Cell Reports, Volume 19

Supplemental Information

Purine Nucleotide Availability Regulates

mTORC1 Activity through the Rheb GTPase

Natasha Emmanuel, Shoba Ragunathan, Qin Shan, FangWang, Andreas Giannakou, NanniHuser, Guixian Jin, Jeremy Myers, Robert T. Abraham, and Keziban Unsal-Kacmaz

Figure S1. Rescue Experiments with Purine and Pyrimidine Metabolites. Related to Figure 1.

(A) Schematic of de novo and salvage pathways of purine biosynthesis.

(B-C) Proliferation assay of A549 cells treated for 4 days with (B) PTX or (C) AG2037 in dialyzed medium

(dFBS) supplemented with AICA (320 µM), thymidine (5.6 µM), or hypoxanthine (32 µM). Data points

represent mean ± SD of triplicate samples.

(D) A549 cell proliferation using live cell quantitative IncuCyte imaging over a period of 70 hrs. Cells were

treated with 150 nM AG2037 or 500 nM PTX in non-dialyzed medium (FBS) supplemented with

hypoxanthine, thymidine, or both bases. Kinetic growth curves were generated using the IncuCyte integrated

confluence algorithm.

B

C

D

SUPPLEMENTAL FIGURES

A

B

C DMSO AG2037 PTX

D

Figure S2. DNA Damage Induction by Purine Biosynthesis Inhibitors. Related to Figure 1.

(A) A panel of NSCLC cell lines was treated overnight with DMSO, 1 μM AG2037, or 1 μM PTX and analyzed

for the expression of p-Chk1 and p-Cdc2.

(B) NCI-H460 and NCI-H157 cells were treated overnight with AG2037 (0.010 - 1 μM) and PTX (0.1 to 9 μM).

Arrows indicate the drug concentration that triggered maximal induction of Chk1 phosphorylation.

(C) DNA damage was measured with a comet assay in NCI-H460 cells treated for 24 h with 150 nM AG2037 or

500 nM PTX.

(D) Quantitation of (C) in 80 cells.

A

Figure S3. Time-Dependent Activation of mTORC1. Related to Figure 3.

A427 cells were treated with 150 nM AG2037, 500 nM PTX, or 500 nM AVN-944 for the

indicated times, and were immunoblotted with the indicated antibodies.

A

B

C

Figure S4. Effect of AG2037 on Pyrimidine and Protein Biosynthesis. Related to Figure 4.

(A) A427 cells were treated with 150 nM AG2037 and 500 nM AVN-944 overnight in the presence of

medium (M), or medium supplemented with adenine (A) or guanine (G).

(B) Cells were treated overnight with AG2037 (500 nM HEK293T, 100 nM A549), CCI-779 (100 nM

HEK293T, 30 nM A549) and WYE-132 (500 nM HEK293T, 100 nM A549).

(C) HEK293T cells were treated as in (B) and extracts were precipitated with m7GTP-conjugated beads.

A

B

Figure S5. Effects of Drugs on AMPK Activation. Related to Figure 5.

(A) A427 cells were treated as in Figure 1A and lysates were analyzed for the indicated proteins.

(B) A427 cells were treated as in Figure 3C and lysates were analyzed for the indicated proteins.

Relative levels of AMP, ATP and AMP:ATP ratio compare to controls are represented below.

Figure S6. Effects of AG2037 and PTX on Activities of Ras and Rac1 GTPases. Related to Figure 5.

(A) Cells treated as in Figure 1A, and lysates were analyzed for phosphorylation of S6RP and ERK1/2.

(B) A427 cells were treated as in Figure S4 and analyzed for p-S6RP and p-ERK1/2.

(C) A549 cells were treated overnight with 100 nM AG2037 or 100 nM PF-05212384. Rac1-GTP was

precipitated from cellular extracts and immunoblotted with α-Rac1 antibody. Samples incubated with GTPgS

or GDP were used as positive and negative controls, respectively. Graph depicts densitometry quantification of

active Rac1 relative to total Rac1 from 3 independent experiments ± SD.

(D) A549 cells were treated overnight with 100 nM AG2037. Ras-GTP was precipitated from cellular extracts

and immunoblotted with α-Ras antibody. Samples incubated with GTPgS or GDP were used as positive and

negative controls, respectively. Graph depicts densitometry quantification of active Ras relative to total Ras

from 3 independent experiments ± SD.

A

B

C

D M S O A G 2 0 3 7 P F -3 8 4

0 .0

0 .5

1 .0

1 .5

Ac

tiv

e-R

ac

1/

To

tal

Ra

c1

D

A Intracellular Rheb processing

B

20160505_PTMProteomics_1007_DMSO-AA_Q-E_r1 #44442-44558 RT: 175.88-176.43 AV: 78 NL: 8.93E4T: FTMS + c NSI Full ms [350.00-1450.00]

498.0 498.5 499.0 499.5 500.0 500.5 501.0 501.5 502.0 502.5 503.0 503.5 504.0

m/z

0

10

20

30

40

50

60

70

80

90

100

Rel

ativ

e Abu

ndan

ce

500.2799

502.2652

501.2832

503.1077

20160505_PTMProteomics_1007_SSC-farnesyl-std_Q-E_r1 #31665-31781 RT: 174.59-175.04 AV: 20 NL: 2.02E7T: FTMS + c NSI Full ms [450.00-550.00]

498.0 498.5 499.0 499.5 500.0 500.5 501.0 501.5 502.0 502.5 503.0 503.5 504.0

m/z

0

10

20

30

40

50

60

70

80

90

100

Rel

ativ

e Abu

ndan

ce

500.2814

501.2779

502.2749

20160505_PTMProteomics_1007_GART_Q-E_r2_160518030932 #3654-3839 RT: 28.52-29.67 AV: 181 NL: 4.17E5T: FTMS + c NSI Full ms [350.00-1100.00]

668.0 668.5 669.0 669.5 670.0 670.5 671.0 671.5 672.0 672.5 673.0 673.5 674.0

m/z

0

10

20

30

40

50

60

70

80

90

100

Rel

ativ

e Abu

ndan

ce

670.2542

671.2572

672.2525

Retention time = 28.9 min

Mass accuracy = 1 ppm

Retention time = 174.8 min

Mass accuracy = 5 ppm

Retention time = 175.6 min

Mass accuracy = 2 ppm C 20160505_PTMProteomics_1007_SSC-farnesyl-std_Q-E_r1 #31702 RT: 174.75 AV: 1 NL: 1.35E7T: FTMS + c NSI d Full ms2 500.28@hcd25.00 [50.00-530.00]

50 100 150 200 250 300 350 400 450 500

m/z

0

10

20

30

40

50

60

70

80

90

100

Rel

ativ

e Abu

ndan

ce

175.07

147.08

81.07

209.06278.08 296.0995.09 122.03

260.0760.05 205.20

Peptide fragmentation

SSC(Farnesyl)–synthetic

peptide standard

20160505_PTMProteomics_1007_DMSO-AA_Q-E_r2_160603031436 #41832 RT: 174.40 AV: 1 NL: 9.17E3T: FTMS + c NSI d Full ms2 500.28@hcd25.00 [50.00-530.00]

50 100 150 200 250 300 350 400 450 500

m/z

0

10

20

30

40

50

60

70

80

90

100

Rel

ativ

e Abu

ndan

ce

175.07

147.08

81.07

209.0695.09

296.09123.12 260.07399.19335.11

Peptide fragmentation

SSC(Farnesyl)– from myc-Rheb

purified from DMSO treatment

SSC(Farnesyl) peptide observed fragmentation

Figure S7. Mass Spectrometric Analysis of Rheb Lipidation. Related to Figure 5.

(A) Schematic showing the intracellular Rheb processing by Rce1 (Ras and a-factor converting enzyme 1)

and Icmt (Isoprenylcysteine carboxyl methyltransferase) (left) and the sample processing of non-

farnesylated Rheb before and after cysteine reduction by dithiothreitol and idoacetamide alkylation (right).

Measured metabolites are highlighted.

(B) Peptide precursor extraction ion chromatogram for non-farnesylated Rheb, synthetic SSC(Farnesyl)

standard, and SSC(Farnesyl) from indicated samples. Confirmatory liquid chromatography retention times

and mass accuracy measurements are shown, along with the observed precursor ion.

(C) Peptide fragmentograms (MS/MS spectra) from synthetic SSC(Farnesyl) standard (top) and

SSC(Farnesyl) of myc-Rheb from DMSO treatment (bottom).

(D) Schematic showing derivation of peptide fragments from SSC(Farnesyl) peptide.

Sample processing of

non-farnesylated Rheb

SSC(Farnesyl)

SSC(Carbamidomethyl)SVM

D

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Cell culture

NSCLC cell lines were obtained from our in-house tissue culture cell bank (original source was ATCC). All cell line

stocks were routinely tested for mycoplasma. The NSCLC cell lines A549, A427, NCI-H460, NCI-H1975, and

Calu-3 were maintained in RPMI-1640 (Gibco 11875-093) supplemented with penicillin/streptomycin and 10% fetal

bovine serum (FBS; Gibco 16000-044) at 37oC in a humidified 95% air; 5% CO2 atmosphere. The HEK293T and

HeLa cell lines were maintained in Dulbecco’s modified Eagle’s media (DMEM; Gibco 11995-065) supplemented

with 10% FBS. TSC1 deficient (TSC1-/-

) and wild-type (TSC1+/+

) mouse embryonic fibroblast cell lines (MEFs)

(kindly provided by David Kwiatkowski, Harvard University, Boston) were cultured in RPMI with 10% FBS. For

amino acid stimulation experiments, cells were starved for 2 h in medium lacking amino acids (US Biologicals

R9010-01), followed by readdition of 2X amino acids (Sigma R7131) and 1X Glutamine (Gibco 25030-081) for 30

min. For insulin stimulation experiments, cells were starved for 16 h in serum-free medium in the presence of drug,

and stimulated with 100 nM insulin (Sigma I9278) for 30 min. For rescue experiments, cells were treated with

adenine or guanine (Sigma A2786, G6779) at 30 μM in 10% FBS; or 30 μM hypoxanthine, 5.6 thymidine μM, or

320 μM AICA (Sigma H9377, A2786 and 164968) in 10% dialyzed FBS (Gibco 26400-044) or in non-dialyzed

FBS (for IncuCyte experiment) at the indicated concentrations for the duration of drug treatment.

AG2037, PF-05212384, CCI-779 and WYE-125132 were synthesized at Pfizer. AVN-944 was purchased from

ChemieTek. MPA and FTI-277 were obtained from Sigma. IC50 calculations for determination of the anti-

proliferative potencies of the drugs were based on 4 d proliferation assays with 9-point dose titrations for each drug

and cell line. Three times the IC50 concentrations of drugs were used in all experiments except in cells transfected

with ectopic Rheb. Optimal seeding densities were established for each cell line to achieve 75-85% confluence at the

end of the assay. At the endpoint, cells were fixed in 10% TCA and stained with the colorimetric dye

sulforhodamine B (Sigma S9012) to determine cytotoxicity. Cell growth was also assessed using live cell imaging

with IncuCyte Zoom (Essen Biosciences). IC50 values were calculated in Prism using a four-parameter (variable

slope) dose-response algorithm (GraphPad Software).

Immunoblotting

Cells were rinsed in cold PBS and lysed in lysis buffer (50 mM TrisHCl pH 7.5, 150 mM sodium chloride, 1%

Triton-X, 20 % glycerol) supplemented with protease (Sigma P8340) and phosphatase inhibitors (Sigma P5726,

P0044). Lysates were cleared of insoluble material by centrifuging at 20,000 g for 10 min at 4°C and protein

concentration was determined with the BCA Protein Assay (Thermo Scientific 23225). For immunoblotting 5 µg of

protein in equal volumes were heated in Laemmli SDS-sample buffer containing DTT for 5 min at 95°C. Samples

were centrifuged at 20,000 g, separated by SDS-PAGE electrophoresis in 4-12% Bis-Tris gels, and transferred to

nitrocellulose membranes. Primary antibodies and dilutions used for immunoblotting are as follows: p-S6RP

S235/36 (CST 4856, 1:1000), S6RP (CST 2217, 1:1000), p-S6K1 T389 (CST 9205, 1:1000), S6K1 (CST 2708,

1:1000), p-Akt S473 (CST 9271, 1:1000), Akt (CST 9272, 1:1000), p-Chk1 S345 (CST 2348, 1:1000), Chk1 (CST

2360, 1:1000), p-Cdc2 Y15 (CST 9111, 1:1000), Cdc2 (CST 9116, 1:1000), p-CAD S1859 (CST 12662, 1:1000),

CAD (CST 11933, 1:1000), p-4EBP1 T37/46 (CST, 9459 1:1000), 4EBP1 (CST, 9452), Rheb (CST 13879, 1:500),

p-ERK1/2 T202/Y204 (CST 4377, 1:1000), ERK1/2 (CST 4695, 1:1000), p-AMPK T172 (CST, 2535 1:1000)

AMPK (CST, 2532 1:1000), , p-Raptor S792 (CST, 2083 1:1000), Raptor (CST, 2280 1:1000), p-TSC2 S1387

(CST, 5584 1:1000), p-TSC2 T1462 (CST, 3611 1:1000), TSC2 (CST, 3635 1:1000), eIF4E (CST, 9742 1:1000),

eIF4A (CST, 2425 1:1000), eIF4G (CST, 2498 1:1000), LAMP1 (CST, 9091 1:1000), GART (Proteintech, 13659

1:500), Myc (Santa Cruz, 47694 1:200), Flag (Sigma, F1804 1:1000), mCherry (Abcam, 167453 1:1000), and

Vinculin (Sigma, V9131 1:3000).

Immunofluorescence microscopy

HeLa cells were cultured at 4 x 104 cells per well (50% confluency) in 8-well chambered coverglass slides (Thermo

Fisher, 155409) in the presence or absence of 500 nM AG2037. Following attachment, cells were washed twice with

Hank’s balanced salt solution plus calcium and magnesium (HBSS+; Gibco 14025-092) and then cultured for 16 h

in serum-free medium. Cells were stimulated with 100 nM insulin for 30 min, washed once in HBSS+, fixed and

permeabilized using the FIX & PERM® kit (Thermo Fisher, GAS004). Slides were blocked for 1 h in HBSS+

supplemented with 3% bovine serum albumin (BSA) at room temperature, and then incubated in primary antibody

diluted in blocking buffer overnight at 4°C. Slides were washed three times for 5 min in HBSS+, incubated for 1 h

in secondary antibody diluted in blocking buffer in the dark at room temperature, and washed three times in HBSS+

prior to imaging. Primary antibody staining was performed with TSC2- (CST 4308, 1:800), LAMP1- (Abcam,

256030 1:150) and mTOR- (CST, 2972 1:200) specific antibodies. Fluorophore -conjugated secondary Alexa-488

(Life Technologies, A21206) and Alexa-546 (Life Technologies, A10036) were used at 1:500.

All confocal mages were acquired with an LSM 710 confocal laser microscope (Zeiss) with a Plan-Apochromat

63x/1.4 oil immersion objective. Both red and green channels were set to 1 Airy unit, with pixel depth of 12-bit,

scan speed of 6, and line averaging of 2. Each optical slice was set to 0.38 µm thickness and images were acquired

at a resolution of 2,048 x 2,048 pixels. For each condition, images of 5 representative fields were captured and

analyzed. Colocalization analysis was performed using Volocity 6.3 (PerkinElmer) software. Threshold intensities

were set to exclude the background of each individual field. Pearson’s correlation coefficients and colocalization

percentages (determined by Mander’s colocalization coefficient) were calculated for each field on a maximum

intensity projection image of the z-stacks (8 contiguous focal planes). Identical acquisition settings were used for all

images.

Cell cycle analysis

Cells were treated with drugs at the indicated concentrations and times, trypsinized, washed in PBS, fixed in 70%

ethanol, and stained with Propidium Iodide/RNase Staining Buffer (BD Biosciences 550825). Individual cells were

characterized for forward and side scatter and DNA content was determined in 10,000 cells as measured by flow

cytometry (FACS; excitation at 488 nm, emission measured using 600 nm bandpass filter) with a FACSCaliber flow

cytometer (BD Biosciences). Histograms and cell counts were generated using FlowJo X software.

Gene silencing

The doxycycline inducible shRNA lentiviral constructs and the packaged viruses were purchased from Cellecta

(Mountain View, CA). shRNAs targeting GARFT were cloned into the doxycycline inducible pRSITEP-U6Tet-(sh)-

EF1-TetRep-2A-Puro lentivector backbone. Target sequences used were sh337:CAGGGAGGAAGGGAACATACT

and sh4907: GCACAGTCTCATCATGTCAAA. Cells were infected with viral particles in the presence of 8 µg/mL

polybrene for 48 h prior to selection with 1.5 µg/mL puromycin for 5 days. shRNAs were induced by treating cells

with 0.25 µg/mL doxycycline for 2 days.

DNA constructs

The following plasmids were purchased from Genecopoeia: pReceiver-Lv107-Myc-Rheb (Cat # EX-A0963-Lv107),

pReceiver-Lv101-Flag-RagB (Cat# EX-Z0443-Lv101) and pReceiver-Lv111-mCherry-RagC (Cat# EX-W0895-

Lv111). The constitutively active mutants Rheb-Q64L, RagB-Q99L and RagC-S75L; the non-farnesylated mutant

Rheb-C181S; and the nucleotide-free mutant Rheb-S20N were generated using Stratagene Quickchange

mutagenesis kit (Stratagene) according to the manufacturer’s instructions. All mutations were confirmed by Sanger

sequencing. Transfections were performed in HEK293T cells using Fugene 6 (Promega) according to the

manufacturer instructions. For Figure 5A, cells were transfected with 1 µg of constitutively active mutants Rheb-

Q64L, RagB-Q99L or RagC-S75L. For Figure 5G, cells were transfected with 100 ng each of wild-type Rheb and

Rheb-C181S plasmids, or 1 µg Rheb-S20N plasmids. Due to the instability of the Rheb-S20N protein product, we

increased the transfection amount of the Rheb-S20N construct by 10-fold to obtain protein levels similar to wild-

type Rheb and Rheb-C181S.

Metabolomic analysis

For cellular metabolic profiling, cells were evenly seeded in 6-well plates in triplicate. After drug treatments, the cell

culture medium was removed from plates and cells were washed twice with LCMS-grade ice-cold water. The cell

culture plates were stored at -80 oC until analysis (within three days). Metabolites were extracted from cells with

0.25 mL of cold organic extraction buffer (40/40/20 mixture of acetonitrile/methanol /water) for 15 min on ice. 10 μl

of 2 μM iso-ATP and 5-fluoro-2-methylpyridine (injection standards) were added to the extracts, and the resulting

solutions were centrifuged at 16,000 g at 4oC for 12 min. Three liquid chromatography-multiple reaction monitoring

(LC-MRM) methods were used for analysis of 175 metabolites: (1) A Phenomenex Synergi Polar-RP 75x2.0 mm

column coupled with AB SCIEX 4000 QTRAP mass spectrometer in the negative ionization mode, with mobile

phase A of 97%/3% water/methanol containing 10 mM tributylamine ion pairing agent and 3 mM acetic acid, and

mobile phase B of methanol was used at a flow rate of 0.3 mL/min and column oven temperature of 30oC. The

following gradient was used: 0-1 min: 10% B, 1-15 min 10-50% B, 15-15.5 min 50-95%B, 15.5-18.5 min 95% B,

18.5-19 min 95-10% B, and 19-25 min 10% B. (2) An Imtakt Scherzo SM-C18 150 × 2.0 mm column coupled with

AB SCIEX API4000 mass spectrometer in the positive ionization mode, with mobile phase A of water containing

0.1% formic acid and mobile phase B of acetonitrile containing 0.1% formic acid, was used at the flow rate of

0.3 ml/min and column oven temperature of 30 °C. The following gradient was used: 0–6 min 0% solvent B, 6–

16 min 50% solvent B, 16–18 min 50–100% solvent B, 18–20 min 100% solvent B, 20–20.5 min 100–0% solvent B

and 20.5–30 min 0% solvent B. (3) An Imtakt Unison UK-Phenyl 75 × 2.0 mm column coupled with AB SCIEX

API4000 mass spectrometer in the negative ionization mode, with mobile phase A of water containing 0.1% formic

acid and mobile phase B of acetonitrile containing 0.1% formic acid, was used at flow rate of 0.3 ml/min and column

oven temperature of 30 °C. The following gradient was used: 0–4 min 0% solvent B, 4–5 min 0–100% solvent B, 5–

8 min 100% solvent B, 8–9 min 100–0% B and 9–15 min 0% solvent B. Data were normalized to vehicle control and

plotted with GraphPad Prism.

Murine xenograft studies

Mice were maintained on a folate-deficient diet for 1 week prior to tumor implantation, and during the course of the

xenograft experiment. Because normal rodent chow contains supraphysiological levels of folic acid, protocols using

folate deficient chow were developed for the purpose of maintaining mouse serum folate levels closer to the normal

human range for this metabolite (Mathias et al., 1996). For tumor growth, mice were randomized when tumors

reached an average volume of ~200mm3, and were treated with 10 mg/kg or 20 mg/kg AG2037, or drug vehicle via

intraperitoneal injections q4dx3 schedule (drug treatment every 4 days for 3 weeks). Tumor volume and body

weight were assessed throughout the experiment. To assess pharmacodynamic markers, animals were randomized at

~300-400mm3 tumor volumes and treated with 20 mg/kg AG2037 or vehicle on days 1, 4 and 7. On day 8, tumors

were collected for immunoblotting analysis.

Methyl-m7GTP pull downs

Cells were treated with indicated inhibitors overnight and lysed in lysis buffer (50 mM Tris pH 7.5, 150 mM sodium

chloride, 1% Triton X, 20 % glycerol). 1 mg of lysate was incubated for 1 h with immobilized γ-Aminophenyl-

m7GTP agarose beads (Jena Bioscience, AC-15S) at 4 ºC. Beads were centrifuged at 3000 g, washed in lysis buffer

and eluted in 2x Laemmli SDS-sample buffer containing DTT.

Rheb activation assay

HEK293T cells were plated at 3 x 106 cells per 10 cm dish and incubated overnight. Cells were transfected with 5

µg of myc-tagged wild-type Rheb or Rheb-C181S plasmid suspended in Fugene 6 (Promega), and after 5 h drugs

were added for an overnight treatment in the presence of Adenine (30 μM) or Guanine (30 μM). Rheb activation was

assessed using the Rheb Activation Assay Kit (NewEast Biosciences 81201) according to the manufacturer

instructions. Briefly, cells were washed with ice-cold PBS, lysed using lysis buffer containing protease and

phosphatase inhibitors, and total protein concentration was determined. Cleared extracts (1 mg per sample) were

incubated overnight with anti-active Rheb monoclonal antibodies and protein A/G agarose beads at 4°C. The beads

were washed in lysis buffer three times and eluted using 2x Laemmli SDS-sample buffer containing DTT. For

positive and negative controls, 1 mg of vehicle-treated lysates were incubated with 200 μM GTPγS or 2 mM GDP in

20 mM EDTA for 30 minutes at 30°C. The reaction was stopped with 60 mM magnesium chloride and the

immunoprecipitation was performed as above. Active Rheb was detected using Rheb antibody (CST 13879 1:500).

Relative amount of active Rheb was quantified by normalizing to total Rheb in input lysates using the ImageJ

software (NIH).

Immunoprecipitation and proteomics analysis

HEK293T cells were plated at 10 x 106 cells per 15 cm dish. The following day, cells were transfected with 15 µg of

myc-tagged wild-type Rheb plasmid suspended in Fugene 6 (Promega). Following the indicated treatments

overnight, immunoprecipitation was performed according to the Pierce Co-IP kit (Thermo Scientific 26149). Cells

were lysed in lysis buffer (25 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP40, 5% glycerol) supplemented

with protease and phosphatase inhibitors. Cleared extracts (1 mg per samples) were incubated overnight with anti-

myc Resin (Thermo Scientific 20168) at 4ºC. Resin was washed three times with IP Lysis Buffer and eluted in low

pH buffer. For proteomic analyses, the eluates were added to 10K MWCO Pierce PES concentrator (Thermo

Scientific 88513) and washed 3X with 8M urea / 5 mM DTT to remove detergents and reduce proteins. Cysteine

residues were alkylated with a final concentration of 10 mM iodoacetamide. The resulting proteins were digested

with mass spec-grade trypsin/lys-c mix (Promega V5071), and the recovered peptides were fractionated over a nano-

LC using PepMap RSLC C18 column (3 μM, 100A, 75 μM X 15 cm, Thermo Scientific 164568). Peptides were

detected with an Easy-Spray nano-electrospray ionization source on Q-Exactive operating at 70,000 resolution for

full-scan from 350-1450 m/z with target AGC of 3 x 106; and 17,500 resolution for tandem mass with target AGC of

1 x 105 for top 15 peptides ion isolated with under fill ratio of 0.2%, intensity threshold of 3.3e3, peptide match

preferred, excluding isotopes, charge state exclusions (unassigned, 1, 6 - 8, >8), repeat count 1, and dynamic

exclusion of 20.0s.

Raw spectra were converted to mzXML using Proteowizard msConvert (Chambers et al., 2012) and spectra were

matched to peptides in a modified version of the Human IPI database v3.84 (90166 entries) by the MyriMatch

algorithm using default settings with the following exceptions: precursor tolerance was set to 10 ppm, fragment

tolerance was set to 10 ppm, semi-tryptic cleavage rules were used, and alkylated cysteine and oxidized methionine

were defined as dynamic modifications (Tabb et al., 2007). A parsimonious protein summary was compiled using

IDPicker with peptide inclusion set at 5% false-discovery rate and protein inclusion requiring 2 unique peptides (Ma

et al., 2009). Peptide ion peaks were manually evaluated, when possible confirmed with peptide standards, and

peaks were integrated with a customized MAVEN build 774 (Clasquin et al., 2012). Resulting metrics were plotted

in GraphPad Prism v6 (GraphPad Software).

Lysosomal isolation

HeLa cells (200 million per condition) were serum starved overnight and stimulated with 100 nM insulin for 30 min.

Lysosomes were isolated using the Lysosome Isolation Kit (Sigma LYSOSO1) and all steps were carried out at 4°C.

Briefly, cells were trypsinized, washed once in ice-cold PBS, and resuspended evenly in extraction buffer

supplemented with protease and phosphatase inhibitors. Cells were mechanically disrupted using a pestle

homogenizer to achieve 80-85% breakage (about 150 strokes). The sample was centrifuged for 10 min at 1000 g to

remove intact cells and nuclei, and the supernatant (Whole Cell Fraction) was centrifuged for 20 min at 20,000 g.

The pellet was resuspended in extraction buffer (Crude Lysosome Fraction) and diluted to a 19% Optiprep Solution.

An Optiprep gradient containing the sample (27%, 22.5%, 19%, 16%, 12% and 8%) was prepared and

ultracentrifuged for 4 h at 150,000 g (no brake). Fractions 1 and 2 contained pure lysosomes and were pooled for

western blotting analysis (Lysosomal Fraction).

Rac1 activation assay

A549 cells were plated at 3 x 106 cells per 10 cm dish, and were treated with 100 nM AG2037 or 100 nM PF-

05212384 overnight. Assays were performed with the Rac1 pull-down activation assay kit (Cytoskeleton BK035)

according to the manufacturer’s instructions. Briefly, cells were treated with inhibitors overnight, lysed in the

provided lysis buffer supplemented with protease and phosphatase inhibitors. Extracts (1 mg per sample) were

incubated for 1 h at 4ºC with PAK-PBD conjugated agarose beads, which preferentially bind to the GTP-bound

active Rac1. Beads were centrifuged for 2 min at 3000 g, washed once in 1x wash buffer, and eluted in 2x Laemmli

SDS buffer. Active Rac1 was visualized using an antibody to Rac1 provided in the kit.

Ras activation assay

A549 cells were plated at 3 x 106 cells per 10 cm dish, and were treated with 100 nM AG2037 overnight. Assays

were performed with the Ras pull-down activation assay kit (Cytoskeleton BK008) according to the manufacturer’s

instructions. Briefly, cells were lysed in the provided lysis buffer supplemented with protease and phosphatase

inhibitors. Extracts (1 mg per sample) were incubated for 1 h at 4ºC with Raf-RBD conjugated agarose beads, which

preferentially bind to the GTP-bound active Ras. Beads were centrifuged for 2 min at 3000 g, washed once in 1x

wash buffer, and eluted in 2x Laemmli SDS buffer. Active Ras was visualized using an antibody to Ras provided in

the kit.

Comet assay

Cells were seeded at approximately 50% confluence and treated for 24 h with 150 nM AG2037 and 500 nM PTX.

Comet assay was performed using the CometAssay® Kit (Trevigan 4250-050-K) according to the manufacturer

instructions. Briefly, cells were trypsinized, pelleted and resuspended in cold PBS at 200,000 cells per ml, diluted

1:10 in melted LM agarose and immediately pipetted onto an electrophoresis slide, and allowed to solidify. Slides

were incubated for 1 h at 4 °C in Lysis Solution, for 1 h at 4 °C in Alkaline Unwinding Solution (pH < 13), and were

subjected to electrophoresis for 30 min. Slides were rinsed in water and comet tails were viewed and counted using

an LSM510 confocal microscope (Zeiss).

SUPPLEMENTAL REFERENCES

Chambers, M.C., Maclean, B., Burke, R., Amodei, D., Ruderman, D.L., Neumann, S., Gatto, L., Fischer, B., Pratt,

B., Egertson, J., et al. (2012). A cross-platform toolkit for mass spectrometry and proteomics. Nature biotechnology

30, 918-920.

Clasquin, M.F., Melamud, E., and Rabinowitz, J.D. (2012). LC-MS data processing with MAVEN: a metabolomic

analysis and visualization engine. Current protocols in bioinformatics / editoral board, Andreas D. Baxevanis ... [et

al.] Chapter 14, Unit14 11.

Ma, Z.Q., Dasari, S., Chambers, M.C., Litton, M.D., Sobecki, S.M., Zimmerman, L.J., Halvey, P.J., Schilling, B.,

Drake, P.M., Gibson, B.W., et al. (2009). IDPicker 2.0: Improved protein assembly with high discrimination peptide

identification filtering. Journal of proteome research 8, 3872-3881.

Tabb, D.L., Fernando, C.G., and Chambers, M.C. (2007). MyriMatch: highly accurate tandem mass spectral peptide

identification by multivariate hypergeometric analysis. Journal of proteome research 6, 654-661.