteriol. 167:210–218.

6. Benjamini, Y., and Y. Hochberg. 1995. Controlling the false discovery rate:a practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B(Methodological) 157:289–300.

7. Berger, L. R., and D. M. Reynolds. 1958. The chitinase system of a strain ofStreptomyces griseus. Biochim. Biophys. Acta 29:522–534.

8. Boles, B. R., and L. L. McCarter. 2000. Insertional inactivation of genesencoding components of the sodium-type flagellar motor and switch of Vibrioparahaemolyticus. J. Bacteriol. 182:1035–1045.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

9. Broberg, C. A., L. Zhang, H. Gonzalez, M. A. Laskowski-Arce, and K. Orth.2010. A Vibrio effector protein is an inositol phosphatase and disrupts hostcell membrane integrity. Science 329:1660–1662.

10. Croxatto, A., et al. 2002. VanT, a homologue of Vibrio harveyi LuxR, regu-lates serine, metalloprotease, pigment, and biofilm production in Vibrioanguillarum. J. Bacteriol. 184:1617–1629.

11. Daniels, R., J. Vanderleyden, and J. Michiels. 2004. Quorum sensing andswarming migration in bacteria. FEMS Microbiol. Rev. 28:261–289.

12. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. U. S. A. 97:6640–6645.

13. Enos-Berlage, J. L., Z. T. Guvener, C. E. Keenan, and L. L. McCarter. 2005.Genetic determinants of biofilm development of opaque and translucentVibrio parahaemolyticus. Mol. Microbiol. 55:1160–1182.

14. Enos-Berlage, J. L., and L. L. McCarter. 2000. Relation of capsular poly-saccharide production and colonial cell organization to colony morphologyin Vibrio parahaemolyticus. J. Bacteriol. 182:5513–5520.

15. Ferreira, R. B., L. C. Antunes, E. P. Greenberg, and L. L. McCarter. 2008.Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation ofgene expression relevant to growth on surfaces. J. Bacteriol. 190:851–860.

16. Fidopiastis, P. M., C. M. Miyamoto, M. G. Jobling, E. A. Meighen, and E. G.Ruby. 2002. LitR, a new transcriptional activator in Vibrio fischeri, regulatesluminescence and symbiotic light organ colonization. Mol. Microbiol. 45:131–143.

17. Freeman, J. A., and B. L. Bassler. 1999. A genetic analysis of the function ofLuxO, a two-component response regulator involved in quorum sensing inVibrio harveyi. Mol. Microbiol. 31:665–677.

18. Gentleman, R., et al. 2004. Bioconductor: open software development forcomputational biology and bioinformatics. Genome Biol. 5:R80.

19. Gode-Potratz, C. J., D. M. Chodur, and L. L. McCarter. 2010. Calcium andiron regulate swarming and type III secretion in Vibrio parahaemolyticus. J.Bacteriol. 192:6025–6038.

20. Gode-Potratz, C. J., R. J. Kustusch, P. J. Breheny, D. S. Weiss, and L. L.McCarter. 2011. Surface sensing in Vibrio parahaemolyticus triggers a pro-gramme of gene expression that promotes colonization and virulence. Mol.Microbiol. 79:240–263.

21. Guvener, Z. T., and L. L. McCarter. 2003. Multiple regulators control cap-sular polysaccharide production in Vibrio parahaemolyticus. J. Bacteriol. 185:5431–5441.

22. Hammer, B. K., and B. L. Bassler. 2003. Quorum sensing controls biofilmformation in Vibrio cholerae. Mol. Microbiol. 50:101–104.

23. Hammer, B. K., and B. L. Bassler. 2007. Regulatory small RNAs circumventthe conventional quorum sensing pathway in pandemic Vibrio cholerae. Proc.Natl. Acad. Sci. U. S. A. 104:11145–11149.

24. Hasegawa, H., and C. C. Hase. 2009. TetR-type transcriptional regulatorVtpR functions as a global regulator in Vibrio tubiashii. Appl. Environ.Microbiol. 75:7602–7609.

25. Hengge, R. 2009. Principles of c-di-GMP signalling in bacteria. Nat. Rev.Microbiol. 7:263–273.

26. Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type IIIsecretion in Vibrio harveyi and Vibrio parahaemolyticus. J. Bacteriol. 186:3794–3805.

27. Hiyoshi, H., T. Kodama, T. Iida, and T. Honda. 2010. Contribution of Vibrioparahaemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethal-ity in mice. Infect. Immun. 78:1772–1780.

28. Jaques, S., and L. L. McCarter. 2006. Three new regulators of swarming inVibrio parahaemolyticus. J. Bacteriol. 188:2625–2635.

29. Jobling, M. G., and R. K. Holmes. 1997. Characterization of hapR, a positiveregulator of the Vibrio cholerae HA/protease gene hap, and its identificationas a functional homologue of the Vibrio harveyi luxR gene. Mol. Microbiol.26:1023–1034.

30. Joelsson, A., Z. Liu, and J. Zhu. 2006. Genetic and phenotypic diversity ofquorum-sensing systems in clinical and environmental isolates of Vibrio chol-erae. Infect. Immun. 74:1141–1147.

31. Johnson, J. A., P. Panigrahi, and J. G. Morris, Jr. 1992. Non-O1 Vibriocholerae NRT36S produces a polysaccharide capsule that determines colonymorphology, serum resistance, and virulence in mice. Infect. Immun. 60:864–869.

32. Joseph, S. W., R. R. Colwell, and J. B. Kaper. 1982. Vibrio parahaemolyticusand related halophilic vibrios. Crit. Rev. Microbiol. 10:77–124.

33. Kaneko, T., and R. R. Colwell. 1973. Ecology of Vibrio parahaemolyticus inChesapeake Bay. J. Bacteriol. 113:24–32.

34. Kovacikova, G., and K. Skorupski. 2002. Regulation of virulence gene ex-pression in Vibrio cholerae by quorum sensing: HapR functions at the aphApromoter. Mol. Microbiol. 46:1135–1147.

35. Lee, D. H., et al. 2008. A consensus sequence for binding of SmcR, a Vibriovulnificus LuxR homologue, and genome-wide identification of the SmcRregulon. J. Biol. Chem. 283:23610–23618.

36. Lenz, D. H., M. B. Miller, J. Zhu, R. V. Kulkarni, and B. L. Bassler. 2005.CsrA and three redundant small RNAs regulate quorum sensing in Vibriocholerae. Mol. Microbiol. 58:1186–1202.

37. Makino, K., et al. 2003. Genome sequence of Vibrio parahaemolyticus: apathogenic mechanism distinct from that of V. cholerae. Lancet 361:743–749.

38. Manoil, C., and J. Bailey. 1997. A simple screen for permissive sites inproteins: analysis of Escherichia coli lac permease. J. Mol. Biol. 267:250–263.

39. McCarter, L. 1999. The multiple identities of Vibrio parahaemolyticus. J.Mol. Microbiol. Biotechnol. 1:51–57.

40. McCarter, L. L. 1998. OpaR, a homolog of Vibrio harveyi LuxR, controlsopacity of Vibrio parahaemolyticus. J. Bacteriol. 180:3166–3173.

41. McCarter, L. L., and M. E. Wright. 1993. Identification of genes encodingcomponents of the swarmer cell flagellar motor and propeller and a sigmafactor controlling differentiation of Vibrio parahaemolyticus. J. Bacteriol.175:3361–3371.

42. McDougald, D., S. A. Rice, and S. Kjelleberg. 2000. The marine pathogenVibrio vulnificus encodes a putative homologue of the Vibrio harveyi regula-tory gene, luxR: a genetic and phylogenetic comparison. Gene 248:213–221.

43. McLaughlin, J. B., et al. 2005. Outbreak of Vibrio parahaemolyticus gastro-enteritis associated with Alaskan oysters. N. Engl. J. Med. 353:1463–1470.

44. Meibom, K. L., M. Blokesch, N. A. Dolganov, C. Y. Wu, and G. K. Schoolnik.2005. Chitin induces natural competence in Vibrio cholerae. Science 310:1824–1827.

45. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

46. Milton, D. L. 2006. Quorum sensing in vibrios: complexity for diversification.Int. J. Med. Microbiol. 296:61–71.

47. Nair, G. B., et al. 2007. Global dissemination of Vibrio parahaemolyticusserotype O3:K6 and its serovariants. Clin. Microbiol. Rev. 20:39–48.

48. Ng, W. L., and B. L. Bassler. 2009. Bacterial quorum-sensing networkarchitectures. Annu. Rev. Genet. 43:197–222.

49. Park, K. S., et al. 2004. Functional characterization of two type III secretionsystems of Vibrio parahaemolyticus. Infect. Immun. 72:6659–6665.

50. Parker, C. T., and V. Sperandio. 2009. Cell-to-cell signalling during patho-genesis. Cell. Microbiol. 11:363–369.

51. Putnam, S. L., and A. L. Koch. 1975. Complications in the simplest cellularenzyme assay: lysis of Escherichia coli for the assay of beta-galactosidase.Anal. Biochem. 63:350–360.

52. Raychaudhuri, S., V. Jain, and M. Dongre. 2006. Identification of a consti-tutively active variant of LuxO that affects production of HA/protease andbiofilm development in a non-O1, non-O139 Vibrio cholerae O110. Gene369:126–133.

53. Sakazaki, R., S. Iwanami, and H. Fukumi. 1963. Studies on the enteropatho-genic, facultatively halophilic bacteria, Vibrio parahaemolyticus. I. Morpho-logical, cultural and biochemical properties and its taxonomical position.Jpn. J. Med. Sci. Biol. 16:161–188.

54. Schweizer, H. D. 1993. Small broad-host-range gentamycin resistance genecassettes for site-specific insertion and deletion mutagenesis. Biotechniques15:831–834.

55. Showalter, R. E., M. O. Martin, and M. R. Silverman. 1990. Cloning andnucleotide sequence of luxR, a regulatory gene controlling bioluminescencein Vibrio harveyi. J. Bacteriol. 172:2946–2954.

56. Simpson, L. M., V. K. White, S. F. Zane, and J. D. Oliver. 1987. Correlationbetween virulence and colony morphology in Vibrio vulnificus. Infect. Im-mun. 55:269–272.

57. Spangler, C., A. Bohm, U. Jenal, R. Seifert, and V. Kaever. 2010. A liquidchromatography-coupled tandem mass spectrometry method for quantita-tion of cyclic di-GMP. J. Microbiol. Methods 81:226–231.

58. Srivastava, M., M. S. Tucker, P. A. Gulig, and A. C. Wright. 2009. Phasevariation, capsular polysaccharide, pilus and flagella contribute to uptake ofVibrio vulnificus by the Eastern oyster (Crassostrea virginica). Environ. Mi-crobiol. 11:1934–1944.

59. Stewart, B. J., and L. L. McCarter. 2003. Lateral flagellar gene system ofVibrio parahaemolyticus. J. Bacteriol. 185:4508–4518.

60. Su, Y. C., and C. Liu. 2007. Vibrio parahaemolyticus: a concern of seafoodsafety. Food Microbiol. 24:549–558.

61. Tsou, A. M., and J. Zhu. 2010. Quorum sensing negatively regulates hemo-lysin transcriptionally and posttranslationally in Vibrio cholerae. Infect. Im-mun. 78:461–467.

62. Vance, R. E., J. Zhu, and J. J. Mekalanos. 2003. A constitutively activevariant of the quorum-sensing regulator LuxO affects protease productionand biofilm formation in Vibrio cholerae. Infect. Immun. 71:2571–2576.

63. Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: cell-to-cell com-munication in bacteria. Annu. Rev. Cell Dev. Biol. 21:319–346.

64. Waters, C. M., and B. L. Bassler. 2006. The Vibrio harveyi quorum-sensingsystem uses shared regulatory components to discriminate between multipleautoinducers. Genes Dev. 20:2754–2767.

65. Waters, C. M., W. Lu, J. D. Rabinowitz, and B. L. Bassler. 2008. Quorumsensing controls biofilm formation in Vibrio cholerae through modulation ofcyclic di-GMP levels and repression of vpsT. J. Bacteriol. 190:2527–2536.

66. Waters, C. M., J. T. Wu, M. E. Ramsey, R. C. Harris, and B. L. Bassler. 2010.Control of the type 3 secretion system in Vibrio harveyi by quorum sensingthrough repression of ExsA. Appl. Environ. Microbiol. 76:4996–5004.

67. White, P. B. 1938. The rugose variant of vibrios. J. Pathol, Bacteriol. 46:1–6.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

68. Woo, T. H. S., A. F. Cheng, and J. M. Ling. 1992. An application of a simplemethod for the preparation of bacterial DNA. Biotechniques 13:696.

69. Wright, A. C., et al. 1999. Differential expression of Vibrio vulnificus capsularpolysaccharide. Infect. Immun. 67:2250–2257.

70. Wright, A. C., L. M. Simpson, J. D. Oliver, and J. G. Morris. 1990. Pheno-typic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect.Immun. 58:1769–1773.

71. Wu, Z., R. Irizarry, R. Gentleman, F. Martinez-Murillo, and F. Spencer.2004. A model-based background adjustment for oligonucleotide expressionarrays. J. Am. Stat. Assoc. 99:909–917.

72. Yeung, P. S., and K. J. Boor. 2004. Epidemiology, pathogenesis, and pre-vention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathog.Dis. 1:74–88.

73. Yildiz, F. H., X. S. Liu, A. Heydorn, and G. K. Schoolnik. 2004. Molecular

analysis of rugosity in a Vibrio cholerae O1 El Tor phase variant. Mol.Microbiol. 53:497–515.

74. Yildiz, F. H., and K. L. Visick. 2009. Vibrio biofilms: so much the same yetso different. Trends Microbiol. 17:109–118.

75. Yoshida, S. I., M. Ogawa, and Y. Mizuguchi. 1985. Relation of capsularmaterials and colony opacity to virulence of Vibrio vulnificus. Infect. Immun.47:446–451.

76. Zheng, J., O. S. Shin, D. E. Cameron, and J. J. Mekalanos. 2010. Quorumsensing and a global regulator TsrA control expression of type VI secretionand virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 107:21128–21133.

77. Zhu, J., and J. J. Mekalanos. 2003. Quorum sensing-dependent biofilmsenhance colonization in Vibrio cholerae. Dev. Cell 5:647–656.

78. Zhu, J., et al. 2002. Quorum-sensing regulators control virulence gene ex-pression in Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 99:3129–3134.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

Documents

Quorum Sensing and Silencing in Vibrio parahaemolyticus · Quorum Sensing and Silencing in Vibrio parahaemolyticus † Cindy J. Gode-Potratz and Linda L. McCarter* Microbiology Department,