Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)
UvA-DARE (Digital Academic Repository)
Complement in neuroinflammationStudies in leprosy and Amyotrophic Lateral SclerosisBahia El Idrissi, N.
Link to publication
Creative Commons License (see https://creativecommons.org/use-remix/cc-licenses):Other
Citation for published version (APA):Bahia El Idrissi, N. (2017). Complement in neuroinflammation: Studies in leprosy and Amyotrophic LateralSclerosis.
General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.
Download date: 12 Nov 2020
Com
plement in neuroinfl am
mation: Studies in leprosy and Am
yotrophic Lateral Sclerosis N
awal Bahia El Idrissi
Complement in neuroinfl ammation: Studies in leprosy and Amyotrophic
Lateral Sclerosis
Nawal Bahia El Idrissi
UITNODIGING
U bent van harte welkom bij de openbare verdediging
van het proefschrift
Complement in neuroinfl ammation:
Studies in leprosy and Amyotrophic Lateral
Sclerosis
Dinsdag 24 januari 2017
Agnietenkapel,Universiteit van AmsterdamOudezijds Voorburgwal 231,
Amsterdam
Nawal Bahia El [email protected]
ParanimfenZineb Bahia el [email protected]
Iliana [email protected]
Complement in neuroinflammation: Studies in leprosy and
Amyotrophic Lateral Sclerosis
Nawal Bahia El Idrissi
Cover design by Georgia Michailidou
Layout and printing by Ridderprint B.V.
The work described in this thesis was performed at the Department of Genome
Analysis, Academic Medical Center Amsterdam, University of Amsterdam in The
Netherlands.
None of the sponsors had a role in the design, measurements or presentation of the
results discussed in this thesis.
Financial support for printing this thesis: Derphartox, Q.M. Gastmann Wichers
stichting and Leprastichting
ISBN: 978-94-6299-507-9
Complement in neuroinflammation:
Studies in leprosy and Amyotrophic Lateral Sclerosis
ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad van doctor
aan de Universiteit van Amsterdam
op gezag van de Rector Magnificus
prof. dr. ir. K.I.J. Maex
ten overstaan van een door het College voor Promoties ingestelde commissie,
in het openbaar te verdedigen in de Agnietenkapel
op dinsdag 24 januari 2017, te 10:00 uur
door
Nawal Bahia El Idrissi
geboren te Amsterdam
Cover design by Georgia Michailidou
Layout and printing by Ridderprint B.V.
The work described in this thesis was performed at the Department of Genome
Analysis, Academic Medical Center Amsterdam, University of Amsterdam in The
Netherlands.
None of the sponsors had a role in the design, measurements or presentation of the
results discussed in this thesis.
Financial support for printing this thesis: Derphartox, Q.M. Gastmann Wichers
stichting and Leprastichting
ISBN: 978-94-6299-507-9
Complement in neuroinflammation:
Studies in leprosy and Amyotrophic Lateral Sclerosis
ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad van doctor
aan de Universiteit van Amsterdam
op gezag van de Rector Magnificus
prof. dr. ir. K.I.J. Maex
ten overstaan van een door het College voor Promoties ingestelde commissie,
in het openbaar te verdedigen in de Agnietenkapel
op dinsdag 24 januari 2017, te 10:00 uur
door
Nawal Bahia El Idrissi
geboren te Amsterdam
Promotiecommissie:
Promotor: Prof. Dr. F. Baas Universiteit van Amsterdam
Copromotores: Dr. P.K. Das Universiteit van Amsterdam
Dr. V. Ramaglia Universiteit van Amsterdam
Overige leden: Prof. dr. M. de Visser Universiteit van Amsterdam
Prof. dr. C.J.F. van Noorden Universiteit van Amsterdam
Prof. dr. T. van der Poll Universiteit van Amsterdam
Prof. dr. T.H.M. Ottenhoff Universiteit Leiden
Dr. B. Naafs Leids Universitair Medisch
Centrum
Faculteit der Geneeskunde
Contents
Chapter 1 General introduction 7
Chapter 2 M. leprae components induce nerve damage by complement
activation: Identification of lipoarabinomannan as the dominant
complement activator 43
Chapter 3 Complement Activation In Leprosy: A Retrospective Study
Shows Elevated Circulating Terminal Complement Complex
In Reactional Leprosy 89
Chapter 4 In Situ complement activation and T-cell immunity in leprosy
spectrum: An Immunohistological Study on Leprosy skin 117
Chapter 5 Complement upregulation and activation on motor neurons
and neuromuscular junctions in the SOD1G93A mouse model
of familial amyotrophic lateral sclerosis 153
Chapter 6 Complement activation at the motor end-plates in
amyotrophic lateral sclerosis 173
Chapter 7 Complement component C6 inhibition decreases neurological
disability in female transgenic SOD1G93A mouse model of
amyotrophic lateral sclerosis 211
Chapter 8 Discussion & Summary 239
Nederlandse Samenvatting 259
List of publications 266
About the Author 267
Dankwoord 268
Portfolio 273
Promotiecommissie:
Promotor: Prof. Dr. F. Baas Universiteit van Amsterdam
Copromotores: Dr. P.K. Das Universiteit van Amsterdam
Dr. V. Ramaglia Universiteit van Amsterdam
Overige leden: Prof. dr. M. de Visser Universiteit van Amsterdam
Prof. dr. C.J.F. van Noorden Universiteit van Amsterdam
Prof. dr. T. van der Poll Universiteit van Amsterdam
Prof. dr. T.H.M. Ottenhoff Universiteit Leiden
Dr. B. Naafs Leids Universitair Medisch
Centrum
Faculteit der Geneeskunde
Contents
Chapter 1 General introduction 7
Chapter 2 M. leprae components induce nerve damage by complement
activation: Identification of lipoarabinomannan as the dominant
complement activator 43
Chapter 3 Complement Activation In Leprosy: A Retrospective Study
Shows Elevated Circulating Terminal Complement Complex
In Reactional Leprosy 89
Chapter 4 In Situ complement activation and T-cell immunity in leprosy
spectrum: An Immunohistological Study on Leprosy skin 117
Chapter 5 Complement upregulation and activation on motor neurons
and neuromuscular junctions in the SOD1G93A mouse model
of familial amyotrophic lateral sclerosis 153
Chapter 6 Complement activation at the motor end-plates in
amyotrophic lateral sclerosis 173
Chapter 7 Complement component C6 inhibition decreases neurological
disability in female transgenic SOD1G93A mouse model of
amyotrophic lateral sclerosis 211
Chapter 8 Discussion & Summary 239
Nederlandse Samenvatting 259
List of publications 266
About the Author 267
Dankwoord 268
Portfolio 273
General introduction
The role of the complement system in neuroinflammation
N. Bahia el Idrissi
General introduction
The role of the complement system in neuroinflammation
N. Bahia el Idrissi
1
Chapter 1
8
1. The nervous system
The nervous system can be divided in the central nervous system (CNS) and the
peripheral nerve system (PNS). The CNS consists of the brain and the spinal cord,
while the PNS consists of all the nerves and ganglia outside the brain and spinal
cord. The PNS connects the CNS to the organs and limbs and is a channel through
which neural signals are transmitted from and to the CNS.
The basic unit of the peripheral nerve is the axon. Axons are surrounded by
myelinating Schwann cells forming the myelin sheath. Myelin provides protection for
the axon, but it also has another function which is increasing the conduction velocity
of the electrical stimulus. Nodes of Ranvier are gaps between intervals in the myelin
sheath. These structures are exposed to the extracellular space and highly enriched
in ion channels allowing the saltatory conduction of the action potential from one
node to the next. The individual nerve fiber that consists of axons and Schwann cells
is held together by connective tissue also known as the endoneurium. Individual
nerve fibers vary in diameter and may be myelinated or unmyelinated [1].
Unmyelinated nerve fibers in the skin usually have a sensory function in the body.
The axons, Schwann cells, and endoneurium are bundled together into fascicles by
the perineurium (Figure 1). The outermost layer of connective tissue, that bundles the
peripheral nerve fascicles and blood vessels, is called the epineurium.
Figure 1. Schematic representation of the peripheral nerve consisting of perineurium containing
myelinated and unmyelinated axons supported by loose endoneurial connective tissue (Graeber et
al., 1998).
1
Introduction
9
1. The nervous system
The nervous system can be divided in the central nervous system (CNS) and the
peripheral nerve system (PNS). The CNS consists of the brain and the spinal cord,
while the PNS consists of all the nerves and ganglia outside the brain and spinal
cord. The PNS connects the CNS to the organs and limbs and is a channel through
which neural signals are transmitted from and to the CNS.
The basic unit of the peripheral nerve is the axon. Axons are surrounded by
myelinating Schwann cells forming the myelin sheath. Myelin provides protection for
the axon, but it also has another function which is increasing the conduction velocity
of the electrical stimulus. Nodes of Ranvier are gaps between intervals in the myelin
sheath. These structures are exposed to the extracellular space and highly enriched
in ion channels allowing the saltatory conduction of the action potential from one
node to the next. The individual nerve fiber that consists of axons and Schwann cells
is held together by connective tissue also known as the endoneurium. Individual
nerve fibers vary in diameter and may be myelinated or unmyelinated [1].
Unmyelinated nerve fibers in the skin usually have a sensory function in the body.
The axons, Schwann cells, and endoneurium are bundled together into fascicles by
the perineurium (Figure 1). The outermost layer of connective tissue, that bundles the
peripheral nerve fascicles and blood vessels, is called the epineurium.
Figure 1. Schematic representation of the peripheral nerve consisting of perineurium containing
myelinated and unmyelinated axons supported by loose endoneurial connective tissue (Graeber et
al., 1998).
Chapter 1
10
2. The neuromuscular junction
The CNS communicates with the rest of the body by sending messages from the
upper motor neurons to the lower motor neurons via the axons that run through the
spinal cord and reach the muscles. The neuromuscular junction is the site of
communication between the motor nerve axons and muscle fibers. The function of
the neuromuscular junction is to transmit electrical impulses from the motor neuron to
the motor nerve terminal and hence to the muscle. Synapses are the junctions
where neurons pass signals to different cells: neurons, muscle or gland cells. Almost
all the nerve to nerve, muscle and gland signaling relies on chemical synapses at
which the presynaptic neuron releases chemicals, called neurotransmitters, that act
on the postsynaptic target cell. At the end of each motor neuron there are synaptic
vesicles containing the neurotransmitter acetylcholine (ACh). Once the impulse
reaches the neuromuscular junction, voltage-sensitive Ca2+ channels are opened
which allow for the influx of Ca2+ into the nerve terminal. Ca2+ entry into the nerve
terminal initiates the fusion of acetylcholine containing vesicles with the presynaptic
membrane. During this communication acetylcholine is released into the synaptic
cleft, to bind the post-synaptic acetylcholine receptors on the muscle cell a process
called exocytosis. When acetylcholine binds to receptors on the muscle cell it triggers
muscle contraction. The time period from the release of acetylcholine to receptor
channel binding is less than a millionth of a second.
Figure 2. Schematic representation of a myelinated nerve fiber that ends at the neuromuscular
junction.
Modified figure, original from: http://www.neuroanatomy.wisc.edu/ SClinic/Weakness/Weakness.htm
Neuromuscular junction
1
Introduction
11
2. The neuromuscular junction
The CNS communicates with the rest of the body by sending messages from the
upper motor neurons to the lower motor neurons via the axons that run through the
spinal cord and reach the muscles. The neuromuscular junction is the site of
communication between the motor nerve axons and muscle fibers. The function of
the neuromuscular junction is to transmit electrical impulses from the motor neuron to
the motor nerve terminal and hence to the muscle. Synapses are the junctions
where neurons pass signals to different cells: neurons, muscle or gland cells. Almost
all the nerve to nerve, muscle and gland signaling relies on chemical synapses at
which the presynaptic neuron releases chemicals, called neurotransmitters, that act
on the postsynaptic target cell. At the end of each motor neuron there are synaptic
vesicles containing the neurotransmitter acetylcholine (ACh). Once the impulse
reaches the neuromuscular junction, voltage-sensitive Ca2+ channels are opened
which allow for the influx of Ca2+ into the nerve terminal. Ca2+ entry into the nerve
terminal initiates the fusion of acetylcholine containing vesicles with the presynaptic
membrane. During this communication acetylcholine is released into the synaptic
cleft, to bind the post-synaptic acetylcholine receptors on the muscle cell a process
called exocytosis. When acetylcholine binds to receptors on the muscle cell it triggers
muscle contraction. The time period from the release of acetylcholine to receptor
channel binding is less than a millionth of a second.
Figure 2. Schematic representation of a myelinated nerve fiber that ends at the neuromuscular
junction.
Modified figure, original from: http://www.neuroanatomy.wisc.edu/ SClinic/Weakness/Weakness.htm
Neuromuscular junction
Chapter 1
12
3. Degeneration of the peripheral nerve
Degeneration of the axon distal to the site of trauma is a process called Wallerian
degeneration. [2]. This process happens both in the CNS and the PNS, but the repair
process is different. After injury of the nerve, Wallerian degeneration occurs within 12
hours, leading to physical fragmentation of both axons and myelin. Myelin breaks
down into ellipsoids in the distal stump onwards to the first intact node of Ranvier.
Schwann cells play a key role in this process, together with phagocytic macrophages/
mast cells. In the PNS Schwann cells dedifferentiate, multiply within their basal
lamina tubes and downregulate myelin protein synthesis [3]. The myelin ellipsoids
are degraded into neutral fat which is removed by macrophages. Starting at 24 hours
after injury, endoneurial macrophages proliferate, become activated and participate
in myelin removal. The Schwann cell also helps to remove the degenerated axonal
and myelin debris and the presentation to macrophages. However, resident
macrophages cannot efficiently complete myelin clearance. Monocyte/macrophages,
recruited to the injured site through the blood stream, are responsible for the rapid
and efficient clearance of myelin debris [4]. The macrophages migrate to the site of
damage, passing through the walls of capillaries, which have become permeable in
the damaged area. As the degradation of the distal nerve segment continues,
connection with the target muscle can get lost, leading to muscle atrophy and
fibrosis. Schwann cells and macrophages phagocytose and clear the site of injury
together. In general this process requires 1 week up to several months.
4. Regeneration of the peripheral nerve
Peripheral nerves have the ability to regenerate [5;6]. This process usually starts
early in the injury process (hours after injury), but can take several days and at least
4 weeks before all the axons grow back and restore their connection. As described
before, effective regeneration is associated with the activation of Schwann cells and
macrophages, along with the inflammatory reaction in the injured nerve [7-9]. After
the inflammation, degeneration and clearance of the debris, only collapsed Schwann
cells persist at the injury site. Axon sprouts grow towards the injury site and need to
re-enter the Schwann cell tubes or basal lamina tubes at the injury site. During this
process axonal branches emerging from the tip of the proximal undamaged nerve
stump use Schwann cells as guides to re-enter the tubes which hold together the
other axons. Once within the distal stump, the axons need to find their way and
generate specific synapses connected to the same muscle fibers they innervated
pre-injury. Motor and sensory axons have little ability to identify Schwann cell tubes
and could be redirected to the wrong target, this process is called misdirection. A
single neuron could send axonal processes to multiple antagonistic muscles a
process called hyperinnervation, impairing functional recovery. In the regeneration
process both repulsive and attractive molecular and physical signals play an
important role, to make sure the axons find their proper target [10-12]. Histological
characterization of regeneration is marked by regenerative clusters of axons within
adjacent Schwann cells as groups of small diameter and thinly myelinated axons.
The axons grow at a rate of approximately 2.5 mm per day, leading to the connection
of the axon to its prior target. After reinnervation, the newly connected axon matures
its function is restored slowly and the remaining branches are eliminated while the
1
Introduction
13
3. Degeneration of the peripheral nerve
Degeneration of the axon distal to the site of trauma is a process called Wallerian
degeneration. [2]. This process happens both in the CNS and the PNS, but the repair
process is different. After injury of the nerve, Wallerian degeneration occurs within 12
hours, leading to physical fragmentation of both axons and myelin. Myelin breaks
down into ellipsoids in the distal stump onwards to the first intact node of Ranvier.
Schwann cells play a key role in this process, together with phagocytic macrophages/
mast cells. In the PNS Schwann cells dedifferentiate, multiply within their basal
lamina tubes and downregulate myelin protein synthesis [3]. The myelin ellipsoids
are degraded into neutral fat which is removed by macrophages. Starting at 24 hours
after injury, endoneurial macrophages proliferate, become activated and participate
in myelin removal. The Schwann cell also helps to remove the degenerated axonal
and myelin debris and the presentation to macrophages. However, resident
macrophages cannot efficiently complete myelin clearance. Monocyte/macrophages,
recruited to the injured site through the blood stream, are responsible for the rapid
and efficient clearance of myelin debris [4]. The macrophages migrate to the site of
damage, passing through the walls of capillaries, which have become permeable in
the damaged area. As the degradation of the distal nerve segment continues,
connection with the target muscle can get lost, leading to muscle atrophy and
fibrosis. Schwann cells and macrophages phagocytose and clear the site of injury
together. In general this process requires 1 week up to several months.
4. Regeneration of the peripheral nerve
Peripheral nerves have the ability to regenerate [5;6]. This process usually starts
early in the injury process (hours after injury), but can take several days and at least
4 weeks before all the axons grow back and restore their connection. As described
before, effective regeneration is associated with the activation of Schwann cells and
macrophages, along with the inflammatory reaction in the injured nerve [7-9]. After
the inflammation, degeneration and clearance of the debris, only collapsed Schwann
cells persist at the injury site. Axon sprouts grow towards the injury site and need to
re-enter the Schwann cell tubes or basal lamina tubes at the injury site. During this
process axonal branches emerging from the tip of the proximal undamaged nerve
stump use Schwann cells as guides to re-enter the tubes which hold together the
other axons. Once within the distal stump, the axons need to find their way and
generate specific synapses connected to the same muscle fibers they innervated
pre-injury. Motor and sensory axons have little ability to identify Schwann cell tubes
and could be redirected to the wrong target, this process is called misdirection. A
single neuron could send axonal processes to multiple antagonistic muscles a
process called hyperinnervation, impairing functional recovery. In the regeneration
process both repulsive and attractive molecular and physical signals play an
important role, to make sure the axons find their proper target [10-12]. Histological
characterization of regeneration is marked by regenerative clusters of axons within
adjacent Schwann cells as groups of small diameter and thinly myelinated axons.
The axons grow at a rate of approximately 2.5 mm per day, leading to the connection
of the axon to its prior target. After reinnervation, the newly connected axon matures
its function is restored slowly and the remaining branches are eliminated while the
Chapter 1
14
remaining axon thickens. Although peripheral axons often achieve a good
morphological regeneration, the regain of function is incomplete [13;14].
Figure 3. Illustration of axonal growth, presenting the neural function rejoining with the skeletal
muscle fibers. Modified figure, original from:
http://chen2820.pbworks.com/w/page/11951452/Biomaterials%20for%20nerve%20regeneration
5. Inflammation during degeneration of the peripheral nerve
After injury, inflammation is one of the first events that occurs. This event starts
before any structural changes are observed in the distal axons. Insight into the
mechanisms of the inflammatory boost after injury are important to understand the
damage to local cells, surrounding tissue and the regeneration process of the
peripheral nerve. Inflammation in the axons is an event that involves different
inflammatory mediators and cells [15-17]. In the recent years an important role for
both the innate and adaptive immune system in neurodegeneration has been
suggested and it has become a major focus of neuroimmunologists.
Traumatic injury to the nerve triggers a cascade of events which results in activation
of the immune system and, consequently, in a robust inflammatory reaction at the
site of injury. The role of inflammation in the course of degeneration and regeneration
is not completely understood. Inflammation in the PNS has been associated with
tissue damage, but is also proposed to be beneficial for Wallerian degeneration and
regeneration.
Wallerian degeneration has been originally described as a process which occurs
after a traumatic injury, but it is also observed in neurodegenerative diseases. In
disease, axons express pathological signs and changes in immune cell behaviour
similar to Wallerian degeneration triggered by traumatic injury [15;16;18]. These
changes influence patterning of axonal degeneration and regeneration.
Uninjured peripheral nerves consist of resident macrophages, fibroblasts and
Schwann cells. Schwann cells outnumber macrophages, and they are the front line
population of cells to react after axonal injury. Under normal physiological conditions,
macrophages and Schwann cells ‘’sense’’ the tissue environment for pathogens,
phagocytoses, dead and dying cells and maintain tissue homeostasis. After axonal
1
Introduction
15
remaining axon thickens. Although peripheral axons often achieve a good
morphological regeneration, the regain of function is incomplete [13;14].
Figure 3. Illustration of axonal growth, presenting the neural function rejoining with the skeletal
muscle fibers. Modified figure, original from:
http://chen2820.pbworks.com/w/page/11951452/Biomaterials%20for%20nerve%20regeneration
5. Inflammation during degeneration of the peripheral nerve
After injury, inflammation is one of the first events that occurs. This event starts
before any structural changes are observed in the distal axons. Insight into the
mechanisms of the inflammatory boost after injury are important to understand the
damage to local cells, surrounding tissue and the regeneration process of the
peripheral nerve. Inflammation in the axons is an event that involves different
inflammatory mediators and cells [15-17]. In the recent years an important role for
both the innate and adaptive immune system in neurodegeneration has been
suggested and it has become a major focus of neuroimmunologists.
Traumatic injury to the nerve triggers a cascade of events which results in activation
of the immune system and, consequently, in a robust inflammatory reaction at the
site of injury. The role of inflammation in the course of degeneration and regeneration
is not completely understood. Inflammation in the PNS has been associated with
tissue damage, but is also proposed to be beneficial for Wallerian degeneration and
regeneration.
Wallerian degeneration has been originally described as a process which occurs
after a traumatic injury, but it is also observed in neurodegenerative diseases. In
disease, axons express pathological signs and changes in immune cell behaviour
similar to Wallerian degeneration triggered by traumatic injury [15;16;18]. These
changes influence patterning of axonal degeneration and regeneration.
Uninjured peripheral nerves consist of resident macrophages, fibroblasts and
Schwann cells. Schwann cells outnumber macrophages, and they are the front line
population of cells to react after axonal injury. Under normal physiological conditions,
macrophages and Schwann cells ‘’sense’’ the tissue environment for pathogens,
phagocytoses, dead and dying cells and maintain tissue homeostasis. After axonal
Chapter 1
16
injury, damage- associated molecular patterns are accumulated at the site of injury,
resulting in changes in the nerve homeostatis [19;20]. Resident macrophages begin
to divide [21;22] and Schwann cells are phagocytic at the injury site. As next step,
activated macrophages enter the nerve, accumulate at the site of injury and start
proliferating 2 to 3 days after injury as a result of inflammation [15;18;23]. Schwann
cells can ‘’sense’’ these changes in the nerve and keep the inflammation in motion
[24], by upregulating inflammatory-related genes via TLR-2 and TLR-3 signaling [25]
and acting as antigen presenting cells [26;27]. Knock out mice for TLR-2 and TLR-4
showed an impaired Wallerian degeneration and regeneration process after sciatic
crush injury [28], while intraneural injections of wild type mice with TLRs ligands after
crush resulted in macrophage influx, myelin clearance and enhanced motor recovery,
suggesting a role for TLRs in the regeneration process.
After the distal stump undergoes structural changes leading to its total disintegration
[29;30], injured axons trigger pathways for self-distruction [31;32] and cytokines,
chemokines and inflammatory cells trigger inflammation that helps the fragmentation
process. The endogenous autoantibodies directed against degenerating PNS myelin
is critical to induce phagocytosis process in macrophages, resulting in robust and
rapid clearance of inhibitory myelin debris and thereby facilitating axon regeneration
in the PNS [33].
After macrophages enter the nerve they start clearing cellular debris in the distal
nerve stump [34;35]. The macrophages can polarize into M1 or M2 macrophages
[36]. M1 macrophages inhibit cell proliferation and causes tissue damage while M2
macrophages promote cell proliferation and tissue repair. Schwann cells start over-
expressing inflammatory cytokines and chemokines including IL-1β, TNF-α, IL-1α,
MCP-1, MIP-1, IL-10, TGF-β, and galectin [2;15;16;37-39], and thereby turn on the
inflammatory response. IL-1β plays an important role early after nerve injury in
inducing myelin collapse, through a cascade which includes phospholipase A2
(PLA2) and lysophosphatidylcholine (LPC) activation in Schwann cells [40;41]. PLA2
triggers myelin breakdown after hydrolyzing the lipid phosphatidylcholine. This lipid is
located in high levels in the myelin sheath. Hydrolysis of this lipid results in the
generation of large amounts of LPC, a molecule with a natural myelinolytic action
[42]. PLA2 expression in Schwann cells and macrophages can increased by the
inflammatory molecules TNF-α, IL-1α, and MCP-1. This process is important to reach
all compact myelin that surrounds severed axons will be fully fragmented into ovoids.
The injury is also affecting the nerve at distance from the lesion (10mm- 15 mm). It is
suggested that Schwann cells can ‘’sense’’ the damage although there is no
morphological alterations at distance from the injury site. A possible mechanism
involved in this process is that Schwann cells can sense the lack of survival factors
such as NMNAT2, transport from the neuronal cell body to the distal axon because of
the damage [43].
Overall, proinflammatory signals that are released during the first week after injury,
trigger tissue damage, Schwann cell proliferation, activate resident nonneuronal cells
to produce a high amount of inflammatory mediators, and recruit circulating
leukocytes to the degenerated nerves [15;18]. These events keep the nerve
inflammation ongoing for long after the nerve injury.
1
Introduction
17
injury, damage- associated molecular patterns are accumulated at the site of injury,
resulting in changes in the nerve homeostatis [19;20]. Resident macrophages begin
to divide [21;22] and Schwann cells are phagocytic at the injury site. As next step,
activated macrophages enter the nerve, accumulate at the site of injury and start
proliferating 2 to 3 days after injury as a result of inflammation [15;18;23]. Schwann
cells can ‘’sense’’ these changes in the nerve and keep the inflammation in motion
[24], by upregulating inflammatory-related genes via TLR-2 and TLR-3 signaling [25]
and acting as antigen presenting cells [26;27]. Knock out mice for TLR-2 and TLR-4
showed an impaired Wallerian degeneration and regeneration process after sciatic
crush injury [28], while intraneural injections of wild type mice with TLRs ligands after
crush resulted in macrophage influx, myelin clearance and enhanced motor recovery,
suggesting a role for TLRs in the regeneration process.
After the distal stump undergoes structural changes leading to its total disintegration
[29;30], injured axons trigger pathways for self-distruction [31;32] and cytokines,
chemokines and inflammatory cells trigger inflammation that helps the fragmentation
process. The endogenous autoantibodies directed against degenerating PNS myelin
is critical to induce phagocytosis process in macrophages, resulting in robust and
rapid clearance of inhibitory myelin debris and thereby facilitating axon regeneration
in the PNS [33].
After macrophages enter the nerve they start clearing cellular debris in the distal
nerve stump [34;35]. The macrophages can polarize into M1 or M2 macrophages
[36]. M1 macrophages inhibit cell proliferation and causes tissue damage while M2
macrophages promote cell proliferation and tissue repair. Schwann cells start over-
expressing inflammatory cytokines and chemokines including IL-1β, TNF-α, IL-1α,
MCP-1, MIP-1, IL-10, TGF-β, and galectin [2;15;16;37-39], and thereby turn on the
inflammatory response. IL-1β plays an important role early after nerve injury in
inducing myelin collapse, through a cascade which includes phospholipase A2
(PLA2) and lysophosphatidylcholine (LPC) activation in Schwann cells [40;41]. PLA2
triggers myelin breakdown after hydrolyzing the lipid phosphatidylcholine. This lipid is
located in high levels in the myelin sheath. Hydrolysis of this lipid results in the
generation of large amounts of LPC, a molecule with a natural myelinolytic action
[42]. PLA2 expression in Schwann cells and macrophages can increased by the
inflammatory molecules TNF-α, IL-1α, and MCP-1. This process is important to reach
all compact myelin that surrounds severed axons will be fully fragmented into ovoids.
The injury is also affecting the nerve at distance from the lesion (10mm- 15 mm). It is
suggested that Schwann cells can ‘’sense’’ the damage although there is no
morphological alterations at distance from the injury site. A possible mechanism
involved in this process is that Schwann cells can sense the lack of survival factors
such as NMNAT2, transport from the neuronal cell body to the distal axon because of
the damage [43].
Overall, proinflammatory signals that are released during the first week after injury,
trigger tissue damage, Schwann cell proliferation, activate resident nonneuronal cells
to produce a high amount of inflammatory mediators, and recruit circulating
leukocytes to the degenerated nerves [15;18]. These events keep the nerve
inflammation ongoing for long after the nerve injury.
Chapter 1
18
6. The role of the complement system during neurodegeneration
6.1 Complement activation
The complement system is a key component of the innate immunity. It counts more
than 30 soluble and membrane bound proteins. Complement has many physiological
roles such as eliminating pathogens, clearing apoptotic cells, protecting healthy self-
cells, disposing immune complexes [44] and it is also involved in synapse remodeling
during development [45]. Another important role for the complement system is
bridging the innate and adaptive immunity. Activation of the complement system
occurs via three pathways (Figure 4): the classical pathway, triggered by antigen-
antibody complexes; the alternative pathway, triggered by foreign surfaces; and the
lectin pathway, triggered by bacterial sugars. The classical pathway is activated by
the recognition of an antigen-antibody complex by C1q, this process activates C1s
and C1r. C1r cleaves C1s which in turn cleaves C2 and C4 into the two fragments;
C2b, C4a and C2a, C4b.The cleavage of the two serum proteins C4 and C2 to
generate C4b2a, the C3 convertase of the classical pathway. The Lectin pathway is
initiated by binding of carbohydrate antigens by mannose-binding lectin (MBL). MBL-
associated serine proteases (MASPs) then cleave C4 and C2 to generate the C3
convertase (C4b2a). In contrast, the alternative pathway is activated through
spontaneous hydrolysis of plasma C3. This event generates a second C3
convertase, C3(H2O)Bb. Eventually all the three pathways lead to the generation of
the C3a and C3b fragments by the C3 convertase that cleaves C3. C3b has the
ability to bind to nearby membranes with exposed amino or hydroxyl groups and
thereby amplify the deposition of C3b on the surface of a cell. Factor B gets cleaved
by factor D after it binds C3b, which generates the membrane bound C3 convertase
[46]. Binding of an additional C3b to the C3 convertase creates a C5 convertase, an
essential step for activation of the common terminal pathway. After the cleavage of
C5, C5a and C5b is formed. The C5b fragment binds C6, C7, C8 and C9 to generate
the cell-bound membrane attack complex (MAC) or the soluble Terminal
Complement Complex (TCC). The MAC participates in clearing diseased or infected
cells by punching holes into their membranes. There are also other activation routes
that result in the pore forming molecule MAC; the ‘’C2 bypass’’ pathway and the
‘’Extrinsic pathway’’. The C2 bypass pathway, is activated by the direct cleavage of
C3 by MASP-2 of the lectin pathway, bypassing the formation of the C3 convertase
[47]. The extrinsic pathway involves non-complement proteins such as thrombin,
which can directly cleave C3 and C5.
1
Introduction
19
6. The role of the complement system during neurodegeneration
6.1 Complement activation
The complement system is a key component of the innate immunity. It counts more
than 30 soluble and membrane bound proteins. Complement has many physiological
roles such as eliminating pathogens, clearing apoptotic cells, protecting healthy self-
cells, disposing immune complexes [44] and it is also involved in synapse remodeling
during development [45]. Another important role for the complement system is
bridging the innate and adaptive immunity. Activation of the complement system
occurs via three pathways (Figure 4): the classical pathway, triggered by antigen-
antibody complexes; the alternative pathway, triggered by foreign surfaces; and the
lectin pathway, triggered by bacterial sugars. The classical pathway is activated by
the recognition of an antigen-antibody complex by C1q, this process activates C1s
and C1r. C1r cleaves C1s which in turn cleaves C2 and C4 into the two fragments;
C2b, C4a and C2a, C4b.The cleavage of the two serum proteins C4 and C2 to
generate C4b2a, the C3 convertase of the classical pathway. The Lectin pathway is
initiated by binding of carbohydrate antigens by mannose-binding lectin (MBL). MBL-
associated serine proteases (MASPs) then cleave C4 and C2 to generate the C3
convertase (C4b2a). In contrast, the alternative pathway is activated through
spontaneous hydrolysis of plasma C3. This event generates a second C3
convertase, C3(H2O)Bb. Eventually all the three pathways lead to the generation of
the C3a and C3b fragments by the C3 convertase that cleaves C3. C3b has the
ability to bind to nearby membranes with exposed amino or hydroxyl groups and
thereby amplify the deposition of C3b on the surface of a cell. Factor B gets cleaved
by factor D after it binds C3b, which generates the membrane bound C3 convertase
[46]. Binding of an additional C3b to the C3 convertase creates a C5 convertase, an
essential step for activation of the common terminal pathway. After the cleavage of
C5, C5a and C5b is formed. The C5b fragment binds C6, C7, C8 and C9 to generate
the cell-bound membrane attack complex (MAC) or the soluble Terminal
Complement Complex (TCC). The MAC participates in clearing diseased or infected
cells by punching holes into their membranes. There are also other activation routes
that result in the pore forming molecule MAC; the ‘’C2 bypass’’ pathway and the
‘’Extrinsic pathway’’. The C2 bypass pathway, is activated by the direct cleavage of
C3 by MASP-2 of the lectin pathway, bypassing the formation of the C3 convertase
[47]. The extrinsic pathway involves non-complement proteins such as thrombin,
which can directly cleave C3 and C5.
Chapter 1
20
Figure 4. Schematic overview of the complement pathways and proteins involved.
6.2 Complement regulation
Activation products of the complement system such as C3a, C5a and MAC could
have numerous potentially harmful effects on the human immune system and can
lead to tissue damage. The propensity of the MAC to “drift” from the site of activation
and deposit on self-cells puts these cells at risk [48-53]. The complement system is
controlled by many regulators to protect self-tissue e.g.; the alternative pathway
regulator Factor H binds and inactivates the C3bBb convertase and Clusterin blocks
the terminal pathway by binding the C5b, 6, 7 complex and preventing its binding to
surfaces (Figure 4).
C1 inhibitor is an inhibitor of the classical pathway that induces dissociation of the C1
components. It inactivates C1r and C1s proteases in the C1 complex of the classical
pathway and MASP-1 and MASP-2 proteases in MBL complexes of the lectin
pathway. Hereby, the C1 inhibitor prevents cleavage of the components C4 and C2
by C1 and MBL. C4b-binding protein (C4BP) blocks the classical and the lectin
pathways on the level of C4. C4BP accelerates decay of C3- convertase. It is also a
cofactor for serine protease factor I that cleaves C4b and C3b and has the ability to
bind C3b.
Membrane bound regulators include complement receptor 1 (CD35), Membrane
cofactor protein, Decay accelerating factor (also known as CD55) and protectin (also
known as CD59). Complement receptor 1 and Decay accelerating factor displace a
component of the C3 convertase in the classical pathway, while CD59 prevents final
assembly of the membrane attack complex. In addition, Vitronectin and complement
factor H related protein 1 are soluble inhibitors of the terminal pathway of
complement. Another component with regulatory function in all the complement
1
Introduction
21
Figure 4. Schematic overview of the complement pathways and proteins involved.
6.2 Complement regulation
Activation products of the complement system such as C3a, C5a and MAC could
have numerous potentially harmful effects on the human immune system and can
lead to tissue damage. The propensity of the MAC to “drift” from the site of activation
and deposit on self-cells puts these cells at risk [48-53]. The complement system is
controlled by many regulators to protect self-tissue e.g.; the alternative pathway
regulator Factor H binds and inactivates the C3bBb convertase and Clusterin blocks
the terminal pathway by binding the C5b, 6, 7 complex and preventing its binding to
surfaces (Figure 4).
C1 inhibitor is an inhibitor of the classical pathway that induces dissociation of the C1
components. It inactivates C1r and C1s proteases in the C1 complex of the classical
pathway and MASP-1 and MASP-2 proteases in MBL complexes of the lectin
pathway. Hereby, the C1 inhibitor prevents cleavage of the components C4 and C2
by C1 and MBL. C4b-binding protein (C4BP) blocks the classical and the lectin
pathways on the level of C4. C4BP accelerates decay of C3- convertase. It is also a
cofactor for serine protease factor I that cleaves C4b and C3b and has the ability to
bind C3b.
Membrane bound regulators include complement receptor 1 (CD35), Membrane
cofactor protein, Decay accelerating factor (also known as CD55) and protectin (also
known as CD59). Complement receptor 1 and Decay accelerating factor displace a
component of the C3 convertase in the classical pathway, while CD59 prevents final
assembly of the membrane attack complex. In addition, Vitronectin and complement
factor H related protein 1 are soluble inhibitors of the terminal pathway of
complement. Another component with regulatory function in all the complement
Chapter 1
22
pathways is Carboxypeptidase N. Carboxypeptidase N regulates the complement
system by controlling the inflammatory response by inactivation of anaphylatoxins
such as C3a and C5a.
Although there are complement regulators to protect the normal tissue against
complement-mediated damage, excessive activation of the complement system,
which breaks through the protective effect of the regulators, can occur. This will
result in tissue damage and drives inflammation.
6.3 Complement and nerve degeneration
The complement system has long been recognized to play a crucial role in peripheral
nerve degeneration. Traumatic injury focally damages the nerve exposing axonal and
myelin epitopes. Myelin proteins can activate the classical and alternative pathways
of complement in an antibody-independent manner [54;55]. The complement
cascade is activated within 1 hour at the side of injury [56]. Activation of the
complement system generates opsonins C3b, C5b and the terminal complement
component MAC. The opsonins target membranes of cells for disposal by
phagocytes and for the anchoring of the MAC. The small cleaved products, C3a and
C5a, have the ability to recruit and activate macrophages. The macrophges start
phagocytosis of myelin, this process is mediated by complement via Complement
Receptor 3 [57;58].
C3 depletion in rats reduced macrophage recruitment into the distal stump of the
degenerating nerve and they failed to acquire the enlarged and vacuolated
morphology, typical of the activated phenotype [59]. Similarly, C5 deficient mice
showed delayed macrophage recruitment as well as axonal and myelin degradation
from one to twenty one days post-injury [60].
We previously showed that MAC damages axons in the acute peripheral nerve crush
model [61]. Deficiency of the natural regulator of the MAC, CD59a, in mice was
shown to exacerbate Wallerian degeneration[62], while inhibition of complement with
soluble complement receptor 1 protected the peripheral nerve from early axon loss
after injury [63]. This suggests that complement therapy accelerates nerve
regeneration and functional recovery after mechanical nerve injury [64]. Formation of
the MAC, was shown to cause nerve damage also after traumatic injury of the brain
1
Introduction
23
pathways is Carboxypeptidase N. Carboxypeptidase N regulates the complement
system by controlling the inflammatory response by inactivation of anaphylatoxins
such as C3a and C5a.
Although there are complement regulators to protect the normal tissue against
complement-mediated damage, excessive activation of the complement system,
which breaks through the protective effect of the regulators, can occur. This will
result in tissue damage and drives inflammation.
6.3 Complement and nerve degeneration
The complement system has long been recognized to play a crucial role in peripheral
nerve degeneration. Traumatic injury focally damages the nerve exposing axonal and
myelin epitopes. Myelin proteins can activate the classical and alternative pathways
of complement in an antibody-independent manner [54;55]. The complement
cascade is activated within 1 hour at the side of injury [56]. Activation of the
complement system generates opsonins C3b, C5b and the terminal complement
component MAC. The opsonins target membranes of cells for disposal by
phagocytes and for the anchoring of the MAC. The small cleaved products, C3a and
C5a, have the ability to recruit and activate macrophages. The macrophges start
phagocytosis of myelin, this process is mediated by complement via Complement
Receptor 3 [57;58].
C3 depletion in rats reduced macrophage recruitment into the distal stump of the
degenerating nerve and they failed to acquire the enlarged and vacuolated
morphology, typical of the activated phenotype [59]. Similarly, C5 deficient mice
showed delayed macrophage recruitment as well as axonal and myelin degradation
from one to twenty one days post-injury [60].
We previously showed that MAC damages axons in the acute peripheral nerve crush
model [61]. Deficiency of the natural regulator of the MAC, CD59a, in mice was
shown to exacerbate Wallerian degeneration[62], while inhibition of complement with
soluble complement receptor 1 protected the peripheral nerve from early axon loss
after injury [63]. This suggests that complement therapy accelerates nerve
regeneration and functional recovery after mechanical nerve injury [64]. Formation of
the MAC, was shown to cause nerve damage also after traumatic injury of the brain
Chapter 1
24
in human [65;66] and mouse models [67-69]. Involvement of the complement system
in degeneration of axons has been attributed to its role in controlling
neuroinflammation. MAC has recently been shown to activate inflammasome NLRP3
from the surface of complement-opsonized particles to plasma membranes of
macrophages and thereby also activating caspase 1 and release of IL1-b and IL-18.
This process is suggested to play an important role in the activation of the adaptive
immune response including recruiting leukocytes to the site of phagocytosis[70].
Trauma or disease-induced neuroinflammation will have impact on the outcome of
neurological disease. In the peripheral nervous system, neuroinflammation will lead
to prolonged and possibly continuous degeneration associated with functional
impairment such as muscle atrophy, loss of sensibility or pain. In the central nervous
system, the effects can have great impact on disease progression and recovery. The
effects of Wallerian degeneration of a nerve tract and its associated
neuroinflammation can easily spread from one functional system to another. As
described earlier Wallerian degeneration is not only triggered by a traumatic insult,
but also occurs in several neurodegenerative diseases (amyotrophic lateral sclerosis,
Alzheimer’s disease, and Parkinson’s disease). In these diseases, the affected axons
share pathological signs with what is normally observed in axons undergoing
traumatic injury-induced Wallerian degeneration [71]. Complement activation is also
thought to be involved in the pathogenesis of chronic neurological diseases including
Alzheimer’s disease, Parkinson’s disease and multiple sclerosis (reviewed in [72]).
Activation of the complement system is a major aspect of many chronic inflammatory
diseases [73;74].
Initially, complement activation was thought to be involved in only a few CNS
disorders. Nowadays complement has been associated with many more disorders. In
EAE, a mouse model of neuroinflammation and demyelination, as seen in multiple
sclerosis, MAC damages nerves whereas inhibition of MAC reduces neurological
symptoms [75]. Recently the complement system and microglia were shown to be
involved in synapse remodeling during development are inappropriately activated
and mediate synapse loss in Alzheimer’s disease. Inhibition of C1q, C3, or the
microglial complement receptor CR3 showed a reduction in the number of
phagocytic microglia, as well as the extent of early synapse loss [76]. This suggests
that the function of complement extends beyond the lysis of bacteria and clearing
damaged cells. Activation aggravates neuroaxonal loss after nerve trauma and in
neurodegenerative diseases. This change in view is accompanied by an increased
interest for complement therapeutics for treatment of neurological diseases.
In this thesis I present studies on the role of the complement system in two disorders,
leprosy and ALS. I have analyzed the involvement of the complement system in
tissue pathology and studied the effect of complement inhibition in these two
diseases.
1
Introduction
25
in human [65;66] and mouse models [67-69]. Involvement of the complement system
in degeneration of axons has been attributed to its role in controlling
neuroinflammation. MAC has recently been shown to activate inflammasome NLRP3
from the surface of complement-opsonized particles to plasma membranes of
macrophages and thereby also activating caspase 1 and release of IL1-b and IL-18.
This process is suggested to play an important role in the activation of the adaptive
immune response including recruiting leukocytes to the site of phagocytosis[70].
Trauma or disease-induced neuroinflammation will have impact on the outcome of
neurological disease. In the peripheral nervous system, neuroinflammation will lead
to prolonged and possibly continuous degeneration associated with functional
impairment such as muscle atrophy, loss of sensibility or pain. In the central nervous
system, the effects can have great impact on disease progression and recovery. The
effects of Wallerian degeneration of a nerve tract and its associated
neuroinflammation can easily spread from one functional system to another. As
described earlier Wallerian degeneration is not only triggered by a traumatic insult,
but also occurs in several neurodegenerative diseases (amyotrophic lateral sclerosis,
Alzheimer’s disease, and Parkinson’s disease). In these diseases, the affected axons
share pathological signs with what is normally observed in axons undergoing
traumatic injury-induced Wallerian degeneration [71]. Complement activation is also
thought to be involved in the pathogenesis of chronic neurological diseases including
Alzheimer’s disease, Parkinson’s disease and multiple sclerosis (reviewed in [72]).
Activation of the complement system is a major aspect of many chronic inflammatory
diseases [73;74].
Initially, complement activation was thought to be involved in only a few CNS
disorders. Nowadays complement has been associated with many more disorders. In
EAE, a mouse model of neuroinflammation and demyelination, as seen in multiple
sclerosis, MAC damages nerves whereas inhibition of MAC reduces neurological
symptoms [75]. Recently the complement system and microglia were shown to be
involved in synapse remodeling during development are inappropriately activated
and mediate synapse loss in Alzheimer’s disease. Inhibition of C1q, C3, or the
microglial complement receptor CR3 showed a reduction in the number of
phagocytic microglia, as well as the extent of early synapse loss [76]. This suggests
that the function of complement extends beyond the lysis of bacteria and clearing
damaged cells. Activation aggravates neuroaxonal loss after nerve trauma and in
neurodegenerative diseases. This change in view is accompanied by an increased
interest for complement therapeutics for treatment of neurological diseases.
In this thesis I present studies on the role of the complement system in two disorders,
leprosy and ALS. I have analyzed the involvement of the complement system in
tissue pathology and studied the effect of complement inhibition in these two
diseases.
Chapter 1
26
7. Infectious neuropathy leprosy and the immune system
Leprosy is a chronic mycobacterial disease caused by Mycobacterium leprae,
affecting about 214,000 new individuals globally every year (WHO, 2014). M.leprae,
is an obligate intracellular parasite with tropism for macrophages and Schwann cells.
Leprosy is characterized by nerve damage, which can lead to patient deformities
[77;78]. The host immunological response to M.leprae and its antigens determines
the clinical/immunological spectrum of leprosy. The spectrum of leprosy ranges from
Lepromatous leprosy (LL) at one pole, with a high bacterial load in the tissues, an
absence of cellular immune response (CMI) to M.leprae and presence of M.leprae
specifc antibodies, to Tuberculoid leprosy (TT) at the other pole, characterised by
the low levels of bacilli accompanied by the presence of robust M.leprae-specific CMI
[79]. Between these polar forms is the spectrum of borderline leprosy, including the
border line lepromatous (BL), true border line (BB) and border line tuberculoid (BT)
forms, with the varying presence of bacilli and M.leprae-specific CMI.
It is as yet unclear why such diverse responses are generated against a single
pathogen in different patients. The use of WHO recommended Multidrug therapy
(MDT) has resulted an a considerable decline in the prevalence of leprosy world-wide
(WHO, 2016). This has led to a major shift in focus on “elimination of leprosy” in
terms of prevalence of the disease to targets that emphasize a decrease in the
number of new cases to promote early detection and reduction of transmission
(WHO, 2016). A major complication in leprosy is the development of the so-called
leprosy “reactions”.
Particularly the borderline groups can develop two types of reactions due to changes
in their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2
or erythema nodosum leprosum (ENL). The RR is due to the increased pathogen-
specific cell-mediated immunity encountered among BT and BL patients, whereas
ENL is seen in BL and LL patients and is thought to be immune complex-mediated
[80]. Treatment of reactions is usually by the use of corticosteroids.
There are multiple proposed routes of M. leprae infection, the seriously considered
portals of entry are the skin and the upper respiratory tract. With regard to the
respiratory route evidence suggests M. leprae is able to bind to nasal epithelial cells
by binding to a soluble protein, fibronectin, that binds to fibronectin receptors on the
surface of the epithelial cell [81]. It is suggested that M. leprae enters the nasal
epithelial cells, then enters the blood stream, and migrates to places with the best
environment, the non-myelinating Schwann cells in the extremities [82]. It was shown
that M. leprae invade the nonmyelinating Schwann cells and multiply, as well as
attach to myelinating Schwann cells. M. leprae colonizes the Schwann cells of the
peripheral nervous system. The bacteria can live and grow within macrophages as a
mechanism to evade the host immune system. Once the immune system recognizes
and targets the infected cells, bacterial heterologous and host autologous antigens
are released [77;78;83]. The release of bacterial antigens to the surrounding tissue
has been suggested to cause tissue damage. The M. leprae cells release PGL
proteins that can disturb the DRP2-dystroglycan complex in the Schwann cell and
lead to a decline in myelination [82]. DRP2 is important for myelination and is
normally produced by myelinating Schwann cells. The DRP2-dystroglycan complex
are suggested to help communication between Schwann cells by transferring the
signals from the inside of the cell to the outside [84]. It is known that dead M. leprae
cells or antigens of the bacilli alone can still cause demyelination in vitro and in vivo
[82]. This suggests that even after the bacteria is killed by treatment antigens still can
1
Introduction
27
7. Infectious neuropathy leprosy and the immune system
Leprosy is a chronic mycobacterial disease caused by Mycobacterium leprae,
affecting about 214,000 new individuals globally every year (WHO, 2014). M.leprae,
is an obligate intracellular parasite with tropism for macrophages and Schwann cells.
Leprosy is characterized by nerve damage, which can lead to patient deformities
[77;78]. The host immunological response to M.leprae and its antigens determines
the clinical/immunological spectrum of leprosy. The spectrum of leprosy ranges from
Lepromatous leprosy (LL) at one pole, with a high bacterial load in the tissues, an
absence of cellular immune response (CMI) to M.leprae and presence of M.leprae
specifc antibodies, to Tuberculoid leprosy (TT) at the other pole, characterised by
the low levels of bacilli accompanied by the presence of robust M.leprae-specific CMI
[79]. Between these polar forms is the spectrum of borderline leprosy, including the
border line lepromatous (BL), true border line (BB) and border line tuberculoid (BT)
forms, with the varying presence of bacilli and M.leprae-specific CMI.
It is as yet unclear why such diverse responses are generated against a single
pathogen in different patients. The use of WHO recommended Multidrug therapy
(MDT) has resulted an a considerable decline in the prevalence of leprosy world-wide
(WHO, 2016). This has led to a major shift in focus on “elimination of leprosy” in
terms of prevalence of the disease to targets that emphasize a decrease in the
number of new cases to promote early detection and reduction of transmission
(WHO, 2016). A major complication in leprosy is the development of the so-called
leprosy “reactions”.
Particularly the borderline groups can develop two types of reactions due to changes
in their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2
or erythema nodosum leprosum (ENL). The RR is due to the increased pathogen-
specific cell-mediated immunity encountered among BT and BL patients, whereas
ENL is seen in BL and LL patients and is thought to be immune complex-mediated
[80]. Treatment of reactions is usually by the use of corticosteroids.
There are multiple proposed routes of M. leprae infection, the seriously considered
portals of entry are the skin and the upper respiratory tract. With regard to the
respiratory route evidence suggests M. leprae is able to bind to nasal epithelial cells
by binding to a soluble protein, fibronectin, that binds to fibronectin receptors on the
surface of the epithelial cell [81]. It is suggested that M. leprae enters the nasal
epithelial cells, then enters the blood stream, and migrates to places with the best
environment, the non-myelinating Schwann cells in the extremities [82]. It was shown
that M. leprae invade the nonmyelinating Schwann cells and multiply, as well as
attach to myelinating Schwann cells. M. leprae colonizes the Schwann cells of the
peripheral nervous system. The bacteria can live and grow within macrophages as a
mechanism to evade the host immune system. Once the immune system recognizes
and targets the infected cells, bacterial heterologous and host autologous antigens
are released [77;78;83]. The release of bacterial antigens to the surrounding tissue
has been suggested to cause tissue damage. The M. leprae cells release PGL
proteins that can disturb the DRP2-dystroglycan complex in the Schwann cell and
lead to a decline in myelination [82]. DRP2 is important for myelination and is
normally produced by myelinating Schwann cells. The DRP2-dystroglycan complex
are suggested to help communication between Schwann cells by transferring the
signals from the inside of the cell to the outside [84]. It is known that dead M. leprae
cells or antigens of the bacilli alone can still cause demyelination in vitro and in vivo
[82]. This suggests that even after the bacteria is killed by treatment antigens still can
Chapter 1
28
trigger demyelination. Therefore, treatment of the patients infected with M. leprae
should be treated on time to avoid more nerve damage. This is why it is important
that the infection is treated right away; before too much damage to the nervous
system is done. Since leprosy patients experience nerve damage even after
treatment understanding the mechanisms of nerve damage by M. lepae and
determining what the modifiers are of the disease is important for a better treatment.
Both host genetic factors [85], and the immune system, including the complement
system are associated with susceptibility to leprosy [86-88]. Recent published data
shows that complement Factor H polymorphisms are associated with susceptibility
to leprosy [89;90].Previous serological studies showed reduced complement
hemolytic activity and reduced levels of C4 in LL patients suggesting consumption of
complement in the circulation via activation of the classical or lectin pathway [88;91].
Also an increased C1q binding activity was measured in LL patients with ENL
reactions suggesting involvement of the classical pathway in these patients, and
increased C3d levels in 70% of patients with ENL and 18% of patients with
uncomplicated LL. In addition, deposits of the membrane attack complex (MAC) have
been found on the damaged nerves of LL but not TT leprosy patients [92]. This
suggests a possible role for complement as a disease modifier in leprosy. We
suggest an important role for complement in nerve damage in leprosy and suggest
that complement activation is associated with the release of bacterial antigens in
tissue.
8. Amyotrophic lateral sclerosis and the immune system
Amyotrophic lateral sclerosis (ALS) is a severe adult-onset motor neuron disease
that is associated with dementia [93], sensory abnormalities [94] and autonomic
dysfunction [95]. It is characterized by progressive loss of motor neurons and
degeneration of the neuromuscular junction/ motor end-plate, leading to muscle
atrophy and eventually death from respiratory paralysis [96] . With rare exceptions,
the cause of disease and the mechanism of motor neuron injury are unknown.
Pathogenesis in ALS includes internal factors in the motor neuron such as
accumulation of different dysfunctional proteins such as TDP43 [97;98], glutamate
toxicity [99] and altered mitochondrial dysfunction [100]. Also external factors have
been associated with damage to the motor neurons, this is known as non-cell
autonomous damage [101;102]. An example of this are astrocytes, which have been
suggested to cause damage to the motor neurons [103].
Genetic and environmental factors have also been associated with ALS. Most ALS
cases (90%) are sporadic ALS while 10% are familial ALS. Several genes have been
identified for familial ALS. C9orf72, SOD1, FUS, TARDBP are the most frequently
affected genes implicated in familial ALS [104]. The most studied gene is SOD-1
(copper/zinc superoxide dismutase 1), that accounts for 10–20% of familial ALS
[105]. Transgenic mice expressing mutated SOD1 (SOD1G93A) develop a
pathological and clinical phenotype resembling human ALS [106;107]. The reason for
toxicity of SOD1 is not fully understood, but it is known that expression of SOD1 in
microglia and astrocytes contributes to disease progression in ALS [102].
Inflammation and immune abnormalities have been found in the ALS mouse models
with mutations in the SOD1 gene and in tissue, blood and CSF of ALS patients. The
1
Introduction
29
trigger demyelination. Therefore, treatment of the patients infected with M. leprae
should be treated on time to avoid more nerve damage. This is why it is important
that the infection is treated right away; before too much damage to the nervous
system is done. Since leprosy patients experience nerve damage even after
treatment understanding the mechanisms of nerve damage by M. lepae and
determining what the modifiers are of the disease is important for a better treatment.
Both host genetic factors [85], and the immune system, including the complement
system are associated with susceptibility to leprosy [86-88]. Recent published data
shows that complement Factor H polymorphisms are associated with susceptibility
to leprosy [89;90].Previous serological studies showed reduced complement
hemolytic activity and reduced levels of C4 in LL patients suggesting consumption of
complement in the circulation via activation of the classical or lectin pathway [88;91].
Also an increased C1q binding activity was measured in LL patients with ENL
reactions suggesting involvement of the classical pathway in these patients, and
increased C3d levels in 70% of patients with ENL and 18% of patients with
uncomplicated LL. In addition, deposits of the membrane attack complex (MAC) have
been found on the damaged nerves of LL but not TT leprosy patients [92]. This
suggests a possible role for complement as a disease modifier in leprosy. We
suggest an important role for complement in nerve damage in leprosy and suggest
that complement activation is associated with the release of bacterial antigens in
tissue.
8. Amyotrophic lateral sclerosis and the immune system
Amyotrophic lateral sclerosis (ALS) is a severe adult-onset motor neuron disease
that is associated with dementia [93], sensory abnormalities [94] and autonomic
dysfunction [95]. It is characterized by progressive loss of motor neurons and
degeneration of the neuromuscular junction/ motor end-plate, leading to muscle
atrophy and eventually death from respiratory paralysis [96] . With rare exceptions,
the cause of disease and the mechanism of motor neuron injury are unknown.
Pathogenesis in ALS includes internal factors in the motor neuron such as
accumulation of different dysfunctional proteins such as TDP43 [97;98], glutamate
toxicity [99] and altered mitochondrial dysfunction [100]. Also external factors have
been associated with damage to the motor neurons, this is known as non-cell
autonomous damage [101;102]. An example of this are astrocytes, which have been
suggested to cause damage to the motor neurons [103].
Genetic and environmental factors have also been associated with ALS. Most ALS
cases (90%) are sporadic ALS while 10% are familial ALS. Several genes have been
identified for familial ALS. C9orf72, SOD1, FUS, TARDBP are the most frequently
affected genes implicated in familial ALS [104]. The most studied gene is SOD-1
(copper/zinc superoxide dismutase 1), that accounts for 10–20% of familial ALS
[105]. Transgenic mice expressing mutated SOD1 (SOD1G93A) develop a
pathological and clinical phenotype resembling human ALS [106;107]. The reason for
toxicity of SOD1 is not fully understood, but it is known that expression of SOD1 in
microglia and astrocytes contributes to disease progression in ALS [102].
Inflammation and immune abnormalities have been found in the ALS mouse models
with mutations in the SOD1 gene and in tissue, blood and CSF of ALS patients. The
Chapter 1
30
abnormalities might contribute to the pathogenesis of disease. Previous reviews on
inflammation in ALS suggest the possibility of treating ALS patients by immune
modulation. Inflammation at the site of disease could be a response to damage
through activation of the innate immune system [108], by cells ‘’sensing’’ molecules
released from damaged tissue [109]. An example of this is the release of
mitochondrial DAMPs that cause an inflammatory response after injury [110]. The
inflammatory response includes activation of the innate immune response, which
involves microglial activation [111-113], upregulation of TLR4 signalling genes in ALS
patients and a consistent activation of monocytes and macrophages [114]. In the
areas of motor neurons destruction in the CNS of human ALS, inflammation results in
infiltrating immune cells including macrophages, mast cells [115] and T cells
[111;116;117]. In addition, immunoglobulins have been detected in the spinal cord
and motor cortex of ALS patients[118]. A more recent study shows an increase in
IgG levels in ALS patients compared to controls [119].
The complement system is also suggested to play a role in the pathology of ALS.
Complement deposits have been detected in the spinal cord and motor cortex of ALS
patients [120]. An increased number of CD4+ T helper cells was measured in blood
of sporadic ALS patients compared to controls [121]. There are increased levels of
circulating chemokines and cytokines in ALS. T cells producing IL-13 have been
found in blood of ALS patients and correlate with the disease progression [122]. Also,
increased levels of the cytokine IL-17 are found in serum of ALS patients [123].
Higher levels of chemokine MCP-1 are found in ALS patients with a more severe and
rapidly progressive disease course [124].
A role for complement in the pathogenesis of ALS in humans is suggested by
elevated concentrations of complement activation products in serum and
cerebrospinal fluid [125]. We previously showed that mRNA and protein levels of
complement proteins (C1q, C4, C3 and MAC) are elevated in spinal cord and motor
cortex of patients with sporadic ALS [125]. In murine ALS models, C1q and C4 are
upregulated in motor neurons [126;127], whereas C3 is upregulated in the anterior
horn areas containing motor neuron degeneration [128].
Other studies have also shown upregulation of the major proinflammatory C5a
receptor, during disease progression in mouse motor neurons [129]. SOD1G93A rats
treated with C5aR antagonist displayed a significant extension of survival time and a
reduction in end-stage motor scores, suggesting an important role for complement in
the disease progression [128]. Increased expression of complement components
C1qB, C4, factors B, C3, C5 and a decrease in the expression of the regulators
CD55 (regulator of C3) and CD59a (regulator of MAC) was detected in the lumbar
spinal cord of SOD1G93A mice [130]. Pathological evidence from human ALS and
animal models suggests that neurodegeneration begins at the muscle endplates
proceeding in a ‘‘dying back’’ pattern towards spinal neurons [131].
1
Introduction
31
abnormalities might contribute to the pathogenesis of disease. Previous reviews on
inflammation in ALS suggest the possibility of treating ALS patients by immune
modulation. Inflammation at the site of disease could be a response to damage
through activation of the innate immune system [108], by cells ‘’sensing’’ molecules
released from damaged tissue [109]. An example of this is the release of
mitochondrial DAMPs that cause an inflammatory response after injury [110]. The
inflammatory response includes activation of the innate immune response, which
involves microglial activation [111-113], upregulation of TLR4 signalling genes in ALS
patients and a consistent activation of monocytes and macrophages [114]. In the
areas of motor neurons destruction in the CNS of human ALS, inflammation results in
infiltrating immune cells including macrophages, mast cells [115] and T cells
[111;116;117]. In addition, immunoglobulins have been detected in the spinal cord
and motor cortex of ALS patients[118]. A more recent study shows an increase in
IgG levels in ALS patients compared to controls [119].
The complement system is also suggested to play a role in the pathology of ALS.
Complement deposits have been detected in the spinal cord and motor cortex of ALS
patients [120]. An increased number of CD4+ T helper cells was measured in blood
of sporadic ALS patients compared to controls [121]. There are increased levels of
circulating chemokines and cytokines in ALS. T cells producing IL-13 have been
found in blood of ALS patients and correlate with the disease progression [122]. Also,
increased levels of the cytokine IL-17 are found in serum of ALS patients [123].
Higher levels of chemokine MCP-1 are found in ALS patients with a more severe and
rapidly progressive disease course [124].
A role for complement in the pathogenesis of ALS in humans is suggested by
elevated concentrations of complement activation products in serum and
cerebrospinal fluid [125]. We previously showed that mRNA and protein levels of
complement proteins (C1q, C4, C3 and MAC) are elevated in spinal cord and motor
cortex of patients with sporadic ALS [125]. In murine ALS models, C1q and C4 are
upregulated in motor neurons [126;127], whereas C3 is upregulated in the anterior
horn areas containing motor neuron degeneration [128].
Other studies have also shown upregulation of the major proinflammatory C5a
receptor, during disease progression in mouse motor neurons [129]. SOD1G93A rats
treated with C5aR antagonist displayed a significant extension of survival time and a
reduction in end-stage motor scores, suggesting an important role for complement in
the disease progression [128]. Increased expression of complement components
C1qB, C4, factors B, C3, C5 and a decrease in the expression of the regulators
CD55 (regulator of C3) and CD59a (regulator of MAC) was detected in the lumbar
spinal cord of SOD1G93A mice [130]. Pathological evidence from human ALS and
animal models suggests that neurodegeneration begins at the muscle endplates
proceeding in a ‘‘dying back’’ pattern towards spinal neurons [131].
Chapter 1
32
Aim outline thesis
An informative way to study the role of the complement system in neurodegeneration
is testing the effect of complement inhibition in different disease models. Insight in
the proces of Wallerian degeneration helps understanding the mechanisms of
neurodegeneration in diseases [132]. We have demonstrated that both genetic and
pharmacological inhibition of the complement system on the level of MAC formation
protect the peripheral nerve from early axon loss after injury [61-64] and stimulate
post-traumatic axonal regeneration and functional recovery [64]. To show this, we
used a drug which inhibits C6 to block MAC formation. C6 is one of the proteins
necessary to form the MAC. This protein is mainly produced in the liver. The C6
inhibiting drug is a modified oligonucleotide that uses antisense principles to target
the mRNA of C6. Inhibition of C6 is not expected to cause side effects because prior
studies have shown that the C6 protein (and presumably MAC formation) is not
essential in humans. Our in house-developed C6 inhibitor is an effective and
selective inhibitor of the terminal complement pathway and is expected to be more
safe in humans than other complement inhibitors on the market.
We showed that C6 RNA antagonist substantially lowered expression of C6 mRNA in
the liver and C6 protein in circulation and reduced MAC activity in treated mice. The
knockdown effect lasts for several weeks after treatment. Importantly, the RNA
antagonist is stable with no overt toxicity in mice.
The hypothesis of this project is that complement activation contributes to
neurodegeneration in leprosy and Amyotrophic lateral sclerosis.
The aim of this thesis is to understand the role of the complement system, especially
the terminal complement pathway, in the pheripheral nerve degenerion in Leprosy
and motor end-plate pathology in Amyotrophic lateral sclerosis.
More specifically, the aim of the leprosy project is (1) to determine whether
complement is deposited on nerves in a mouse model of M. leprae induced nerve
damage, (2) to determine whether complement inhibition in this model is
neuroprotective (3) and to determine whether and where complement is activated in
serum and deposited in skin and nerve biopsies of leprosy patients along the disease
spectrum.
The aim of the ALS project is (1) to determine whether complement is deposited at
the neuromuscular junction of the SOD1G93A mouse model at the pre symptomatic,
the symptomatic and the end-stage of the disease (2) to determine whether
complement inhibition affects the disease progression in a mouse model of ALS (3)
and to determine whether complement activation products and regulators are
deposited on the neuromuscular junctions in human ALS post-mortem tissue.
Chapter 2 of this thesis shows the effect of complement inhibition in an mouse model
for M. leprae- induced nerve damage. In Chapter 3 the levels of complement
activation products and regulators in serum samples of leprosy patients with and
without reactions are presented. Chapter 4 presents the role of complement and
inflammatory cells in skin lesions of leprosy patients. In Chapter 5 presents
complement deposition on motor end-plates of SOD1G93A mice at the
presymptomatic, symptomactic and end stage of the disease. In Chapter 6
complement activation products and regulators are shown deposited on motor end-
plates in post-mortem intercostal muscle of ALS patients. Chapter 7 describes the
effect of complement inhibition in SOD1G93A mice on the survival, body weight and
1
Introduction
33
Aim outline thesis
An informative way to study the role of the complement system in neurodegeneration
is testing the effect of complement inhibition in different disease models. Insight in
the proces of Wallerian degeneration helps understanding the mechanisms of
neurodegeneration in diseases [132]. We have demonstrated that both genetic and
pharmacological inhibition of the complement system on the level of MAC formation
protect the peripheral nerve from early axon loss after injury [61-64] and stimulate
post-traumatic axonal regeneration and functional recovery [64]. To show this, we
used a drug which inhibits C6 to block MAC formation. C6 is one of the proteins
necessary to form the MAC. This protein is mainly produced in the liver. The C6
inhibiting drug is a modified oligonucleotide that uses antisense principles to target
the mRNA of C6. Inhibition of C6 is not expected to cause side effects because prior
studies have shown that the C6 protein (and presumably MAC formation) is not
essential in humans. Our in house-developed C6 inhibitor is an effective and
selective inhibitor of the terminal complement pathway and is expected to be more
safe in humans than other complement inhibitors on the market.
We showed that C6 RNA antagonist substantially lowered expression of C6 mRNA in
the liver and C6 protein in circulation and reduced MAC activity in treated mice. The
knockdown effect lasts for several weeks after treatment. Importantly, the RNA
antagonist is stable with no overt toxicity in mice.
The hypothesis of this project is that complement activation contributes to
neurodegeneration in leprosy and Amyotrophic lateral sclerosis.
The aim of this thesis is to understand the role of the complement system, especially
the terminal complement pathway, in the pheripheral nerve degenerion in Leprosy
and motor end-plate pathology in Amyotrophic lateral sclerosis.
More specifically, the aim of the leprosy project is (1) to determine whether
complement is deposited on nerves in a mouse model of M. leprae induced nerve
damage, (2) to determine whether complement inhibition in this model is
neuroprotective (3) and to determine whether and where complement is activated in
serum and deposited in skin and nerve biopsies of leprosy patients along the disease
spectrum.
The aim of the ALS project is (1) to determine whether complement is deposited at
the neuromuscular junction of the SOD1G93A mouse model at the pre symptomatic,
the symptomatic and the end-stage of the disease (2) to determine whether
complement inhibition affects the disease progression in a mouse model of ALS (3)
and to determine whether complement activation products and regulators are
deposited on the neuromuscular junctions in human ALS post-mortem tissue.
Chapter 2 of this thesis shows the effect of complement inhibition in an mouse model
for M. leprae- induced nerve damage. In Chapter 3 the levels of complement
activation products and regulators in serum samples of leprosy patients with and
without reactions are presented. Chapter 4 presents the role of complement and
inflammatory cells in skin lesions of leprosy patients. In Chapter 5 presents
complement deposition on motor end-plates of SOD1G93A mice at the
presymptomatic, symptomactic and end stage of the disease. In Chapter 6
complement activation products and regulators are shown deposited on motor end-
plates in post-mortem intercostal muscle of ALS patients. Chapter 7 describes the
effect of complement inhibition in SOD1G93A mice on the survival, body weight and
Chapter 1
34
neurological score. In Chapter 8 all the findings from each study reported in this
thesis are summarized and discussed.
References
[1] King RH, Tournev I, Colomer J, Merlini L, Kalaydjieva L, Thomas PK: Ultrastructural changes in peripheral nerve in hereditary motor and sensory neuropathy-Lom. Neuropathol Appl Neurobiol 1999;25:306-312.
[2] Stoll G, Jander S, Myers RR: Degeneration and regeneration of the peripheral nervous system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 2002;7:13-27.
[3] LeBlanc AC, Poduslo JF: Axonal modulation of myelin gene expression in the peripheral nerve. J Neurosci Res 1990;26:317-326.
[4] Kiefer R, Kieseier BC, Stoll G, Hartung HP: The role of macrophages in immune-mediated damage to the peripheral nervous system. Prog Neurobiol 2001;64:109-127.
[5] Makwana M, Raivich G: Molecular mechanisms in successful peripheral regeneration. FEBS J 2005;272:2628-2638.
[6] Chen ZL, Yu WM, Strickland S: Peripheral regeneration. Annu Rev Neurosci 2007;30:209-233.
[7] Barrette B, Hebert MA, Filali M, Lafortune K, Vallieres N, Gowing G, Julien JP, Lacroix S: Requirement of myeloid cells for axon regeneration. J Neurosci 17-9-2008;28:9363-9376.
[8] Narciso MS, Mietto BS, Marques SA, Soares CP, Mermelstein CS, El-Cheikh MC, Martinez AM: Sciatic nerve regeneration is accelerated in galectin-3 knockout mice. Exp Neurol 2009;217:7-15.
[9] Mietto BS, Jurgensen S, Alves L, Pecli C, Narciso MS, Assuncao-Miranda I, Villa-Verde DM, de Souza Lima FR, de Menezes JR, Benjamim CF, Bozza MT, Martinez AM: Lack of galectin-3 speeds Wallerian degeneration by altering TLR and pro-inflammatory cytokine expressions in injured sciatic nerve. Eur J Neurosci 2013;37:1682-1690.
[10] Tessier-Lavigne M, Goodman CS: The molecular biology of axon guidance. Science 15-11-1996;274:1123-1133.
[11] Yu TW, Bargmann CI: Dynamic regulation of axon guidance. Nat Neurosci 2001;4 Suppl:1169-1176.
[12] Nguyen QT, Sanes JR, Lichtman JW: Pre-existing pathways promote precise projection patterns. Nat Neurosci 2002;5:861-867.
[13] Baker RS, Stava MW, Nelson KR, May PJ, Huffman MD, Porter JD: Aberrant reinnervation of facial musculature in a subhuman primate: a correlative analysis of eyelid kinematics, muscle synkinesis, and motoneuron localization. Neurology 1994;44:2165-2173.
[14] Lundborg G, Rosen B: Hand function after nerve repair. Acta Physiol (Oxf) 2007;189:207-217.
[15] Gaudet AD, Popovich PG, Ramer MS: Wallerian degeneration: gaining perspective on inflammatory events after peripheral nerve injury. J Neuroinflammation 2011;8:110.
[16] Rotshenker S: Wallerian degeneration: the innate-immune response to traumatic nerve injury. J Neuroinflammation 2011;8:109.
[17] Bastien D, Lacroix S: Cytokine pathways regulating glial and leukocyte function after spinal cord and peripheral nerve injury. Exp Neurol 2014;258:62-77.
[18] DeFrancesco-Lisowitz A, Lindborg JA, Niemi JP, Zigmond RE: The neuroimmunology of degeneration and regeneration in the peripheral nervous system. Neuroscience 27-8-2015;302:174-203.
[19] Kim D, Lee S, Lee SJ: Toll-like receptors in peripheral nerve injury and neuropathic pain. Curr Top Microbiol Immunol 2009;336:169-186.
[20] Pineau I, Lacroix S: Endogenous signals initiating inflammation in the injured nervous system. Glia 2009;57:351-361.
[21] Mueller M, Wacker K, Ringelstein EB, Hickey WF, Imai Y, Kiefer R: Rapid response of identified resident endoneurial macrophages to nerve injury. Am J Pathol 2001;159:2187-2197.
[22] Mueller M, Leonhard C, Wacker K, Ringelstein EB, Okabe M, Hickey WF, Kiefer R: Macrophage response to peripheral nerve injury: the quantitative contribution of resident and hematogenous macrophages. Lab Invest 2003;83:175-185.
[23] Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R: Lesion response of long-term and recently immigrated resident endoneurial macrophages in peripheral nerve explant cultures from bone marrow chimeric mice. Eur J Neurosci 2002;16:1654-1660.
[24] Zedler S, Faist E: The impact of endogenous triggers on trauma-associated inflammation. Curr Opin Crit Care 2006;12:595-601.
[25] Lee H, Jo EK, Choi SY, Oh SB, Park K, Kim JS, Lee SJ: Necrotic neuronal cells induce inflammatory Schwann cell activation via TLR2 and TLR3: implication in Wallerian degeneration. Biochem Biophys Res Commun 24-11-2006;350:742-747.
[26] Wekerle H, Schwab M, Linington C, Meyermann R: Antigen presentation in the peripheral nervous system: Schwann cells present endogenous myelin autoantigens to lymphocytes. Eur J Immunol 1986;16:1551-1557.
[27] Baetas-da-Cruz W, Alves L, Guimaraes EV, Santos-Silva A, Pessolani MC, Barbosa HS, Corte-Real S, Cavalcante LA: Efficient uptake of mannosylated proteins by a human Schwann cell line. Histol Histopathol 2009;24:1029-1034.
[28] Boivin A, Pineau I, Barrette B, Filali M, Vallieres N, Rivest S, Lacroix S: Toll-like receptor signaling is critical for Wallerian degeneration and functional recovery after peripheral nerve injury. J Neurosci 14-11-2007;27:12565-12576.
[29] Malbouisson AM, Ghabriel MN, Allt G: Axonal degeneration in large and small nerve fibres. An electron-microscopic and morphometric study. J Neurol Sci 1985;67:307-318.
[30] Martinez AM, Canavarro S: Early myelin breakdown following sural nerve crush: a freeze-fracture study. Braz J Med Biol Res 2000;33:1477-1482.
[31] Raff MC, Whitmore AV, Finn JT: Axonal self-destruction and neurodegeneration. Science 3-5-2002;296:868-871.
1
Introduction
35
neurological score. In Chapter 8 all the findings from each study reported in this
thesis are summarized and discussed.
References
[1] King RH, Tournev I, Colomer J, Merlini L, Kalaydjieva L, Thomas PK: Ultrastructural changes in peripheral nerve in hereditary motor and sensory neuropathy-Lom. Neuropathol Appl Neurobiol 1999;25:306-312.
[2] Stoll G, Jander S, Myers RR: Degeneration and regeneration of the peripheral nervous system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 2002;7:13-27.
[3] LeBlanc AC, Poduslo JF: Axonal modulation of myelin gene expression in the peripheral nerve. J Neurosci Res 1990;26:317-326.
[4] Kiefer R, Kieseier BC, Stoll G, Hartung HP: The role of macrophages in immune-mediated damage to the peripheral nervous system. Prog Neurobiol 2001;64:109-127.
[5] Makwana M, Raivich G: Molecular mechanisms in successful peripheral regeneration. FEBS J 2005;272:2628-2638.
[6] Chen ZL, Yu WM, Strickland S: Peripheral regeneration. Annu Rev Neurosci 2007;30:209-233.
[7] Barrette B, Hebert MA, Filali M, Lafortune K, Vallieres N, Gowing G, Julien JP, Lacroix S: Requirement of myeloid cells for axon regeneration. J Neurosci 17-9-2008;28:9363-9376.
[8] Narciso MS, Mietto BS, Marques SA, Soares CP, Mermelstein CS, El-Cheikh MC, Martinez AM: Sciatic nerve regeneration is accelerated in galectin-3 knockout mice. Exp Neurol 2009;217:7-15.
[9] Mietto BS, Jurgensen S, Alves L, Pecli C, Narciso MS, Assuncao-Miranda I, Villa-Verde DM, de Souza Lima FR, de Menezes JR, Benjamim CF, Bozza MT, Martinez AM: Lack of galectin-3 speeds Wallerian degeneration by altering TLR and pro-inflammatory cytokine expressions in injured sciatic nerve. Eur J Neurosci 2013;37:1682-1690.
[10] Tessier-Lavigne M, Goodman CS: The molecular biology of axon guidance. Science 15-11-1996;274:1123-1133.
[11] Yu TW, Bargmann CI: Dynamic regulation of axon guidance. Nat Neurosci 2001;4 Suppl:1169-1176.
[12] Nguyen QT, Sanes JR, Lichtman JW: Pre-existing pathways promote precise projection patterns. Nat Neurosci 2002;5:861-867.
[13] Baker RS, Stava MW, Nelson KR, May PJ, Huffman MD, Porter JD: Aberrant reinnervation of facial musculature in a subhuman primate: a correlative analysis of eyelid kinematics, muscle synkinesis, and motoneuron localization. Neurology 1994;44:2165-2173.
[14] Lundborg G, Rosen B: Hand function after nerve repair. Acta Physiol (Oxf) 2007;189:207-217.
[15] Gaudet AD, Popovich PG, Ramer MS: Wallerian degeneration: gaining perspective on inflammatory events after peripheral nerve injury. J Neuroinflammation 2011;8:110.
[16] Rotshenker S: Wallerian degeneration: the innate-immune response to traumatic nerve injury. J Neuroinflammation 2011;8:109.
[17] Bastien D, Lacroix S: Cytokine pathways regulating glial and leukocyte function after spinal cord and peripheral nerve injury. Exp Neurol 2014;258:62-77.
[18] DeFrancesco-Lisowitz A, Lindborg JA, Niemi JP, Zigmond RE: The neuroimmunology of degeneration and regeneration in the peripheral nervous system. Neuroscience 27-8-2015;302:174-203.
[19] Kim D, Lee S, Lee SJ: Toll-like receptors in peripheral nerve injury and neuropathic pain. Curr Top Microbiol Immunol 2009;336:169-186.
[20] Pineau I, Lacroix S: Endogenous signals initiating inflammation in the injured nervous system. Glia 2009;57:351-361.
[21] Mueller M, Wacker K, Ringelstein EB, Hickey WF, Imai Y, Kiefer R: Rapid response of identified resident endoneurial macrophages to nerve injury. Am J Pathol 2001;159:2187-2197.
[22] Mueller M, Leonhard C, Wacker K, Ringelstein EB, Okabe M, Hickey WF, Kiefer R: Macrophage response to peripheral nerve injury: the quantitative contribution of resident and hematogenous macrophages. Lab Invest 2003;83:175-185.
[23] Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R: Lesion response of long-term and recently immigrated resident endoneurial macrophages in peripheral nerve explant cultures from bone marrow chimeric mice. Eur J Neurosci 2002;16:1654-1660.
[24] Zedler S, Faist E: The impact of endogenous triggers on trauma-associated inflammation. Curr Opin Crit Care 2006;12:595-601.
[25] Lee H, Jo EK, Choi SY, Oh SB, Park K, Kim JS, Lee SJ: Necrotic neuronal cells induce inflammatory Schwann cell activation via TLR2 and TLR3: implication in Wallerian degeneration. Biochem Biophys Res Commun 24-11-2006;350:742-747.
[26] Wekerle H, Schwab M, Linington C, Meyermann R: Antigen presentation in the peripheral nervous system: Schwann cells present endogenous myelin autoantigens to lymphocytes. Eur J Immunol 1986;16:1551-1557.
[27] Baetas-da-Cruz W, Alves L, Guimaraes EV, Santos-Silva A, Pessolani MC, Barbosa HS, Corte-Real S, Cavalcante LA: Efficient uptake of mannosylated proteins by a human Schwann cell line. Histol Histopathol 2009;24:1029-1034.
[28] Boivin A, Pineau I, Barrette B, Filali M, Vallieres N, Rivest S, Lacroix S: Toll-like receptor signaling is critical for Wallerian degeneration and functional recovery after peripheral nerve injury. J Neurosci 14-11-2007;27:12565-12576.
[29] Malbouisson AM, Ghabriel MN, Allt G: Axonal degeneration in large and small nerve fibres. An electron-microscopic and morphometric study. J Neurol Sci 1985;67:307-318.
[30] Martinez AM, Canavarro S: Early myelin breakdown following sural nerve crush: a freeze-fracture study. Braz J Med Biol Res 2000;33:1477-1482.
[31] Raff MC, Whitmore AV, Finn JT: Axonal self-destruction and neurodegeneration. Science 3-5-2002;296:868-871.
Chapter 1
36
[32] Wang JT, Medress ZA, Barres BA: Axon degeneration: molecular mechanisms of a self-destruction pathway. J Cell Biol 9-1-2012;196:7-18.
[33] Vargas ME, Watanabe J, Singh SJ, Robinson WH, Barres BA: Endogenous antibodies promote rapid myelin clearance and effective axon regeneration after nerve injury. Proc Natl Acad Sci U S A 29-6-2010;107:11993-11998.
[34] Fernandez-Valle C, Bunge RP, Bunge MB: Schwann cells degrade myelin and proliferate in the absence of macrophages: evidence from in vitro studies of Wallerian degeneration. J Neurocytol 1995;24:667-679.
[35] Perry VH, Tsao JW, Fearn S, Brown MC: Radiation-induced reductions in macrophage recruitment have only slight effects on myelin degeneration in sectioned peripheral nerves of mice. Eur J Neurosci 1-2-1995;7:271-280.
[36] David S, Kroner A: Repertoire of microglial and macrophage responses after spinal cord injury. Nat Rev Neurosci 2011;12:388-399.
[37] Shamash S, Reichert F, Rotshenker S: The cytokine network of Wallerian degeneration: tumor necrosis factor-alpha, interleukin-1alpha, and interleukin-1beta. J Neurosci 15-4-2002;22:3052-3060.
[38] Be'eri H, Reichert F, Saada A, Rotshenker S: The cytokine network of wallerian degeneration: IL-10 and GM-CSF. Eur J Neurosci 1998;10:2707-2713.
[39] Perrin FE, Lacroix S, Aviles-Trigueros M, David S: Involvement of monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha and interleukin-1beta in Wallerian degeneration. Brain 2005;128:854-866.
[40] Murakami M, Nakatani Y, Atsumi G, Inoue K, Kudo I: Regulatory functions of phospholipase A2. Crit Rev Immunol 1997;17:225-283.
[41] De S, Trigueros MA, Kalyvas A, David S: Phospholipase A2 plays an important role in myelin breakdown and phagocytosis during Wallerian degeneration. Mol Cell Neurosci 2003;24:753-765.
[42] Martini R, Fischer S, Lopez-Vales R, David S: Interactions between Schwann cells and macrophages in injury and inherited demyelinating disease. Glia 1-11-2008;56:1566-1577.
[43] Gilley J, Coleman MP: Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biol 2010;8:e1000300.
[44] Ricklin D, Hajishengallis G, Yang K, Lambris JD: Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-797.
[45] Stevens B, Allen NJ, Vazquez LE, Howell GR, Christopherson KS, Nouri N, Micheva KD, Mehalow AK, Huberman AD, Stafford B, Sher A, Litke AM, Lambris JD, Smith SJ, John SW, Barres BA: The classical complement cascade mediates CNS synapse elimination. Cell 14-12-2007;131:1164-1178.
[46] Muller-Eberhard HJ, Gotze O: C3 proactivator convertase and its mode of action. J Exp Med 1-4-1972;135:1003-1008.
[47] Atkinson JP, Frank MM: Bypassing complement: evolutionary lessons and future implications. J Clin Invest 2006;116:1215-1218.
[48] Atkinson JP, Oglesby TJ, White D, Adams EA, Liszewski MK: Separation of self from non-self in the complement system: a role for membrane cofactor protein and decay accelerating factor. Clin Exp Immunol 1991;86 Suppl 1:27-30.
[49] Kim DD, Song WC: Membrane complement regulatory proteins. Clin Immunol 2006;118:127-136.
[50] Kirkitadze MD, Barlow PN: Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunol Rev 2001;180:146-161.
[51] Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP: Control of the complement system. Adv Immunol 1996;61:201-283.
[52] Harris CL, Rushmere NK, Morgan BP: Molecular and functional analysis of mouse decay accelerating factor (CD55). Biochem J 1-8-1999;341 ( Pt 3):821-829.
[53] Wiesmann C, Katschke KJ, Yin J, Helmy KY, Steffek M, Fairbrother WJ, McCallum SA, Embuscado L, DeForge L, Hass PE, van Lookeren CM: Structure of C3b in complex with CRIg gives insights into regulation of complement activation. Nature 9-11-2006;444:217-220.
[54] Koski CL, Vanguri P, Shin ML: Activation of the alternative pathway of complement by human peripheral nerve myelin. J Immunol 1985;134:1810-1814.
[55] Vanguri P, Koski CL, Silverman B, Shin ML: Complement activation by isolated myelin: activation of the classical pathway in the absence of myelin-specific antibodies. Proc Natl Acad Sci U S A 1982;79:3290-3294.
[56] de Jonge RR, van Schaik IN, Vreijling JP, Troost D, Baas F: Expression of complement components in the peripheral nervous system. Hum Mol Genet 1-2-2004;13:295-302.
[57] Reichert F, Rotshenker S: Complement-receptor-3 and scavenger-receptor-AI/II mediated myelin phagocytosis in microglia and macrophages. Neurobiol Dis 2003;12:65-72.
[58] Makranz C, Cohen G, Reichert F, Kodama T, Rotshenker S: cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 2006;53:441-448.
[59] Dailey AT, Avellino AM, Benthem L, Silver J, Kliot M: Complement depletion reduces macrophage infiltration and activation during Wallerian degeneration and axonal regeneration. J Neurosci 1-9-1998;18:6713-6722.
[60] Liu L, Lioudyno M, Tao R, Eriksson P, Svensson M, Aldskogius H: Hereditary absence of complement C5 in adult mice influences Wallerian degeneration, but not retrograde responses, following injury to peripheral nerve. J Peripher Nerv Syst 1999;4:123-133.
[61] Ramaglia V, King RH, Nourallah M, Wolterman R, de JR, Ramkema M, Vigar MA, van der Wetering S, Morgan BP, Troost D, Baas F: The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 18-7-2007;27:7663-7672.
[62] Ramaglia V, King RH, Morgan BP, Baas F: Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009;46:1892-1896.
[63] Ramaglia V, Wolterman R, de KM, Vigar MA, Wagenaar-Bos I, King RH, Morgan BP, Baas F: Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-1052.
[64] Ramaglia V, Tannemaat MR, de KM, Wolterman R, Vigar MA, King RH, Morgan BP, Baas F: Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-309.
[65] Stahel PF, Morganti-Kossmann MC, Perez D, Redaelli C, Gloor B, Trentz O, Kossmann T: Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate
1
Introduction
37
[32] Wang JT, Medress ZA, Barres BA: Axon degeneration: molecular mechanisms of a self-destruction pathway. J Cell Biol 9-1-2012;196:7-18.
[33] Vargas ME, Watanabe J, Singh SJ, Robinson WH, Barres BA: Endogenous antibodies promote rapid myelin clearance and effective axon regeneration after nerve injury. Proc Natl Acad Sci U S A 29-6-2010;107:11993-11998.
[34] Fernandez-Valle C, Bunge RP, Bunge MB: Schwann cells degrade myelin and proliferate in the absence of macrophages: evidence from in vitro studies of Wallerian degeneration. J Neurocytol 1995;24:667-679.
[35] Perry VH, Tsao JW, Fearn S, Brown MC: Radiation-induced reductions in macrophage recruitment have only slight effects on myelin degeneration in sectioned peripheral nerves of mice. Eur J Neurosci 1-2-1995;7:271-280.
[36] David S, Kroner A: Repertoire of microglial and macrophage responses after spinal cord injury. Nat Rev Neurosci 2011;12:388-399.
[37] Shamash S, Reichert F, Rotshenker S: The cytokine network of Wallerian degeneration: tumor necrosis factor-alpha, interleukin-1alpha, and interleukin-1beta. J Neurosci 15-4-2002;22:3052-3060.
[38] Be'eri H, Reichert F, Saada A, Rotshenker S: The cytokine network of wallerian degeneration: IL-10 and GM-CSF. Eur J Neurosci 1998;10:2707-2713.
[39] Perrin FE, Lacroix S, Aviles-Trigueros M, David S: Involvement of monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha and interleukin-1beta in Wallerian degeneration. Brain 2005;128:854-866.
[40] Murakami M, Nakatani Y, Atsumi G, Inoue K, Kudo I: Regulatory functions of phospholipase A2. Crit Rev Immunol 1997;17:225-283.
[41] De S, Trigueros MA, Kalyvas A, David S: Phospholipase A2 plays an important role in myelin breakdown and phagocytosis during Wallerian degeneration. Mol Cell Neurosci 2003;24:753-765.
[42] Martini R, Fischer S, Lopez-Vales R, David S: Interactions between Schwann cells and macrophages in injury and inherited demyelinating disease. Glia 1-11-2008;56:1566-1577.
[43] Gilley J, Coleman MP: Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biol 2010;8:e1000300.
[44] Ricklin D, Hajishengallis G, Yang K, Lambris JD: Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-797.
[45] Stevens B, Allen NJ, Vazquez LE, Howell GR, Christopherson KS, Nouri N, Micheva KD, Mehalow AK, Huberman AD, Stafford B, Sher A, Litke AM, Lambris JD, Smith SJ, John SW, Barres BA: The classical complement cascade mediates CNS synapse elimination. Cell 14-12-2007;131:1164-1178.
[46] Muller-Eberhard HJ, Gotze O: C3 proactivator convertase and its mode of action. J Exp Med 1-4-1972;135:1003-1008.
[47] Atkinson JP, Frank MM: Bypassing complement: evolutionary lessons and future implications. J Clin Invest 2006;116:1215-1218.
[48] Atkinson JP, Oglesby TJ, White D, Adams EA, Liszewski MK: Separation of self from non-self in the complement system: a role for membrane cofactor protein and decay accelerating factor. Clin Exp Immunol 1991;86 Suppl 1:27-30.
[49] Kim DD, Song WC: Membrane complement regulatory proteins. Clin Immunol 2006;118:127-136.
[50] Kirkitadze MD, Barlow PN: Structure and flexibility of the multiple domain proteins that regulate complement activation. Immunol Rev 2001;180:146-161.
[51] Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP: Control of the complement system. Adv Immunol 1996;61:201-283.
[52] Harris CL, Rushmere NK, Morgan BP: Molecular and functional analysis of mouse decay accelerating factor (CD55). Biochem J 1-8-1999;341 ( Pt 3):821-829.
[53] Wiesmann C, Katschke KJ, Yin J, Helmy KY, Steffek M, Fairbrother WJ, McCallum SA, Embuscado L, DeForge L, Hass PE, van Lookeren CM: Structure of C3b in complex with CRIg gives insights into regulation of complement activation. Nature 9-11-2006;444:217-220.
[54] Koski CL, Vanguri P, Shin ML: Activation of the alternative pathway of complement by human peripheral nerve myelin. J Immunol 1985;134:1810-1814.
[55] Vanguri P, Koski CL, Silverman B, Shin ML: Complement activation by isolated myelin: activation of the classical pathway in the absence of myelin-specific antibodies. Proc Natl Acad Sci U S A 1982;79:3290-3294.
[56] de Jonge RR, van Schaik IN, Vreijling JP, Troost D, Baas F: Expression of complement components in the peripheral nervous system. Hum Mol Genet 1-2-2004;13:295-302.
[57] Reichert F, Rotshenker S: Complement-receptor-3 and scavenger-receptor-AI/II mediated myelin phagocytosis in microglia and macrophages. Neurobiol Dis 2003;12:65-72.
[58] Makranz C, Cohen G, Reichert F, Kodama T, Rotshenker S: cAMP cascade (PKA, Epac, adenylyl cyclase, Gi, and phosphodiesterases) regulates myelin phagocytosis mediated by complement receptor-3 and scavenger receptor-AI/II in microglia and macrophages. Glia 2006;53:441-448.
[59] Dailey AT, Avellino AM, Benthem L, Silver J, Kliot M: Complement depletion reduces macrophage infiltration and activation during Wallerian degeneration and axonal regeneration. J Neurosci 1-9-1998;18:6713-6722.
[60] Liu L, Lioudyno M, Tao R, Eriksson P, Svensson M, Aldskogius H: Hereditary absence of complement C5 in adult mice influences Wallerian degeneration, but not retrograde responses, following injury to peripheral nerve. J Peripher Nerv Syst 1999;4:123-133.
[61] Ramaglia V, King RH, Nourallah M, Wolterman R, de JR, Ramkema M, Vigar MA, van der Wetering S, Morgan BP, Troost D, Baas F: The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 18-7-2007;27:7663-7672.
[62] Ramaglia V, King RH, Morgan BP, Baas F: Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009;46:1892-1896.
[63] Ramaglia V, Wolterman R, de KM, Vigar MA, Wagenaar-Bos I, King RH, Morgan BP, Baas F: Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-1052.
[64] Ramaglia V, Tannemaat MR, de KM, Wolterman R, Vigar MA, King RH, Morgan BP, Baas F: Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-309.
[65] Stahel PF, Morganti-Kossmann MC, Perez D, Redaelli C, Gloor B, Trentz O, Kossmann T: Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate
Chapter 1
38
with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001;18:773-781.
[66] Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR: Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997;73:63-69.
[67] Leinhase I, Holers VM, Thurman JM, Harhausen D, Schmidt OI, Pietzcker M, Taha ME, Rittirsch D, Huber-Lang M, Smith WR, Ward PA, Stahel PF: Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
[68] Rancan M, Morganti-Kossmann MC, Barnum SR, Saft S, Schmidt OI, Ertel W, Stahel PF: Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-1074.
[69] Anderson AJ, Robert S, Huang W, Young W, Cotman CW: Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-1846.
[70] Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM: Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 1-5-2016;129:1928-1939.
[71] Coleman MP, Perry VH: Axon pathology in neurological disease: a neglected therapeutic target. Trends Neurosci 2002;25:532-537.
[72] Bonifati DM, Kishore U: Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.
[73] Walport MJ: Complement. First of two parts. N Engl J Med 5-4-2001;344:1058-1066.
[74] Walport MJ: Complement. Second of two parts. N Engl J Med 12-4-2001;344:1140-1144.
[75] Mead RJ, Singhrao SK, Neal JW, Lassmann H, Morgan BP: The membrane attack complex of complement causes severe demyelination associated with acute axonal injury. J Immunol 1-1-2002;168:458-465.
[76] Hong S, Beja-Glasser VF, Nfonoyim BM, Frouin A, Li S, Ramakrishnan S, Merry KM, Shi Q, Rosenthal A, Barres BA, Lemere CA, Selkoe DJ, Stevens B: Complement and microglia mediate early synapse loss in Alzheimer mouse models. Science 6-5-2016;352:712-716.
[77] Sansarricq H: The WHO leprosy programme. Ann Microbiol (Paris) 1982;133:5-12.
[78] Bleharski JR, Li H, Meinken C, Graeber TG, Ochoa MT, Yamamura M, Burdick A, Sarno EN, Wagner M, Rollinghoff M, Rea TH, Colonna M, Stenger S, Bloom BR, Eisenberg D, Modlin RL: Use of genetic profiling in leprosy to discriminate clinical forms of the disease. Science 12-9-2003;301:1527-1530.
[79] Ridley DS, Jopling WH: Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34:255-273.
[80] Laal S, Bhutani LK, Nath I: Natural emergence of antigen-reactive T cells in lepromatous leprosy patients during erythema nodosum leprosum. Infect Immun 1985;50:887-892.
[81] Byrd SR, Gelber R, Bermudez LE: Roles of soluble fibronectin and beta 1 integrin receptors in the binding of Mycobacterium leprae to nasal epithelial cells. Clin Immunol Immunopathol 1993;69:266-271.
[82] Brophy PJ: Microbiology. Subversion of Schwann cells and the leper's bell. Science 3-5-2002;296:862-863.
[83] Kaplan G: Recent advances in cytokine therapy in leprosy. J Infect Dis 1993;167 Suppl 1:S18-S22.
[84] Ooi WW, Srinivasan J: Leprosy and the peripheral nervous system: basic and clinical aspects. Muscle Nerve 2004;30:393-409.
[85] Britton WJ, Lockwood DN: Leprosy. Lancet 10-4-2004;363:1209-1219.
[86] Saitz EW, Dierks RE, Shepard CC: Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968;36:400-404.
[87] Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T: Complement profile in leprosy. Am J Trop Med Hyg 1973;22:761-764.
[88] Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL: The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008;78:605-610.
[89] Zhang DF, Huang XQ, Wang D, Li YY, Yao YG: Genetic variants of complement genes ficolin-2, mannose-binding lectin and complement factor H are associated with leprosy in Han Chinese from Southwest China. Hum Genet 2013;132:629-640.
[90] Zhang DF, Wang D, Li YY, Yao YG: Mapping genetic variants in the CFH gene for association with leprosy in Han Chinese. Genes Immun 2014;15:506-510.
[91] Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U: Activation of complement by circulating immune complexes isolated from leprosy patients. Int J Lepr Other Mycobact Dis 1990;58:31-38.
[92] Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK: Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9:195-199.
[93] Geser F, Martinez-Lage M, Kwong LK, Lee VM, Trojanowski JQ: Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. J Neurol 2009;256:1205-1214.
[94] Heads T, Pollock M, Robertson A, Sutherland WH, Allpress S: Sensory nerve pathology in amyotrophic lateral sclerosis. Acta Neuropathol 1991;82:316-320.
[95] Chida K, Sakamaki S, Takasu T: Alteration in autonomic function and cardiovascular regulation in amyotrophic lateral sclerosis. J Neurol 1989;236:127-130.
[96] Mitchell JD, Borasio GD: Amyotrophic lateral sclerosis. Lancet 16-6-2007;369:2031-2041.
[97] Liscic RM, Grinberg LT, Zidar J, Gitcho MA, Cairns NJ: ALS and FTLD: two faces of TDP-43 proteinopathy. Eur J Neurol 2008;15:772-780.
[98] Buratti E, Baralle FE: The molecular links between TDP-43 dysfunction and neurodegeneration. Adv Genet 2009;66:1-34.
[99] Rothstein JD: Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009;65 Suppl 1:S3-S9.
[100] Shi P, Gal J, Kwinter DM, Liu X, Zhu H: Mitochondrial dysfunction in amyotrophic lateral sclerosis. Biochim Biophys Acta 2010;1802:45-51.
[101] Boillee S, Vande VC, Cleveland DW: ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron 5-10-2006;52:39-59.
1
Introduction
39
with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001;18:773-781.
[66] Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR: Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997;73:63-69.
[67] Leinhase I, Holers VM, Thurman JM, Harhausen D, Schmidt OI, Pietzcker M, Taha ME, Rittirsch D, Huber-Lang M, Smith WR, Ward PA, Stahel PF: Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
[68] Rancan M, Morganti-Kossmann MC, Barnum SR, Saft S, Schmidt OI, Ertel W, Stahel PF: Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-1074.
[69] Anderson AJ, Robert S, Huang W, Young W, Cotman CW: Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-1846.
[70] Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM: Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 1-5-2016;129:1928-1939.
[71] Coleman MP, Perry VH: Axon pathology in neurological disease: a neglected therapeutic target. Trends Neurosci 2002;25:532-537.
[72] Bonifati DM, Kishore U: Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.
[73] Walport MJ: Complement. First of two parts. N Engl J Med 5-4-2001;344:1058-1066.
[74] Walport MJ: Complement. Second of two parts. N Engl J Med 12-4-2001;344:1140-1144.
[75] Mead RJ, Singhrao SK, Neal JW, Lassmann H, Morgan BP: The membrane attack complex of complement causes severe demyelination associated with acute axonal injury. J Immunol 1-1-2002;168:458-465.
[76] Hong S, Beja-Glasser VF, Nfonoyim BM, Frouin A, Li S, Ramakrishnan S, Merry KM, Shi Q, Rosenthal A, Barres BA, Lemere CA, Selkoe DJ, Stevens B: Complement and microglia mediate early synapse loss in Alzheimer mouse models. Science 6-5-2016;352:712-716.
[77] Sansarricq H: The WHO leprosy programme. Ann Microbiol (Paris) 1982;133:5-12.
[78] Bleharski JR, Li H, Meinken C, Graeber TG, Ochoa MT, Yamamura M, Burdick A, Sarno EN, Wagner M, Rollinghoff M, Rea TH, Colonna M, Stenger S, Bloom BR, Eisenberg D, Modlin RL: Use of genetic profiling in leprosy to discriminate clinical forms of the disease. Science 12-9-2003;301:1527-1530.
[79] Ridley DS, Jopling WH: Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34:255-273.
[80] Laal S, Bhutani LK, Nath I: Natural emergence of antigen-reactive T cells in lepromatous leprosy patients during erythema nodosum leprosum. Infect Immun 1985;50:887-892.
[81] Byrd SR, Gelber R, Bermudez LE: Roles of soluble fibronectin and beta 1 integrin receptors in the binding of Mycobacterium leprae to nasal epithelial cells. Clin Immunol Immunopathol 1993;69:266-271.
[82] Brophy PJ: Microbiology. Subversion of Schwann cells and the leper's bell. Science 3-5-2002;296:862-863.
[83] Kaplan G: Recent advances in cytokine therapy in leprosy. J Infect Dis 1993;167 Suppl 1:S18-S22.
[84] Ooi WW, Srinivasan J: Leprosy and the peripheral nervous system: basic and clinical aspects. Muscle Nerve 2004;30:393-409.
[85] Britton WJ, Lockwood DN: Leprosy. Lancet 10-4-2004;363:1209-1219.
[86] Saitz EW, Dierks RE, Shepard CC: Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968;36:400-404.
[87] Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T: Complement profile in leprosy. Am J Trop Med Hyg 1973;22:761-764.
[88] Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL: The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008;78:605-610.
[89] Zhang DF, Huang XQ, Wang D, Li YY, Yao YG: Genetic variants of complement genes ficolin-2, mannose-binding lectin and complement factor H are associated with leprosy in Han Chinese from Southwest China. Hum Genet 2013;132:629-640.
[90] Zhang DF, Wang D, Li YY, Yao YG: Mapping genetic variants in the CFH gene for association with leprosy in Han Chinese. Genes Immun 2014;15:506-510.
[91] Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U: Activation of complement by circulating immune complexes isolated from leprosy patients. Int J Lepr Other Mycobact Dis 1990;58:31-38.
[92] Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK: Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9:195-199.
[93] Geser F, Martinez-Lage M, Kwong LK, Lee VM, Trojanowski JQ: Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. J Neurol 2009;256:1205-1214.
[94] Heads T, Pollock M, Robertson A, Sutherland WH, Allpress S: Sensory nerve pathology in amyotrophic lateral sclerosis. Acta Neuropathol 1991;82:316-320.
[95] Chida K, Sakamaki S, Takasu T: Alteration in autonomic function and cardiovascular regulation in amyotrophic lateral sclerosis. J Neurol 1989;236:127-130.
[96] Mitchell JD, Borasio GD: Amyotrophic lateral sclerosis. Lancet 16-6-2007;369:2031-2041.
[97] Liscic RM, Grinberg LT, Zidar J, Gitcho MA, Cairns NJ: ALS and FTLD: two faces of TDP-43 proteinopathy. Eur J Neurol 2008;15:772-780.
[98] Buratti E, Baralle FE: The molecular links between TDP-43 dysfunction and neurodegeneration. Adv Genet 2009;66:1-34.
[99] Rothstein JD: Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009;65 Suppl 1:S3-S9.
[100] Shi P, Gal J, Kwinter DM, Liu X, Zhu H: Mitochondrial dysfunction in amyotrophic lateral sclerosis. Biochim Biophys Acta 2010;1802:45-51.
[101] Boillee S, Vande VC, Cleveland DW: ALS: a disease of motor neurons and their nonneuronal neighbors. Neuron 5-10-2006;52:39-59.
Chapter 1
40
[102] Ilieva H, Polymenidou M, Cleveland DW: Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 14-12-2009;187:761-772.
[103] Aebischer J, Cassina P, Otsmane B, Moumen A, Seilhean D, Meininger V, Barbeito L, Pettmann B, Raoul C: IFNgamma triggers a LIGHT-dependent selective death of motoneurons contributing to the non-cell-autonomous effects of mutant SOD1. Cell Death Differ 2011;18:754-768.
[104] Pasinelli P, Brown RH: Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-723.
[105] Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, .: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 4-3-1993;362:59-62.
[106] Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J, Hentati A, Kwon YW, Deng HX, .: Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 17-6-1994;264:1772-1775.
[107] Gurney ME: Transgenic-mouse model of amyotrophic lateral sclerosis. N Engl J Med 22-12-1994;331:1721-1722.
[108] Papadimitriou D, Le V, V, Jacquier A, Ikiz B, Przedborski S, Re DB: Inflammation in ALS and SMA: sorting out the good from the evil. Neurobiol Dis 2010;37:493-502.
[109] Matzinger P: Tolerance, danger, and the extended family. Annu Rev Immunol 1994;12:991-1045.
[110] Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ: Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 4-3-2010;464:104-107.
[111] McGeer PL, McGeer EG, Kawamata T, Yamada T, Akiyama H: Reactions of the immune system in chronic degenerative neurological diseases. Can J Neurol Sci 1991;18:376-379.
[112] Engelhardt JI, Tajti J, Appel SH: Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993;50:30-36.
[113] McGeer PL, McGeer EG: Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002;26:459-470.
[114] Zhang R, Hadlock KG, Do H, Yu S, Honrada R, Champion S, Forshew D, Madison C, Katz J, Miller RG, McGrath MS: Gene expression profiling in peripheral blood mononuclear cells from patients with sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2011;230:114-123.
[115] Graves MC, Fiala M, Dinglasan LA, Liu NQ, Sayre J, Chiappelli F, van KC, Vinters HV: Inflammation in amyotrophic lateral sclerosis spinal cord and brain is mediated by activated macrophages, mast cells and T cells. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:213-219.
[116] Lawson JM, Tremble J, Dayan C, Beyan H, Leslie RD, Peakman M, Tree TI: Increased resistance to CD4+CD25hi regulatory T cell-mediated suppression in patients with type 1 diabetes. Clin Exp Immunol 2008;154:353-359.
[117] Holmoy T, Roos PM, Kvale EO: ALS: cytokine profile in cerebrospinal fluid T-cell clones. Amyotroph Lateral Scler 2006;7:183-186.
[118] Engelhardt JI, Appel SH: IgG reactivity in the spinal cord and motor cortex in amyotrophic lateral sclerosis. Arch Neurol 1990;47:1210-1216.
[119] Saleh IA, Zesiewicz T, Xie Y, Sullivan KL, Miller AM, Kuzmin-Nichols N, Sanberg PR, Garbuzova-Davis S: Evaluation of humoral immune response in adaptive immunity in ALS patients during disease progression. J Neuroimmunol 30-10-2009;215:96-101.
[120] Donnenfeld H, Kascsak RJ, Bartfeld H: Deposits of IgG and C3 in the spinal cord and motor cortex of ALS patients. J Neuroimmunol 1984;6:51-57.
[121] Zhang R, Gascon R, Miller RG, Gelinas DF, Mass J, Hadlock K, Jin X, Reis J, Narvaez A, McGrath MS: Evidence for systemic immune system alterations in sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2005;159:215-224.
[122] Shi N, Kawano Y, Tateishi T, Kikuchi H, Osoegawa M, Ohyagi Y, Kira J: Increased IL-13-producing T cells in ALS: positive correlations with disease severity and progression rate. J Neuroimmunol 2007;182:232-235.
[123] Fiala M, Chattopadhay M, La CA, Tse E, Liu G, Lourenco E, Eskin A, Liu PT, Magpantay L, Tse S, Mahanian M, Weitzman R, Tong J, Nguyen C, Cho T, Koo P, Sayre J, Martinez-Maza O, Rosenthal MJ, Wiedau-Pazos M: IL-17A is increased in the serum and in spinal cord CD8 and mast cells of ALS patients. J Neuroinflammation 2010;7:76.
[124] Kuhle J, Lindberg RL, Regeniter A, Mehling M, Steck AJ, Kappos L, Czaplinski A: Increased levels of inflammatory chemokines in amyotrophic lateral sclerosis. Eur J Neurol 2009;16:771-774.
[125] Sta M, Sylva-Steenland RM, Casula M, de Jong JM, Troost D, Aronica E, Baas F: Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-220.
[126] Lobsiger CS, Boillee S, Cleveland DW: Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 1-5-2007;104:7319-7326.
[127] Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ: Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 22-8-2007;27:9201-9219.
[128] Woodruff TM, Costantini KJ, Taylor SM, Noakes PG: Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-158.
[129] Humayun S, Gohar M, Volkening K, Moisse K, Leystra-Lantz C, Mepham J, McLean J, Strong MJ: The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 29-5-2009;210:52-62.
[130] Lee JD, Kamaruzaman NA, Fung JN, Taylor SM, Turner BJ, Atkin JD, Woodruff TM, Noakes PG: Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
[131] Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J, Polak MA, Glass JD: Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-240.
[132] Glass JD: Wallerian degeneration as a window to peripheral neuropathy. J Neurol Sci 15-5-2004;220:123-124.
1
Introduction
41
[102] Ilieva H, Polymenidou M, Cleveland DW: Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Biol 14-12-2009;187:761-772.
[103] Aebischer J, Cassina P, Otsmane B, Moumen A, Seilhean D, Meininger V, Barbeito L, Pettmann B, Raoul C: IFNgamma triggers a LIGHT-dependent selective death of motoneurons contributing to the non-cell-autonomous effects of mutant SOD1. Cell Death Differ 2011;18:754-768.
[104] Pasinelli P, Brown RH: Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-723.
[105] Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, .: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 4-3-1993;362:59-62.
[106] Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD, Caliendo J, Hentati A, Kwon YW, Deng HX, .: Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 17-6-1994;264:1772-1775.
[107] Gurney ME: Transgenic-mouse model of amyotrophic lateral sclerosis. N Engl J Med 22-12-1994;331:1721-1722.
[108] Papadimitriou D, Le V, V, Jacquier A, Ikiz B, Przedborski S, Re DB: Inflammation in ALS and SMA: sorting out the good from the evil. Neurobiol Dis 2010;37:493-502.
[109] Matzinger P: Tolerance, danger, and the extended family. Annu Rev Immunol 1994;12:991-1045.
[110] Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ: Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature 4-3-2010;464:104-107.
[111] McGeer PL, McGeer EG, Kawamata T, Yamada T, Akiyama H: Reactions of the immune system in chronic degenerative neurological diseases. Can J Neurol Sci 1991;18:376-379.
[112] Engelhardt JI, Tajti J, Appel SH: Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993;50:30-36.
[113] McGeer PL, McGeer EG: Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002;26:459-470.
[114] Zhang R, Hadlock KG, Do H, Yu S, Honrada R, Champion S, Forshew D, Madison C, Katz J, Miller RG, McGrath MS: Gene expression profiling in peripheral blood mononuclear cells from patients with sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2011;230:114-123.
[115] Graves MC, Fiala M, Dinglasan LA, Liu NQ, Sayre J, Chiappelli F, van KC, Vinters HV: Inflammation in amyotrophic lateral sclerosis spinal cord and brain is mediated by activated macrophages, mast cells and T cells. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:213-219.
[116] Lawson JM, Tremble J, Dayan C, Beyan H, Leslie RD, Peakman M, Tree TI: Increased resistance to CD4+CD25hi regulatory T cell-mediated suppression in patients with type 1 diabetes. Clin Exp Immunol 2008;154:353-359.
[117] Holmoy T, Roos PM, Kvale EO: ALS: cytokine profile in cerebrospinal fluid T-cell clones. Amyotroph Lateral Scler 2006;7:183-186.
[118] Engelhardt JI, Appel SH: IgG reactivity in the spinal cord and motor cortex in amyotrophic lateral sclerosis. Arch Neurol 1990;47:1210-1216.
[119] Saleh IA, Zesiewicz T, Xie Y, Sullivan KL, Miller AM, Kuzmin-Nichols N, Sanberg PR, Garbuzova-Davis S: Evaluation of humoral immune response in adaptive immunity in ALS patients during disease progression. J Neuroimmunol 30-10-2009;215:96-101.
[120] Donnenfeld H, Kascsak RJ, Bartfeld H: Deposits of IgG and C3 in the spinal cord and motor cortex of ALS patients. J Neuroimmunol 1984;6:51-57.
[121] Zhang R, Gascon R, Miller RG, Gelinas DF, Mass J, Hadlock K, Jin X, Reis J, Narvaez A, McGrath MS: Evidence for systemic immune system alterations in sporadic amyotrophic lateral sclerosis (sALS). J Neuroimmunol 2005;159:215-224.
[122] Shi N, Kawano Y, Tateishi T, Kikuchi H, Osoegawa M, Ohyagi Y, Kira J: Increased IL-13-producing T cells in ALS: positive correlations with disease severity and progression rate. J Neuroimmunol 2007;182:232-235.
[123] Fiala M, Chattopadhay M, La CA, Tse E, Liu G, Lourenco E, Eskin A, Liu PT, Magpantay L, Tse S, Mahanian M, Weitzman R, Tong J, Nguyen C, Cho T, Koo P, Sayre J, Martinez-Maza O, Rosenthal MJ, Wiedau-Pazos M: IL-17A is increased in the serum and in spinal cord CD8 and mast cells of ALS patients. J Neuroinflammation 2010;7:76.
[124] Kuhle J, Lindberg RL, Regeniter A, Mehling M, Steck AJ, Kappos L, Czaplinski A: Increased levels of inflammatory chemokines in amyotrophic lateral sclerosis. Eur J Neurol 2009;16:771-774.
[125] Sta M, Sylva-Steenland RM, Casula M, de Jong JM, Troost D, Aronica E, Baas F: Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-220.
[126] Lobsiger CS, Boillee S, Cleveland DW: Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 1-5-2007;104:7319-7326.
[127] Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ: Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 22-8-2007;27:9201-9219.
[128] Woodruff TM, Costantini KJ, Taylor SM, Noakes PG: Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-158.
[129] Humayun S, Gohar M, Volkening K, Moisse K, Leystra-Lantz C, Mepham J, McLean J, Strong MJ: The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 29-5-2009;210:52-62.
[130] Lee JD, Kamaruzaman NA, Fung JN, Taylor SM, Turner BJ, Atkin JD, Woodruff TM, Noakes PG: Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
[131] Fischer LR, Culver DG, Tennant P, Davis AA, Wang M, Castellano-Sanchez A, Khan J, Polak MA, Glass JD: Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-240.
[132] Glass JD: Wallerian degeneration as a window to peripheral neuropathy. J Neurol Sci 15-5-2004;220:123-124.
Maria (87) woont al veertig jaar vlakbij het ziekenhuis. Sinds de introductie van de
multi-drug therapie (een cocktail van antibiotica) in de jaren tachtig kan lepra
genezen worden. Helaas kwam voor Maria de medicatie te laat. ‘Mijn handen werden
steeds slechter. Mijn been raakte ontstoken en moest geamputeerd worden. Het is
zo moeilijk als ik bedenk hoe gezond ik vroeger was.’
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
M. leprae components induce nerve damage by complement
activation: Identification of lipoarabinomannan as the dominant
complement activator
Nawal Bahia El Idrissi 1, Pranab K. Das 2,3,4, Kees Fluiter 1, Patricia S. Rosa4, Jeroen
Vreijling1, Dirk Troost 2, B. Paul Morgan 5, Frank Baas 1 and Valeria Ramaglia 1
Acta Neuropathologica, 2015 May.
1 Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, The Netherlands; 3 Department of Clinical Immunology, Colleges of
Medical and Dental Sciences, University of Birmingham, Birmingham,United Kingdom; 4
Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil; 5 Institute of Infection and Immunity,
School of Medicine, Cardiff University, Cardiff, United Kingdom.
Maria (87) woont al veertig jaar vlakbij het ziekenhuis. Sinds de introductie van de
multi-drug therapie (een cocktail van antibiotica) in de jaren tachtig kan lepra
genezen worden. Helaas kwam voor Maria de medicatie te laat. ‘Mijn handen werden
steeds slechter. Mijn been raakte ontstoken en moest geamputeerd worden. Het is
zo moeilijk als ik bedenk hoe gezond ik vroeger was.’
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
M. leprae components induce nerve damage by complement
activation: Identification of lipoarabinomannan as the dominant
complement activator
Nawal Bahia El Idrissi 1, Pranab K. Das 2,3,4, Kees Fluiter 1, Patricia S. Rosa4, Jeroen
Vreijling1, Dirk Troost 2, B. Paul Morgan 5, Frank Baas 1 and Valeria Ramaglia 1
Acta Neuropathologica, 2015 May.
1 Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, The Netherlands; 3 Department of Clinical Immunology, Colleges of
Medical and Dental Sciences, University of Birmingham, Birmingham,United Kingdom; 4
Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil; 5 Institute of Infection and Immunity,
School of Medicine, Cardiff University, Cardiff, United Kingdom. 2
Chapter 2
44
Abstract
Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is
unclear. We previously identified the membrane attack complex (MAC) of the
complement system as a key determinant of post-traumatic nerve damage and
demonstrated that its inhibition is neuroprotective. Here, we determined the
contribution of the MAC to nerve damage caused by M. leprae and its components in
mouse. Furthermore, we studied the association between MAC and the key M.
leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients.
Intraneural injections of M. leprae sonicate induced MAC deposition and pathological
changes in the mouse nerve whereas MAC inhibition preserved myelin and axons.
Complement activation occurred mainly via the lectin pathway and the principal
activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity
was robust and significantly higher in multibacillary compared to paucibacillary
donors (p=0.01 and p=0.001, respectively), with a highly significant association
between LAM and MAC in the diseased samples (r=0.9601, p=0.0001). Further,
MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in
complement activation and nerve damage in leprosy. Our findings demonstrate that
MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and
its inhibition is neuroprotective. In addition, our data identified LAM as the key
pathogen associated molecule that activates complement and causes nerve damage.
Taken together our data imply an important role of complement in nerve damage in
leprosy and may inform the development of novel therapeutics for patients.
Keywords. Leprosy, complement, neuropathy, therapy
Introduction
Leprosy is one of the earliest recorded human infectious diseases. To date, infection
with Mycobacterium leprae (M. leprae) remains the leading cause of infectious
neuropathy and disabilities. Despite effective multidrug therapy (MDT), leprosy is still
endemic in several parts of the world, especially in Brazil and India. The majority of
the infected population remains healthy whereas a subset of infected individuals
develop clinical symptoms, which are associated with host immunity to the bacilli.
The manifestation of the disease displays a broad clinical, histopathological and
immunological spectrum, with tuberculoid (TT) and lepromatous (LL) forms at the two
poles, and with several intermediate forms including borderline tuberculoid (BT),
borderline borderline (BB) and borderline lepromatous (BL) [14]. The BT and TT are
paucibacillary (PB) whereas LL, BL and BB are multibacillary (MB). PB patients show
a strong T-cell-mediated immunity to M. leprae, whereas MB patients show a M.
leprae-specific cell-mediated response anergy but mount an antibody response,
which results in extensive diffuse bacilli-laden skin lesions. In addition to the above
described spectrum of the disease, a percentage of patients, particularly those in the
borderline groups during treatment, develop two types of reactions due to changes in
their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2 or
erythema nodusum leprosum (ENL). The RR is due to the increased pathogen-
specific cell-mediated immunity encountered among BT and BL patients, whereas
ENL is seen in BL and LL patients and are thought to be immune complex-mediated
[5].
Histologically, skin lesions of paucibacillary patients show T-cell infiltrates and
epitheloid giant cells, whereas those of multibacillary patients show a paucity of T-
2
C6 inhibition in nerve damage in leprosy
45
Abstract
Peripheral nerve damage is the hallmark of leprosy pathology but its etiology is
unclear. We previously identified the membrane attack complex (MAC) of the
complement system as a key determinant of post-traumatic nerve damage and
demonstrated that its inhibition is neuroprotective. Here, we determined the
contribution of the MAC to nerve damage caused by M. leprae and its components in
mouse. Furthermore, we studied the association between MAC and the key M.
leprae component lipoarabinomannan (LAM) in nerve biopsies of leprosy patients.
Intraneural injections of M. leprae sonicate induced MAC deposition and pathological
changes in the mouse nerve whereas MAC inhibition preserved myelin and axons.
Complement activation occurred mainly via the lectin pathway and the principal
activator was LAM. In leprosy nerves, the extent of LAM and MAC immunoreactivity
was robust and significantly higher in multibacillary compared to paucibacillary
donors (p=0.01 and p=0.001, respectively), with a highly significant association
between LAM and MAC in the diseased samples (r=0.9601, p=0.0001). Further,
MAC co-localized with LAM on axons, pointing to a role for this M. leprae antigen in
complement activation and nerve damage in leprosy. Our findings demonstrate that
MAC contributes to nerve damage in a model of M. leprae-induced nerve injury and
its inhibition is neuroprotective. In addition, our data identified LAM as the key
pathogen associated molecule that activates complement and causes nerve damage.
Taken together our data imply an important role of complement in nerve damage in
leprosy and may inform the development of novel therapeutics for patients.
Keywords. Leprosy, complement, neuropathy, therapy
Introduction
Leprosy is one of the earliest recorded human infectious diseases. To date, infection
with Mycobacterium leprae (M. leprae) remains the leading cause of infectious
neuropathy and disabilities. Despite effective multidrug therapy (MDT), leprosy is still
endemic in several parts of the world, especially in Brazil and India. The majority of
the infected population remains healthy whereas a subset of infected individuals
develop clinical symptoms, which are associated with host immunity to the bacilli.
The manifestation of the disease displays a broad clinical, histopathological and
immunological spectrum, with tuberculoid (TT) and lepromatous (LL) forms at the two
poles, and with several intermediate forms including borderline tuberculoid (BT),
borderline borderline (BB) and borderline lepromatous (BL) [14]. The BT and TT are
paucibacillary (PB) whereas LL, BL and BB are multibacillary (MB). PB patients show
a strong T-cell-mediated immunity to M. leprae, whereas MB patients show a M.
leprae-specific cell-mediated response anergy but mount an antibody response,
which results in extensive diffuse bacilli-laden skin lesions. In addition to the above
described spectrum of the disease, a percentage of patients, particularly those in the
borderline groups during treatment, develop two types of reactions due to changes in
their pathogen-specific immune status; type 1 or reversal reaction (RR) and type 2 or
erythema nodusum leprosum (ENL). The RR is due to the increased pathogen-
specific cell-mediated immunity encountered among BT and BL patients, whereas
ENL is seen in BL and LL patients and are thought to be immune complex-mediated
[5].
Histologically, skin lesions of paucibacillary patients show T-cell infiltrates and
epitheloid giant cells, whereas those of multibacillary patients show a paucity of T-
Chapter 2
46
cells and the accumulation of bacilli laden macrophages. The major pathological
hallmark of M. leprae infection across the entire disease spectrum is nerve damage.
Nerve damage in leprosy is almost exclusively studied in late disease stages; no
published study describes nerve changes at the early stages of the disease.
However, epidemiological surveys in endemic areas reported that nerve damage
occurs even among the non-diseased leprosy contacts [19], suggesting that nerve
damage might commence long before the disease manifests as skin lesions. Indeed,
the natural affinity of M. leprae for nerve, particularly for Schwann cells, makes it
likely that nerve damage starts at a very early stage of infection. However, the
mechanisms underlying nerve damage in early disease remain to be elucidated.
Understanding the molecular and immunological mechanisms of M. leprae-induced
nerve damage is a necessary step in the management of leprosy to prevent
progression of the infection into an extensive neuropathic condition.
Previous studies in animal models induced by direct interaction of M. leprae with
nerves have shown that myelin loss and axonal damage can occur in M. leprae
infection, even in the absence of a functional adaptive immune system[13, 17].
Although the adaptive immune response plays a critical role in the clinical
manifestation of the disease, the identification of an adaptive immunity-independent
myelin loss suggests the existence of additional mechanisms. We have previously
identified an important role of the complement system in myelin loss and axonal
injury of the peripheral nerve after acute trauma [9]. The complement system is a key
component of the host defense against pathogens but uncontrolled or excessive
activation can cause damage to the host. Complement activation can occur via the
recognition of antigen-antibody complexes (classical pathway), foreign surfaces
(alternative pathway) or bacterial sugars (lectin pathway). Regardless of the trigger,
activation results in the cleavage of C3, followed by cleavage of C5 and formation of
the membrane attack complex (MAC), which forms pores in the cell membrane
resulting in lysis of the target cell. Because activated complement components are
soluble and can drift from their site of activation to adjacent areas, MAC can damage
adjacent healthy tissue and enhance inflammation [22, 23]. We have shown that
formation of the MAC contributes to early clearance of myelin proteins and to axonal
damage after traumatic injury of the peripheral nerve [9, 11], while inhibition of MAC
formation reduces nerve damage [10] and improves regeneration and functional
recovery [12].
Our hypothesis is that complement, specifically the MAC, may play an important role
in nerve damage in leprosy. This hypothesis is substantiated by pathological studies
which reported MAC deposits on damaged nerves of LL but not TT leprosy patients
[8], pointing to the possibility that complement, and specifically the MAC, plays a role
as disease modifier in leprosy. In addition, significant serum complement
consumption by M. leprae was also reported [4].
In this study, we injected M. leprae or its components into the mouse sciatic nerve to
induce nerve injury. This model does not recapitulate M. leprae-induced neuropathy
in man. However, it is a good model to study M. leprae-induced loss of axonal
components and focal loss of myelin, which we define as nerve damage in this study.
Since, we made use of nude mice (NMRI-Foxn1nu), which lack functional T and B
lymphocytes, we can study the direct role of complement in M. leprae-induced nerve
damage in the absence of a cellular adaptive immune response. In a first experiment,
we demonstrated that M. leprae sonicate and its components, particularly
lipoarabinomannan (LAM), induce complement activation, which results in MAC
deposition, myelin loss and axonal damage of the mouse sciatic nerve. In a second
2
C6 inhibition in nerve damage in leprosy
47
cells and the accumulation of bacilli laden macrophages. The major pathological
hallmark of M. leprae infection across the entire disease spectrum is nerve damage.
Nerve damage in leprosy is almost exclusively studied in late disease stages; no
published study describes nerve changes at the early stages of the disease.
However, epidemiological surveys in endemic areas reported that nerve damage
occurs even among the non-diseased leprosy contacts [19], suggesting that nerve
damage might commence long before the disease manifests as skin lesions. Indeed,
the natural affinity of M. leprae for nerve, particularly for Schwann cells, makes it
likely that nerve damage starts at a very early stage of infection. However, the
mechanisms underlying nerve damage in early disease remain to be elucidated.
Understanding the molecular and immunological mechanisms of M. leprae-induced
nerve damage is a necessary step in the management of leprosy to prevent
progression of the infection into an extensive neuropathic condition.
Previous studies in animal models induced by direct interaction of M. leprae with
nerves have shown that myelin loss and axonal damage can occur in M. leprae
infection, even in the absence of a functional adaptive immune system[13, 17].
Although the adaptive immune response plays a critical role in the clinical
manifestation of the disease, the identification of an adaptive immunity-independent
myelin loss suggests the existence of additional mechanisms. We have previously
identified an important role of the complement system in myelin loss and axonal
injury of the peripheral nerve after acute trauma [9]. The complement system is a key
component of the host defense against pathogens but uncontrolled or excessive
activation can cause damage to the host. Complement activation can occur via the
recognition of antigen-antibody complexes (classical pathway), foreign surfaces
(alternative pathway) or bacterial sugars (lectin pathway). Regardless of the trigger,
activation results in the cleavage of C3, followed by cleavage of C5 and formation of
the membrane attack complex (MAC), which forms pores in the cell membrane
resulting in lysis of the target cell. Because activated complement components are
soluble and can drift from their site of activation to adjacent areas, MAC can damage
adjacent healthy tissue and enhance inflammation [22, 23]. We have shown that
formation of the MAC contributes to early clearance of myelin proteins and to axonal
damage after traumatic injury of the peripheral nerve [9, 11], while inhibition of MAC
formation reduces nerve damage [10] and improves regeneration and functional
recovery [12].
Our hypothesis is that complement, specifically the MAC, may play an important role
in nerve damage in leprosy. This hypothesis is substantiated by pathological studies
which reported MAC deposits on damaged nerves of LL but not TT leprosy patients
[8], pointing to the possibility that complement, and specifically the MAC, plays a role
as disease modifier in leprosy. In addition, significant serum complement
consumption by M. leprae was also reported [4].
In this study, we injected M. leprae or its components into the mouse sciatic nerve to
induce nerve injury. This model does not recapitulate M. leprae-induced neuropathy
in man. However, it is a good model to study M. leprae-induced loss of axonal
components and focal loss of myelin, which we define as nerve damage in this study.
Since, we made use of nude mice (NMRI-Foxn1nu), which lack functional T and B
lymphocytes, we can study the direct role of complement in M. leprae-induced nerve
damage in the absence of a cellular adaptive immune response. In a first experiment,
we demonstrated that M. leprae sonicate and its components, particularly
lipoarabinomannan (LAM), induce complement activation, which results in MAC
deposition, myelin loss and axonal damage of the mouse sciatic nerve. In a second
Chapter 2
48
experiment we proved that, in this model, inhibition of MAC formation is
neuroprotective. In addition, we explored the extent of complement deposition,
including MAC, in a snap-shot of nerve biopsies from patients with full blown leprosy
at either of the two poles of the disease spectrum, showing an association between
the amount of MAC deposition and LAM immunoreactivity in nerves of leprosy
patients. Altogether, our findings strongly point to an important role of complement in
nerve damage in leprosy.
Materials and methods
Animals. Outbred nude (NMRI-Foxn1nu) mice were purchased from Charles River
(United Kingdom). The mice were housed under standard pathogen-free conditions
and allowed free access to food and water. Female mice, aged between 8 to 12
weeks, were used in all experiments and allowed to acclimatize for at least 1 week
prior to the experimental procedures. All experiments complied with national ethical
guidelines for the care of experimental animals.
Bacterial fractions. The following reagents were obtained through BEI Resources,
NIAID, NIH: Whole M. leprae sonicate and its fractions, including cell wall, cell
membrane, lipoarbinomannan (LAM) and phenolic glycolipid-1 (PGL-1), as well as M.
tuberculosis sonicate (see table S1). M. leprae was propagated in armadillos.
Both M. leprae and M. tuberculosis were made non-viable by gamma-irradiation
before sonication. Gamma-irradiated and sonicated M. leprae is referred to in the text
and figures as M. leprae or sonicated M. leprae. Gamma-irradiated and sonicated M.
tuberculosis is referred to in the text and figures as M. tuberculosis or sonicated M.
tuberculosis.
Intraneural injection of M. leprae sonicate or fractions. Surgical procedures were
performed under deep isoflurane anesthesia (2.5% vol isoflurane, 1 L/minute O2, and
1 L/minute N2O). For analgesia, Buprenorphine (0.1mg/kg, Temgesic®, Schering-
Plough, The Netherlands) was administered subcutaneously 30 minutes prior to the
surgery. The sciatic nerve was exposed via an incision in the thigh and injected
2
C6 inhibition in nerve damage in leprosy
49
experiment we proved that, in this model, inhibition of MAC formation is
neuroprotective. In addition, we explored the extent of complement deposition,
including MAC, in a snap-shot of nerve biopsies from patients with full blown leprosy
at either of the two poles of the disease spectrum, showing an association between
the amount of MAC deposition and LAM immunoreactivity in nerves of leprosy
patients. Altogether, our findings strongly point to an important role of complement in
nerve damage in leprosy.
Materials and methods
Animals. Outbred nude (NMRI-Foxn1nu) mice were purchased from Charles River
(United Kingdom). The mice were housed under standard pathogen-free conditions
and allowed free access to food and water. Female mice, aged between 8 to 12
weeks, were used in all experiments and allowed to acclimatize for at least 1 week
prior to the experimental procedures. All experiments complied with national ethical
guidelines for the care of experimental animals.
Bacterial fractions. The following reagents were obtained through BEI Resources,
NIAID, NIH: Whole M. leprae sonicate and its fractions, including cell wall, cell
membrane, lipoarbinomannan (LAM) and phenolic glycolipid-1 (PGL-1), as well as M.
tuberculosis sonicate (see table S1). M. leprae was propagated in armadillos.
Both M. leprae and M. tuberculosis were made non-viable by gamma-irradiation
before sonication. Gamma-irradiated and sonicated M. leprae is referred to in the text
and figures as M. leprae or sonicated M. leprae. Gamma-irradiated and sonicated M.
tuberculosis is referred to in the text and figures as M. tuberculosis or sonicated M.
tuberculosis.
Intraneural injection of M. leprae sonicate or fractions. Surgical procedures were
performed under deep isoflurane anesthesia (2.5% vol isoflurane, 1 L/minute O2, and
1 L/minute N2O). For analgesia, Buprenorphine (0.1mg/kg, Temgesic®, Schering-
Plough, The Netherlands) was administered subcutaneously 30 minutes prior to the
surgery. The sciatic nerve was exposed via an incision in the thigh and injected
Chapter 2
50
according to the procedure previously described by Rambukkana et al [13].
Importantly, this pin-prick injection by itself does not induce complement activation,
myelin loss or axonal damage. Specifically, a micro needle was used to inject the
sciatic nerve with a single dose of a solution containing 1 µg of either sonicated M.
leprae (n=10) or cell membrane (n=7) or LAM (n=5) in a volume of 5 µl. Intraneural
injections with equal volume of either phosphate buffer saline (PBS) (n=10) or
sonicated M. tuberculosis (n=4) were used as controls. In all experiments, the
contralateral nerve of each mouse was injected with PBS as internal control.
In addition, sciatic nerves from nude mice that did not receive intraneurial injection
were analyzed as controls for the PBS injections. We found no difference in axonal
density between non-injected and PBS-injected nerves (data not shown).
The injection site was marked by indian ink. The skin was sutured and the mice were
allowed to recover. At 3 days post-intraneural injections, mice were deeply
anaesthetized. Blood and liver biopsies were collected for serum analysis and qPCR
analysis, respectively. All mice were then euthanized by intracardial perfusion with
PBS followed by formalin. The sciatic nerves were collected and post-fixed in
formalin for 1 week at 4 ºC before they were processed in paraffin for histology,
according to standard procedures.
Mouse tissue preparation and immunohistochemistry. Paraffin-embedded nerves
were sectioned at a thickness of 6 µm for the entire length of the nerve, including the
site of injection, and mounted on glass slides. Up to 4000 sections per nerve were
cut. Three adjacent sections of every 10 were selected and stained for hematoxylin
and eosin (H&E) and scored by two independent investigators (NBEI and VR) for
damage and accumulation of immune cells. Immunohistochemistry for PGL-1 and/or
LAM was used to locate the site of injection in the nerves. Seventy to 80 sections per
sciatic nerve were further analyzed by immunohistochemistry to evaluate the axonal,
myelin and Schwann cell damage as well as MAC deposition and the extent of
endoneurial accumulation of macrophages.
For the immunohistochemistry, sections were deparaffinated and rehydrated. The
endogenous peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20
minutes at room temperature. Epitopes were exposed by heat-induced antigen
retrieval, in either 10mM sodium citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA
buffer (pH 9.0) depending on the primary antibody used (see table S2). Aspecific
binding of antibodies was blocked using 10% normal goat serum (DAKO, Heverlee,
Belgium) in PBS for 30 minutes at room temperature. Primary antibodies were diluted
in Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated
for 1 hour at room temperature. Detection was performed by incubating the sections
in the secondary Poly-HRP-Goat anti Mouse/Rabbit/Rat IgG (Brightvision
Immunologic, Duiven, The Netherlands) antibody diluted 1:1 in PBS for 30 minutes at
room temperature followed by incubation in 3,3- diaminobenzidine tetrahydrochloride
(DAB; Vector Laboratories, Burlingame, CA) as chromogen and counterstaining with
hematoxylin for 5 minutes. Sections stained with secondary antibody alone were
included as negative controls with each test. After dehydration, slides were mounted
in Pertex (Histolab, Gothenburg, Sweden). Images were captured with a light
microscope (BX41TF; Olympus,Center Valley, PA) using the Cell D software
(Olympus).
For immunofluorescence, the primary antibodies raised in rabbit (see table S2) were
detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG (Sigma-Aldrich,
2
C6 inhibition in nerve damage in leprosy
51
according to the procedure previously described by Rambukkana et al [13].
Importantly, this pin-prick injection by itself does not induce complement activation,
myelin loss or axonal damage. Specifically, a micro needle was used to inject the
sciatic nerve with a single dose of a solution containing 1 µg of either sonicated M.
leprae (n=10) or cell membrane (n=7) or LAM (n=5) in a volume of 5 µl. Intraneural
injections with equal volume of either phosphate buffer saline (PBS) (n=10) or
sonicated M. tuberculosis (n=4) were used as controls. In all experiments, the
contralateral nerve of each mouse was injected with PBS as internal control.
In addition, sciatic nerves from nude mice that did not receive intraneurial injection
were analyzed as controls for the PBS injections. We found no difference in axonal
density between non-injected and PBS-injected nerves (data not shown).
The injection site was marked by indian ink. The skin was sutured and the mice were
allowed to recover. At 3 days post-intraneural injections, mice were deeply
anaesthetized. Blood and liver biopsies were collected for serum analysis and qPCR
analysis, respectively. All mice were then euthanized by intracardial perfusion with
PBS followed by formalin. The sciatic nerves were collected and post-fixed in
formalin for 1 week at 4 ºC before they were processed in paraffin for histology,
according to standard procedures.
Mouse tissue preparation and immunohistochemistry. Paraffin-embedded nerves
were sectioned at a thickness of 6 µm for the entire length of the nerve, including the
site of injection, and mounted on glass slides. Up to 4000 sections per nerve were
cut. Three adjacent sections of every 10 were selected and stained for hematoxylin
and eosin (H&E) and scored by two independent investigators (NBEI and VR) for
damage and accumulation of immune cells. Immunohistochemistry for PGL-1 and/or
LAM was used to locate the site of injection in the nerves. Seventy to 80 sections per
sciatic nerve were further analyzed by immunohistochemistry to evaluate the axonal,
myelin and Schwann cell damage as well as MAC deposition and the extent of
endoneurial accumulation of macrophages.
For the immunohistochemistry, sections were deparaffinated and rehydrated. The
endogenous peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20
minutes at room temperature. Epitopes were exposed by heat-induced antigen
retrieval, in either 10mM sodium citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA
buffer (pH 9.0) depending on the primary antibody used (see table S2). Aspecific
binding of antibodies was blocked using 10% normal goat serum (DAKO, Heverlee,
Belgium) in PBS for 30 minutes at room temperature. Primary antibodies were diluted
in Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated
for 1 hour at room temperature. Detection was performed by incubating the sections
in the secondary Poly-HRP-Goat anti Mouse/Rabbit/Rat IgG (Brightvision
Immunologic, Duiven, The Netherlands) antibody diluted 1:1 in PBS for 30 minutes at
room temperature followed by incubation in 3,3- diaminobenzidine tetrahydrochloride
(DAB; Vector Laboratories, Burlingame, CA) as chromogen and counterstaining with
hematoxylin for 5 minutes. Sections stained with secondary antibody alone were
included as negative controls with each test. After dehydration, slides were mounted
in Pertex (Histolab, Gothenburg, Sweden). Images were captured with a light
microscope (BX41TF; Olympus,Center Valley, PA) using the Cell D software
(Olympus).
For immunofluorescence, the primary antibodies raised in rabbit (see table S2) were
detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG (Sigma-Aldrich,
Chapter 2
52
Saint Louis, MI) and the primary antibodies raised in mouse were detected with Cy3
(red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich, Saint Louis, MI).
Sections were counterstained with 4.6-diamidine-2-phenylindole dihydrochloride
(DAPI, Sigma-Aldrich) (blue, 280nm), air dried and mounted in Vectashield (Vector,
Burlingame, CA). Images were captured with a digital camera (DFC500; Leica) on a
fluorescence microscope (DM LB2; Leica, Wetzlar, Germany). .
Measurement of human serum complement consumption by M. leprae. Blood
from healthy volunteers was collected by venepuncture and allowed to clot on ice.
The serum was separated by centrifugation at 5000 x g at 4ºC for 10 minutes and
assayed immediately. 50 µl of serum was incubated with equal volume of either
whole M. leprae sonicate (1x109 cells), referred to in the text and figures as M.
leprae, or PBS as control, for 1 hour at 37 ºC. In the subsequent step, residual
human complement activity was tested in triplicate by hemolytic assay according to
standard procedures [7, 15].
ELISA for fluid-phase terminal complement complex (TCC). Enzyme-linked
immunosorbent assay (ELISA) for TCC, was performed on Microlon high-affinity
binding plates (Greiner bio one, Frickenhausen, Germany) coated with 2.5µg of
either M. leprae, cell wall, cell membrane, LAM or PGL-1 in carbonate buffer (pH 9.6)
overnight at 4ºC. Nonspecific binding was blocked with 10% bovine serum albumin
(BSA) (pH 7.4) for 1 hour at room temperature. After washing with 0.05% Tween in
PBS, the wells were incubated with 10% fresh normal human serum (NHS) in dilution
buffer (4mM barbital, 145mM NaCl, 2mM CaCl2, 1 mM MgCl2, 0.3% BSA, 0.02%
Tween20) for 1 hour at 37ºC. After washing, TCC was detected by incubation with a
mouse anti-human C5b-9neo monoclonal antibody (aE11 clone, DAKO) (1:100 in
dilution buffer). The wells were washed and then incubated with the polyclonal goat
anti-mouse Ig HRPO-conjugate (DAKO) (1:2000 in dilution buffer) for 1 hour at room
temperature. Plates were developed using tetramethylbenzidine (TMB) as substrate
and the reaction was stopped using 1M H2SO4. The absorbance was measured at
450 nm. The signals were corrected for background by subtracting the absorbance of
the controls.
Identification of complement pathways activated by M. leprae. Neutralizing anti-
C1q antibody (anti-C1q-85, Sanquin, Amsterdam, The Netherlands) (50 µg/ml),
which inhibits the classical pathway of complement, or C1 inhibitor (C1inh; Cetor,
Sanquin) (1 µg/µl), which blocks activation of both the classical and lectin pathways,
were pre-incubated with 10% fresh human serum in dilution buffer for 15 minutes at
37ºC. Mannose-binding lectin (MBL) deficient serum (10% in dilution buffer) was
used as control for lectin pathway activation. Fresh serum pre-incubated with either
BSA or EDTA was used as controls. All sera were assayed for M. leprae-mediated
generation of TCC by ELISA as described above. Microlon high-affinity binding plates
(Greiner bio one) were coated with 2.5 µg of M. leprae in carbonate buffer (pH 9.6)
overnight at 4ºC. Coating of the wells with either 1 µg mannan (Sigma, M7504) or
1µg IgG1,2,3,4 (Gammaquin 160 g/l, Sanquin) were included as controls. Blocking of
nonspecific binding sites, detection of the TCC and development of the enzymatic
HRP reaction were performed as described above. The signals were corrected for
background by subtracting the absorbance of the controls.
2
C6 inhibition in nerve damage in leprosy
53
Saint Louis, MI) and the primary antibodies raised in mouse were detected with Cy3
(red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich, Saint Louis, MI).
Sections were counterstained with 4.6-diamidine-2-phenylindole dihydrochloride
(DAPI, Sigma-Aldrich) (blue, 280nm), air dried and mounted in Vectashield (Vector,
Burlingame, CA). Images were captured with a digital camera (DFC500; Leica) on a
fluorescence microscope (DM LB2; Leica, Wetzlar, Germany). .
Measurement of human serum complement consumption by M. leprae. Blood
from healthy volunteers was collected by venepuncture and allowed to clot on ice.
The serum was separated by centrifugation at 5000 x g at 4ºC for 10 minutes and
assayed immediately. 50 µl of serum was incubated with equal volume of either
whole M. leprae sonicate (1x109 cells), referred to in the text and figures as M.
leprae, or PBS as control, for 1 hour at 37 ºC. In the subsequent step, residual
human complement activity was tested in triplicate by hemolytic assay according to
standard procedures [7, 15].
ELISA for fluid-phase terminal complement complex (TCC). Enzyme-linked
immunosorbent assay (ELISA) for TCC, was performed on Microlon high-affinity
binding plates (Greiner bio one, Frickenhausen, Germany) coated with 2.5µg of
either M. leprae, cell wall, cell membrane, LAM or PGL-1 in carbonate buffer (pH 9.6)
overnight at 4ºC. Nonspecific binding was blocked with 10% bovine serum albumin
(BSA) (pH 7.4) for 1 hour at room temperature. After washing with 0.05% Tween in
PBS, the wells were incubated with 10% fresh normal human serum (NHS) in dilution
buffer (4mM barbital, 145mM NaCl, 2mM CaCl2, 1 mM MgCl2, 0.3% BSA, 0.02%
Tween20) for 1 hour at 37ºC. After washing, TCC was detected by incubation with a
mouse anti-human C5b-9neo monoclonal antibody (aE11 clone, DAKO) (1:100 in
dilution buffer). The wells were washed and then incubated with the polyclonal goat
anti-mouse Ig HRPO-conjugate (DAKO) (1:2000 in dilution buffer) for 1 hour at room
temperature. Plates were developed using tetramethylbenzidine (TMB) as substrate
and the reaction was stopped using 1M H2SO4. The absorbance was measured at
450 nm. The signals were corrected for background by subtracting the absorbance of
the controls.
Identification of complement pathways activated by M. leprae. Neutralizing anti-
C1q antibody (anti-C1q-85, Sanquin, Amsterdam, The Netherlands) (50 µg/ml),
which inhibits the classical pathway of complement, or C1 inhibitor (C1inh; Cetor,
Sanquin) (1 µg/µl), which blocks activation of both the classical and lectin pathways,
were pre-incubated with 10% fresh human serum in dilution buffer for 15 minutes at
37ºC. Mannose-binding lectin (MBL) deficient serum (10% in dilution buffer) was
used as control for lectin pathway activation. Fresh serum pre-incubated with either
BSA or EDTA was used as controls. All sera were assayed for M. leprae-mediated
generation of TCC by ELISA as described above. Microlon high-affinity binding plates
(Greiner bio one) were coated with 2.5 µg of M. leprae in carbonate buffer (pH 9.6)
overnight at 4ºC. Coating of the wells with either 1 µg mannan (Sigma, M7504) or
1µg IgG1,2,3,4 (Gammaquin 160 g/l, Sanquin) were included as controls. Blocking of
nonspecific binding sites, detection of the TCC and development of the enzymatic
HRP reaction were performed as described above. The signals were corrected for
background by subtracting the absorbance of the controls.
Chapter 2
54
C6 antisense oligonucleotide synthesis. The C6 Locked Nucleic Acid (LNA)
oligonucleotides were synthesized with phosphorothioate backbones and 5-methyl
cytosine residues (medC) by Ribotask (Odense, Denmark) on a Mermade 12™,
using 2g NittoPhase™ (BioAutomation, Irving, Texas). All oligonucleotides were
HPLC purified. C6 oligonucleotide (C6 LNA): 5’ A A C t t g c t g g g A A T 3’.
Mismatch control oligonucleotide (mismatch LNA): 5’ A T C t t c g c g t g a a T A A 3’.
LNA is shown in capital letters and DNA in lowercase.
Treatment with C6 antisense oligonucleotide. C6 antisense is a LNA-DNA based
gap-mer RNase H recruiting oligonucleotide that specifically targets the mRNA of C6,
resulting in the degradation of the mRNA thereby stopping the production of C6
protein, ultimately preventing MAC formation.
Mice were treated with either 5mg/kg of C6 antisense LNA oligonucleotide (n=5)
(referred to as C6 LNA) or scrambled mismatch antisense LNA oligonucleotide as
control (n=5) (referred to as mismatch LNA) administered by subcutaneous injections
for 4 consecutive days followed by 2 days of suspended treatment prior to intraneural
injection with M. leprae. At 3 days post-intraneural injections, blood, liver and sciatic
nerves were collected as described above.
qPCR for C6. RNA from the liver was isolated using Trizol according to the
instructions of the manufacturer (Invitrogen). cDNA was generated using oligo-dT
primer and SuperScriptII enzyme (Invitrogen). qPCR was performed using Universal
probe primers (Roche) and a Lightcycler 480 (Roche). Primers specific for C6 were
used (C6-forward 5’-CAGAGAAAAATGAACATTCCCATTA; C6-reverse 5’-
TTCTTGTGGGAAGCTTTAATGAC). Amplification of C6 mRNA was quantified using
LightCycler software (Roche Diagnostics). Values were normalized to Hypoxanthine-
guanine phosphoribosyltransferase mRNA (HPRT-forward 5’-
GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-
CAATCAAGACGTTCTTTCCAGTT). All reactions were done in quadruplicate and
qPCR conditions were as recommended by the manufacturer (Roche).
Human nerve biopsies. Sural or ulnar nerve biopsies (n=12) of leprosy patients with
multibacillary (MB, including BL and LL; n= 7) or paucibacillary (PB, including TT and
BT; n= 5) leprosy, classified according to the Ridley-Jopling scale [14], as well as 5
control nerve biopsies from Brazilian donors, were obtained at hospitalization at the
Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil according to diagnostic
procedures (Table S3). The nerve biopsies were chosen randomly from routine
pathology from patients with active disease (duration from 6-15 months) and
chronically inflamed tissues. The control biopsies were from non-leprosy individuals
with an unrelated peripheral nerve complaint requiring microsurgery. These
specimens were made available by Dr. Marcos Virmond and were found to be devoid
of any evidence of infection. Informed consent for the use of diagnostic tissue for
research purposes was obtained from the patients.
Briefly, the nerves were fixed in 10% formalin immediately after dissection and were
processed according to standard procedures for embedding in paraffin. Paraffin
section of 6 µm thickness were cut using a microtome and mounted on glass slides
for further pathological analysis. The immunohistochemistry on the human nerve
biopsies was performed essentially as described above for mouse tissue.
2
C6 inhibition in nerve damage in leprosy
55
C6 antisense oligonucleotide synthesis. The C6 Locked Nucleic Acid (LNA)
oligonucleotides were synthesized with phosphorothioate backbones and 5-methyl
cytosine residues (medC) by Ribotask (Odense, Denmark) on a Mermade 12™,
using 2g NittoPhase™ (BioAutomation, Irving, Texas). All oligonucleotides were
HPLC purified. C6 oligonucleotide (C6 LNA): 5’ A A C t t g c t g g g A A T 3’.
Mismatch control oligonucleotide (mismatch LNA): 5’ A T C t t c g c g t g a a T A A 3’.
LNA is shown in capital letters and DNA in lowercase.
Treatment with C6 antisense oligonucleotide. C6 antisense is a LNA-DNA based
gap-mer RNase H recruiting oligonucleotide that specifically targets the mRNA of C6,
resulting in the degradation of the mRNA thereby stopping the production of C6
protein, ultimately preventing MAC formation.
Mice were treated with either 5mg/kg of C6 antisense LNA oligonucleotide (n=5)
(referred to as C6 LNA) or scrambled mismatch antisense LNA oligonucleotide as
control (n=5) (referred to as mismatch LNA) administered by subcutaneous injections
for 4 consecutive days followed by 2 days of suspended treatment prior to intraneural
injection with M. leprae. At 3 days post-intraneural injections, blood, liver and sciatic
nerves were collected as described above.
qPCR for C6. RNA from the liver was isolated using Trizol according to the
instructions of the manufacturer (Invitrogen). cDNA was generated using oligo-dT
primer and SuperScriptII enzyme (Invitrogen). qPCR was performed using Universal
probe primers (Roche) and a Lightcycler 480 (Roche). Primers specific for C6 were
used (C6-forward 5’-CAGAGAAAAATGAACATTCCCATTA; C6-reverse 5’-
TTCTTGTGGGAAGCTTTAATGAC). Amplification of C6 mRNA was quantified using
LightCycler software (Roche Diagnostics). Values were normalized to Hypoxanthine-
guanine phosphoribosyltransferase mRNA (HPRT-forward 5’-
GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-
CAATCAAGACGTTCTTTCCAGTT). All reactions were done in quadruplicate and
qPCR conditions were as recommended by the manufacturer (Roche).
Human nerve biopsies. Sural or ulnar nerve biopsies (n=12) of leprosy patients with
multibacillary (MB, including BL and LL; n= 7) or paucibacillary (PB, including TT and
BT; n= 5) leprosy, classified according to the Ridley-Jopling scale [14], as well as 5
control nerve biopsies from Brazilian donors, were obtained at hospitalization at the
Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil according to diagnostic
procedures (Table S3). The nerve biopsies were chosen randomly from routine
pathology from patients with active disease (duration from 6-15 months) and
chronically inflamed tissues. The control biopsies were from non-leprosy individuals
with an unrelated peripheral nerve complaint requiring microsurgery. These
specimens were made available by Dr. Marcos Virmond and were found to be devoid
of any evidence of infection. Informed consent for the use of diagnostic tissue for
research purposes was obtained from the patients.
Briefly, the nerves were fixed in 10% formalin immediately after dissection and were
processed according to standard procedures for embedding in paraffin. Paraffin
section of 6 µm thickness were cut using a microtome and mounted on glass slides
for further pathological analysis. The immunohistochemistry on the human nerve
biopsies was performed essentially as described above for mouse tissue.
Chapter 2
56
Quantitative analysis of immunohistochemistry on mouse and human nerves.
All quantitative analyses of immunohistochemistry were performed with the Image
Pro Plus software version 7 (Media Cybernetics Europe, Marlow, UK) by blinded
investigators. Digital images of the immunostainings were captured with a light
microscope (BX41TF, Olympus) using the Cell D software (Olympus). Images of 20x
magnification, covering the complete nerve biopsy were quantified. The surface area
stained is expressed as percentage of total area examined. For the mouse nerves
error bars represent the standard deviation and for the human nerves error bars
indicate standard error of the mean.
Statistical analysis. Student’s t test was performed for statistical analysis comparing
two groups. For comparison of more than two groups One way ANOVA with
Bonferroni multiple comparison post-hoc test was used, changes were considered
statistically significant for p ≤ 0.05. For the correlation analysis we included a
selection of paucibacillary and multibacillary nerves for which serial sections stained
for LAM, MAC and C3d were available. Shapiro-Wilk normality test was performed
before using Pearson’s correlation, to determine whether the data was normally
distributed.
Results
M. leprae sonicate induces complement deposition and nerve damage in vivo
To determine whether M. leprae induces complement deposition and nerve damage
in vivo, sonicates of M. leprae or M. tuberculosis as a control mycobacterial species
were injected into the sciatic nerves of nude (NMRI-Foxn1nu) mice. The use of nude
mice, which lack functional T and B lymphocytes, allowed us to study the direct role
of complement in M. leprae-induced nerve damage in the absence of a cellular
adaptive immune response. Nerves were analyzed at 3 days post-injection.
Intraneural injection of whole M. leprae sonicate induced deposition of C9 (a marker
for MAC) at the site of injection (Fig. 1a) whereas injection of M. tuberculosis
sonicate did not (Fig. 1b), p=0.0008 (Fig, 1c). M. leprae-induced complement
activation was accompanied by axonal damage, as shown by the loss of
neurofilament staining in the M. leprae -injected (Fig.1d) but not in the M.tuberculosis
-injected nerves (Fig. 1e), p=0.01 (Fig. 1f). In the M. leprae-injected nerves, C9
deposition was found to localize on neurofilament–positive axons (Fig. 1g, arrows),
indicating that MAC attacks the axons in the M. leprae-injected nerve but not in the
M. tuberculosis-injected nerve (Fig. 1h), p=0.0003 (Fig. 1i). The C9 and
neurofilament expression in the M.leprae- injected nerves extended beyond the
injection site, some regions around the injection site show reduced neurofilament
staining and show no co-localization with C9 deposition (figure 1g, asterisk),
indicating that macrophages might already have cleared the debris.
The M. leprae injection also resulted in loss of immunoreactivity for myelin basic
protein (MBP) (Fig. 1j, asterisk), and loss of the S100β Schwann cell marker (Fig.
1m); these changes were not observed in M. tuberculosis-injected nerves (Fig. 1k, n),
2
C6 inhibition in nerve damage in leprosy
57
Quantitative analysis of immunohistochemistry on mouse and human nerves.
All quantitative analyses of immunohistochemistry were performed with the Image
Pro Plus software version 7 (Media Cybernetics Europe, Marlow, UK) by blinded
investigators. Digital images of the immunostainings were captured with a light
microscope (BX41TF, Olympus) using the Cell D software (Olympus). Images of 20x
magnification, covering the complete nerve biopsy were quantified. The surface area
stained is expressed as percentage of total area examined. For the mouse nerves
error bars represent the standard deviation and for the human nerves error bars
indicate standard error of the mean.
Statistical analysis. Student’s t test was performed for statistical analysis comparing
two groups. For comparison of more than two groups One way ANOVA with
Bonferroni multiple comparison post-hoc test was used, changes were considered
statistically significant for p ≤ 0.05. For the correlation analysis we included a
selection of paucibacillary and multibacillary nerves for which serial sections stained
for LAM, MAC and C3d were available. Shapiro-Wilk normality test was performed
before using Pearson’s correlation, to determine whether the data was normally
distributed.
Results
M. leprae sonicate induces complement deposition and nerve damage in vivo
To determine whether M. leprae induces complement deposition and nerve damage
in vivo, sonicates of M. leprae or M. tuberculosis as a control mycobacterial species
were injected into the sciatic nerves of nude (NMRI-Foxn1nu) mice. The use of nude
mice, which lack functional T and B lymphocytes, allowed us to study the direct role
of complement in M. leprae-induced nerve damage in the absence of a cellular
adaptive immune response. Nerves were analyzed at 3 days post-injection.
Intraneural injection of whole M. leprae sonicate induced deposition of C9 (a marker
for MAC) at the site of injection (Fig. 1a) whereas injection of M. tuberculosis
sonicate did not (Fig. 1b), p=0.0008 (Fig, 1c). M. leprae-induced complement
activation was accompanied by axonal damage, as shown by the loss of
neurofilament staining in the M. leprae -injected (Fig.1d) but not in the M.tuberculosis
-injected nerves (Fig. 1e), p=0.01 (Fig. 1f). In the M. leprae-injected nerves, C9
deposition was found to localize on neurofilament–positive axons (Fig. 1g, arrows),
indicating that MAC attacks the axons in the M. leprae-injected nerve but not in the
M. tuberculosis-injected nerve (Fig. 1h), p=0.0003 (Fig. 1i). The C9 and
neurofilament expression in the M.leprae- injected nerves extended beyond the
injection site, some regions around the injection site show reduced neurofilament
staining and show no co-localization with C9 deposition (figure 1g, asterisk),
indicating that macrophages might already have cleared the debris.
The M. leprae injection also resulted in loss of immunoreactivity for myelin basic
protein (MBP) (Fig. 1j, asterisk), and loss of the S100β Schwann cell marker (Fig.
1m); these changes were not observed in M. tuberculosis-injected nerves (Fig. 1k, n),
Chapter 2
58
p=0.0001 (Fig. 1l, o). Further, accumulation of macrophages (Iba-1) at the site of
injection was observed in M. leprae-injected (Fig. 1p) but not in M. tuberculosis-
injected nerves (Fig. 1q), p=0.008 (Fig. 1r). To additionally control for the possibility
that the injection per se may induce nerve damage, the contra-lateral sciatic nerve of
each mouse was injected with PBS. These nerves showed no signs of axonal loss,
no loss of the myelin protein MBP, no loss of immunoreactivity for the S100β
Schwann cell marker and no deposition of C9 (data not shown). These data show
that the changes observed in the M. leprae-injected nerves are antigen-specific and
are not the result of the injection per se.
2
C6 inhibition in nerve damage in leprosy
59
p=0.0001 (Fig. 1l, o). Further, accumulation of macrophages (Iba-1) at the site of
injection was observed in M. leprae-injected (Fig. 1p) but not in M. tuberculosis-
injected nerves (Fig. 1q), p=0.008 (Fig. 1r). To additionally control for the possibility
that the injection per se may induce nerve damage, the contra-lateral sciatic nerve of
each mouse was injected with PBS. These nerves showed no signs of axonal loss,
no loss of the myelin protein MBP, no loss of immunoreactivity for the S100β
Schwann cell marker and no deposition of C9 (data not shown). These data show
that the changes observed in the M. leprae-injected nerves are antigen-specific and
are not the result of the injection per se.
Chapter 2
60
Fig. 1 M. leprae induces complement deposition and nerve damage in vivo. Immunohistochemistry
and quantification for C9 detecting MAC (a-c), neurofilament detecting axons (c-f), co-localization of
MAC and axons (g-i), MBP detecting myelin (j-l), S100β detecting Schwann cells (m-o), or Iba-1
detecting macrophages (p-r) in cross sections of mouse sciatic nerves at 3 days post-injection with
either M. leprae (a, d, g, j, m, p) or M. tuberculosis (b, e, h, k, n, q), showing a significant higher
amount of MAC immunoreactivity (a, asterisk) (c, Student’s t-test: p=0.0008), axonal damage (d) and
loss (d, asterisk) (f, Student’s t-test: p=0.01), MAC deposited on axons (g, arrows) (i, Student’s t-test:
p=0.0003) and axonal debris (g, asterisk), myelin loss (j, asterisk) (l, Student’s t-test: p=0.0001), loss
of S100β expression on Schwann cells (m, asterisk) (o, Student’s t-test: p=0.0001) and accumulation
of macrophages (p, arrows) (r, Student’s t-test: p=0.008) in M. leprae-injected nerves compared to M.
tuberculosis-injected nerves where no MAC deposition and nerve damage was detected (b, e, h, k, n,
q). The arrow in (n) points to the normal moon-shaped appearance of S100β-positive Schwann cells.
The M. leprae component lipoarabinomannan (LAM) is a dominant complement
activator and induces nerve damage in vivo
To determine whether M. leprae sonicate is a direct activator of human complement,
we tested the capacity of M. leprae to induce complement consumption in normal
human serum (NHS). Complement consumption was measured in an antibody-
induced complement-mediated erythrocyte lysis assay [7]. Pre-incubation of NHS
with M. leprae significantly reduced haemolysis in this assay compared to PBS pre-
incubated controls (67% reduction; p=0.0001), suggesting that complement was
consumed by M. leprae (Fig. 2a). Pre-incubation of NHS with M. tuberculosis did not
significantly reduce haemolysis compared to PBS, indicating that M. tuberculosis
sonicate, unlike M. leprae, is not a strong activator of complement (Fig. 2a).
To confirm that reduction of haemolysis was the result of complement consumption
by M. leprae rather than inhibition of complement activation, we performed ELISA to
detect formation of the MAC in its soluble form, the terminal complement complex
(TCC), in human serum added to plates coated with M. leprae. In the same
experiment, we aimed to identify which complement pathway(s) are activated by M.
leprae by pre-incubating NHS with either the anti-C1q neutralizing antibody to block
the classical pathway or the C1 esterase-inhibitor (C1inh; Cetor), to block both the
classical and the lectin pathways. MBL-deficient (MBL-/-) serum was also used to test
for complement activation via the MBL-dependent lectin pathway. Both, the MBL-/-
serum and the C1inh-treated NHS on M. leprae showed a significant reduction in
TCC formation compared to NHS alone (respectively 57% and 65%, p=0.036 and
p=0.047); the anti-C1q antibody had no effect, suggesting that M. leprae activates
complement via the lectin pathway (Fig. 2b). As controls, we measured activation of
the classical and lectin pathways on mannan- or IgG1,2,3,4- coated plates,
2
C6 inhibition in nerve damage in leprosy
61
Fig. 1 M. leprae induces complement deposition and nerve damage in vivo. Immunohistochemistry
and quantification for C9 detecting MAC (a-c), neurofilament detecting axons (c-f), co-localization of
MAC and axons (g-i), MBP detecting myelin (j-l), S100β detecting Schwann cells (m-o), or Iba-1
detecting macrophages (p-r) in cross sections of mouse sciatic nerves at 3 days post-injection with
either M. leprae (a, d, g, j, m, p) or M. tuberculosis (b, e, h, k, n, q), showing a significant higher
amount of MAC immunoreactivity (a, asterisk) (c, Student’s t-test: p=0.0008), axonal damage (d) and
loss (d, asterisk) (f, Student’s t-test: p=0.01), MAC deposited on axons (g, arrows) (i, Student’s t-test:
p=0.0003) and axonal debris (g, asterisk), myelin loss (j, asterisk) (l, Student’s t-test: p=0.0001), loss
of S100β expression on Schwann cells (m, asterisk) (o, Student’s t-test: p=0.0001) and accumulation
of macrophages (p, arrows) (r, Student’s t-test: p=0.008) in M. leprae-injected nerves compared to M.
tuberculosis-injected nerves where no MAC deposition and nerve damage was detected (b, e, h, k, n,
q). The arrow in (n) points to the normal moon-shaped appearance of S100β-positive Schwann cells.
The M. leprae component lipoarabinomannan (LAM) is a dominant complement
activator and induces nerve damage in vivo
To determine whether M. leprae sonicate is a direct activator of human complement,
we tested the capacity of M. leprae to induce complement consumption in normal
human serum (NHS). Complement consumption was measured in an antibody-
induced complement-mediated erythrocyte lysis assay [7]. Pre-incubation of NHS
with M. leprae significantly reduced haemolysis in this assay compared to PBS pre-
incubated controls (67% reduction; p=0.0001), suggesting that complement was
consumed by M. leprae (Fig. 2a). Pre-incubation of NHS with M. tuberculosis did not
significantly reduce haemolysis compared to PBS, indicating that M. tuberculosis
sonicate, unlike M. leprae, is not a strong activator of complement (Fig. 2a).
To confirm that reduction of haemolysis was the result of complement consumption
by M. leprae rather than inhibition of complement activation, we performed ELISA to
detect formation of the MAC in its soluble form, the terminal complement complex
(TCC), in human serum added to plates coated with M. leprae. In the same
experiment, we aimed to identify which complement pathway(s) are activated by M.
leprae by pre-incubating NHS with either the anti-C1q neutralizing antibody to block
the classical pathway or the C1 esterase-inhibitor (C1inh; Cetor), to block both the
classical and the lectin pathways. MBL-deficient (MBL-/-) serum was also used to test
for complement activation via the MBL-dependent lectin pathway. Both, the MBL-/-
serum and the C1inh-treated NHS on M. leprae showed a significant reduction in
TCC formation compared to NHS alone (respectively 57% and 65%, p=0.036 and
p=0.047); the anti-C1q antibody had no effect, suggesting that M. leprae activates
complement via the lectin pathway (Fig. 2b). As controls, we measured activation of
the classical and lectin pathways on mannan- or IgG1,2,3,4- coated plates,
Chapter 2
62
respectively. Mannan driven TCC formation was significantly reduced in MBL-/-serum
compared to MBL+/+ serum control (54% compared to the control, p=0.0001) (Fig.
S1a), while pre-incubation of NHS with the anti-C1q antibody showed significant
inhibition of IgG-triggered classical pathway activation and TCC formation (81%
compared to the control, p=0.0038, Fig. S1b).
To identify which components of M. leprae are responsible for activation of
complement, we performed TCC ELISA in NHS on plates coated with either whole M.
leprae sonicate, cell wall, cell membrane, PGL-1 or LAM. M. tuberculosis sonicate or
mannan were used as controls. We found that, except for PGL-1, all M. leprae
components examined induced TCC formation (Fig. 2c). LAM was a strong inducer,
resulting in TCC levels close to mannan control values (p=0.05). In line with the in
vivo data (Fig. 1a,b), also in this assay, M. tuberculosis did not induce TCC formation
(p=0.01, Fig. 2c). These in vitro data confirmed the in vivo observations that M.
leprae specifically activates the complement cascade. In addition, we found that LAM
is a dominant complement activator in vitro.
To determine whether the M. leprae fractions, that induced TCC formation in vitro
also caused MAC deposition and nerve damage in vivo, we injected the cell
membrane and the LAM fraction in the sciatic nerve of the nude mice and analyzed
and quantified the pathological changes at 3 days post-injection (Fig. 2d-w).
Intraneural injection of PBS was used as control. PBS caused no pathological
changes in the nerves (Fig. 2d, h, l, p, t). Intraneural injections of cell membrane or
LAM caused MAC deposition (Fig. 2e, f), axonal damage (Fig. 2i, j), loss of MBP
reactivity (Fig. 2m, n), loss of the Schwann cell marker S100β (Fig. 2q, r) and
accumulation of Iba-1 positive macrophages (Fig. 2u, v). Quantification of staining on
cell membrane- and LAM injected nerves showed a significantly higher amount of
MAC deposition (p=0.0001; p=0.0001, respectively), axonal damage (p=0.0001;
p=0.0001, respectively), myelin loss (p=0.0001; p=0.0001, respectively), loss of
S100β expression (p=0.0001; p=0.0001, respectively) and accumulation of
macrophages (p=0.0001; p=0.0001, respectively) compared to PBS-injected nerves.
These findings prove that the M. leprae cell membrane and purified LAM cause MAC
deposition and nerve damage in vivo.
2
C6 inhibition in nerve damage in leprosy
63
respectively. Mannan driven TCC formation was significantly reduced in MBL-/-serum
compared to MBL+/+ serum control (54% compared to the control, p=0.0001) (Fig.
S1a), while pre-incubation of NHS with the anti-C1q antibody showed significant
inhibition of IgG-triggered classical pathway activation and TCC formation (81%
compared to the control, p=0.0038, Fig. S1b).
To identify which components of M. leprae are responsible for activation of
complement, we performed TCC ELISA in NHS on plates coated with either whole M.
leprae sonicate, cell wall, cell membrane, PGL-1 or LAM. M. tuberculosis sonicate or
mannan were used as controls. We found that, except for PGL-1, all M. leprae
components examined induced TCC formation (Fig. 2c). LAM was a strong inducer,
resulting in TCC levels close to mannan control values (p=0.05). In line with the in
vivo data (Fig. 1a,b), also in this assay, M. tuberculosis did not induce TCC formation
(p=0.01, Fig. 2c). These in vitro data confirmed the in vivo observations that M.
leprae specifically activates the complement cascade. In addition, we found that LAM
is a dominant complement activator in vitro.
To determine whether the M. leprae fractions, that induced TCC formation in vitro
also caused MAC deposition and nerve damage in vivo, we injected the cell
membrane and the LAM fraction in the sciatic nerve of the nude mice and analyzed
and quantified the pathological changes at 3 days post-injection (Fig. 2d-w).
Intraneural injection of PBS was used as control. PBS caused no pathological
changes in the nerves (Fig. 2d, h, l, p, t). Intraneural injections of cell membrane or
LAM caused MAC deposition (Fig. 2e, f), axonal damage (Fig. 2i, j), loss of MBP
reactivity (Fig. 2m, n), loss of the Schwann cell marker S100β (Fig. 2q, r) and
accumulation of Iba-1 positive macrophages (Fig. 2u, v). Quantification of staining on
cell membrane- and LAM injected nerves showed a significantly higher amount of
MAC deposition (p=0.0001; p=0.0001, respectively), axonal damage (p=0.0001;
p=0.0001, respectively), myelin loss (p=0.0001; p=0.0001, respectively), loss of
S100β expression (p=0.0001; p=0.0001, respectively) and accumulation of
macrophages (p=0.0001; p=0.0001, respectively) compared to PBS-injected nerves.
These findings prove that the M. leprae cell membrane and purified LAM cause MAC
deposition and nerve damage in vivo.
Chapter 2
64
Fig. 2 The M. leprae component lipoarabinomanan (LAM) is the dominant complement activator and
induces nerve damage in vivo. a Haemolytic assay of normal human serum (NHS) pre-incubated for 1
hour at 37°C with either M. leprae sonicate (5 µg/µl) or M. tuberculosis sonicate (5 µg/µl) or PBS as
controls, showing significantly decreased haemolytic activity in NHS pre-incubated with M. leprae but
not with M. tuberculosis or PBS, demonstrating complement consumption by M. leprae. b ELISA for
MAC generation on M. leprae sonicate (2.5 µg)-coated plates incubated with either mannose binding
lectin deficient (MBL-/-
) serum (to test for the contribution of the lectin pathway) or NHS in the presence
of the neutralizing anti-C1q antibody (to test for the contribution of the classical pathway) or C1
inhibitor (to test for the combined contribution of the lectin and classical pathways) or BSA as control,
showing a significant reduction of MAC formation in the MBL-/-
serum and NHS supplemented with the
C1 inhibitor, but not by the neutralizing anti-C1q antibody, demonstrating complement activation by M.
leprae via the lectin pathway. c ELISA for TCC generation in NHS on plates coated with either M.
leprae sonicate (2.5 µg) or its cellular fractions, including cell membrane (2.5 µg), the inner cell wall
component lipoarabinomannan (LAM) (2.5 µg) or the outer cell wall component phenolic glycolipid 1
(PGL-1) (2.5 µg), showing that all components except PGL-1 result in TCC generation. d-r Intraneural
injections of cell membrane or LAM induce complement deposition and nerve damage in vivo.
Immunohistochemistry and quantification for C9 detecting MAC (d-g), neurofilament detecting axons
(h-k), MBP detecting myelin (l-o), S100β detecting Schwann cells (p-s) or Iba-1 detecting
macrophages (t-w) in cross sections of mouse sciatic nerves at 72h post-injection with either PBS (d,
h, l, p, t), cell membrane (e, i, m, q, u) or LAM (f, j, n, r, v), showing a significant higher amount of
MAC deposition (e, f and asterisks) (g, One way ANOVA test: p=0.0001;p=0.0001), ,axonal damage
(i, j and asterisks) (k, One way ANOVA test: p=0.0001;p=0.0001), loss of myelin proteins (m, n and
asterisks) (o, One way ANOVA test: p=0.0001;p=0.0001), loss of S100β expression on Schwann
cells (q, r and asterisks) (s, One way ANOVA test: p=0.0001;p=0.0001) and accumulation of
macrophages (u, v and arrows) in cell membrane- and LAM- injected nerves compared to PBS-
injected nerves where no signs of MAC deposition (d), undamaged nerve morphology (h, l), preserved
S100β expression (p) and a paucity of endoneurial macrophages (t) were observed.
2
C6 inhibition in nerve damage in leprosy
65
Fig. 2 The M. leprae component lipoarabinomanan (LAM) is the dominant complement activator and
induces nerve damage in vivo. a Haemolytic assay of normal human serum (NHS) pre-incubated for 1
hour at 37°C with either M. leprae sonicate (5 µg/µl) or M. tuberculosis sonicate (5 µg/µl) or PBS as
controls, showing significantly decreased haemolytic activity in NHS pre-incubated with M. leprae but
not with M. tuberculosis or PBS, demonstrating complement consumption by M. leprae. b ELISA for
MAC generation on M. leprae sonicate (2.5 µg)-coated plates incubated with either mannose binding
lectin deficient (MBL-/-
) serum (to test for the contribution of the lectin pathway) or NHS in the presence
of the neutralizing anti-C1q antibody (to test for the contribution of the classical pathway) or C1
inhibitor (to test for the combined contribution of the lectin and classical pathways) or BSA as control,
showing a significant reduction of MAC formation in the MBL-/-
serum and NHS supplemented with the
C1 inhibitor, but not by the neutralizing anti-C1q antibody, demonstrating complement activation by M.
leprae via the lectin pathway. c ELISA for TCC generation in NHS on plates coated with either M.
leprae sonicate (2.5 µg) or its cellular fractions, including cell membrane (2.5 µg), the inner cell wall
component lipoarabinomannan (LAM) (2.5 µg) or the outer cell wall component phenolic glycolipid 1
(PGL-1) (2.5 µg), showing that all components except PGL-1 result in TCC generation. d-r Intraneural
injections of cell membrane or LAM induce complement deposition and nerve damage in vivo.
Immunohistochemistry and quantification for C9 detecting MAC (d-g), neurofilament detecting axons
(h-k), MBP detecting myelin (l-o), S100β detecting Schwann cells (p-s) or Iba-1 detecting
macrophages (t-w) in cross sections of mouse sciatic nerves at 72h post-injection with either PBS (d,
h, l, p, t), cell membrane (e, i, m, q, u) or LAM (f, j, n, r, v), showing a significant higher amount of
MAC deposition (e, f and asterisks) (g, One way ANOVA test: p=0.0001;p=0.0001), ,axonal damage
(i, j and asterisks) (k, One way ANOVA test: p=0.0001;p=0.0001), loss of myelin proteins (m, n and
asterisks) (o, One way ANOVA test: p=0.0001;p=0.0001), loss of S100β expression on Schwann
cells (q, r and asterisks) (s, One way ANOVA test: p=0.0001;p=0.0001) and accumulation of
macrophages (u, v and arrows) in cell membrane- and LAM- injected nerves compared to PBS-
injected nerves where no signs of MAC deposition (d), undamaged nerve morphology (h, l), preserved
S100β expression (p) and a paucity of endoneurial macrophages (t) were observed.
Chapter 2
66
MAC inhibition protects against M. leprae-induced nerve damage
To determine the contribution of MAC formation to M. leprae sonicate-induced nerve
damage in vivo, we treated mice with an antisense LNA-DNA oligonucleotide against
C6 for 4 days, starting at 1 week prior to the intraneural injection of M. leprae
sonicate (Fig. 3a). In the absence of C6, MAC cannot be formed. Quantification of C6
mRNA in the liver of C6 LNA-treated mice showed a significant 60% reduction
compared to mismatch LNA-treated controls (p=0.01) (Fig. 3b). Such reduction in the
amount of C6 mRNA liver levels is sufficient to block MAC formation, as shown by
the significant 80% reduction of MAC deposits in the nerves of C6 LNA-treated mice
compared to mismatch LNA-treated controls at 3 days post-injection (p=0.005) (Fig.
3c-e ). In addition, C6 LNA treatment conserved the intact annular nerve morphology
and preserved staining of the myelin protein MBP, compared to the collapsed myelin
structure and significant loss of myelin MBP immunoreactivity seen in the mismatch
LNA-treated animals (p=0.0007) (Fig. 3f-h). Axons were protected from damage in
the C6 LNA-treated mice but not in the mismatch LNA-treated animals, which
showed a significant loss of neurofilament immunoreactivity (p=0.0006) (Fig. 3i-k).
The nerves of C6 LNA-treated mice showed also expression of the Schwann cell
marker S100β which had normal appearance as half-moon-shaped profiles (Fig. 3l,
arrows), whereas in the mismatch LNA-treated nerves this marker was significantly
reduced (p=0.03) (Fig. 3l-n). Lastly, C6 LNA treatment significantly reduced
accumulation of intraneural Iba-1 positive macrophages compared to controls
(p=0.0001) (Fig. 3o-q). These data show that inhibition of C6 synthesis blocks MAC
deposition in the M. leprae-injected nerves and prevents the loss of myelin and
axonal proteins, protects from the loss of a key Schwann cell marker and reduces
accumulation of intraneural macrophages.
Fig. 3 MAC inhibition by C6 antisense therapy protects against M. leprae-induced nerve damage. a
Schedule of treatment and experimental timeline for the C6 antisense therapy. Mice were treated for 4
days with either the C6 LNA (n=5) or the control mismatch LNA (n=5). At day 6, M. leprae sonicate
was injected into the mouse sciatic nerve. At day 9 (3 days post-injection) mice were sacrificed for
determination of C6 mRNA liver levels and pathlogical analysis. b qPCR of liver C6 mRNA, showing
significant lower levels in mice treated with the C6 LNA compared to mismatch LNA-treated controls.
2
C6 inhibition in nerve damage in leprosy
67
MAC inhibition protects against M. leprae-induced nerve damage
To determine the contribution of MAC formation to M. leprae sonicate-induced nerve
damage in vivo, we treated mice with an antisense LNA-DNA oligonucleotide against
C6 for 4 days, starting at 1 week prior to the intraneural injection of M. leprae
sonicate (Fig. 3a). In the absence of C6, MAC cannot be formed. Quantification of C6
mRNA in the liver of C6 LNA-treated mice showed a significant 60% reduction
compared to mismatch LNA-treated controls (p=0.01) (Fig. 3b). Such reduction in the
amount of C6 mRNA liver levels is sufficient to block MAC formation, as shown by
the significant 80% reduction of MAC deposits in the nerves of C6 LNA-treated mice
compared to mismatch LNA-treated controls at 3 days post-injection (p=0.005) (Fig.
3c-e ). In addition, C6 LNA treatment conserved the intact annular nerve morphology
and preserved staining of the myelin protein MBP, compared to the collapsed myelin
structure and significant loss of myelin MBP immunoreactivity seen in the mismatch
LNA-treated animals (p=0.0007) (Fig. 3f-h). Axons were protected from damage in
the C6 LNA-treated mice but not in the mismatch LNA-treated animals, which
showed a significant loss of neurofilament immunoreactivity (p=0.0006) (Fig. 3i-k).
The nerves of C6 LNA-treated mice showed also expression of the Schwann cell
marker S100β which had normal appearance as half-moon-shaped profiles (Fig. 3l,
arrows), whereas in the mismatch LNA-treated nerves this marker was significantly
reduced (p=0.03) (Fig. 3l-n). Lastly, C6 LNA treatment significantly reduced
accumulation of intraneural Iba-1 positive macrophages compared to controls
(p=0.0001) (Fig. 3o-q). These data show that inhibition of C6 synthesis blocks MAC
deposition in the M. leprae-injected nerves and prevents the loss of myelin and
axonal proteins, protects from the loss of a key Schwann cell marker and reduces
accumulation of intraneural macrophages.
Fig. 3 MAC inhibition by C6 antisense therapy protects against M. leprae-induced nerve damage. a
Schedule of treatment and experimental timeline for the C6 antisense therapy. Mice were treated for 4
days with either the C6 LNA (n=5) or the control mismatch LNA (n=5). At day 6, M. leprae sonicate
was injected into the mouse sciatic nerve. At day 9 (3 days post-injection) mice were sacrificed for
determination of C6 mRNA liver levels and pathlogical analysis. b qPCR of liver C6 mRNA, showing
significant lower levels in mice treated with the C6 LNA compared to mismatch LNA-treated controls.
Chapter 2
68
Immunohistochemistry and quantification of C9 detecting MAC (c-e), MBP detecting myelin (f-h),
neurofilament detecting axons (i-k), S100β detecting Schwann cells (l-n) or Iba-1 detecting
macrophages (o-q) in cross sections of sciatic nerves from C6 LNA-treated (c, f, i, l, o) or mismatch
LNA-treated (d, g, j, m, p) mice at 72h post-injection with M. leprae sonicate, showing a significant
and robust reduction in MAC deposition (Student’s t-test: p=0.005) (e), intact myelin (Student’s t-test:
p=0.0007) (h) and axonal morphology (k), S100β expression by Schwann cells (l and arrows) and
reduced accumulation of macrophages (Student’s t-test: p=0.0001) (k) in C6 LNA-treated mice
compared to mismatch-treated controls (asterisks in g, j and m indicate damaged areas of the
mismatch-treated nerves, Arrows in p indicate iba-1 positive macrophages in the mismatch-treated
nerves).
Leprosy nerves are LAM positive and show MAC deposition
To determine the extent of M. leprae antigen deposition and to test whether MAC is
deposited in the nerve biopsies of leprosy patients, we performed
immunohistochemistry for LAM and MAC on nerve biopsies from paucibacillary and
multibacillary patients (Fig. 4a-f). These nerves, showed substantial myelin and
axonal loss, as demonstrated by quantification of the immunostaining for MBP and
SMI31 (Fig. S2). Immunostaining for LAM and MAC were always negative in control
nerves (Fig. 4a and 4b, respectively). Nerves of paucibacillary and multibacillary
patients were both positive for LAM (Fig. 4c, e) with the percentage of LAM staining
per surface area being significantly higher in multibacillary nerves compared to
paucibacillary (p=0.01) (Fig. 4g). Nerves of multibacillary patients also showed
substantial MAC deposition (up to 15% of total area assessed, mean 8%) (Fig. 4f, h)
whereas nerve biopsies from paucibacillary patients were negative for MAC
(p=0.007) (Fig. 4d). In line with the robust deposition of MAC, we also found
substantial C3d deposition in nerves of multibacillary patients, with the percentage of
C3d staining per surface area being significantly higher (>4-fold) than paucibacillary
patients (p=0.006) (Fig. S3).
2
C6 inhibition in nerve damage in leprosy
69
Immunohistochemistry and quantification of C9 detecting MAC (c-e), MBP detecting myelin (f-h),
neurofilament detecting axons (i-k), S100β detecting Schwann cells (l-n) or Iba-1 detecting
macrophages (o-q) in cross sections of sciatic nerves from C6 LNA-treated (c, f, i, l, o) or mismatch
LNA-treated (d, g, j, m, p) mice at 72h post-injection with M. leprae sonicate, showing a significant
and robust reduction in MAC deposition (Student’s t-test: p=0.005) (e), intact myelin (Student’s t-test:
p=0.0007) (h) and axonal morphology (k), S100β expression by Schwann cells (l and arrows) and
reduced accumulation of macrophages (Student’s t-test: p=0.0001) (k) in C6 LNA-treated mice
compared to mismatch-treated controls (asterisks in g, j and m indicate damaged areas of the
mismatch-treated nerves, Arrows in p indicate iba-1 positive macrophages in the mismatch-treated
nerves).
Leprosy nerves are LAM positive and show MAC deposition
To determine the extent of M. leprae antigen deposition and to test whether MAC is
deposited in the nerve biopsies of leprosy patients, we performed
immunohistochemistry for LAM and MAC on nerve biopsies from paucibacillary and
multibacillary patients (Fig. 4a-f). These nerves, showed substantial myelin and
axonal loss, as demonstrated by quantification of the immunostaining for MBP and
SMI31 (Fig. S2). Immunostaining for LAM and MAC were always negative in control
nerves (Fig. 4a and 4b, respectively). Nerves of paucibacillary and multibacillary
patients were both positive for LAM (Fig. 4c, e) with the percentage of LAM staining
per surface area being significantly higher in multibacillary nerves compared to
paucibacillary (p=0.01) (Fig. 4g). Nerves of multibacillary patients also showed
substantial MAC deposition (up to 15% of total area assessed, mean 8%) (Fig. 4f, h)
whereas nerve biopsies from paucibacillary patients were negative for MAC
(p=0.007) (Fig. 4d). In line with the robust deposition of MAC, we also found
substantial C3d deposition in nerves of multibacillary patients, with the percentage of
C3d staining per surface area being significantly higher (>4-fold) than paucibacillary
patients (p=0.006) (Fig. S3).
Chapter 2
70
Fig. 4 LAM and MAC deposition in nerves of leprosy patients. Immunostaining for the M. leprae
antigen LAM and C9, detecting MAC, in nerve biopsies of control (a, b) compared to paucibacillary (c,
d) and multibacillary (e, f) leprosy patients. The control nerves were negative for LAM (a) and MAC
(b), as expected. paucibacillary nerves show little immunoreactivity for LAM (c) and virtually no MAC
deposition (d) whereas multibacillary patients show robust staining for LAM (e and arrows) and MAC
(f). Quantification of the immunostainings showed that the amount of immunoreactivity for LAM (g)
and MAC (h) is significantly higher in multibacillary compared to paucibacillary nerves (Student’s t-test
paucibacillary versus multibacillary: LAM, p=0.01; C9, p=0.007). Error bars indicate standard error of
the mean.
Complement deposition is associated with M. leprae antigen LAM in leprosy
lesions.
To determine the location of the deposition of activated complement components in
the nerves of multibacillary leprosy patients, we performed immunofluorescent
double staining for MAC and C3d with the M. leprae antigen LAM or markers of
axons (SMI31 or pan-neurofilament). We found colocalization of LAM with MAC (Fig.
5a) and C3d (Fig. S4a), indicating that complement targets M. leprae in the nerve, as
expected. Notably, MAC and C3d immunoreactivity extended also to LAM-negative
nerve areas, which we identified to be axons as shown by the double immunolabeling
of C9 and C3d with the axonal marker SMI31 (Fig. 5b and Fig. S4b). In addition, co-
localization of LAM with neurofilament (see table S2), showed that LAM is present in
close proximity to axons which show signs of damage, including swelling and
degradation (Fig. 5c). Together these data suggest a functional link between
complement, the M. leprae antigen LAM and axonal changes in leprosy.
To determine whether there is a link between the amount of LAM and the amount of
complement activation in the nerves of paucibacillary and multibacillary leprosy
patients, we tested whether there is a correlation between the extent of C9 staining
and the extent of LAM staining in corresponding nerve areas. We found a highly
significant positive correlation between the amount of LAM and MAC (r=0.9601,
p<0.0001) in leprosy nerves (Fig. 5d). Also the percentage of C3d positive staining
correlated with the amount of LAM positive staining in the nerves (r=0.9692,
p<0.0001) (Fig. S4c). In line with these findings, we also found a significant
correlation between the percentage of complement-immunoreactivity for C3d
(r=0.9692, p=0.0003) or C9 (r=0.9682, p=0.0015) and the bacterial index in nerve
biopsies of paucibacillary and multibacillary leprosy patients (Fig. S5a, b). Overall
these data show a strong link between the presence of M. leprae antigen LAM in the
nerves and complement activation.
2
C6 inhibition in nerve damage in leprosy
71
Fig. 4 LAM and MAC deposition in nerves of leprosy patients. Immunostaining for the M. leprae
antigen LAM and C9, detecting MAC, in nerve biopsies of control (a, b) compared to paucibacillary (c,
d) and multibacillary (e, f) leprosy patients. The control nerves were negative for LAM (a) and MAC
(b), as expected. paucibacillary nerves show little immunoreactivity for LAM (c) and virtually no MAC
deposition (d) whereas multibacillary patients show robust staining for LAM (e and arrows) and MAC
(f). Quantification of the immunostainings showed that the amount of immunoreactivity for LAM (g)
and MAC (h) is significantly higher in multibacillary compared to paucibacillary nerves (Student’s t-test
paucibacillary versus multibacillary: LAM, p=0.01; C9, p=0.007). Error bars indicate standard error of
the mean.
Complement deposition is associated with M. leprae antigen LAM in leprosy
lesions.
To determine the location of the deposition of activated complement components in
the nerves of multibacillary leprosy patients, we performed immunofluorescent
double staining for MAC and C3d with the M. leprae antigen LAM or markers of
axons (SMI31 or pan-neurofilament). We found colocalization of LAM with MAC (Fig.
5a) and C3d (Fig. S4a), indicating that complement targets M. leprae in the nerve, as
expected. Notably, MAC and C3d immunoreactivity extended also to LAM-negative
nerve areas, which we identified to be axons as shown by the double immunolabeling
of C9 and C3d with the axonal marker SMI31 (Fig. 5b and Fig. S4b). In addition, co-
localization of LAM with neurofilament (see table S2), showed that LAM is present in
close proximity to axons which show signs of damage, including swelling and
degradation (Fig. 5c). Together these data suggest a functional link between
complement, the M. leprae antigen LAM and axonal changes in leprosy.
To determine whether there is a link between the amount of LAM and the amount of
complement activation in the nerves of paucibacillary and multibacillary leprosy
patients, we tested whether there is a correlation between the extent of C9 staining
and the extent of LAM staining in corresponding nerve areas. We found a highly
significant positive correlation between the amount of LAM and MAC (r=0.9601,
p<0.0001) in leprosy nerves (Fig. 5d). Also the percentage of C3d positive staining
correlated with the amount of LAM positive staining in the nerves (r=0.9692,
p<0.0001) (Fig. S4c). In line with these findings, we also found a significant
correlation between the percentage of complement-immunoreactivity for C3d
(r=0.9692, p=0.0003) or C9 (r=0.9682, p=0.0015) and the bacterial index in nerve
biopsies of paucibacillary and multibacillary leprosy patients (Fig. S5a, b). Overall
these data show a strong link between the presence of M. leprae antigen LAM in the
nerves and complement activation.
Chapter 2
72
Fig. 5 LAM is associated with MAC deposition in nerves of leprosy patients. Immunofluorescent
doublestaining for complement component C9, detecting MAC, and the M. leprae antigen LAM,
showing colocalization in the nerves of multibacillary patients (a). C9 and LAM also colocalized with
the SMI31 (b) and the neurofilament (NF) (c) markers of axons, respectively. The amount of C9
immunoreactivity significantly correlated with the amount of LAM immunoreactivity found in
paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9601, p<0.0001) (d),
indicating an association between the extent of M.leprae antigen LAM and MAC deposition in leprosy
nerves.
Discussion
The occurrence of polyneuropathy due to various infectious agents is well recognized
in the literature [18]. Among them, nerve damage in leprosy leading to permanent
disability still represents an important global health problem. The nerve damage in
leprosy is widely regarded as the consequence of adaptive immunity via M. leprae-
specific T cell activity, persisting long after the patients have completed treatment
[16]. However, the nerve damage should be regarded as an early sign of leprosy,
because the loss of sensation in patients with suspected leprosy is considered the
hall mark of early disease [1]. Despite advances in our knowledge of the
pathogenesis of leprosy spectrum, the understanding of the mechanisms of nerve
damage and regeneration in leprosy-associated neuropathy remains poor. Progress
has been limited by the lack of established experimental models for studying leprosy-
induced neuropathy.
Assuming that nerve dysfunction occurs at the onset of effective infection, it can be
hypothesized that before the initiation of host adaptive immunity, a direct interaction
between the nerve and the infectious agent, could be the initiator of nerve damage
which is then compounded by the inflammatory sequel. In support of this hypothesis,
literature reports imply that loss of myelin proteins can be induced by M. leprae in the
absence of lymphocytes in Rag knock out mice [13]. These data suggest the
existence of host innate factors that interact with a pathogen-associated molecule
(PAM) causing the initial damage. Understanding the molecular mechanisms, which
initiate nerve damage in leprosy, is critical for the development of effective therapies
aimed at preventing the severe disability in patients.
2
C6 inhibition in nerve damage in leprosy
73
Fig. 5 LAM is associated with MAC deposition in nerves of leprosy patients. Immunofluorescent
doublestaining for complement component C9, detecting MAC, and the M. leprae antigen LAM,
showing colocalization in the nerves of multibacillary patients (a). C9 and LAM also colocalized with
the SMI31 (b) and the neurofilament (NF) (c) markers of axons, respectively. The amount of C9
immunoreactivity significantly correlated with the amount of LAM immunoreactivity found in
paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9601, p<0.0001) (d),
indicating an association between the extent of M.leprae antigen LAM and MAC deposition in leprosy
nerves.
Discussion
The occurrence of polyneuropathy due to various infectious agents is well recognized
in the literature [18]. Among them, nerve damage in leprosy leading to permanent
disability still represents an important global health problem. The nerve damage in
leprosy is widely regarded as the consequence of adaptive immunity via M. leprae-
specific T cell activity, persisting long after the patients have completed treatment
[16]. However, the nerve damage should be regarded as an early sign of leprosy,
because the loss of sensation in patients with suspected leprosy is considered the
hall mark of early disease [1]. Despite advances in our knowledge of the
pathogenesis of leprosy spectrum, the understanding of the mechanisms of nerve
damage and regeneration in leprosy-associated neuropathy remains poor. Progress
has been limited by the lack of established experimental models for studying leprosy-
induced neuropathy.
Assuming that nerve dysfunction occurs at the onset of effective infection, it can be
hypothesized that before the initiation of host adaptive immunity, a direct interaction
between the nerve and the infectious agent, could be the initiator of nerve damage
which is then compounded by the inflammatory sequel. In support of this hypothesis,
literature reports imply that loss of myelin proteins can be induced by M. leprae in the
absence of lymphocytes in Rag knock out mice [13]. These data suggest the
existence of host innate factors that interact with a pathogen-associated molecule
(PAM) causing the initial damage. Understanding the molecular mechanisms, which
initiate nerve damage in leprosy, is critical for the development of effective therapies
aimed at preventing the severe disability in patients.
Chapter 2
74
Response against pathogens, which result in the activation of host’s innate and
adaptive factors, is essential for containing the infection, but excessive activation can
damage self-tissues. We have previously shown that activation of the complement
system, a key component of the host’s immune response, is an important player in
the process of nerve damage and regeneration. Specifically, we proved that
formation of the membrane attack complex (MAC: comprised of C5b C6 C7 C8 and
C9) is essential for rapid Wallerian degeneration of axons in peripheral nerves and
inhibition of MAC formation promotes axonal regeneration and recovery of the
damaged nerve [9, 11, 12]
In view of these key findings, we undertook the present study in two subsequent
steps Firstly, we made use of a mouse model of M. leprae-induced nerve injury to
elucidated the molecular pathways of the interaction between the nerve and M.
leprae components. Secondly, we analyzed nerve biopsies of leprosy patients to
establish the relevance of our experimental findings in the understanding of the
pathology of leprosy neuropathy. The combined data collected from the mouse
experiments and from the immunohistopathological analysis of nerve biopsies of
leprosy patients, led to our conclusion that lipoarabinomannan (LAM) of M. leprae is
the dominant PAM, which interacts with the nerve and initiates complement activation
resulting in the in situ formation of the MAC, causing nerve damage. We also show
that inhibition of MAC formation by antisense oligonucleotide-based therapy protects
the nerve from M. leprae-induced damage. Therefore we propose that MAC inhibition
could form the basis of future development of novel therapeutics for leprosy.
Complement activation in leprosy has been previously associated with immune
complexes, pointing to the involvement of the classical pathway of complement in the
disease [2]. Our data show that LAM-mediated complement activation is initiated via
the lectin pathway, potentially occurring via the binding of MBL or ficolins from the
circulation. However, we do not exclude a contribution of other pathways in the
pathogenesis of leprosy. We further demonstrated the co-localization of axonal
markers with LAM and MAC, which strongly points to the possibility that LAM
interacts with an axonal component and activates the complement cascade.
Complement activation induced by LAM may trigger a number of events, including
activation of neuronal cells, in situ generation of chemokines and chemoattractants,
recruitment of inflammatory cells including macrophages, ultimately leading to nerve
fragmentation in a similar manner to that seen in Wallerian degeneration [3, 6, 20].
The involvement of LAM in the pathogenesis of leprosy-induced neuropathy is also
supported by early studies showing that clearance of LAM from granulomas in skin
lesions is inefficient. Even after completion of treatment, LAM could still be detected
in skin and nerve biopsies from leprosy patients, with clearance of LAM from
granulomas in multibacillary lesions being slower than other antigens e.g. PGL-1
[21]. Interestingly, in this work the in situ expression of LAM appeared to be
associated with the occurrence of a reactional state. LAM is abundantly present in
infiltrating macrophages in lesions of multibacillary patients but not in paucibacillary
patients. In the latter case, hardly any macrophage infiltration is seen, instead
epitheloid cells are usually present.
LAM, a major pathogen-associated molecule of M. leprae, could be the trigger for
complement activation and subsequent demyelination. This generates myelin debris,
which by itself also activates complement and will attract macrophages [9]. In this
way, a vicious cycle occurs. Since LAM can be detected in nerves of leprosy patients
accompanied by myelinated axonal loss after multidrug therapy, the signals for
myelinated axonal loss might persist even after treatment.
2
C6 inhibition in nerve damage in leprosy
75
Response against pathogens, which result in the activation of host’s innate and
adaptive factors, is essential for containing the infection, but excessive activation can
damage self-tissues. We have previously shown that activation of the complement
system, a key component of the host’s immune response, is an important player in
the process of nerve damage and regeneration. Specifically, we proved that
formation of the membrane attack complex (MAC: comprised of C5b C6 C7 C8 and
C9) is essential for rapid Wallerian degeneration of axons in peripheral nerves and
inhibition of MAC formation promotes axonal regeneration and recovery of the
damaged nerve [9, 11, 12]
In view of these key findings, we undertook the present study in two subsequent
steps Firstly, we made use of a mouse model of M. leprae-induced nerve injury to
elucidated the molecular pathways of the interaction between the nerve and M.
leprae components. Secondly, we analyzed nerve biopsies of leprosy patients to
establish the relevance of our experimental findings in the understanding of the
pathology of leprosy neuropathy. The combined data collected from the mouse
experiments and from the immunohistopathological analysis of nerve biopsies of
leprosy patients, led to our conclusion that lipoarabinomannan (LAM) of M. leprae is
the dominant PAM, which interacts with the nerve and initiates complement activation
resulting in the in situ formation of the MAC, causing nerve damage. We also show
that inhibition of MAC formation by antisense oligonucleotide-based therapy protects
the nerve from M. leprae-induced damage. Therefore we propose that MAC inhibition
could form the basis of future development of novel therapeutics for leprosy.
Complement activation in leprosy has been previously associated with immune
complexes, pointing to the involvement of the classical pathway of complement in the
disease [2]. Our data show that LAM-mediated complement activation is initiated via
the lectin pathway, potentially occurring via the binding of MBL or ficolins from the
circulation. However, we do not exclude a contribution of other pathways in the
pathogenesis of leprosy. We further demonstrated the co-localization of axonal
markers with LAM and MAC, which strongly points to the possibility that LAM
interacts with an axonal component and activates the complement cascade.
Complement activation induced by LAM may trigger a number of events, including
activation of neuronal cells, in situ generation of chemokines and chemoattractants,
recruitment of inflammatory cells including macrophages, ultimately leading to nerve
fragmentation in a similar manner to that seen in Wallerian degeneration [3, 6, 20].
The involvement of LAM in the pathogenesis of leprosy-induced neuropathy is also
supported by early studies showing that clearance of LAM from granulomas in skin
lesions is inefficient. Even after completion of treatment, LAM could still be detected
in skin and nerve biopsies from leprosy patients, with clearance of LAM from
granulomas in multibacillary lesions being slower than other antigens e.g. PGL-1
[21]. Interestingly, in this work the in situ expression of LAM appeared to be
associated with the occurrence of a reactional state. LAM is abundantly present in
infiltrating macrophages in lesions of multibacillary patients but not in paucibacillary
patients. In the latter case, hardly any macrophage infiltration is seen, instead
epitheloid cells are usually present.
LAM, a major pathogen-associated molecule of M. leprae, could be the trigger for
complement activation and subsequent demyelination. This generates myelin debris,
which by itself also activates complement and will attract macrophages [9]. In this
way, a vicious cycle occurs. Since LAM can be detected in nerves of leprosy patients
accompanied by myelinated axonal loss after multidrug therapy, the signals for
myelinated axonal loss might persist even after treatment.
Chapter 2
76
We and others [8] also found that C3d and MAC are abundantly deposited in nerves
of multibacillary patients, even in biopsies from patients that have completed
treatment.
However, we should emphasize that the analysis of the nerve biopsies of leprosy
patients represents a snap shot of the disease pathology at the time when the patient
comes into the clinic. Therefore, a temporal course of pathological processes cannot
be concluded from the sole analysis of these biopsies. In view of this consideration,
the lack of MAC immunoreactivity in the nerves of paucibacillary patients, should be
interpreted carefully. Based on the in vitro and in vivo findings reported in this study,
we propose that the lack of MAC immunoreactivity in the paucibacillary biopsies is
likely due to the fact that in these patients the nerves are severely damaged and
MAC-activating debris and LAM are almost completely cleared, resulting in no
obvious MAC deposition at the time of biopsy. In line with this interpretation, we also
found a strong association between the presence of LAM and MAC deposition in the
nerves, which suggests a functional link between these two factors.
Here we investigated the acute effects of the cognate interaction of the nerve with M.
leprae components which trigger complement activation causing nerve damage. This
initial event cannot be studied in humans, because leprosy is a slowly developing
chronic inflammatory disease with adaptive immunity in operation, resulting in
M.leprae disruption, release and subsequent clearance of its components. In such a
situation the host may be intermittently exposed to some M.leprae components (e.g.
LAM) due to inefficient clearance or access of drug into nerves leading to changes in
component concentrations, altering the drive to complement activation that may be
relevant to the ongoing disease process.
Our model, comprising M.leprae intraneurial injections in nude mouse sciatic nerves
does not accurately represent human leprosy but rather tests the capacity of
M.leprae inactivated by gamma-irradiation or fractions thereof to activate
complement; infection with intact M.leprae in the immunocompetent host would not
allow such an analysis. Our analysis of human nerve biopsies from leprosy patients
allowed us to extrapolate results from the mouse model to man, showing relevance
of complement activation to the human disease. Complement was activated in
leprosy nerve biopsies, including formation of MAC, capable of damaging myelin and
causing lysis of the target cell. Nerve biopsies were available only from established
disease so these results only provide a snapshot demonstration of MAC deposition in
diseased nerves and do not allow us to conclude that the nerve damage, which
occurs early, is mediated by complement activation. A longitudinal study would be
important to test the role of MAC in nerve damage early in disease and such a study
is currently in progress.
In conclusion, we have shown that LAM is a dominant complement activating M.
leprae antigen. We also showed, in a model optimized to study the early cognate
interaction of M. leprae components with the nerve axon, that this interaction leads to
complement activation, myelin loss and axonal damage. Importantly, we proved that
inhibition of MAC formation prevented myelin and axonal loss in this model, providing
the proof of principle that blocking MAC formation may potentially reduce nerve
damage in M. leprae-induced neuropathy.
2
C6 inhibition in nerve damage in leprosy
77
We and others [8] also found that C3d and MAC are abundantly deposited in nerves
of multibacillary patients, even in biopsies from patients that have completed
treatment.
However, we should emphasize that the analysis of the nerve biopsies of leprosy
patients represents a snap shot of the disease pathology at the time when the patient
comes into the clinic. Therefore, a temporal course of pathological processes cannot
be concluded from the sole analysis of these biopsies. In view of this consideration,
the lack of MAC immunoreactivity in the nerves of paucibacillary patients, should be
interpreted carefully. Based on the in vitro and in vivo findings reported in this study,
we propose that the lack of MAC immunoreactivity in the paucibacillary biopsies is
likely due to the fact that in these patients the nerves are severely damaged and
MAC-activating debris and LAM are almost completely cleared, resulting in no
obvious MAC deposition at the time of biopsy. In line with this interpretation, we also
found a strong association between the presence of LAM and MAC deposition in the
nerves, which suggests a functional link between these two factors.
Here we investigated the acute effects of the cognate interaction of the nerve with M.
leprae components which trigger complement activation causing nerve damage. This
initial event cannot be studied in humans, because leprosy is a slowly developing
chronic inflammatory disease with adaptive immunity in operation, resulting in
M.leprae disruption, release and subsequent clearance of its components. In such a
situation the host may be intermittently exposed to some M.leprae components (e.g.
LAM) due to inefficient clearance or access of drug into nerves leading to changes in
component concentrations, altering the drive to complement activation that may be
relevant to the ongoing disease process.
Our model, comprising M.leprae intraneurial injections in nude mouse sciatic nerves
does not accurately represent human leprosy but rather tests the capacity of
M.leprae inactivated by gamma-irradiation or fractions thereof to activate
complement; infection with intact M.leprae in the immunocompetent host would not
allow such an analysis. Our analysis of human nerve biopsies from leprosy patients
allowed us to extrapolate results from the mouse model to man, showing relevance
of complement activation to the human disease. Complement was activated in
leprosy nerve biopsies, including formation of MAC, capable of damaging myelin and
causing lysis of the target cell. Nerve biopsies were available only from established
disease so these results only provide a snapshot demonstration of MAC deposition in
diseased nerves and do not allow us to conclude that the nerve damage, which
occurs early, is mediated by complement activation. A longitudinal study would be
important to test the role of MAC in nerve damage early in disease and such a study
is currently in progress.
In conclusion, we have shown that LAM is a dominant complement activating M.
leprae antigen. We also showed, in a model optimized to study the early cognate
interaction of M. leprae components with the nerve axon, that this interaction leads to
complement activation, myelin loss and axonal damage. Importantly, we proved that
inhibition of MAC formation prevented myelin and axonal loss in this model, providing
the proof of principle that blocking MAC formation may potentially reduce nerve
damage in M. leprae-induced neuropathy.
Chapter 2
78
Acknowledgements. This work was supported by the Leprosy Foundation of the Netherlands [grant
number 701.03.08]. NBEI performed the experiments and the data analysis; KF and PR performed the
intraneural injection of M. leprae in the pilot experiment (data not shown); JV performed the qPCR
experiment; PKD, FB and VR formulated the project and supervised the progress of the project; DT
and BPM advised on the project; FB coordinated the project; NBEI wrote the manuscript.
Conflicts of interest. FB. KF and VR are co-inventors of patents that describe the use of inhibitors of
the terminal complement pathway for therapeutic purposes and are founders of Regenesance BV,
which is developing inhibitors of the terminal complement pathway for clinical applications.
References
1. WHO Expert Committee on Leprosy (1998) World Health Organ Tech Rep Ser 874:1-43.
2. Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH (1976) Immune complexes and
complement hypercatabolism in patients with leprosy. Clin Exp Immunol 26:388-396.
3. Camara-Lemarroy CR, Guzman-De La Garza FJ, Fernandez-Garza NE (2010) Molecular
inflammatory mediators in peripheral nerve damage and regeneration. Neuroimmunomodulation
17:314-324.
4. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL (2008) The functional state of the
complement system in leprosy. Am J Trop Med Hyg 78:605-610.
5. Laal S, Bhutani LK, Nath I (1985) Natural emergence of antigen-reactive T cells in lepromatous
leprosy patients during erythema nodosum leprosum. Infect Immun 50:887-892.
6. Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R (2002) Lesion response of long-
term and recently immigrated resident endoneurial macrophages in peripheral nerve explant
cultures from bone marrow chimeric mice. Eur J Neurosci 16:1654-1660.
7. Morgan BP (2000) Measurement of complement hemolytic activity, generation of complement-
depleted sera, and production of hemolytic intermediates. Methods Mol Biol 150:61-71.
8. Parkash O, Kumar V, Mukherjee A, Sengupta U, et al. (1995) Membrane attack complex in
thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 9:195-199.
9. Ramaglia V, King RH, Nourallah M, Wolterman R, et al. (2007) The membrane attack complex
of the complement system is essential for rapid Wallerian degeneration. J Neurosci 27:7663-
7672.
10. Ramaglia V, Wolterman R, de Kok M, Vigar MA, et al. (2008) Soluble complement receptor 1
protects the peripheral nerve from early axon loss after injury. Am J Pathol 172:1043-1052.
11. Ramaglia V, King RH, Morgan BP, Baas F (2009) Deficiency of the complement regulator
CD59a exacerbates Wallerian degeneration. Mol Immunol 46:1892-1896.
12. Ramaglia V, Tannemaat MR, de KM, Wolterman R, et al. (2009) Complement inhibition
accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 47:302-309.
13. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL (2002) Contact-dependent demyelination by
Mycobacterium leprae in the absence of immune cells. Science 296:927-931.
14. Ridley DS, Jopling WH (1966) Classification of leprosy according to immunity. A five-group
system. Int J Lepr Other Mycobact Dis 34:255-273.
15. Ruseva MM, Hughes TR, Donev RM, Sivasankar B, et al. (2009) Crry deficiency in complement
sufficient mice: C3 consumption occurs without associated renal injury. Mol Immunol 46:803-
811.
16. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, et al. (2006) The continuing challenges of
leprosy. Clin Microbiol Rev 19:338-381.
2
C6 inhibition in nerve damage in leprosy
79
Acknowledgements. This work was supported by the Leprosy Foundation of the Netherlands [grant
number 701.03.08]. NBEI performed the experiments and the data analysis; KF and PR performed the
intraneural injection of M. leprae in the pilot experiment (data not shown); JV performed the qPCR
experiment; PKD, FB and VR formulated the project and supervised the progress of the project; DT
and BPM advised on the project; FB coordinated the project; NBEI wrote the manuscript.
Conflicts of interest. FB. KF and VR are co-inventors of patents that describe the use of inhibitors of
the terminal complement pathway for therapeutic purposes and are founders of Regenesance BV,
which is developing inhibitors of the terminal complement pathway for clinical applications.
References
1. WHO Expert Committee on Leprosy (1998) World Health Organ Tech Rep Ser 874:1-43.
2. Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH (1976) Immune complexes and
complement hypercatabolism in patients with leprosy. Clin Exp Immunol 26:388-396.
3. Camara-Lemarroy CR, Guzman-De La Garza FJ, Fernandez-Garza NE (2010) Molecular
inflammatory mediators in peripheral nerve damage and regeneration. Neuroimmunomodulation
17:314-324.
4. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL (2008) The functional state of the
complement system in leprosy. Am J Trop Med Hyg 78:605-610.
5. Laal S, Bhutani LK, Nath I (1985) Natural emergence of antigen-reactive T cells in lepromatous
leprosy patients during erythema nodosum leprosum. Infect Immun 50:887-892.
6. Leonhard C, Muller M, Hickey WF, Ringelstein EB, Kiefer R (2002) Lesion response of long-
term and recently immigrated resident endoneurial macrophages in peripheral nerve explant
cultures from bone marrow chimeric mice. Eur J Neurosci 16:1654-1660.
7. Morgan BP (2000) Measurement of complement hemolytic activity, generation of complement-
depleted sera, and production of hemolytic intermediates. Methods Mol Biol 150:61-71.
8. Parkash O, Kumar V, Mukherjee A, Sengupta U, et al. (1995) Membrane attack complex in
thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 9:195-199.
9. Ramaglia V, King RH, Nourallah M, Wolterman R, et al. (2007) The membrane attack complex
of the complement system is essential for rapid Wallerian degeneration. J Neurosci 27:7663-
7672.
10. Ramaglia V, Wolterman R, de Kok M, Vigar MA, et al. (2008) Soluble complement receptor 1
protects the peripheral nerve from early axon loss after injury. Am J Pathol 172:1043-1052.
11. Ramaglia V, King RH, Morgan BP, Baas F (2009) Deficiency of the complement regulator
CD59a exacerbates Wallerian degeneration. Mol Immunol 46:1892-1896.
12. Ramaglia V, Tannemaat MR, de KM, Wolterman R, et al. (2009) Complement inhibition
accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 47:302-309.
13. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL (2002) Contact-dependent demyelination by
Mycobacterium leprae in the absence of immune cells. Science 296:927-931.
14. Ridley DS, Jopling WH (1966) Classification of leprosy according to immunity. A five-group
system. Int J Lepr Other Mycobact Dis 34:255-273.
15. Ruseva MM, Hughes TR, Donev RM, Sivasankar B, et al. (2009) Crry deficiency in complement
sufficient mice: C3 consumption occurs without associated renal injury. Mol Immunol 46:803-
811.
16. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, et al. (2006) The continuing challenges of
leprosy. Clin Microbiol Rev 19:338-381.
Chapter 2
80
17. Shetty VP, Mistry NF, Birdi TJ, Antia NH (1995) Effect of T-cell depletion on bacterial
multiplication and pattern of nerve damage in M. leprae-infected mice. Indian J Lepr 67:363-374.
18. Sindic CJ (2013) Infectious neuropathies. Curr Opin Neurol 26:510-515.
19. Sohi AS, Kandhari KC, Singh N (1971) Motor nerve conduction studies in leprosy. Int J Dermatol
10:151-155.
20. Stoll G, Jander S, Myers RR (2002) Degeneration and regeneration of the peripheral nervous
system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 7:13-
27.
21. Verhagen C, Faber W, Klatser P, Buffing A, et al. (1999) Immunohistological analysis of in situ
expression of mycobacterial antigens in skin lesions of leprosy patients across the
histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and
Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol
154:1793-1804.
22. Walport MJ (2001) Complement. First of two parts. N Engl J Med 344:1058-1066.
23. Walport MJ (2001) Complement. Second of two parts. N Engl J Med 344:1140-1144.
SUPPLEMENTARY FIGURES & TABLES
Fig S1. a ELISA for MAC generation on mannan (1 µg)-coated plates incubated with either normal
human serum (NHS) or MBL-deficient (MBL-/-) serum for 15 minutes at 37°C, showing significant
reduction of MAC formation in MBL-/- serum, demonstrating that MBL-/- serum blocks lectin pathway
activation initiated by mannan. b ELISA for MAC generation on IgG1, 2, 3, 4 (IgG, 1 µg)-coated plates
incubated with NHS with either the neutralizing anti-C1q antibody or BSA as control, showing a
significant reduction of MAC formation by the anti-C1q antibody, demonstrating the anti-C1q antibody
blocks classical complement activation initiated by IgG. Normal human serum with BSA produced
abundant MAC generation (positive control) whereas normal human serum with EDTA (negative
control) blocked MAC formation as expected.
2
C6 inhibition in nerve damage in leprosy
81
17. Shetty VP, Mistry NF, Birdi TJ, Antia NH (1995) Effect of T-cell depletion on bacterial
multiplication and pattern of nerve damage in M. leprae-infected mice. Indian J Lepr 67:363-374.
18. Sindic CJ (2013) Infectious neuropathies. Curr Opin Neurol 26:510-515.
19. Sohi AS, Kandhari KC, Singh N (1971) Motor nerve conduction studies in leprosy. Int J Dermatol
10:151-155.
20. Stoll G, Jander S, Myers RR (2002) Degeneration and regeneration of the peripheral nervous
system: from Augustus Waller's observations to neuroinflammation. J Peripher Nerv Syst 7:13-
27.
21. Verhagen C, Faber W, Klatser P, Buffing A, et al. (1999) Immunohistological analysis of in situ
expression of mycobacterial antigens in skin lesions of leprosy patients across the
histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and
Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol
154:1793-1804.
22. Walport MJ (2001) Complement. First of two parts. N Engl J Med 344:1058-1066.
23. Walport MJ (2001) Complement. Second of two parts. N Engl J Med 344:1140-1144.
SUPPLEMENTARY FIGURES & TABLES
Fig S1. a ELISA for MAC generation on mannan (1 µg)-coated plates incubated with either normal
human serum (NHS) or MBL-deficient (MBL-/-) serum for 15 minutes at 37°C, showing significant
reduction of MAC formation in MBL-/- serum, demonstrating that MBL-/- serum blocks lectin pathway
activation initiated by mannan. b ELISA for MAC generation on IgG1, 2, 3, 4 (IgG, 1 µg)-coated plates
incubated with NHS with either the neutralizing anti-C1q antibody or BSA as control, showing a
significant reduction of MAC formation by the anti-C1q antibody, demonstrating the anti-C1q antibody
blocks classical complement activation initiated by IgG. Normal human serum with BSA produced
abundant MAC generation (positive control) whereas normal human serum with EDTA (negative
control) blocked MAC formation as expected.
Chapter 2
82
Fig S2. Myelin loss and axonal damage in nerves of leprosy patients. Immunohistochemistry for MBP
and the phosphorylated-neurofilament marker of axons, SMI31, showing intact myelin and axons in
control nerves (zoom a, b) whereas myelin loss and axonal damage are detected in nerves of
paucibacillary (c, d) and mutibacillary (e, f) leprosy patients. Quantification of the immunostainings
shows reduced immunoreactivity for MBP (g) and SMI31 (h) in both paucibacillary and multibacillary
nerves, indicating myelin loss and axonal damage in both groups. Notably, the amount of axonal
antigens are significantly more abundant in the multibacillary nerves compare to the paucibacillary (h)
(Student’s t-test paucibacillary versus multibacillary: p=0.02). Error bars indicate standard error of the
mean.
2
C6 inhibition in nerve damage in leprosy
83
Fig S2. Myelin loss and axonal damage in nerves of leprosy patients. Immunohistochemistry for MBP
and the phosphorylated-neurofilament marker of axons, SMI31, showing intact myelin and axons in
control nerves (zoom a, b) whereas myelin loss and axonal damage are detected in nerves of
paucibacillary (c, d) and mutibacillary (e, f) leprosy patients. Quantification of the immunostainings
shows reduced immunoreactivity for MBP (g) and SMI31 (h) in both paucibacillary and multibacillary
nerves, indicating myelin loss and axonal damage in both groups. Notably, the amount of axonal
antigens are significantly more abundant in the multibacillary nerves compare to the paucibacillary (h)
(Student’s t-test paucibacillary versus multibacillary: p=0.02). Error bars indicate standard error of the
mean.
Chapter 2
84
Fig. S3. C3d deposition in nerves of leprosy patients. Immunohistochemistry for C3d on nerve
biopsies of controls (a) compared to paucibacillary (b) and multibacillary (c) leprosy patients. The
control nerves are negative for C3d (a) whereas the nerves of paucibacillary and multibacillary
patients show immunoreactivity for C3d (b, c and arrows). Quantification of the staining (d), shows a
significant higher amounts of C3d deposits in the nerves of multibacillary compared to paucibacillary
patients (Student’s t-test paucibacillary versus multibacillary: p=0.006). Error bars indicate standard
error of the mean.
Fig. S4. Bacterial Index (BI) is associated with C3d and MAC deposition in nerves of leprosy patients.
The amount of C3d (a) and C9 (b) immunoreactivity significantly correlated with the BI of
paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9692, p=0.0003 and
r=0.9682, p=0.0015 respectively), indicating an association between the M.leprae BI and complement
activation in leprosy nerves.
Table S1. Bacterial fractions (BEI Resources)
Catalogue number Product Description
NR-19329 Whole Cell Sonicate of gamma-irradiated -- Mycobacterium leprae
NR-19348 Lipoarabinomannan (LAM) -- Mycobacterium leprae
NR-19342 Phenolic Glycolipid-1 (PGL-1) -- Mycobacterium leprae
NR-19333 Cell Wall Fraction (MLCwA) -- Mycobacterium leprae
NR-19331 Cell Membrane Fraction (MLMA) -- Mycobacterium leprae
NR-14821 HN878 Gamma-irradiated Whole Cells – Mycobacterium tuberculosis
2
C6 inhibition in nerve damage in leprosy
85
Fig. S3. C3d deposition in nerves of leprosy patients. Immunohistochemistry for C3d on nerve
biopsies of controls (a) compared to paucibacillary (b) and multibacillary (c) leprosy patients. The
control nerves are negative for C3d (a) whereas the nerves of paucibacillary and multibacillary
patients show immunoreactivity for C3d (b, c and arrows). Quantification of the staining (d), shows a
significant higher amounts of C3d deposits in the nerves of multibacillary compared to paucibacillary
patients (Student’s t-test paucibacillary versus multibacillary: p=0.006). Error bars indicate standard
error of the mean.
Fig. S4. Bacterial Index (BI) is associated with C3d and MAC deposition in nerves of leprosy patients.
The amount of C3d (a) and C9 (b) immunoreactivity significantly correlated with the BI of
paucibacillary and multibacillary leprosy nerves (Pearson’s correlation, r=0.9692, p=0.0003 and
r=0.9682, p=0.0015 respectively), indicating an association between the M.leprae BI and complement
activation in leprosy nerves.
Table S1. Bacterial fractions (BEI Resources)
Catalogue number Product Description
NR-19329 Whole Cell Sonicate of gamma-irradiated -- Mycobacterium leprae
NR-19348 Lipoarabinomannan (LAM) -- Mycobacterium leprae
NR-19342 Phenolic Glycolipid-1 (PGL-1) -- Mycobacterium leprae
NR-19333 Cell Wall Fraction (MLCwA) -- Mycobacterium leprae
NR-19331 Cell Membrane Fraction (MLMA) -- Mycobacterium leprae
NR-14821 HN878 Gamma-irradiated Whole Cells – Mycobacterium tuberculosis
Chapter 2
86
Table S2. Antibody, source, dilution
Antibody Detects Source Dilution
Polyclonal rabbit anti-rat C9
(cross-reacts with human C9)
MAC Made in house
(B.P. Morgan)
1:200’
Polyclonal rabbit anti-human MBP Myelin Dako (A0623) 1:100*
Polyclonal rabbit anti-mouse
Neurofilament
Axons Abcam (ab8135) 1:1000*
Polyclonal rabbit anti-mouse S100β Schwann cells Dako (Z0311) 1:400*
Polyclonal rabbit anti-mouse Iba-1 Macrophages Wako (019-19741) 1:200*
Monoclonal mouse anti-M. leprae PGL-1 Phenolic glycolipid-1 Made in house
(P.K. Das)
1:200’
Polyclonal rabbit anti-human C3d C3dg Dako (A0063) 1:200*
Monoclonal mouse anti-LAM LAM Made in house
(P.K. Das)
1:200’
Monoclonal mouse anti-human
phosphorylated neurofilament (clone
SMI31)
Axons Sternberger
Monoclonals Inc.
1:1000’
Antigen retrieval was performed with either 10mM Tris 1mM EDTA pH 9’ or 10mM Sodium Citrate pH 6*
Table S3. Characterization of nerve biopsies and clinical data of leprosy patients and controls
Case Nerve biopsy Leprosy type Gender Age
diagnosis
(in years)
Treatment
1 ulnar - F Unknown -
2 sural - F 50 -
3 sural - M 54 -
4 sural - M 45 -
5 sural - F 60 -
6 sural Paucibacillary M 65 MDT
7 sural Paucibacillary M Unknown Unknown
8 ulnar Paucibacillary M 59 MDT
9 ulnar Paucibacillary M 52 ROM
10 sural Paucibacillary F 43 MDT
11 sural Multibacillary F 28 DDS
12 sural Multibacillary F 43 MDT
13 fibular Multibacillary M Unknown Unknown
14 ulnar Multibacillary M 36 MDT
15 ulnar Multibacillary M 27 Unknown
16 sural Multibacillary M 43 DDS, MDT
17 ulnar Multibacillary M 49 MDT, Thalimidoglutarimide
Prednisolone
F, female; M, male; MDT, multidrug therapy; DDS, diamino diphenyl sulphone; ROM, rifampicin,
ofloxacin and minocycline.
2
C6 inhibition in nerve damage in leprosy
87
Table S2. Antibody, source, dilution
Antibody Detects Source Dilution
Polyclonal rabbit anti-rat C9
(cross-reacts with human C9)
MAC Made in house
(B.P. Morgan)
1:200’
Polyclonal rabbit anti-human MBP Myelin Dako (A0623) 1:100*
Polyclonal rabbit anti-mouse
Neurofilament
Axons Abcam (ab8135) 1:1000*
Polyclonal rabbit anti-mouse S100β Schwann cells Dako (Z0311) 1:400*
Polyclonal rabbit anti-mouse Iba-1 Macrophages Wako (019-19741) 1:200*
Monoclonal mouse anti-M. leprae PGL-1 Phenolic glycolipid-1 Made in house
(P.K. Das)
1:200’
Polyclonal rabbit anti-human C3d C3dg Dako (A0063) 1:200*
Monoclonal mouse anti-LAM LAM Made in house
(P.K. Das)
1:200’
Monoclonal mouse anti-human
phosphorylated neurofilament (clone
SMI31)
Axons Sternberger
Monoclonals Inc.
1:1000’
Antigen retrieval was performed with either 10mM Tris 1mM EDTA pH 9’ or 10mM Sodium Citrate pH 6*
Table S3. Characterization of nerve biopsies and clinical data of leprosy patients and controls
Case Nerve biopsy Leprosy type Gender Age
diagnosis
(in years)
Treatment
1 ulnar - F Unknown -
2 sural - F 50 -
3 sural - M 54 -
4 sural - M 45 -
5 sural - F 60 -
6 sural Paucibacillary M 65 MDT
7 sural Paucibacillary M Unknown Unknown
8 ulnar Paucibacillary M 59 MDT
9 ulnar Paucibacillary M 52 ROM
10 sural Paucibacillary F 43 MDT
11 sural Multibacillary F 28 DDS
12 sural Multibacillary F 43 MDT
13 fibular Multibacillary M Unknown Unknown
14 ulnar Multibacillary M 36 MDT
15 ulnar Multibacillary M 27 Unknown
16 sural Multibacillary M 43 DDS, MDT
17 ulnar Multibacillary M 49 MDT, Thalimidoglutarimide
Prednisolone
F, female; M, male; MDT, multidrug therapy; DDS, diamino diphenyl sulphone; ROM, rifampicin,
ofloxacin and minocycline.
Maria Rita (70, hier met kleinzoon) is genezen van lepra. Door de ziekte heeft ze
geen gevoel meer in haar handen, maar wat lepra precies is, vindt ze moeilijk te
omschrijven. Haar vrienden heeft ze niets verteld.
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
Complement Activation In Leprosy: A Retrospective Study
Shows Elevated Circulating Terminal Complement Complex In
Reactional Leprosy
Nawal Bahia El Idrissi1, Svetlana Hakobyan2, Valeria Ramaglia1, Annemieke Geluk3,
B. Paul Morgan2, Pranab Kumar Das1,4 and Frank Baas1 Clinical Experimental
Immunology, 2016 January.
1 Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The
Netherlands; 2 Institute of Infection and Immunity, School of Medicine, Cardiff University,
Cardiff, CF14 4YU, United Kingdom; 3 Department of Infectious Diseases, Leiden University
Medical Centre, Leiden, 2333 ZA, The Netherlands.; 4 Department of Clinical Immunology,
Colleges of Medical and Dental Sciences, University of Birmingham, Birmingham, UK
Maria Rita (70, hier met kleinzoon) is genezen van lepra. Door de ziekte heeft ze
geen gevoel meer in haar handen, maar wat lepra precies is, vindt ze moeilijk te
omschrijven. Haar vrienden heeft ze niets verteld.
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
Complement Activation In Leprosy: A Retrospective Study
Shows Elevated Circulating Terminal Complement Complex In
Reactional Leprosy
Nawal Bahia El Idrissi1, Svetlana Hakobyan2, Valeria Ramaglia1, Annemieke Geluk3,
B. Paul Morgan2, Pranab Kumar Das1,4 and Frank Baas1 Clinical Experimental
Immunology, 2016 January.
1 Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The
Netherlands; 2 Institute of Infection and Immunity, School of Medicine, Cardiff University,
Cardiff, CF14 4YU, United Kingdom; 3 Department of Infectious Diseases, Leiden University
Medical Centre, Leiden, 2333 ZA, The Netherlands.; 4 Department of Clinical Immunology,
Colleges of Medical and Dental Sciences, University of Birmingham, Birmingham, UK
3
Chapter 3
90
Summary
Mycobacterium leprae (M. leprae) infection gives rise to the immunologically and
histopathologically classified spectrum of leprosy. At present several tools for the
stratification of patients are based on acquired immunity markers. However, the role
of innate immunity, particularly the complement system, is largely unexplored. The
present retrospective study was undertaken to explore whether the systemic levels of
complement activation components and regulators can stratify leprosy patients,
particularly in reference to the reactional state of the disease.
Serum samples from two cohorts were analyzed. The cohort from Bangladesh
included multibacillary (MB) patients with (n=12) or without (n=46) reaction (R) at
intake and endemic controls (n=20). The cohort from Ethiopia included paucibacillary
(PB; n= 7) and MB (n= 23) patients without reaction and MB (n=15) patients with
reaction.
The results showed that the activation products terminal complement complex (TCC)
(p ≤0.01), C4d (p ≤0.05) and iC3b (p ≤0.05) were specifically elevated in Bangladeshi
patients with reaction at intake compared to endemic controls. In addition, levels of
the regulator Clusterin (p ≤0.001 without R; p<0.05 with R) were also elevated in MB
patients irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed
that irrespective of a reaction, serum TCC levels were significantly increased in
patients with reactions compared to patients without reactions (p ≤0.05).
Our findings suggests that serum TCC levels may prove to be a valuable tool in
diagnosing patients at risk of developing reactions.
Keywords. Complement, Leprosy, Reactions
Introduction
Leprosy is a chronic debilitating disease caused by Mycobacterium leprae (M.
leprae), an obligate intracellular parasite with tropism for macrophages and Schwann
cells. Effective treatment with multi drug therapy (MDT) has reduced the prevalence
around the world, although new case detection has remained stable at around
200,000 per annum. Nevertheless, the disease is still endemic in several parts of the
world, including parts of Bangladesh, Ethiopia, Brazil and Nepal
(http://www.who.int/mediacentre/factsheets/).
Although the infection is asymptomatic for a prolonged period, the disease eventually
presents with nerve damage, which is the major cause of patients’ disability and
deformities. On the basis of clinical, histopathological and immunological criteria
leprosy is recognized as a spectral disease [1]. The inter-individual variablity of
acquired immune response to M. leprae and its antigens dictates the clinical,
histopathological and immunological spectrum of leprosy [2]. As a result, it is now
well established that the leprosy spectrum fluctuates between two poles: tuberculoid
leprosy (TT) with a strong M. leprae specific T-helper 1 (Th1) cell-mediated immunity
associated with negligible bacillary load, and lepromatous leprosy (LL) with a strong
antibody response to M. leprae, phenolic glycolipid- 1 (PGL-I) accompanied by
complete absence of M. leprae specific Th1 response. The polar LL patients show
high bacillary load in relation to T-cell anergy to M. leprae not only in the lesions, but
also in other tissues in a disseminated manner. Between the two polar forms, the
majority of patients belong to immunologically unstable borderline categories that
are classified as borderline tuberculoid (BT), mid-borderline (BB) and borderline
lepromatous (BL) with variable degree of bacillary load with an increasing trend from
3
Complement in serum of leprosy patients
91
Summary
Mycobacterium leprae (M. leprae) infection gives rise to the immunologically and
histopathologically classified spectrum of leprosy. At present several tools for the
stratification of patients are based on acquired immunity markers. However, the role
of innate immunity, particularly the complement system, is largely unexplored. The
present retrospective study was undertaken to explore whether the systemic levels of
complement activation components and regulators can stratify leprosy patients,
particularly in reference to the reactional state of the disease.
Serum samples from two cohorts were analyzed. The cohort from Bangladesh
included multibacillary (MB) patients with (n=12) or without (n=46) reaction (R) at
intake and endemic controls (n=20). The cohort from Ethiopia included paucibacillary
(PB; n= 7) and MB (n= 23) patients without reaction and MB (n=15) patients with
reaction.
The results showed that the activation products terminal complement complex (TCC)
(p ≤0.01), C4d (p ≤0.05) and iC3b (p ≤0.05) were specifically elevated in Bangladeshi
patients with reaction at intake compared to endemic controls. In addition, levels of
the regulator Clusterin (p ≤0.001 without R; p<0.05 with R) were also elevated in MB
patients irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed
that irrespective of a reaction, serum TCC levels were significantly increased in
patients with reactions compared to patients without reactions (p ≤0.05).
Our findings suggests that serum TCC levels may prove to be a valuable tool in
diagnosing patients at risk of developing reactions.
Keywords. Complement, Leprosy, Reactions
Introduction
Leprosy is a chronic debilitating disease caused by Mycobacterium leprae (M.
leprae), an obligate intracellular parasite with tropism for macrophages and Schwann
cells. Effective treatment with multi drug therapy (MDT) has reduced the prevalence
around the world, although new case detection has remained stable at around
200,000 per annum. Nevertheless, the disease is still endemic in several parts of the
world, including parts of Bangladesh, Ethiopia, Brazil and Nepal
(http://www.who.int/mediacentre/factsheets/).
Although the infection is asymptomatic for a prolonged period, the disease eventually
presents with nerve damage, which is the major cause of patients’ disability and
deformities. On the basis of clinical, histopathological and immunological criteria
leprosy is recognized as a spectral disease [1]. The inter-individual variablity of
acquired immune response to M. leprae and its antigens dictates the clinical,
histopathological and immunological spectrum of leprosy [2]. As a result, it is now
well established that the leprosy spectrum fluctuates between two poles: tuberculoid
leprosy (TT) with a strong M. leprae specific T-helper 1 (Th1) cell-mediated immunity
associated with negligible bacillary load, and lepromatous leprosy (LL) with a strong
antibody response to M. leprae, phenolic glycolipid- 1 (PGL-I) accompanied by
complete absence of M. leprae specific Th1 response. The polar LL patients show
high bacillary load in relation to T-cell anergy to M. leprae not only in the lesions, but
also in other tissues in a disseminated manner. Between the two polar forms, the
majority of patients belong to immunologically unstable borderline categories that
are classified as borderline tuberculoid (BT), mid-borderline (BB) and borderline
lepromatous (BL) with variable degree of bacillary load with an increasing trend from
Chapter 3
92
BT towards BL/LL. On the basis of bacillary indices of the lesions, LL together with
BB and BL are collectively grouped as multibacillary (MB), whereas the BT and TT
forms are grouped as paucibacillary (PB) [1].
MDT is effective in curing leprosy to a large extent as, in the majority of MB patients,
the dead bacilli are cleared steadily. However, a considerable number of patients
show a changing clinical and immunohistopathological status in the course of the
disease as well as during and post-treatment either as a result of treatment or as a
natural evolution of the disease. Such episodic disease status is widely recognized
as reactional state, resulting in clinical and pathological alterations accompanied by
exacerbation of tissue (particularly) nerve damage [3,4].
The change in immunological response results in one of two types of reactions: i)
reversal reaction (RR, also called type 1 reaction) primarily encountered with patients
with BT and BL category or ii) erythema nodosum leprosum (ENL, also called type 2
reaction), especially in the borderline and lepromatous region of the spectrum. Both
these episodic reactions appear to be due to the persistence of antigens like
lipoarabinomannan (LAM) or PGL-I [5]. Interestingly, the localization of persisting M.
leprae antigens in leprosy patients with nerve damage was also demonstrated by
Shetty VP et al [6].
In general, RR or type 1 reactions are due to the polarization of M. leprae specific T-
cell activity with the cytokine characteristic of Th1 profile [7,8], and usually occur
early in the course of treatment and result in an increased cellular immune response
to mycobacterial antigens.
On the other hand, ENL or type 2 reactions are due to the increased T-cell
dependent antibody production (specifically to M. leprae antigens or to treatment
drugs) resulting in immune complex formation and complement activation [9-13].
Accordingly, efforts to establish sets of biomarkers for laboratory diagnosis and
prognosis of leprosy spectrum and leprosy reactions has concentrated on acquired
immunity-based cytokine and antibody profiling of the patients [14-17]. In contrast,
biomarkers of innate immunity in leprosy pathomechanism have received little
attention. Indeed, studies linking biomarkers of innate immunity in regards to the role
of complement in leprosy disease state, particularly to the reactional state, are rare
in literature.
The complement system is an integral part of innate immunity, comprising more than
30 serum and cell-associated proteins and plays an important role in host immunity
and inflammation[18]. Its activation and regulation occurs via multiple pathways.
Complement activation can be triggered by antigen-antibody complexes (classical
pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin pathway).
Regardless of the trigger, activation results in the cleavage of C3, generating the
anaphylatoxin C3a and the opsonin C3b, the latter of which binds pathogens thereby
mediating clearance by phagocytes. C3b is also required for the formation of the C5
convertase, to cleave C5 into C5a and C5b. C5b initiates activation of the terminal
pathway, which results in the formation of the membrane attack complex (MAC)
comprising a heteropolymer of C5b, C6, C7, C8 and multiple C9 molecules that
forms transmembrane channels in the target cell, resulting in lysis.
Deposits of MAC or the soluble terminal complement complex (TCC) were
demonstrated in association with damaged nerve in leprosy patients[19]. In this
3
Complement in serum of leprosy patients
93
BT towards BL/LL. On the basis of bacillary indices of the lesions, LL together with
BB and BL are collectively grouped as multibacillary (MB), whereas the BT and TT
forms are grouped as paucibacillary (PB) [1].
MDT is effective in curing leprosy to a large extent as, in the majority of MB patients,
the dead bacilli are cleared steadily. However, a considerable number of patients
show a changing clinical and immunohistopathological status in the course of the
disease as well as during and post-treatment either as a result of treatment or as a
natural evolution of the disease. Such episodic disease status is widely recognized
as reactional state, resulting in clinical and pathological alterations accompanied by
exacerbation of tissue (particularly) nerve damage [3,4].
The change in immunological response results in one of two types of reactions: i)
reversal reaction (RR, also called type 1 reaction) primarily encountered with patients
with BT and BL category or ii) erythema nodosum leprosum (ENL, also called type 2
reaction), especially in the borderline and lepromatous region of the spectrum. Both
these episodic reactions appear to be due to the persistence of antigens like
lipoarabinomannan (LAM) or PGL-I [5]. Interestingly, the localization of persisting M.
leprae antigens in leprosy patients with nerve damage was also demonstrated by
Shetty VP et al [6].
In general, RR or type 1 reactions are due to the polarization of M. leprae specific T-
cell activity with the cytokine characteristic of Th1 profile [7,8], and usually occur
early in the course of treatment and result in an increased cellular immune response
to mycobacterial antigens.
On the other hand, ENL or type 2 reactions are due to the increased T-cell
dependent antibody production (specifically to M. leprae antigens or to treatment
drugs) resulting in immune complex formation and complement activation [9-13].
Accordingly, efforts to establish sets of biomarkers for laboratory diagnosis and
prognosis of leprosy spectrum and leprosy reactions has concentrated on acquired
immunity-based cytokine and antibody profiling of the patients [14-17]. In contrast,
biomarkers of innate immunity in leprosy pathomechanism have received little
attention. Indeed, studies linking biomarkers of innate immunity in regards to the role
of complement in leprosy disease state, particularly to the reactional state, are rare
in literature.
The complement system is an integral part of innate immunity, comprising more than
30 serum and cell-associated proteins and plays an important role in host immunity
and inflammation[18]. Its activation and regulation occurs via multiple pathways.
Complement activation can be triggered by antigen-antibody complexes (classical
pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin pathway).
Regardless of the trigger, activation results in the cleavage of C3, generating the
anaphylatoxin C3a and the opsonin C3b, the latter of which binds pathogens thereby
mediating clearance by phagocytes. C3b is also required for the formation of the C5
convertase, to cleave C5 into C5a and C5b. C5b initiates activation of the terminal
pathway, which results in the formation of the membrane attack complex (MAC)
comprising a heteropolymer of C5b, C6, C7, C8 and multiple C9 molecules that
forms transmembrane channels in the target cell, resulting in lysis.
Deposits of MAC or the soluble terminal complement complex (TCC) were
demonstrated in association with damaged nerve in leprosy patients[19]. In this
Chapter 3
94
context, we recently showed the association between persistence of the M. leprae
antigen LAM and complement activation in the damaged nerve. This finding strongly
suggests that complement activation plays a causal role in nerve damage in leprosy.
Since nerve damage is prominent in reactional episodes it is rational to speculate
that complement activation and formation of TCC or MAC can be valuable in
diagnosing leprosy patients without reaction from those with reactions. There are
only a few studies on serology of complement activation in leprosy reported in the
literature [20-23]. PPrevious serological studies showed 1) reduced complement
hemolytic activity and reduced levels of C4 in LL patients suggesting consumption of
complement in the circulation via activation of the classical or lectin pathway [23,24];
2) an increased C1q binding activity (the initiator of classical pathway activation) in
LL patients with ENL reactions suggesting involvement of the classical pathway in
these patients, and increased C3d levels in 70% of patients with ENL and 18% of
patients with uncomplicated LL. Such findings suggested that C3d could be a marker
of complement activation which may be of some practical interest in the early
diagnosis of reactional state [12]. Thus, taking the literature findings with our own, we
decided to reinvestigate the use of serological markers of complement activation in
leprosy reaction, which is the major cause of leprosy-associated nerve damage.
In this retrospective study we used a state-of-the-art multiplex assay set (Meso
Scale) for the quantification of complement activation products and regulators in
serum of patients and controls to test whether the quantification of complement
products might be valuable in diagnosing leprosy patients without reaction from those
with reactions.
Materials and methods
Serum samples
Serum samples were obtained from stored serum bank collected for a prospective
cohort study in two leprosy endemic regions, Bangladesh and Ethiopia [25]. Ethical
approval of the study-protocol was obtained through appropriate ethics committees
and written informed consent was obtained from the patients before the samples
were collected.
These samples were transported to the LUMC, Leiden, Netherlands for storage. It
should be stated with clarity that the serum samples were collected and stored under
conditions found suitable for another study [25]; complement assay require special
addition of EDTA which was not included in the collection of these sera. We have
refrained from dealing with the types of reactions , as the patients’ samples are
obtained from archive of stored specimens and not with the aim of longitudinal study.
Serum samples were stored at -20◦C or below and shipped frozen on dry ice.
Briefly, in this study we used biobanked serum samples of untreated leprosy patients
without clinical reactions ( and before MDT) and newly diagnosed patients who
visited clinics with reactions and sera were collected in a similar fashion and before
starting treatment. In addition, we had the opportunity to follow up four of these
patients with reaction and also collected samples after the completion of treatment.
Serum samples from the Bangladesh cohort consisted of MB patients with (n=12) or
without (n=46) reactions at intake and endemic controls lacking clinical signs and
symptoms of leprosy or TB (n=20); a replication cohort comprised serum samples of
PB (TT and BT) (n=7), multibacillary (BL and LL) without (n=23) and with reaction
3
Complement in serum of leprosy patients
95
context, we recently showed the association between persistence of the M. leprae
antigen LAM and complement activation in the damaged nerve. This finding strongly
suggests that complement activation plays a causal role in nerve damage in leprosy.
Since nerve damage is prominent in reactional episodes it is rational to speculate
that complement activation and formation of TCC or MAC can be valuable in
diagnosing leprosy patients without reaction from those with reactions. There are
only a few studies on serology of complement activation in leprosy reported in the
literature [20-23]. PPrevious serological studies showed 1) reduced complement
hemolytic activity and reduced levels of C4 in LL patients suggesting consumption of
complement in the circulation via activation of the classical or lectin pathway [23,24];
2) an increased C1q binding activity (the initiator of classical pathway activation) in
LL patients with ENL reactions suggesting involvement of the classical pathway in
these patients, and increased C3d levels in 70% of patients with ENL and 18% of
patients with uncomplicated LL. Such findings suggested that C3d could be a marker
of complement activation which may be of some practical interest in the early
diagnosis of reactional state [12]. Thus, taking the literature findings with our own, we
decided to reinvestigate the use of serological markers of complement activation in
leprosy reaction, which is the major cause of leprosy-associated nerve damage.
In this retrospective study we used a state-of-the-art multiplex assay set (Meso
Scale) for the quantification of complement activation products and regulators in
serum of patients and controls to test whether the quantification of complement
products might be valuable in diagnosing leprosy patients without reaction from those
with reactions.
Materials and methods
Serum samples
Serum samples were obtained from stored serum bank collected for a prospective
cohort study in two leprosy endemic regions, Bangladesh and Ethiopia [25]. Ethical
approval of the study-protocol was obtained through appropriate ethics committees
and written informed consent was obtained from the patients before the samples
were collected.
These samples were transported to the LUMC, Leiden, Netherlands for storage. It
should be stated with clarity that the serum samples were collected and stored under
conditions found suitable for another study [25]; complement assay require special
addition of EDTA which was not included in the collection of these sera. We have
refrained from dealing with the types of reactions , as the patients’ samples are
obtained from archive of stored specimens and not with the aim of longitudinal study.
Serum samples were stored at -20◦C or below and shipped frozen on dry ice.
Briefly, in this study we used biobanked serum samples of untreated leprosy patients
without clinical reactions ( and before MDT) and newly diagnosed patients who
visited clinics with reactions and sera were collected in a similar fashion and before
starting treatment. In addition, we had the opportunity to follow up four of these
patients with reaction and also collected samples after the completion of treatment.
Serum samples from the Bangladesh cohort consisted of MB patients with (n=12) or
without (n=46) reactions at intake and endemic controls lacking clinical signs and
symptoms of leprosy or TB (n=20); a replication cohort comprised serum samples of
PB (TT and BT) (n=7), multibacillary (BL and LL) without (n=23) and with reaction
Chapter 3
96
(n=15) from Ethiopia (Table 1). No endemic control samples were tested for the
Ethiopian cohort.
Table 1. Demographic and clinical data of cases and controls for serological studies
Number of cases Female/male ratio Age Ethnicity Leprosy Type
20 7: 13 22-45 Bangladesh Endemic controls
46 12:22 20-41 Bangladesh MB, No reaction
47 5:14 18-44 Bangladesh MB, Reaction
7 3:4 24-46 Ethiopia PB (TT/BT), No reaction
23 10:13 16- 41 Ethiopia MB (BL/LL), No reaction
15 3:13 18- 44 Ethiopia MB, Reaction
Meso Scale Discovery (MSD) platform
All the complement assays were performed on a novel multiplex developed using the
MesoScale Discovery Platform (MSD; Gaithersburg, MD; www.mesoscale.com). The
multiplex set comprised C1s, the activation markers C4d, Bb, iC3b and TCC, and the
regulators FH (using FH Y402, FH H402 monoclonal antibodies which quantifies the
concentration of total factor H as described previously [26]) and clusterin (Table 2).
All the in-house antibodies were initially established as ELISA assays for evaluating
the level of compliment activation products on the MSD platform. The assays were
extensively validated, and the results were described in details previously [26,27].
Antibody-coated plates were blocked with BSA/EDTA/PBS, serum samples and
standards diluted in BSA/EDTA/PBS added to wells and incubated for 1 hour at RT
on a shaker. Plates were washed, the detecting antibody cocktail added to the plate
(Table 2) and incubated for 1 hour at RT on a shaker. After washing, the reading
buffer (R92TC-2; MesoScale Diagnostics) was added and plates were read on a
MSD Sector Imager 6000 instrument. The data were analyzed using SoftMax Pro 4.6
Enterprise Edition (Molecular Devices LLC, Sunnyvale, CA, USA).
3
Complement in serum of leprosy patients
97
(n=15) from Ethiopia (Table 1). No endemic control samples were tested for the
Ethiopian cohort.
Table 1. Demographic and clinical data of cases and controls for serological studies
Number of cases Female/male ratio Age Ethnicity Leprosy Type
20 7: 13 22-45 Bangladesh Endemic controls
46 12:22 20-41 Bangladesh MB, No reaction
47 5:14 18-44 Bangladesh MB, Reaction
7 3:4 24-46 Ethiopia PB (TT/BT), No reaction
23 10:13 16- 41 Ethiopia MB (BL/LL), No reaction
15 3:13 18- 44 Ethiopia MB, Reaction
Meso Scale Discovery (MSD) platform
All the complement assays were performed on a novel multiplex developed using the
MesoScale Discovery Platform (MSD; Gaithersburg, MD; www.mesoscale.com). The
multiplex set comprised C1s, the activation markers C4d, Bb, iC3b and TCC, and the
regulators FH (using FH Y402, FH H402 monoclonal antibodies which quantifies the
concentration of total factor H as described previously [26]) and clusterin (Table 2).
All the in-house antibodies were initially established as ELISA assays for evaluating
the level of compliment activation products on the MSD platform. The assays were
extensively validated, and the results were described in details previously [26,27].
Antibody-coated plates were blocked with BSA/EDTA/PBS, serum samples and
standards diluted in BSA/EDTA/PBS added to wells and incubated for 1 hour at RT
on a shaker. Plates were washed, the detecting antibody cocktail added to the plate
(Table 2) and incubated for 1 hour at RT on a shaker. After washing, the reading
buffer (R92TC-2; MesoScale Diagnostics) was added and plates were read on a
MSD Sector Imager 6000 instrument. The data were analyzed using SoftMax Pro 4.6
Enterprise Edition (Molecular Devices LLC, Sunnyvale, CA, USA).
Chapter 3
98
Table 2. Antibodies for the MSD assays
Statistical analysis
Data analysis was performed using GraphPad Prism version 5.0 (GraphPad
Software Inc, San Diego, CA, USA) statistical package. Student’s t test was
performed for statistical analyses comparing two groups. For comparison of more
than two groups, one-way ANOVA with Bonferroni multiple comparison post-hoc test
was used when the data was normally distributed. For non-normally distributed data
the Kruskal-Wallis test was used. Differences were considered statistically significant
when p ≤ 0.05. The data is presented and expressed as standard error (SE) of the
mean.
Assay Coating Antibody (source) Detection Antibody (source)
C1s M81 (Hycult) F33 (in-house, BPM)
C4d Neo C4d (A251, Quidel) C4d (A213, Quidel)
Bb Neo Bb (A252, Quidel) JC1 (in-house, BPM)
iC3b Neo iC3b (Hycult) C3-30 (in-house, BPM)
TCC aE11 (Hycult) E2 (in-house, BPM)
FH Y402 MBI-6 (in-house, BPM) Ox-24
FH H402 MBI-7 (in-house, BPM) Ox-24
Clusterin Polyclonal-Anti-Apolipoprotein
J (AB825, Milipore)
MBI-40 (in-house, BPM)
Results
Complement activation and regulation in multibacillary leprosy patients with or
without reaction from Bangladesh
Selected complement components, activation products and regulators were
measured in serum samples of leprosy patients with or without a reaction from
Bangladesh and endemic controls collected under similar conditions and all samples
were collected before start of MDT. Analytes were selected in part to interrogate
different parts of the complement activation cascade in order to assess the
contributions of different activation pathways. Complement components, regulators
and activation products were measured on a novel multiplex built on the MSD
platform. The Bangladesh leprosy population showed no significant difference in
serum C1s values compared to controls (p= 0.442) (data is shown in table 3). Levels
of the classical/lectin pathway activation fragment C4d (p <0.001 without R; p <0.001
R) and the alternative pathway fragment Bb (p <0.01 without R; p <0.001 R) were
significantly increased in MB leprosy patients with or without reaction compared to
endemic controls (Figure 1A and B). C4d levels were also significantly increased in
patients with reaction compared to patients without a reaction (p <0.05) (Figure 1A).
The increased serum levels of C4d in the leprosy reaction patients suggest the
involvement of the classical and/or lectin pathway in the reaction process.
The levels of the activation pathway fragment iC3b and the terminal pathway
activation marker TCC were significantly raised in leprosy patients with a reaction
compared to endemic controls (p <0.05 and p <0.01, respectively), showing further
evidence for increased complement activation in reactions (Figure 1C and D). Four
patients from Bangladesh that were followed up after treatment showed that the TCC
3
Complement in serum of leprosy patients
99
Table 2. Antibodies for the MSD assays
Statistical analysis
Data analysis was performed using GraphPad Prism version 5.0 (GraphPad
Software Inc, San Diego, CA, USA) statistical package. Student’s t test was
performed for statistical analyses comparing two groups. For comparison of more
than two groups, one-way ANOVA with Bonferroni multiple comparison post-hoc test
was used when the data was normally distributed. For non-normally distributed data
the Kruskal-Wallis test was used. Differences were considered statistically significant
when p ≤ 0.05. The data is presented and expressed as standard error (SE) of the
mean.
Assay Coating Antibody (source) Detection Antibody (source)
C1s M81 (Hycult) F33 (in-house, BPM)
C4d Neo C4d (A251, Quidel) C4d (A213, Quidel)
Bb Neo Bb (A252, Quidel) JC1 (in-house, BPM)
iC3b Neo iC3b (Hycult) C3-30 (in-house, BPM)
TCC aE11 (Hycult) E2 (in-house, BPM)
FH Y402 MBI-6 (in-house, BPM) Ox-24
FH H402 MBI-7 (in-house, BPM) Ox-24
Clusterin Polyclonal-Anti-Apolipoprotein
J (AB825, Milipore)
MBI-40 (in-house, BPM)
Results
Complement activation and regulation in multibacillary leprosy patients with or
without reaction from Bangladesh
Selected complement components, activation products and regulators were
measured in serum samples of leprosy patients with or without a reaction from
Bangladesh and endemic controls collected under similar conditions and all samples
were collected before start of MDT. Analytes were selected in part to interrogate
different parts of the complement activation cascade in order to assess the
contributions of different activation pathways. Complement components, regulators
and activation products were measured on a novel multiplex built on the MSD
platform. The Bangladesh leprosy population showed no significant difference in
serum C1s values compared to controls (p= 0.442) (data is shown in table 3). Levels
of the classical/lectin pathway activation fragment C4d (p <0.001 without R; p <0.001
R) and the alternative pathway fragment Bb (p <0.01 without R; p <0.001 R) were
significantly increased in MB leprosy patients with or without reaction compared to
endemic controls (Figure 1A and B). C4d levels were also significantly increased in
patients with reaction compared to patients without a reaction (p <0.05) (Figure 1A).
The increased serum levels of C4d in the leprosy reaction patients suggest the
involvement of the classical and/or lectin pathway in the reaction process.
The levels of the activation pathway fragment iC3b and the terminal pathway
activation marker TCC were significantly raised in leprosy patients with a reaction
compared to endemic controls (p <0.05 and p <0.01, respectively), showing further
evidence for increased complement activation in reactions (Figure 1C and D). Four
patients from Bangladesh that were followed up after treatment showed that the TCC
Chapter 3
100
levels stay high even after treatment (supplement figure 1). This suggests that
treatment with either multidrug therapy or steroids does not lower complement serum
levels in reaction patients.
Serum levels of Factor H (FH), the principle plasma regulator of the alternative
pathway, and clusterin, a plasma regulator of the TCC, were also analyzed in serum
samples of MB patients with or without reaction from Bangladesh. Total FH levels did
not show a significant difference between leprosy patients with or without a reaction
compared to controls (p=0.149) (data is shown in table 3).
Clusterin levels in leprosy patients with or without reaction were significantly higher
than endemic controls (p <0.05 without R; p <0.001 with R) (Figure 1E), but not
different between the patient groups.
Fig. 1. Complement activation and regulation in multibacillary leprosy patients with and without
reactions from Bangladesh. MSD platform for measuring complement activation products C4d (A), Bb
(B), iC3b (C), TCC (D) and clusterin (E) in serum from endemic controls (n= 20) and multibacillary
leprosy patients with (n=12) or without (n= 46) reaction at intake, showing a significant increase in
multibacillary leprosy patients with and without reaction compared controls for all measured
components (p=<0.05). C4d levels are specifically and significantly increased in patients with reaction
compared to those without reaction (B) [mean C4d no reaction 8.83 mg/l (SE 0,77) versus mean C4d
3
Complement in serum of leprosy patients
101
levels stay high even after treatment (supplement figure 1). This suggests that
treatment with either multidrug therapy or steroids does not lower complement serum
levels in reaction patients.
Serum levels of Factor H (FH), the principle plasma regulator of the alternative
pathway, and clusterin, a plasma regulator of the TCC, were also analyzed in serum
samples of MB patients with or without reaction from Bangladesh. Total FH levels did
not show a significant difference between leprosy patients with or without a reaction
compared to controls (p=0.149) (data is shown in table 3).
Clusterin levels in leprosy patients with or without reaction were significantly higher
than endemic controls (p <0.05 without R; p <0.001 with R) (Figure 1E), but not
different between the patient groups.
Fig. 1. Complement activation and regulation in multibacillary leprosy patients with and without
reactions from Bangladesh. MSD platform for measuring complement activation products C4d (A), Bb
(B), iC3b (C), TCC (D) and clusterin (E) in serum from endemic controls (n= 20) and multibacillary
leprosy patients with (n=12) or without (n= 46) reaction at intake, showing a significant increase in
multibacillary leprosy patients with and without reaction compared controls for all measured
components (p=<0.05). C4d levels are specifically and significantly increased in patients with reaction
compared to those without reaction (B) [mean C4d no reaction 8.83 mg/l (SE 0,77) versus mean C4d
Chapter 3
102
Reaction 13.41 mg/l (SE 1,60); P < 0.05]. In addition, Clusterin levels were significantly increased in
serum of multibacillary leprosy patients compared to endemic controls, but no difference between
patients with or without reactions (E) [mean clusterin no reaction 398,0 mg/l (SE 10,15 ); P = <0.001
versus mean clusterin Reaction 378,9 mg/l (SE 15,87); P =<0.05]. The error bars represent the
standard error of the mean.
Table 3. Complement levels in the Bangladeshi cohort
Endemic controls MB patients without
reaction
MB patients with
reaction
Bagladeshi
cohort
Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l)
C1s 94,69 2,77 99,41 3,07 90,66 4,84
C4d 3,46 0,39 8,83 0,77 13,41 1,60
Bb 16,53 1,92 24,26 0,98 28,12 1,96
iC3b 5,42 0,63 8,63 0,81 12,05 2,71
TCC 1,87 0,15 2,27 0,09 2,56 0,10
Factor H 253,7 15,82 277,3 11,28 231,6 21,97
Clusterin 297,3 19,74 398,0 10,15 378,9 15,87
TCC levels are increased in serum of multibacillary leprosy patients with
reaction compared to patients without reaction from Ethiopia
In the preceding section results using the leprosy serum samples from Bangladesh
data indicate that levels of complement activation products were higher in patients
with reaction compared to those without – significantly so for C4d and trending for
iC3b and TCC. We therefore surmised that these markers could be used as an
indicator for identifying patients with reactions. In order to substantiate this finding we
measured the levels of these complement activation products in serum samples of an
Ethiopian leprosy cohort. These samples were also collected before start of MDT and
classified as PB (TT and BT) or MB (BL and LL) leprosy patients without reaction and
MB patients with reaction. In these samples, like those of Bangladesh, no significant
difference was found in the level of C1s in serum of MB compared to PB patients
without reaction (p= 0.384) (data is shown in table 4). Serum levels of the
complement activation products in MB patients compared to PB patients without a
reaction were significantly increased for C4d (p= 0.04), Bb (p= 0.03) iC3b (p= 0.02 )
and TCC (p= 0.003) (Supplement figure 2). No significant difference was found in
the levels of C4d and Bb in the MB leprosy patients without reaction compared to the
patients with a reaction (p= 0.392 and p=0.143 respectively) (data is shown in table
4). Levels of the common complement pathway marker iC3b were not significantly
different between MB leprosy patients without reaction compared to those with a
reaction (Figure 2A). However, levels of TCC in Ethiopian cohort MB patients with a
reaction were significantly raised in comparison to PB (p=<0.01) patients and to MB
patients without reaction (p=<0.05) (Figure 2B). This latter result independently
confirms that raised plasma levels of TCC represent a potential tool for identifying
leprosy patients with reactions.
3
Complement in serum of leprosy patients
103
Reaction 13.41 mg/l (SE 1,60); P < 0.05]. In addition, Clusterin levels were significantly increased in
serum of multibacillary leprosy patients compared to endemic controls, but no difference between
patients with or without reactions (E) [mean clusterin no reaction 398,0 mg/l (SE 10,15 ); P = <0.001
versus mean clusterin Reaction 378,9 mg/l (SE 15,87); P =<0.05]. The error bars represent the
standard error of the mean.
Table 3. Complement levels in the Bangladeshi cohort
Endemic controls MB patients without
reaction
MB patients with
reaction
Bagladeshi
cohort
Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l)
C1s 94,69 2,77 99,41 3,07 90,66 4,84
C4d 3,46 0,39 8,83 0,77 13,41 1,60
Bb 16,53 1,92 24,26 0,98 28,12 1,96
iC3b 5,42 0,63 8,63 0,81 12,05 2,71
TCC 1,87 0,15 2,27 0,09 2,56 0,10
Factor H 253,7 15,82 277,3 11,28 231,6 21,97
Clusterin 297,3 19,74 398,0 10,15 378,9 15,87
TCC levels are increased in serum of multibacillary leprosy patients with
reaction compared to patients without reaction from Ethiopia
In the preceding section results using the leprosy serum samples from Bangladesh
data indicate that levels of complement activation products were higher in patients
with reaction compared to those without – significantly so for C4d and trending for
iC3b and TCC. We therefore surmised that these markers could be used as an
indicator for identifying patients with reactions. In order to substantiate this finding we
measured the levels of these complement activation products in serum samples of an
Ethiopian leprosy cohort. These samples were also collected before start of MDT and
classified as PB (TT and BT) or MB (BL and LL) leprosy patients without reaction and
MB patients with reaction. In these samples, like those of Bangladesh, no significant
difference was found in the level of C1s in serum of MB compared to PB patients
without reaction (p= 0.384) (data is shown in table 4). Serum levels of the
complement activation products in MB patients compared to PB patients without a
reaction were significantly increased for C4d (p= 0.04), Bb (p= 0.03) iC3b (p= 0.02 )
and TCC (p= 0.003) (Supplement figure 2). No significant difference was found in
the levels of C4d and Bb in the MB leprosy patients without reaction compared to the
patients with a reaction (p= 0.392 and p=0.143 respectively) (data is shown in table
4). Levels of the common complement pathway marker iC3b were not significantly
different between MB leprosy patients without reaction compared to those with a
reaction (Figure 2A). However, levels of TCC in Ethiopian cohort MB patients with a
reaction were significantly raised in comparison to PB (p=<0.01) patients and to MB
patients without reaction (p=<0.05) (Figure 2B). This latter result independently
confirms that raised plasma levels of TCC represent a potential tool for identifying
leprosy patients with reactions.
Chapter 3
104
Fig. 2. TCC levels are increased in serum of multibacillary leprosy patients with reaction compared to
patients without reaction from Ethiopia. MSD assay for measuring the common complement pathway
activation fragment iC3b (A) and the terminal pathway activation marker TCC (B), in serum samples of
paucibacillary (n=7) and multibacillary patients without a reaction (n=23) or with a reaction (n=15).
Although no significant difference was found in the levels of iC3b in serum of paucibacillary and
multibacillary patients without and with a reaction, TCC levels were significantly increased in
multibacillary leprosy patients with a reaction comparted to paucibacillary and multibacillary patients
without a reaction [mean TCC no reaction 4,03 mg/l (SE 0,28) versus mean TCC Reaction 7,49 mg/l
(SE 1,48); P =<0.01 and P =<0.05]. The error bars represent the standard error of the mean.
Table 4. Complement levels in the Ethiopian cohort
PB patients without
reaction
MB patients without
reaction
MB patients with
reaction
Ethiopian
cohort
Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l)
C1s 112,4 9,71 128,2 8,66 134,2 8,59
C4d 17,99 1,99 27,15 4,04 36,73 4,93
Bb 24,91 2,39 28,62 1,99 36,75 2,72
iC3b 13,15 1,94 22,39 1,92 14,80 2,84
TCC 2,02 0,23 4,03 0,28 7,49 1,48
Factor H 385,0 26,85 301,9 14,15 381,1 22,61
Clusterin 457,9 34,08 493,8 21,94 656,1 43,70
3
Complement in serum of leprosy patients
105
Fig. 2. TCC levels are increased in serum of multibacillary leprosy patients with reaction compared to
patients without reaction from Ethiopia. MSD assay for measuring the common complement pathway
activation fragment iC3b (A) and the terminal pathway activation marker TCC (B), in serum samples of
paucibacillary (n=7) and multibacillary patients without a reaction (n=23) or with a reaction (n=15).
Although no significant difference was found in the levels of iC3b in serum of paucibacillary and
multibacillary patients without and with a reaction, TCC levels were significantly increased in
multibacillary leprosy patients with a reaction comparted to paucibacillary and multibacillary patients
without a reaction [mean TCC no reaction 4,03 mg/l (SE 0,28) versus mean TCC Reaction 7,49 mg/l
(SE 1,48); P =<0.01 and P =<0.05]. The error bars represent the standard error of the mean.
Table 4. Complement levels in the Ethiopian cohort
PB patients without
reaction
MB patients without
reaction
MB patients with
reaction
Ethiopian
cohort
Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l) Mean (mg/l) SE (mg/l)
C1s 112,4 9,71 128,2 8,66 134,2 8,59
C4d 17,99 1,99 27,15 4,04 36,73 4,93
Bb 24,91 2,39 28,62 1,99 36,75 2,72
iC3b 13,15 1,94 22,39 1,92 14,80 2,84
TCC 2,02 0,23 4,03 0,28 7,49 1,48
Factor H 385,0 26,85 301,9 14,15 381,1 22,61
Clusterin 457,9 34,08 493,8 21,94 656,1 43,70
Chapter 3
106
Discussion
Nerve damage leading to deformity is a major problem in the course of leprosy and
progression of the disease among susceptible hosts. In the absence of the
peripheral neuropathy, leprosy would be an innocuous inflammatory skin disease
rather than one that, even today in the 21st century, is one of the most stigmatized
diseases often associated with severe social repercussions for the patient [28,29].
The etiology of leprosy reactions and nerve damage has largely been attributed to
the consequence of granulomatous reactions due to the host immune response to M.
leprae. Variability in the hosts’ immune response has a causal relationship to the
spectral pathology of the disease. Timely diagnosis followed by optimum and
evidence based treatment would reduce risks of permanent tissue damage and
assist regeneration of the damaged tissue [30]. Despite continued efforts in the
refinement of diagnostic methods, reactions are often misdiagnosed even by
experienced health workers and clinicians [31]. Unquestionably, a reliable test or
combination of tests for the prompt diagnosis of reactions, particularly RR or type 1,
would contribute positively to the clinical outcome of the patients. Biomarkers for
identification of patients developing reactions have focused on circulating parameters
of adaptive immunity like antibodies, cytokines and chemokines as well as gene
expression profiles [32]. However, a recent report described the importance of innate
immunity in orchestrating leprosy immunopathology and in the initiating phase of host
defense against the pathogen [33]. Innate immune effectors include cellular systems
that are now being studied in relation to mycobacterial pathology, and also humoral
effectors, including the complement system, critical in initiating and orchestrating the
innate immune response to infection [34,35]. These findings imply that the analysis of
the complement system might be of value for the diagnosis and prognosis of leprosy
disease status.
It is now well appreciated that complement activation can be induced by pathogen-
associated molecular patterns (PAMPs) [18,34-36]. Particularly in the context of
leprosy, we recently showed that the membrane attack complex (MAC) of
complement is generated upon cognate interaction of the axon of the peripheral
nerve with the M. leprae specific PAMP lipoarabinomanan (LAM) [19]. In addition, we
showed that MAC formation results in nerve damage and its inhibition is
neuroprotective in a mouse model for M. leprae-induced nerve damage. We also
demonstrated that MAC is deposited in nerve lesions of leprosy patients, paralleling
the observed nerve degeneration. Our findings indicate an important role for
complement in the disease, and therefore we examined whether increased systemic
levels of complement activation could be detected in leprosy patients and whether
complement products and regulators might be useful markers of leprosy disease
state.
The present study reports for the first time the quantification of a panel of
complement activation products and regulators in serum of leprosy patients in
multiplexed assays on the Meso Scale Discovery (MSD) platform. The study was
performed retrospectively using serum samples from PB and MB patients with or
without reaction collected in Ethiopia and Bangladesh for a previous study [25].
Here we show significantly increased levels of complement activation products C4d,
Bb, in serum of Bangladeshi leprosy patients compared to endemic controls. The
increased levels of C4d in the patients supports activation of the lectin and/or
classical pathway of complement, while elevated Bb supports a significant
3
Complement in serum of leprosy patients
107
Discussion
Nerve damage leading to deformity is a major problem in the course of leprosy and
progression of the disease among susceptible hosts. In the absence of the
peripheral neuropathy, leprosy would be an innocuous inflammatory skin disease
rather than one that, even today in the 21st century, is one of the most stigmatized
diseases often associated with severe social repercussions for the patient [28,29].
The etiology of leprosy reactions and nerve damage has largely been attributed to
the consequence of granulomatous reactions due to the host immune response to M.
leprae. Variability in the hosts’ immune response has a causal relationship to the
spectral pathology of the disease. Timely diagnosis followed by optimum and
evidence based treatment would reduce risks of permanent tissue damage and
assist regeneration of the damaged tissue [30]. Despite continued efforts in the
refinement of diagnostic methods, reactions are often misdiagnosed even by
experienced health workers and clinicians [31]. Unquestionably, a reliable test or
combination of tests for the prompt diagnosis of reactions, particularly RR or type 1,
would contribute positively to the clinical outcome of the patients. Biomarkers for
identification of patients developing reactions have focused on circulating parameters
of adaptive immunity like antibodies, cytokines and chemokines as well as gene
expression profiles [32]. However, a recent report described the importance of innate
immunity in orchestrating leprosy immunopathology and in the initiating phase of host
defense against the pathogen [33]. Innate immune effectors include cellular systems
that are now being studied in relation to mycobacterial pathology, and also humoral
effectors, including the complement system, critical in initiating and orchestrating the
innate immune response to infection [34,35]. These findings imply that the analysis of
the complement system might be of value for the diagnosis and prognosis of leprosy
disease status.
It is now well appreciated that complement activation can be induced by pathogen-
associated molecular patterns (PAMPs) [18,34-36]. Particularly in the context of
leprosy, we recently showed that the membrane attack complex (MAC) of
complement is generated upon cognate interaction of the axon of the peripheral
nerve with the M. leprae specific PAMP lipoarabinomanan (LAM) [19]. In addition, we
showed that MAC formation results in nerve damage and its inhibition is
neuroprotective in a mouse model for M. leprae-induced nerve damage. We also
demonstrated that MAC is deposited in nerve lesions of leprosy patients, paralleling
the observed nerve degeneration. Our findings indicate an important role for
complement in the disease, and therefore we examined whether increased systemic
levels of complement activation could be detected in leprosy patients and whether
complement products and regulators might be useful markers of leprosy disease
state.
The present study reports for the first time the quantification of a panel of
complement activation products and regulators in serum of leprosy patients in
multiplexed assays on the Meso Scale Discovery (MSD) platform. The study was
performed retrospectively using serum samples from PB and MB patients with or
without reaction collected in Ethiopia and Bangladesh for a previous study [25].
Here we show significantly increased levels of complement activation products C4d,
Bb, in serum of Bangladeshi leprosy patients compared to endemic controls. The
increased levels of C4d in the patients supports activation of the lectin and/or
classical pathway of complement, while elevated Bb supports a significant
Chapter 3
108
involvement of the alternative pathway in leprosy patients. Earlier studies had already
suggested a role for the classical pathway of the complement system in leprosy
across the spectrum by meassuring the ability of circulating immune complexes
isolated from sera of leprosy patients to activate complement , but none of these
studies measured pathway-specific activation products [23,24,37].
Bacterial antigens either in the free form or by slow multiplication of bacilli in the
reaction patients could initiate complement activation via the lectin pathway, initiated
by the binding of the pattern recognition molecule mannose-binding lectin (MBL) to
bacterial surfaces [38]. In support of the involvement of the lectin pathway in MB
leprosy patients, one study found that MBL serum levels were significantly increased
in LL form of leprosy compared to other leprosy types [23]. However, it should be
noted that the association of MBL with leprosy pathophysiology is controversial,
because some investigators found increased level of MBL in the patients undergoing
reaction. For this reason, no confirmatory conclusion can be drawn from our present
limited study on the role of MBL pathway in contributing higher level of complement
activation products in leprosy reactions.
iC3b levels in the Bangladeshi population were significantly increased in leprosy
patients with reaction compared to controls. The levels were also higher compared to
patients without a reaction although not significant.
The present study is limited in identifying the major contribution of either the classical
or lectin pathway for complement activation, TCC levels in serum of leprosy patients
from Bangladesh were significantly higher in patients with reaction compared to
endemic controls. No significant difference was found between leprosy patients
without reactions and endemic controls for TCC. This reflects that complement TCC
level may be considered as a promising marker for patients developing a reaction. It
also suggests that treatment with either MDT or steroids does not lower complement
activation in reaction patients, reinforcing the possibility that complement contributes
to the nerve damage in these patients.
Similar to the findings encountered with Bangladeshi cohort, TCC levels in serum
samples of leprosy patients from Ethiopia also showed a significant increase in
reactions compared to patients without reactions. Since complement activation is
under control of several regulatory molecules, we also measured the levels of factor
H, regulator of the alternative pathway of complement, in leprosy patients with or
without reactions; previous studies showed that factor H is associated with a variety
of diseases, including neurodegenerative disease [39-42]. Changes in factor H
levels, might suggest altered regulation of activation of the alternative pathway of
complement during disease. We did not detect any significant change in the total
level of Factor H in serum of leprosy patients with and without a reaction. Clusterin, a
fluid-phase regulator of the MAC, is increased in tissue and plasma in different
diseases including neurodegenerative conditions [43-48]. Hence, we determined the
circulatory levels of Clusterin in leprosy patients in association with disease activities.
Clusterin levels were higher in leprosy patients compared to controls. No difference
was found in Clusterin levels in patients with or without reaction, suggesting no
increase in regulatory status of the terminal pathway of complement by Clusterin in
reaction patients.
Unfortunately, due to the nature of the study, 1) being carried out with the samples
collected in the field situations and 2) the lack of EDTA in the serum samples, any
elaborate interpretation regarding the mechanism of high level of TCC in leprosy
patients with reaction should be avoided at this stage of the study. The lack of
3
Complement in serum of leprosy patients
109
involvement of the alternative pathway in leprosy patients. Earlier studies had already
suggested a role for the classical pathway of the complement system in leprosy
across the spectrum by meassuring the ability of circulating immune complexes
isolated from sera of leprosy patients to activate complement , but none of these
studies measured pathway-specific activation products [23,24,37].
Bacterial antigens either in the free form or by slow multiplication of bacilli in the
reaction patients could initiate complement activation via the lectin pathway, initiated
by the binding of the pattern recognition molecule mannose-binding lectin (MBL) to
bacterial surfaces [38]. In support of the involvement of the lectin pathway in MB
leprosy patients, one study found that MBL serum levels were significantly increased
in LL form of leprosy compared to other leprosy types [23]. However, it should be
noted that the association of MBL with leprosy pathophysiology is controversial,
because some investigators found increased level of MBL in the patients undergoing
reaction. For this reason, no confirmatory conclusion can be drawn from our present
limited study on the role of MBL pathway in contributing higher level of complement
activation products in leprosy reactions.
iC3b levels in the Bangladeshi population were significantly increased in leprosy
patients with reaction compared to controls. The levels were also higher compared to
patients without a reaction although not significant.
The present study is limited in identifying the major contribution of either the classical
or lectin pathway for complement activation, TCC levels in serum of leprosy patients
from Bangladesh were significantly higher in patients with reaction compared to
endemic controls. No significant difference was found between leprosy patients
without reactions and endemic controls for TCC. This reflects that complement TCC
level may be considered as a promising marker for patients developing a reaction. It
also suggests that treatment with either MDT or steroids does not lower complement
activation in reaction patients, reinforcing the possibility that complement contributes
to the nerve damage in these patients.
Similar to the findings encountered with Bangladeshi cohort, TCC levels in serum
samples of leprosy patients from Ethiopia also showed a significant increase in
reactions compared to patients without reactions. Since complement activation is
under control of several regulatory molecules, we also measured the levels of factor
H, regulator of the alternative pathway of complement, in leprosy patients with or
without reactions; previous studies showed that factor H is associated with a variety
of diseases, including neurodegenerative disease [39-42]. Changes in factor H
levels, might suggest altered regulation of activation of the alternative pathway of
complement during disease. We did not detect any significant change in the total
level of Factor H in serum of leprosy patients with and without a reaction. Clusterin, a
fluid-phase regulator of the MAC, is increased in tissue and plasma in different
diseases including neurodegenerative conditions [43-48]. Hence, we determined the
circulatory levels of Clusterin in leprosy patients in association with disease activities.
Clusterin levels were higher in leprosy patients compared to controls. No difference
was found in Clusterin levels in patients with or without reaction, suggesting no
increase in regulatory status of the terminal pathway of complement by Clusterin in
reaction patients.
Unfortunately, due to the nature of the study, 1) being carried out with the samples
collected in the field situations and 2) the lack of EDTA in the serum samples, any
elaborate interpretation regarding the mechanism of high level of TCC in leprosy
patients with reaction should be avoided at this stage of the study. The lack of
Chapter 3
110
especially EDTA might result in in vitro generation of TCC which continues in serum.
This limitation is considered equally applicable to all the samples studied; therefore,
any comparative values relating the disease state is considered as true reflection.
Despite such limitations, the present datasets have demonstrated convincingly, that
systemic activation of complement occurs in leprosy and likely involves multiple
pathways. The increased serum levels of TCC and other activation markers in
leprosy patients with reaction warrants a prospective and sequential study on
complement activation in leprosy, to confirm conclusively whether circulating
complement activation products such as TCC can be applied as biomarkers for
diagnosis of patients at a risk of developing a reaction.
Funding. This work was supported by the Leprosy Foundation of the Netherlands [grant number
701.03.08]. AG acknowledges the support of QM Gastmann Wichers Foundation for her participation.
Author’s contribution. PKD, VR and FB formulated the project; AG provided access to the stored
serum samples collected for a different prospective study; BPM provided access to the in-house
complement assays and advised on the project; SH performed assays; NBEI analyzed the data and
wrote the manuscript.
Acknowledgements. The authors would like to thank Dr. Sheikh Abdul Hadi (Dhaka), Genet Amare,
Haregewoin Yetesha and Alemayehu Kifle (AHRI/ALERT, Addis Ababa); Dr. Sayera Banu from the
International Center for Diarrhoeal Disease Research Bangladesh, Dhaka (Bangladesh), and Dr.
Kidist Bobosha from the Armauer Hansen Research Institute, Addis Ababa in Ethiopia for sample
collection without which this study could not have been possible.
Competing financial interests. FB and VR are inventors on a patent that describes the use of
inhibitors of the terminal complement pathway for therapeutic purposes. FB and VR are shareholders
of Regenesance BV. The remaining authors declare no competing financial interests.
References
1 Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int.J.Lepr.Other Mycobact.Dis. 1966; 34:255-73.
2 Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin.Microbiol.Rev. 2006; 19:338-81.
3 Ridley DS. Reactions in leprosy. Lepr.Rev. 1969; 40:77-81.
4 Godal T, Myrvang B, Samuel DR, Ross WF, Lofgren M. Mechanism of "reactions" in borderline tuberculoid (BT) leprosy. A preliminary report. Acta Pathol.Microbiol.Scand.Suppl 1973; 236:45-53.
5 Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am.J.Pathol. 1999; 154:1793-804.
6 Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol. 1994; 88:300-6.
7 Verhagen CE, Wierenga EA, Buffing AA, Chand MA, Faber WR, Das PK. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study. J.Immunol. 1997; 159:4474-83.
8 Sreenivasan P, Misra RS, Wilfred D, Nath I. Lepromatous leprosy patients show T helper 1-like cytokine profile with differential expression of interleukin-10 during type 1 and 2 reactions. Immunology 1998; 95:529-36.
9 Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969; 2:933-5.
10 Das PK, Klatser PR, Pondman KW et al. Dapsone and anti-dapsone antibody in circulating immune complexes in leprosy patients. Lancet 1980; 1:1309-11.
11 Modlin RL. Th1-Th2 paradigm: insights from leprosy. J.Invest Dermatol. 1994; 102:828-32.
12 Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH. Immune complexes and complement hypercatabolism in patients with leprosy. Clin.Exp.Immunol. 1976; 26:388-96.
13 Kahawita IP, Lockwood DN. Towards understanding the pathology of erythema nodosum leprosum. Trans.R.Soc.Trop.Med.Hyg. 2008; 102:329-37.
14 Stefani MM, Guerra JG, Sousa AL et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC.Infect.Dis. 2009; 9:75.
15 Little D, Khanolkar-Young S, Coulthart A, Suneetha S, Lockwood DN. Immunohistochemical analysis of cellular infiltrate and gamma interferon, interleukin-12, and inducible nitric oxide synthase expression in leprosy type 1 (reversal) reactions before and during prednisolone treatment. Infect.Immun. 2001; 69:3413-7.
16 Partida-Sanchez S, Favila-Castillo L, Pedraza-Sanchez S et al. IgG antibody subclasses, tumor necrosis factor and IFN-gamma levels in patients with type II lepra reaction on thalidomide treatment. Int.Arch.Allergy Immunol. 1998; 116:60-6.
3
Complement in serum of leprosy patients
111
especially EDTA might result in in vitro generation of TCC which continues in serum.
This limitation is considered equally applicable to all the samples studied; therefore,
any comparative values relating the disease state is considered as true reflection.
Despite such limitations, the present datasets have demonstrated convincingly, that
systemic activation of complement occurs in leprosy and likely involves multiple
pathways. The increased serum levels of TCC and other activation markers in
leprosy patients with reaction warrants a prospective and sequential study on
complement activation in leprosy, to confirm conclusively whether circulating
complement activation products such as TCC can be applied as biomarkers for
diagnosis of patients at a risk of developing a reaction.
Funding. This work was supported by the Leprosy Foundation of the Netherlands [grant number
701.03.08]. AG acknowledges the support of QM Gastmann Wichers Foundation for her participation.
Author’s contribution. PKD, VR and FB formulated the project; AG provided access to the stored
serum samples collected for a different prospective study; BPM provided access to the in-house
complement assays and advised on the project; SH performed assays; NBEI analyzed the data and
wrote the manuscript.
Acknowledgements. The authors would like to thank Dr. Sheikh Abdul Hadi (Dhaka), Genet Amare,
Haregewoin Yetesha and Alemayehu Kifle (AHRI/ALERT, Addis Ababa); Dr. Sayera Banu from the
International Center for Diarrhoeal Disease Research Bangladesh, Dhaka (Bangladesh), and Dr.
Kidist Bobosha from the Armauer Hansen Research Institute, Addis Ababa in Ethiopia for sample
collection without which this study could not have been possible.
Competing financial interests. FB and VR are inventors on a patent that describes the use of
inhibitors of the terminal complement pathway for therapeutic purposes. FB and VR are shareholders
of Regenesance BV. The remaining authors declare no competing financial interests.
References
1 Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int.J.Lepr.Other Mycobact.Dis. 1966; 34:255-73.
2 Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin.Microbiol.Rev. 2006; 19:338-81.
3 Ridley DS. Reactions in leprosy. Lepr.Rev. 1969; 40:77-81.
4 Godal T, Myrvang B, Samuel DR, Ross WF, Lofgren M. Mechanism of "reactions" in borderline tuberculoid (BT) leprosy. A preliminary report. Acta Pathol.Microbiol.Scand.Suppl 1973; 236:45-53.
5 Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am.J.Pathol. 1999; 154:1793-804.
6 Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol. 1994; 88:300-6.
7 Verhagen CE, Wierenga EA, Buffing AA, Chand MA, Faber WR, Das PK. Reversal reaction in borderline leprosy is associated with a polarized shift to type 1-like Mycobacterium leprae T cell reactivity in lesional skin: a follow-up study. J.Immunol. 1997; 159:4474-83.
8 Sreenivasan P, Misra RS, Wilfred D, Nath I. Lepromatous leprosy patients show T helper 1-like cytokine profile with differential expression of interleukin-10 during type 1 and 2 reactions. Immunology 1998; 95:529-36.
9 Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969; 2:933-5.
10 Das PK, Klatser PR, Pondman KW et al. Dapsone and anti-dapsone antibody in circulating immune complexes in leprosy patients. Lancet 1980; 1:1309-11.
11 Modlin RL. Th1-Th2 paradigm: insights from leprosy. J.Invest Dermatol. 1994; 102:828-32.
12 Bjorvatn B, Barnetson RS, Kronvall G, Zubler RH, Lambert PH. Immune complexes and complement hypercatabolism in patients with leprosy. Clin.Exp.Immunol. 1976; 26:388-96.
13 Kahawita IP, Lockwood DN. Towards understanding the pathology of erythema nodosum leprosum. Trans.R.Soc.Trop.Med.Hyg. 2008; 102:329-37.
14 Stefani MM, Guerra JG, Sousa AL et al. Potential plasma markers of Type 1 and Type 2 leprosy reactions: a preliminary report. BMC.Infect.Dis. 2009; 9:75.
15 Little D, Khanolkar-Young S, Coulthart A, Suneetha S, Lockwood DN. Immunohistochemical analysis of cellular infiltrate and gamma interferon, interleukin-12, and inducible nitric oxide synthase expression in leprosy type 1 (reversal) reactions before and during prednisolone treatment. Infect.Immun. 2001; 69:3413-7.
16 Partida-Sanchez S, Favila-Castillo L, Pedraza-Sanchez S et al. IgG antibody subclasses, tumor necrosis factor and IFN-gamma levels in patients with type II lepra reaction on thalidomide treatment. Int.Arch.Allergy Immunol. 1998; 116:60-6.
Chapter 3
112
17 Iyer A, Hatta M, Usman R et al. Serum levels of interferon-gamma, tumour necrosis factor-alpha, soluble interleukin-6R and soluble cell activation markers for monitoring response to treatment of leprosy reactions. Clin.Exp.Immunol. 2007; 150:210-6.
18 Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat.Immunol. 2010; 11:785-97.
19 Bahia E, I, Das PK, Fluiter K et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol. 2015.
20 Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int.J.Lepr.Other Mycobact.Dis. 1968; 36:400-4.
21 Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am.J.Trop.Med.Hyg. 1973; 22:761-4.
22 Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am.J.Trop.Med.Hyg. 1974; 23:471-5.
23 Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am.J.Trop.Med.Hyg. 2008; 78:605-10.
24 Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U. Activation of complement by circulating immune complexes isolated from leprosy patients. Int.J.Lepr.Other Mycobact.Dis. 1990; 58:31-8.
25 Khadge S, Banu S, Bobosha K et al. Longitudinal immune profiles in type 1 leprosy reactions in Bangladesh, Brazil, Ethiopia and Nepal. BMC.Infect.Dis. 2015; 15:477.
26 Hakobyan S, Harris CL, Tortajada A et al. Measurement of factor H variants in plasma using variant-specific monoclonal antibodies: application to assessing risk of age-related macular degeneration. Invest Ophthalmol.Vis.Sci. 2008; 49:1983-90.
27 Ingram G, Hakobyan S, Hirst CL et al. Systemic complement profiling in multiple sclerosis as a biomarker of disease state. Mult.Scler. 2012; 18:1401-11.
28 Rafferty J. Curing the stigma of leprosy. Lepr.Rev. 2005; 76:119-26.
29 Tsutsumi A, Izutsu T, Islam AM, Maksuda AN, Kato H, Wakai S. The quality of life, mental health, and perceived stigma of leprosy patients in Bangladesh. Soc.Sci.Med. 2007; 64:2443-53.
30 Lockwood DN, Saunderson PR. Nerve damage in leprosy: a continuing challenge to scientists, clinicians and service providers. Int.Health 2012; 4:77-85.
31 Raffe SF, Thapa M, Khadge S, Tamang K, Hagge D, Lockwood DN. Diagnosis and treatment of leprosy reactions in integrated services--the patients' perspective in Nepal. PLoS.Negl.Trop.Dis. 2013; 7:e2089.
32 Geluk A, van Meijgaarden KE, Wilson L et al. Longitudinal immune responses and gene expression profiles in type 1 leprosy reactions. J.Clin.Immunol. 2014; 34:245-55.
33 Montoya D, Modlin RL. Learning from leprosy: insight into the human innate immune response. Adv.Immunol. 2010; 105:1-24.
34 Walport MJ. Complement. First of two parts. N.Engl.J.Med. 2001; 344:1058-66.
35 Walport MJ. Complement. Second of two parts. N.Engl.J.Med. 2001; 344:1140-4.
36 Mogensen TH. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin.Microbiol.Rev. 2009; 22:240-73, Table.
37 Ramanathan VD, Thyagi P, Ramanathan U, Katoch K, Ramu G. A sequential study of circulating immune complexes, complement and immunoglobulins in borderline tuberculoid leprosy patients with and without reactions. Indian J.Lepr. 1998; 70:153-60.
38 Ip WK, Takahashi K, Ezekowitz RA, Stuart LM. Mannose-binding lectin and innate immunity. Immunol.Rev. 2009; 230:9-21.
39 Oksjoki R, Jarva H, Kovanen PT, Laine P, Meri S, Pentikainen MO. Association between complement factor H and proteoglycans in early human coronary atherosclerotic lesions: implications for local regulation of complement activation. Arterioscler.Thromb.Vasc.Biol. 2003; 23:630-6.
40 Edwards AO, Ritter R, III, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005; 308:421-4.
41 Pickering MC, Cook HT. Translational mini-review series on complement factor H: renal diseases associated with complement factor H: novel insights from humans and animals. Clin.Exp.Immunol. 2008; 151:210-30.
42 Thambisetty M, Hye A, Foy C et al. Proteome-based identification of plasma proteins associated with hippocampal metabolism in early Alzheimer's disease. J.Neurol. 2008; 255:1712-20.
43 Rosenberg ME, Silkensen J. Clusterin and the kidney. Exp.Nephrol. 1995; 3:9-14.
44 Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glycoprotein 2, a constituent of rat testis fluid. Proc.Natl.Acad.Sci.U.S.A 1989; 86:7123-7.
45 Silkensen JR, Schwochau GB, Rosenberg ME. The role of clusterin in tissue injury. Biochem.Cell Biol. 1994; 72:483-8.
46 Rosenberg ME, Silkensen J. Clusterin: physiologic and pathophysiologic considerations. Int.J.Biochem.Cell Biol. 1995; 27:633-45.
47 Nilselid AM, Davidsson P, Nagga K, Andreasen N, Fredman P, Blennow K. Clusterin in cerebrospinal fluid: analysis of carbohydrates and quantification of native and glycosylated forms. Neurochem.Int. 2006; 48:718-28.
48 Schrijvers EM, Koudstaal PJ, Hofman A, Breteler MM. Plasma clusterin and the risk of Alzheimer disease. JAMA 2011; 305:1322-6.
3
Complement in serum of leprosy patients
113
17 Iyer A, Hatta M, Usman R et al. Serum levels of interferon-gamma, tumour necrosis factor-alpha, soluble interleukin-6R and soluble cell activation markers for monitoring response to treatment of leprosy reactions. Clin.Exp.Immunol. 2007; 150:210-6.
18 Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat.Immunol. 2010; 11:785-97.
19 Bahia E, I, Das PK, Fluiter K et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol. 2015.
20 Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int.J.Lepr.Other Mycobact.Dis. 1968; 36:400-4.
21 Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am.J.Trop.Med.Hyg. 1973; 22:761-4.
22 Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am.J.Trop.Med.Hyg. 1974; 23:471-5.
23 Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am.J.Trop.Med.Hyg. 2008; 78:605-10.
24 Tyagi P, Ramanathan VD, Girdhar BK, Katoch K, Bhatia AS, Sengupta U. Activation of complement by circulating immune complexes isolated from leprosy patients. Int.J.Lepr.Other Mycobact.Dis. 1990; 58:31-8.
25 Khadge S, Banu S, Bobosha K et al. Longitudinal immune profiles in type 1 leprosy reactions in Bangladesh, Brazil, Ethiopia and Nepal. BMC.Infect.Dis. 2015; 15:477.
26 Hakobyan S, Harris CL, Tortajada A et al. Measurement of factor H variants in plasma using variant-specific monoclonal antibodies: application to assessing risk of age-related macular degeneration. Invest Ophthalmol.Vis.Sci. 2008; 49:1983-90.
27 Ingram G, Hakobyan S, Hirst CL et al. Systemic complement profiling in multiple sclerosis as a biomarker of disease state. Mult.Scler. 2012; 18:1401-11.
28 Rafferty J. Curing the stigma of leprosy. Lepr.Rev. 2005; 76:119-26.
29 Tsutsumi A, Izutsu T, Islam AM, Maksuda AN, Kato H, Wakai S. The quality of life, mental health, and perceived stigma of leprosy patients in Bangladesh. Soc.Sci.Med. 2007; 64:2443-53.
30 Lockwood DN, Saunderson PR. Nerve damage in leprosy: a continuing challenge to scientists, clinicians and service providers. Int.Health 2012; 4:77-85.
31 Raffe SF, Thapa M, Khadge S, Tamang K, Hagge D, Lockwood DN. Diagnosis and treatment of leprosy reactions in integrated services--the patients' perspective in Nepal. PLoS.Negl.Trop.Dis. 2013; 7:e2089.
32 Geluk A, van Meijgaarden KE, Wilson L et al. Longitudinal immune responses and gene expression profiles in type 1 leprosy reactions. J.Clin.Immunol. 2014; 34:245-55.
33 Montoya D, Modlin RL. Learning from leprosy: insight into the human innate immune response. Adv.Immunol. 2010; 105:1-24.
34 Walport MJ. Complement. First of two parts. N.Engl.J.Med. 2001; 344:1058-66.
35 Walport MJ. Complement. Second of two parts. N.Engl.J.Med. 2001; 344:1140-4.
36 Mogensen TH. Pathogen recognition and inflammatory signaling in innate immune defenses. Clin.Microbiol.Rev. 2009; 22:240-73, Table.
37 Ramanathan VD, Thyagi P, Ramanathan U, Katoch K, Ramu G. A sequential study of circulating immune complexes, complement and immunoglobulins in borderline tuberculoid leprosy patients with and without reactions. Indian J.Lepr. 1998; 70:153-60.
38 Ip WK, Takahashi K, Ezekowitz RA, Stuart LM. Mannose-binding lectin and innate immunity. Immunol.Rev. 2009; 230:9-21.
39 Oksjoki R, Jarva H, Kovanen PT, Laine P, Meri S, Pentikainen MO. Association between complement factor H and proteoglycans in early human coronary atherosclerotic lesions: implications for local regulation of complement activation. Arterioscler.Thromb.Vasc.Biol. 2003; 23:630-6.
40 Edwards AO, Ritter R, III, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science 2005; 308:421-4.
41 Pickering MC, Cook HT. Translational mini-review series on complement factor H: renal diseases associated with complement factor H: novel insights from humans and animals. Clin.Exp.Immunol. 2008; 151:210-30.
42 Thambisetty M, Hye A, Foy C et al. Proteome-based identification of plasma proteins associated with hippocampal metabolism in early Alzheimer's disease. J.Neurol. 2008; 255:1712-20.
43 Rosenberg ME, Silkensen J. Clusterin and the kidney. Exp.Nephrol. 1995; 3:9-14.
44 Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulfated glycoprotein 2, a constituent of rat testis fluid. Proc.Natl.Acad.Sci.U.S.A 1989; 86:7123-7.
45 Silkensen JR, Schwochau GB, Rosenberg ME. The role of clusterin in tissue injury. Biochem.Cell Biol. 1994; 72:483-8.
46 Rosenberg ME, Silkensen J. Clusterin: physiologic and pathophysiologic considerations. Int.J.Biochem.Cell Biol. 1995; 27:633-45.
47 Nilselid AM, Davidsson P, Nagga K, Andreasen N, Fredman P, Blennow K. Clusterin in cerebrospinal fluid: analysis of carbohydrates and quantification of native and glycosylated forms. Neurochem.Int. 2006; 48:718-28.
48 Schrijvers EM, Koudstaal PJ, Hofman A, Breteler MM. Plasma clusterin and the risk of Alzheimer disease. JAMA 2011; 305:1322-6.
Chapter 3
114
SUPPLEMENTARY FIGURES
Sup. Fig. 1. TCC serum levels of leprosy patients followed at reaction and after treatment. TCC
serum levels of leprosy patients at reaction do not change after treatment, indicating that treatment
does not affect complement activity in leprosy.
Sup. Fig. 2. Complement activation in paucibacillary and multibacillary leprosy patients from
Ethiopia. MSD platform for measuring complement activation products C4d (A), Bb (B), iC3b (C) and
TCC (D) in serum from paucibacillary (n= 7) and multibacillary (n=23) leprosy patients, showing a
significant increase in multibacillary compared to paucibacillary leprosy patients for C4d (mean PB
17,99 mg/l SE 1,99 versus mean MB 27,15 mg/l SE 4,04; p=0.04], Bb (mean PB 24,91 mg/l SE 2,39
versus mean MB 28,62 mg/l SE 1,99; p=0.03], iC3b (mean PB 13,15 mg/l SE 1,94 versus mean MB
22,39 mg/l SE 1,92; p=0.02] and TCC (mean PB 2,02 mg/l SE 0.23 versus MB 4,03 mg/l SE 0,28;
p=0.003]. The error bars represent the standard error of the mean.
3
Complement in serum of leprosy patients
115
SUPPLEMENTARY FIGURES
Sup. Fig. 1. TCC serum levels of leprosy patients followed at reaction and after treatment. TCC
serum levels of leprosy patients at reaction do not change after treatment, indicating that treatment
does not affect complement activity in leprosy.
Sup. Fig. 2. Complement activation in paucibacillary and multibacillary leprosy patients from
Ethiopia. MSD platform for measuring complement activation products C4d (A), Bb (B), iC3b (C) and
TCC (D) in serum from paucibacillary (n= 7) and multibacillary (n=23) leprosy patients, showing a
significant increase in multibacillary compared to paucibacillary leprosy patients for C4d (mean PB
17,99 mg/l SE 1,99 versus mean MB 27,15 mg/l SE 4,04; p=0.04], Bb (mean PB 24,91 mg/l SE 2,39
versus mean MB 28,62 mg/l SE 1,99; p=0.03], iC3b (mean PB 13,15 mg/l SE 1,94 versus mean MB
22,39 mg/l SE 1,92; p=0.02] and TCC (mean PB 2,02 mg/l SE 0.23 versus MB 4,03 mg/l SE 0,28;
p=0.003]. The error bars represent the standard error of the mean.
Fernanda (19) en haar broer Evaldo (17) werden waarschijnlijk besmet met lepra via
hun buurjongen. Fernanda: ‘Ik kreeg vlekken op mijn handen en armen. Mijn moeder
dacht dat het een huidschimmel was. Maar de zalfjes die ze me gaf, hielpen niet.’
Een buurvrouw nam Fernanda en haar broer uiteindelijk mee naar de dokter. Die zag
direct dat het lepra was. ‘Pas later begrepen we wat het betekende om lepra te
hebben omdat iemand erover kwam vertellen.’
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
In Situ complement activation and T-cell immunity in leprosy
spectrum: An Immunohistological Study on Leprosy Lesional
skin
Nawal Bahia El Idrissi 1, Anand M Iyer2 , Valeria Ramaglia1, Patricia S. Rosa3,
Cleverson T. Soares3, Frank Baas1* and Pranab K Das4. Submitted to PLOSone.
1Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, 1105 AZ, The Netherlands; 3 Instituto Lauro de Souza Lima, Bauru,
17034-971, Brazil;4 Department of Clinical Immunology, Colleges of Medical and Dental
Sciences, University of Birmingham, Birmingham, B15 2TT, UK.
Fernanda (19) en haar broer Evaldo (17) werden waarschijnlijk besmet met lepra via
hun buurjongen. Fernanda: ‘Ik kreeg vlekken op mijn handen en armen. Mijn moeder
dacht dat het een huidschimmel was. Maar de zalfjes die ze me gaf, hielpen niet.’
Een buurvrouw nam Fernanda en haar broer uiteindelijk mee naar de dokter. Die zag
direct dat het lepra was. ‘Pas later begrepen we wat het betekende om lepra te
hebben omdat iemand erover kwam vertellen.’
Leprastichting / Netherlands Leprosy Relief (NLR) Fondsenwerving & Voorlichting
In Situ complement activation and T-cell immunity in leprosy
spectrum: An Immunohistological Study on Leprosy Lesional
skin
Nawal Bahia El Idrissi 1, Anand M Iyer2 , Valeria Ramaglia1, Patricia S. Rosa3,
Cleverson T. Soares3, Frank Baas1* and Pranab K Das4. Submitted to PLOSone.
1Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, 1105 AZ, The Netherlands; 3 Instituto Lauro de Souza Lima, Bauru,
17034-971, Brazil;4 Department of Clinical Immunology, Colleges of Medical and Dental
Sciences, University of Birmingham, Birmingham, B15 2TT, UK.
4
Chapter 4
118
Abstract
Background. Mycobacterium leprae (M. leprae) infection causes nerve damage and
the condition worsens often during and long after treatment. Clearance of bacterial
antigens including lipoarabinomannan (LAM) during and after treatment in leprosy
patients is slow. We previously demonstrated that M. leprae specific component LAM
damages peripheral nerves by in situ generation of the terminal complement
component membrane attack complex (MAC). Investigating the role of complement
activation in skin lesions of leprosy patients might provide insight into the dynamics of
in situ immune reactivity and the destructive pathology of M. leprae. Previously we
showed that LAM and MAC are deposited on axons in nerve biopsies of leprosy
patients. In this study, we analyzed in skin lesions of leprosy patients, whether M.
leprae antigen LAM deposition correlates with the deposition of complement
activation products MAC and C3d on nerves and cells in the surrounding tissue.
Methods. Routine hematoxylin and eosin (H&E) staining was performed on the skin
biopsies of leprosy patients evaluating the histopathology of studied biopsies.
Deposition of LAM and key complement activation products, C3d and membrane
attack complex (MAC) were analyzed in skin biopsies of paucibacillary (n=7),
multibacillary leprosy patients (n=7), and patients with erythema nodosum leprosum
(ENL) (n=6) or reversal reaction (RR) (n=4) and controls (n=4). Double
immunofluorescence stainings were performed to detect which immune cells were
positive for complement products C3d and MAC in skin lesions of leprosy patients. In
addition, nerves were analyzed for MAC deposition in these lesions.
Results. The percentage of C3d, MAC and LAM deposition was significantly higher
in the skin biopsies of multibacillary compared to paucibacillary patients (p=<0.05,
p=<0.001 and p=<0.001 respectively), with a significant association between LAM
and C3d or MAC in the skin biopsies of leprosy patients (r=0.9578, p< 0.0001 and
r=0.8585, p<0.0001 respectively). In skin lesions of multibacillary patients, MAC
deposition was found on axons co-localizing with LAM, suggesting that MAC targets
the axons in skin lesions with LAM as a trigger for complement activation. In addition,
skin lesions of RR showed significantly higher levels of C3d deposition compared to
non-reactional leprosy patients (p=<0.05). MAC immunoreactivity was increased in
both ENL and RR skin lesions compared to non-reactional leprosy patients (p=<0.01
and p=<0.01 respectively). C3d is known to be involved in co-stimulation of T-cells. In
skin lesions of paucibacillary patients, we found C3d positive T-cells in and
surrounding granulomas, but hardly any MAC deposition or nerves detected
compared to multibacillary patients.
Conclusions. The present findings demonstrate that complement is deposited in
skin lesions of leprosy patients, suggesting that inflammation driven by complement
activation might contribute to nerve damage in the lesions of these patients. This
should be regarded as an important factor in M. leprae nerve damage pathology.
Keywords. M. leprae, Lipoarabinomannan, Complement, Membrane attack complex, C3d; T-cells,
Skin lesions.
4
Complement in leprosy skin lesions
119
Abstract
Background. Mycobacterium leprae (M. leprae) infection causes nerve damage and
the condition worsens often during and long after treatment. Clearance of bacterial
antigens including lipoarabinomannan (LAM) during and after treatment in leprosy
patients is slow. We previously demonstrated that M. leprae specific component LAM
damages peripheral nerves by in situ generation of the terminal complement
component membrane attack complex (MAC). Investigating the role of complement
activation in skin lesions of leprosy patients might provide insight into the dynamics of
in situ immune reactivity and the destructive pathology of M. leprae. Previously we
showed that LAM and MAC are deposited on axons in nerve biopsies of leprosy
patients. In this study, we analyzed in skin lesions of leprosy patients, whether M.
leprae antigen LAM deposition correlates with the deposition of complement
activation products MAC and C3d on nerves and cells in the surrounding tissue.
Methods. Routine hematoxylin and eosin (H&E) staining was performed on the skin
biopsies of leprosy patients evaluating the histopathology of studied biopsies.
Deposition of LAM and key complement activation products, C3d and membrane
attack complex (MAC) were analyzed in skin biopsies of paucibacillary (n=7),
multibacillary leprosy patients (n=7), and patients with erythema nodosum leprosum
(ENL) (n=6) or reversal reaction (RR) (n=4) and controls (n=4). Double
immunofluorescence stainings were performed to detect which immune cells were
positive for complement products C3d and MAC in skin lesions of leprosy patients. In
addition, nerves were analyzed for MAC deposition in these lesions.
Results. The percentage of C3d, MAC and LAM deposition was significantly higher
in the skin biopsies of multibacillary compared to paucibacillary patients (p=<0.05,
p=<0.001 and p=<0.001 respectively), with a significant association between LAM
and C3d or MAC in the skin biopsies of leprosy patients (r=0.9578, p< 0.0001 and
r=0.8585, p<0.0001 respectively). In skin lesions of multibacillary patients, MAC
deposition was found on axons co-localizing with LAM, suggesting that MAC targets
the axons in skin lesions with LAM as a trigger for complement activation. In addition,
skin lesions of RR showed significantly higher levels of C3d deposition compared to
non-reactional leprosy patients (p=<0.05). MAC immunoreactivity was increased in
both ENL and RR skin lesions compared to non-reactional leprosy patients (p=<0.01
and p=<0.01 respectively). C3d is known to be involved in co-stimulation of T-cells. In
skin lesions of paucibacillary patients, we found C3d positive T-cells in and
surrounding granulomas, but hardly any MAC deposition or nerves detected
compared to multibacillary patients.
Conclusions. The present findings demonstrate that complement is deposited in
skin lesions of leprosy patients, suggesting that inflammation driven by complement
activation might contribute to nerve damage in the lesions of these patients. This
should be regarded as an important factor in M. leprae nerve damage pathology.
Keywords. M. leprae, Lipoarabinomannan, Complement, Membrane attack complex, C3d; T-cells,
Skin lesions.
Chapter 4
120
1. Introduction
Leprosy is a chronic granulomatous disease caused by the intracellular bacterium
Mycobacterium leprae (M. leprae) which displays a broad spectrum of immunological
and histopathological responses. The leprosy spectrum has as its poles either
tuberculoid (TT) or lepromatous (LL), and intermediate forms known as borderline
lepromatous (BL), borderline borderline (BB) and borderline tuberculoid (BT). The LL,
BL and BB forms are collectively called multibacillary (MB) whereas the BT and TT
are paucibacillary (PB) [1]. Histopathologically, TT skin lesions are characterized by
the presence of epithelioid cells surrounded by a cuff of T-cells with few or no bacilli,
whereas LL lesions show an abundance of bacilli-filled foamy macrophages.
The immunopathological spectrum in leprosy is largely considered to be due to the
variation in immune responses accompanied with changing granulomatous reactions
by the individual host to specific M.leprae antigens. Tuberculoid leprosy is
characterized by a strong T-cell-mediated immunity towards the antigens of M. leprae
whereas lepromatous leprosy is characterized by a selective T-cell unresponsiveness
to M. leprae antigens [2]. In contrast, high levels of M. leprae specific antibodies are
present in LL which does not prevent the spread of the bacteria within the host. The
borderline forms of leprosy (BT, BB and BL) are immunologically unstable. In
addition, about 20-30% of the borderline patients may undergo immune
exacerbations during the course of the disease, which manifest as either reversal
reaction (RR) or erythema nodosum leprosum (ENL). This event can follow initial
treatment and could worsen the nerve damage even after release from treatment.
Most studies have shown that the involvement of the adaptive immunity is
responsible for tissue destruction in leprosy. However, recent evidence suggests that
the innate immunity of the host including complement activation plays an important
role in leprosy pathology and tissue destruction.
The complement system is the first line of defence against pathogens and a key
component of innate immunity, activated early after infections. Activation of the
complement system can occur via the recognition of antigen-antibody complexes
(classical pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin
pathway). Regardless of the trigger, activation results in the cleavage of C3, and
formation of the membrane attack complex (MAC), which lyses cells by making holes
in their membrane. Activated complement is able to drift from the target site to
adjacent areas and enhance inflammation and damage healthy tissue [3, 4].
The complement system is crucial for the opsonisation and subsequent killing of
bacteria. Previous studies have indicated an important role for complement in
leprosy, showing increased levels of complement components by serological and
pathological studies [5-11]. Another study showed deposits of the MAC in cutaneous
sensory nerves of leprosy patients, suggesting a possible role for MAC in leprosy
pathology [10, 12]. We have shown that formation of the MAC contributes to early
demyelination and axonal damage after traumatic injury of the peripheral nerve [13,
14], and that inhibition of MAC formation reduces nerve damage [15] and improves
regeneration and functional recovery [16].
The pathogenesis of nerve damage in leprosy patients remains largely unsolved. We
have shown that complement contributes to peripheral nerve damage in a model of
M. leprae induced neuropathy [17]. The interesting question is what triggers the
extensive nerve damage. Important elements of an infection with M. leprae are the
recognition of pathogen associated molecular patterns, such as LAM, by pattern
4
Complement in leprosy skin lesions
121
1. Introduction
Leprosy is a chronic granulomatous disease caused by the intracellular bacterium
Mycobacterium leprae (M. leprae) which displays a broad spectrum of immunological
and histopathological responses. The leprosy spectrum has as its poles either
tuberculoid (TT) or lepromatous (LL), and intermediate forms known as borderline
lepromatous (BL), borderline borderline (BB) and borderline tuberculoid (BT). The LL,
BL and BB forms are collectively called multibacillary (MB) whereas the BT and TT
are paucibacillary (PB) [1]. Histopathologically, TT skin lesions are characterized by
the presence of epithelioid cells surrounded by a cuff of T-cells with few or no bacilli,
whereas LL lesions show an abundance of bacilli-filled foamy macrophages.
The immunopathological spectrum in leprosy is largely considered to be due to the
variation in immune responses accompanied with changing granulomatous reactions
by the individual host to specific M.leprae antigens. Tuberculoid leprosy is
characterized by a strong T-cell-mediated immunity towards the antigens of M. leprae
whereas lepromatous leprosy is characterized by a selective T-cell unresponsiveness
to M. leprae antigens [2]. In contrast, high levels of M. leprae specific antibodies are
present in LL which does not prevent the spread of the bacteria within the host. The
borderline forms of leprosy (BT, BB and BL) are immunologically unstable. In
addition, about 20-30% of the borderline patients may undergo immune
exacerbations during the course of the disease, which manifest as either reversal
reaction (RR) or erythema nodosum leprosum (ENL). This event can follow initial
treatment and could worsen the nerve damage even after release from treatment.
Most studies have shown that the involvement of the adaptive immunity is
responsible for tissue destruction in leprosy. However, recent evidence suggests that
the innate immunity of the host including complement activation plays an important
role in leprosy pathology and tissue destruction.
The complement system is the first line of defence against pathogens and a key
component of innate immunity, activated early after infections. Activation of the
complement system can occur via the recognition of antigen-antibody complexes
(classical pathway), foreign surfaces (alternative pathway) or bacterial sugars (lectin
pathway). Regardless of the trigger, activation results in the cleavage of C3, and
formation of the membrane attack complex (MAC), which lyses cells by making holes
in their membrane. Activated complement is able to drift from the target site to
adjacent areas and enhance inflammation and damage healthy tissue [3, 4].
The complement system is crucial for the opsonisation and subsequent killing of
bacteria. Previous studies have indicated an important role for complement in
leprosy, showing increased levels of complement components by serological and
pathological studies [5-11]. Another study showed deposits of the MAC in cutaneous
sensory nerves of leprosy patients, suggesting a possible role for MAC in leprosy
pathology [10, 12]. We have shown that formation of the MAC contributes to early
demyelination and axonal damage after traumatic injury of the peripheral nerve [13,
14], and that inhibition of MAC formation reduces nerve damage [15] and improves
regeneration and functional recovery [16].
The pathogenesis of nerve damage in leprosy patients remains largely unsolved. We
have shown that complement contributes to peripheral nerve damage in a model of
M. leprae induced neuropathy [17]. The interesting question is what triggers the
extensive nerve damage. Important elements of an infection with M. leprae are the
recognition of pathogen associated molecular patterns, such as LAM, by pattern
Chapter 4
122
recognition receptors that can trigger the activation of the complement system. In
nerve biopsies of leprosy patients we found a correlation between the amount of
MAC and M. leprae antigen LAM deposition, suggestig that LAM is a trigger for
complement activation [17]. An other study showed an increased amount of
antibodies against bacterial antigens such as Lipoarabinomannan (LAM) in serum of
multibacillary patients compared to paucibacillary patients [18, 19], suggesting an
immune response to the bacterial antigens.
Persistence of M. leprae antigens from dead bacilli can provoke immunological
reactions, such as reversal reaction, causing serious nerve damage and subsequent
disabilities. Although multiple drug therapy (MDT) is an affective target to kill M.
leprae, early diagnosis and an effective treatment of the disease related nerve
damage is still a challenge. Treatment with MDT targets M. leprae and this
consequently results in reduction of viable bacilli, and initiates the release of dead
bacilli and M. leprae antigens. This could cause a persistent stimulus with
consequent activation of the complement system and continued inflammatory
response, which contributes to nerve damage. Others and we showed that bacterial
antigens such as LAM and axonal debris could be found in leprosy patients long after
treatment [20]. Persistence of M. leprae antigens might be an important risk factor for
late reactions by continuously triggering pathogen recognition receptors and
activation of complement.
It is important to understand what role the complement system has in leprosy,
because increasing evidence suggests that complement is not only involved in killing
of pathogens but also plays a critical role in modulating the adaptive immune
response and causing nerve damage. Understanding the role of the complement
system in the immunopathology in leprosy skin lesions could be of benefit to develop
therapeutic intervention in modulating the course of the disease.
This study gives an insight into the immunopathology in skin lesions of leprosy
patients throughout the spectrum. It is unknown whether the presence of the M.
leprae antigen LAM is associated with the amount of complement activation in skin
lesions of leprosy patients. Here we explore to what extent complement is present in
skin lesions of paucibacillary, multibacillary patients and patients with a reaction (ENL
and RR) in relation to the presence of M. leprae antigen LAM. We analyzed
borderline lepromatous leprosy patients that developed ENL or RR. In addition, we
were interested in the cellular localization of complement activation products C3d and
MAC and whether MAC targets the axons in skin lesions of leprosy patients.
Our data supports the hypothesis that the persistence of LAM in leprosy lesions
could be the driver of perpetuating disease fluctuation. We propose that complement
plays a significant role in inflammation not only through the deposition of tissue
damaging complement activation product MAC but also via the involvement of the
infiltrating T-cells in situ.
4
Complement in leprosy skin lesions
123
recognition receptors that can trigger the activation of the complement system. In
nerve biopsies of leprosy patients we found a correlation between the amount of
MAC and M. leprae antigen LAM deposition, suggestig that LAM is a trigger for
complement activation [17]. An other study showed an increased amount of
antibodies against bacterial antigens such as Lipoarabinomannan (LAM) in serum of
multibacillary patients compared to paucibacillary patients [18, 19], suggesting an
immune response to the bacterial antigens.
Persistence of M. leprae antigens from dead bacilli can provoke immunological
reactions, such as reversal reaction, causing serious nerve damage and subsequent
disabilities. Although multiple drug therapy (MDT) is an affective target to kill M.
leprae, early diagnosis and an effective treatment of the disease related nerve
damage is still a challenge. Treatment with MDT targets M. leprae and this
consequently results in reduction of viable bacilli, and initiates the release of dead
bacilli and M. leprae antigens. This could cause a persistent stimulus with
consequent activation of the complement system and continued inflammatory
response, which contributes to nerve damage. Others and we showed that bacterial
antigens such as LAM and axonal debris could be found in leprosy patients long after
treatment [20]. Persistence of M. leprae antigens might be an important risk factor for
late reactions by continuously triggering pathogen recognition receptors and
activation of complement.
It is important to understand what role the complement system has in leprosy,
because increasing evidence suggests that complement is not only involved in killing
of pathogens but also plays a critical role in modulating the adaptive immune
response and causing nerve damage. Understanding the role of the complement
system in the immunopathology in leprosy skin lesions could be of benefit to develop
therapeutic intervention in modulating the course of the disease.
This study gives an insight into the immunopathology in skin lesions of leprosy
patients throughout the spectrum. It is unknown whether the presence of the M.
leprae antigen LAM is associated with the amount of complement activation in skin
lesions of leprosy patients. Here we explore to what extent complement is present in
skin lesions of paucibacillary, multibacillary patients and patients with a reaction (ENL
and RR) in relation to the presence of M. leprae antigen LAM. We analyzed
borderline lepromatous leprosy patients that developed ENL or RR. In addition, we
were interested in the cellular localization of complement activation products C3d and
MAC and whether MAC targets the axons in skin lesions of leprosy patients.
Our data supports the hypothesis that the persistence of LAM in leprosy lesions
could be the driver of perpetuating disease fluctuation. We propose that complement
plays a significant role in inflammation not only through the deposition of tissue
damaging complement activation product MAC but also via the involvement of the
infiltrating T-cells in situ.
Chapter 4
124
2. Methods
Skin biopsies. Skin biopsies of paucibacillary (TT and BT) (n=7) and multibacillary
(BL and LL) (n=7) leprosy patients were from Brazilian donors and were obtained at
hospitalization at the Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil as
diagnostic procedure (Table 1). In this study we did not include any borderline
boderline (BB) patient as this group is unstable and rare, which makes pathological
diagnosis difficult. Skin biopsies of leprosy patients after treatment (BL) (n=4) or with
erythema nodusum leprosum (ENL) (n=4) and reversal reaction (RR) (n=4) were
obtained from the archieval material of the Academical medical Center and were
from Dutch donors (Table 2 and 3). The reaction patients were BL patients that
developed ENL or RR. We choose BL leprosy patients because they can develop
ENL as well as RR. All patients were classified according to the Ridley-Jopling scale.
The control biopsies (n=4) were obtained during surgery from patients with no
leprosy. Tissue was obtained and used in accordance with the Declaration of Helsinki
and the Academic Medical Center Research Code provided by the Medical Ethics
Committee. Informed consent was obtained from all the patients.
After dissection, the skin biopsies were fixed in 10% formalin and processed
according to standard procedures for embedding in parrafin. Paraffin section of 6 µm
and/or 14 µm thickness were cut using a microtome and mounted on glass slides for
further pathological analysis. Tissue sections were stained with haematoxylin-eosin
for histopathological analysis and to assess the inflammatory activity in the lesions.
Table 1.Characterization of skin biopsies and clinical data of PB/ MB leprosy patients and controls
Case Material Leprosy type Gender Age diagnosis Treatment
1 Skin - -
2 Skin - -
3 Skin - -
4 Skin - -
1 Skin Paucibacillary (TT) F 12 MDT/PB (2009)
2 Skin Paucibacillary (TT) M unkown MDT/PB (2009)
3 Skin Paucibacillary (BT) F 29 MDT/ (2010)
4 Skin Paucibacillary (BT) F 49 MDT/MB (2010)
5 Skin Paucibacillary (BT) F 53 MDT/PB (2010/11)
6 Skin Paucibacillary (TT) M 23 unknown
7 Skin Paucibacillary (BT) M 29 unknown
8 Skin Multibacillary (LL) M unknown MDT/MB (2010/11)
9 Skin Multibacillary (LL) F 28 MDT/MB (2009/10)
10 Skin Multibacillary (BL) F 49 MDT/MB (2009/10)
11 Skin Multibacillary (LL) M 39 MDT/MB (2010/11)
12 Skin Multibacillary (LL) M 28 MDT/MB (2010)
13 Skin Multibacillary (LL) M 79 MDT/MB (2010/11)
14 Skin Multibacillary (BL) F 26 MDT/MB (2010)
15 Skin Multibacillary (BL) M 46 MDT/MB (2010)
16 Skin Multibacillary (BL) F 71 MDT/MB (2010)
17 Skin Multibacillary (BL) M 50 MDT/MB (2010)
F, female; M, male; MDT, multidrug therapy.
4
Complement in leprosy skin lesions
125
2. Methods
Skin biopsies. Skin biopsies of paucibacillary (TT and BT) (n=7) and multibacillary
(BL and LL) (n=7) leprosy patients were from Brazilian donors and were obtained at
hospitalization at the Instituto Lauro de Souza Lima, Bauru, Sao Paulo, Brazil as
diagnostic procedure (Table 1). In this study we did not include any borderline
boderline (BB) patient as this group is unstable and rare, which makes pathological
diagnosis difficult. Skin biopsies of leprosy patients after treatment (BL) (n=4) or with
erythema nodusum leprosum (ENL) (n=4) and reversal reaction (RR) (n=4) were
obtained from the archieval material of the Academical medical Center and were
from Dutch donors (Table 2 and 3). The reaction patients were BL patients that
developed ENL or RR. We choose BL leprosy patients because they can develop
ENL as well as RR. All patients were classified according to the Ridley-Jopling scale.
The control biopsies (n=4) were obtained during surgery from patients with no
leprosy. Tissue was obtained and used in accordance with the Declaration of Helsinki
and the Academic Medical Center Research Code provided by the Medical Ethics
Committee. Informed consent was obtained from all the patients.
After dissection, the skin biopsies were fixed in 10% formalin and processed
according to standard procedures for embedding in parrafin. Paraffin section of 6 µm
and/or 14 µm thickness were cut using a microtome and mounted on glass slides for
further pathological analysis. Tissue sections were stained with haematoxylin-eosin
for histopathological analysis and to assess the inflammatory activity in the lesions.
Table 1.Characterization of skin biopsies and clinical data of PB/ MB leprosy patients and controls
Case Material Leprosy type Gender Age diagnosis Treatment
1 Skin - -
2 Skin - -
3 Skin - -
4 Skin - -
1 Skin Paucibacillary (TT) F 12 MDT/PB (2009)
2 Skin Paucibacillary (TT) M unkown MDT/PB (2009)
3 Skin Paucibacillary (BT) F 29 MDT/ (2010)
4 Skin Paucibacillary (BT) F 49 MDT/MB (2010)
5 Skin Paucibacillary (BT) F 53 MDT/PB (2010/11)
6 Skin Paucibacillary (TT) M 23 unknown
7 Skin Paucibacillary (BT) M 29 unknown
8 Skin Multibacillary (LL) M unknown MDT/MB (2010/11)
9 Skin Multibacillary (LL) F 28 MDT/MB (2009/10)
10 Skin Multibacillary (BL) F 49 MDT/MB (2009/10)
11 Skin Multibacillary (LL) M 39 MDT/MB (2010/11)
12 Skin Multibacillary (LL) M 28 MDT/MB (2010)
13 Skin Multibacillary (LL) M 79 MDT/MB (2010/11)
14 Skin Multibacillary (BL) F 26 MDT/MB (2010)
15 Skin Multibacillary (BL) M 46 MDT/MB (2010)
16 Skin Multibacillary (BL) F 71 MDT/MB (2010)
17 Skin Multibacillary (BL) M 50 MDT/MB (2010)
F, female; M, male; MDT, multidrug therapy.
Chapter 4
126
Table 3. Characterization of skin biopsies and clinical data of ENL leprosy patients
Case Material Leprosy type Gender Age diagnosis
Treatment
1 Skin Multibacillary (ENL) F 28
MDT/MB (2009-10)
2 Skin Multibacillary (ENL) M 39
MDT/MB (2010-11)
3
Skin Multibacillary (ENL) F 18
MDT/MB
+PRED (2003)
4 Skin Multibacillary (ENL) M 48
MDT/MB (2009-10)
F, female; M, male; MDT, multidrug therapy; PRED, Prednisone.
Table 2. Characterization of skin biopsies and clinical data of RR leprosy patients
Case Material Leprosy type Gender Age
diagnosis
Treatment
1 Skin Multibacillary (RR) M 36 MDT/MB (1998)
2 Skin Multibacillary (RR) F 57 MDT/MB (1995)
3 Skin Multibacillary (RR) M 40 MDT/MB (1996)
4 Skin Multibacillary (RR) F 40 MDT/MB (1997)
F, female; M, male; MDT, multidrug therapy.
Immunohistochemistry. After deparaffination and rehydration, the endogenous
peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20 minutes.
Epitopes were exposed by heat-induced antigen retrieval, in either 10mM sodium
citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA buffer (pH 9.0) depending on the
primary antibody used (see Table 4). Aspecific binding of antibodies was blocked
using 10% Normal Goat Serum (DAKO, Heverlee, Belgium) in phosphate buffer
saline (PBS) for 30 minutes at room temperature. Primary antibodies were diluted in
Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated for
1 hour at room temperature. Detection was performed by incubating the sections in
the secondary poly-HRP-goat anti Mouse/Rabbit/Rat IgG (Brightvision Immunologic,
Duiven, The Netherlands) antibody cocktail diluted 1:1 in PBS for 30 minutes at room
temperature following by incubation in 3,3- diaminobenzidine tetrahydrochloride
(DAB; Vector Laboratories, Burlingame, CA) as chromogen. Counterstaining to
visualize nuclei was performed by immersion in Hematoxylin for 5 minutes at room
temperature, followed by differentiation in running water for 4 minutes at room
temperature. Sections stained with secondary antibody alone were included as
negative controls with each test. After dehydration, slides were mounted in Pertex
(Histolab, Gothenburg, Sweden).
The quantitative analysis of the immunostainings was performed with the Image Pro
Plus software version 7 (Media Cybernetics Europe, Marlow, UK). Digital images of
20x magnification of the immunostainings were captured with a light microscope
(BX41TF; Olympus,Center Valley, PA) using the Cell D software (Olympus). Images
covering the complete skin biopsy were quantified. The surface area stained is
expressed as percentage of total area examined. The error bars indicate standard
error of the mean.
4
Complement in leprosy skin lesions
127
Table 3. Characterization of skin biopsies and clinical data of ENL leprosy patients
Case Material Leprosy type Gender Age diagnosis
Treatment
1 Skin Multibacillary (ENL) F 28
MDT/MB (2009-10)
2 Skin Multibacillary (ENL) M 39
MDT/MB (2010-11)
3
Skin Multibacillary (ENL) F 18
MDT/MB
+PRED (2003)
4 Skin Multibacillary (ENL) M 48
MDT/MB (2009-10)
F, female; M, male; MDT, multidrug therapy; PRED, Prednisone.
Table 2. Characterization of skin biopsies and clinical data of RR leprosy patients
Case Material Leprosy type Gender Age
diagnosis
Treatment
1 Skin Multibacillary (RR) M 36 MDT/MB (1998)
2 Skin Multibacillary (RR) F 57 MDT/MB (1995)
3 Skin Multibacillary (RR) M 40 MDT/MB (1996)
4 Skin Multibacillary (RR) F 40 MDT/MB (1997)
F, female; M, male; MDT, multidrug therapy.
Immunohistochemistry. After deparaffination and rehydration, the endogenous
peroxidase activity was blocked with 0.3 % H2O2 in methanol for 20 minutes.
Epitopes were exposed by heat-induced antigen retrieval, in either 10mM sodium
citrate buffer (pH 6.0) or 10mM Tris 1mM EDTA buffer (pH 9.0) depending on the
primary antibody used (see Table 4). Aspecific binding of antibodies was blocked
using 10% Normal Goat Serum (DAKO, Heverlee, Belgium) in phosphate buffer
saline (PBS) for 30 minutes at room temperature. Primary antibodies were diluted in
Normal Antibody Diluent (Immunologic, Duiven, The Netherlands) and incubated for
1 hour at room temperature. Detection was performed by incubating the sections in
the secondary poly-HRP-goat anti Mouse/Rabbit/Rat IgG (Brightvision Immunologic,
Duiven, The Netherlands) antibody cocktail diluted 1:1 in PBS for 30 minutes at room
temperature following by incubation in 3,3- diaminobenzidine tetrahydrochloride
(DAB; Vector Laboratories, Burlingame, CA) as chromogen. Counterstaining to
visualize nuclei was performed by immersion in Hematoxylin for 5 minutes at room
temperature, followed by differentiation in running water for 4 minutes at room
temperature. Sections stained with secondary antibody alone were included as
negative controls with each test. After dehydration, slides were mounted in Pertex
(Histolab, Gothenburg, Sweden).
The quantitative analysis of the immunostainings was performed with the Image Pro
Plus software version 7 (Media Cybernetics Europe, Marlow, UK). Digital images of
20x magnification of the immunostainings were captured with a light microscope
(BX41TF; Olympus,Center Valley, PA) using the Cell D software (Olympus). Images
covering the complete skin biopsy were quantified. The surface area stained is
expressed as percentage of total area examined. The error bars indicate standard
error of the mean.
Chapter 4
128
Table 4. Antibody, source, dilution
Antibody Detects Source Concentration/
Dilution
Polyclonal rabbit anti-rat C9
(cross-reacts with human C9)
MAC Made in house
(B.P. Morgan)
0.013 µg/µl’
Polyclonal rabbit anti-human C3d C3d Dako (A0063) 0.016 µg/µl *
Monoclonal mouse anti-human
phosphorylated neurofilament (clone
SMI31)
Axons Sternberger
Monoclonals Inc.
(SMI31R)
1:1000’
Monoclonal mouse anti-LAM LAM Made in house
(P.K. Das)
1:200’
Mouse anti- CD3 T-cells Life technologies
MHCD0300
1:500*
Mouse anti-CD68 Macrophages PG-M1 Dako 1:200*
Mouse anti-CD20 B-cells DAKO M755 1:400*
Mouse anti-CD21 Receptor for
C3d on B- and
T cells
Abcam Ab9492 1:200*
Antigen retrieval was performed with either 10mM Tris 1mM EDTA pH 9’ or 10mM Sodium Citrate pH 6*
Immunofluorescence. Immunofluorescence staining was performed to compare the
cellular distribution of two markers in the same tissue section. Deparaffination,
antigen retrieval and blocking of aspecific binding sites were performed essentially as
described above. To determine which cells were C3d or MAC positive in skin lesions
of leprosy patients skin sections of 6 µm were stained with the unconjugated primary
antibodies against CD3+ T-cells, CD20+ B-cells or CD68+ macrophages together
with either C3d or MAC (see table 4). The unbound primary antibodies were
removed by rinsing (3 × 5 min) with PBS followed by incubating with a fluorescently
labeled secondary antibody for 45 min. The primary antibodies raised in rabbit (see
table 4) were detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG
(Sigma-Aldrich, Saint Louis, MI) and the primary antibodies raised in mouse were
detected with Cy3 (red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich,
Saint Louis, MI). Sections were air dried and mounted in Vectashield (Vector,
Burlingame, CA). To determine co localization, images were captured digitally with a
fluorescence microscope (DM LB2; Leica, Wetzlar, Germany) connected to a digital
camera (DFC500; Leica).
To analyze the deposition of MAC on nerves, 14 µm skin sections were stained with
unconjugated polyclonal rabbit anti-rat C9 and monoclonal mouse anti-human
phosphorylated neurofilament (see Table 4). The staining was performed in the
same manner as described above. The primary C9 antibody was detected with
Fluorophores FITC (green, 488nm) - conjugated goat anti-rabbit (Sigma-Aldrich,
Saint Louis, MI) and the SMI31 antibody was detected with the secondary antibody
Cy3 (red, 550-570 nm) – conjugated goat anti-mouse (Sigma) using a Leica TCS
SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk, The Netherlands).
Z-stacks of all the positive skin areas were made using the 40x objective /1.30 Oil
4
Complement in leprosy skin lesions
129
Table 4. Antibody, source, dilution
Antibody Detects Source Concentration/
Dilution
Polyclonal rabbit anti-rat C9
(cross-reacts with human C9)
MAC Made in house
(B.P. Morgan)
0.013 µg/µl’
Polyclonal rabbit anti-human C3d C3d Dako (A0063) 0.016 µg/µl *
Monoclonal mouse anti-human
phosphorylated neurofilament (clone
SMI31)
Axons Sternberger
Monoclonals Inc.
(SMI31R)
1:1000’
Monoclonal mouse anti-LAM LAM Made in house
(P.K. Das)
1:200’
Mouse anti- CD3 T-cells Life technologies
MHCD0300
1:500*
Mouse anti-CD68 Macrophages PG-M1 Dako 1:200*
Mouse anti-CD20 B-cells DAKO M755 1:400*
Mouse anti-CD21 Receptor for
C3d on B- and
T cells
Abcam Ab9492 1:200*
Antigen retrieval was performed with either 10mM Tris 1mM EDTA pH 9’ or 10mM Sodium Citrate pH 6*
Immunofluorescence. Immunofluorescence staining was performed to compare the
cellular distribution of two markers in the same tissue section. Deparaffination,
antigen retrieval and blocking of aspecific binding sites were performed essentially as
described above. To determine which cells were C3d or MAC positive in skin lesions
of leprosy patients skin sections of 6 µm were stained with the unconjugated primary
antibodies against CD3+ T-cells, CD20+ B-cells or CD68+ macrophages together
with either C3d or MAC (see table 4). The unbound primary antibodies were
removed by rinsing (3 × 5 min) with PBS followed by incubating with a fluorescently
labeled secondary antibody for 45 min. The primary antibodies raised in rabbit (see
table 4) were detected with FITC (green, 488nm)-conjugated goat anti-rabbit IgG
(Sigma-Aldrich, Saint Louis, MI) and the primary antibodies raised in mouse were
detected with Cy3 (red, 560nm)–conjugated goat anti-mouse IgG (Sigma-Aldrich,
Saint Louis, MI). Sections were air dried and mounted in Vectashield (Vector,
Burlingame, CA). To determine co localization, images were captured digitally with a
fluorescence microscope (DM LB2; Leica, Wetzlar, Germany) connected to a digital
camera (DFC500; Leica).
To analyze the deposition of MAC on nerves, 14 µm skin sections were stained with
unconjugated polyclonal rabbit anti-rat C9 and monoclonal mouse anti-human
phosphorylated neurofilament (see Table 4). The staining was performed in the
same manner as described above. The primary C9 antibody was detected with
Fluorophores FITC (green, 488nm) - conjugated goat anti-rabbit (Sigma-Aldrich,
Saint Louis, MI) and the SMI31 antibody was detected with the secondary antibody
Cy3 (red, 550-570 nm) – conjugated goat anti-mouse (Sigma) using a Leica TCS
SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk, The Netherlands).
Z-stacks of all the positive skin areas were made using the 40x objective /1.30 Oil
Chapter 4
130
analyzing the 14 µm thick skin section. The images were analyzed using Leica LCS
software (Leica).
Statistical analysis. Data analysis was performed using GraphPad Prism version
5.0 (GraphPad Software Inc, San Diego, CA, USA) statistical package. Student’s t
test was performed for statistical analysis comparing two groups. For comparison of
more than two groups One way ANOVA with Bonferroni multiple comparison post-
hoc test was used, changes were considered statistically significant for p ≤ 0.05. For
the correlation analysis Shapiro-Wilk normality test was performed before using
Pearson’s correlation, to determine whether the data was normally distributed.
3. Results
MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy
patients.
The procedure to obtain skin biopsies is less invasive than the nerve biopsies,
therefore it is more commonly used in the diagnosis of leprosy patients. We carried
out immunohistochemical stainings to determine whether complement is deposited in
leprosy skin lesions and whether expression level is different in multibacillary
compared to paucibacillary patients. Immunohistochemistry for C3d, using an anti-
C3d antibody, or MAC, using an antibody against C9, which recognizes bound C9 in
tissue [21], was performed on skin biopsies of controls (Figure 1A, B), paucibacillary
(Figure 1C, D) and multibacillary patients (Figure 1E, F), showing immunoreactivity
for C3d within the dermis of both paucibacillary (Figure 1C, arrow) and multibacillary
(Figure 1E, arrow) skin. In the skin lesions of paucibacillary patients, mainly
macrophages and lymphocytes were found on or in the vicinity of the positive
staining, while in the skin lesions of multibacillary patients macrophages were
predominantly present. In addition, extensive C9 immunoreactivity was found within
the dermis of multibacillary patients’ lesions (Figure 1F), indicating abundant local
deposition of the active terminal complement product MAC in lesions of multibacillary
patients. Quantification of the staining on skin biopsies showed a significantly higher
amount of C3d and MAC deposition in multibacillary compared to paucibacillary
patients (p=<0.05; p=<0.001, respectively) (Figure 1G, H). Control skin biopsies
were negative for C3d and MAC (Figure 1A, B).
4
Complement in leprosy skin lesions
131
analyzing the 14 µm thick skin section. The images were analyzed using Leica LCS
software (Leica).
Statistical analysis. Data analysis was performed using GraphPad Prism version
5.0 (GraphPad Software Inc, San Diego, CA, USA) statistical package. Student’s t
test was performed for statistical analysis comparing two groups. For comparison of
more than two groups One way ANOVA with Bonferroni multiple comparison post-
hoc test was used, changes were considered statistically significant for p ≤ 0.05. For
the correlation analysis Shapiro-Wilk normality test was performed before using
Pearson’s correlation, to determine whether the data was normally distributed.
3. Results
MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy
patients.
The procedure to obtain skin biopsies is less invasive than the nerve biopsies,
therefore it is more commonly used in the diagnosis of leprosy patients. We carried
out immunohistochemical stainings to determine whether complement is deposited in
leprosy skin lesions and whether expression level is different in multibacillary
compared to paucibacillary patients. Immunohistochemistry for C3d, using an anti-
C3d antibody, or MAC, using an antibody against C9, which recognizes bound C9 in
tissue [21], was performed on skin biopsies of controls (Figure 1A, B), paucibacillary
(Figure 1C, D) and multibacillary patients (Figure 1E, F), showing immunoreactivity
for C3d within the dermis of both paucibacillary (Figure 1C, arrow) and multibacillary
(Figure 1E, arrow) skin. In the skin lesions of paucibacillary patients, mainly
macrophages and lymphocytes were found on or in the vicinity of the positive
staining, while in the skin lesions of multibacillary patients macrophages were
predominantly present. In addition, extensive C9 immunoreactivity was found within
the dermis of multibacillary patients’ lesions (Figure 1F), indicating abundant local
deposition of the active terminal complement product MAC in lesions of multibacillary
patients. Quantification of the staining on skin biopsies showed a significantly higher
amount of C3d and MAC deposition in multibacillary compared to paucibacillary
patients (p=<0.05; p=<0.001, respectively) (Figure 1G, H). Control skin biopsies
were negative for C3d and MAC (Figure 1A, B).
Chapter 4
132
Figure 1. MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy patients.
Representative immunohistochemical stainings of skin sections from control (A and B), paucibacillary
(C and D) and multibacillary (E and F) for C3d, detecting C3d, (C and E) or C9, detecting MAC (D and
F). (magnification; 50 µm) showing immunoreactivity for C3d within the dermis layer of the skin of both
paucibacillary (C) and multibacillary (E) (in brown) (see arrow). In addition, a strong MAC
immunoreactivity was found within the dermis layer of the skin of multibacillary patients (F) (see
arrow), indicating abundant local deposition of the active terminal complement product MAC in lesions
of multibacillary patients. The control biopsies of skin and nerve are negative for C3d and C9 (A, B).
Quantification of the staining (G and H), shows a significant higher amounts of C3d and MAC
deposits in skin lesions of multibacillary compared to paucibacillary patients (p=<0.05 and p=<0.001
respectively). Error bars indicate standard error of the mean.
C3d fragments co localize with T-cells in skin lesions of paucibacillary patients
We found C3d deposited in granulomatous lesions in the skin of paucibacillary
patients (Figure 1C). We tested whether the abundant lymphocytes and
macrophages that we observed in the H&E staining in granulomatous lesions of
paucibacillary patients (Figure 2A and B) were C3d positive by immunofluorescence
staining. We observed that both CD3+ T-cells and CD68+ macrophages co-localized
with the C3d fragment of complement in the skin lesions of paucibacillary patients
(Figure 2C and D). CD68+ cells were occasionally MAC positive in lesions of
paucibacillary patients (data not shown), but CD3+ T-cells were not. B- and T-cells
are known to express the CR2 receptor for C3d. To confirm our findings we analyzed
whether C3d also co-localized with the CR2/CD21 receptor. We observed that also
CD21 co-localized with C3d in skin lesions of paucibacillary patients (Figure 2E).
B cells were also found to co-localize with C3d in the skin lesions of these patients,
but these were not as frequently found as the C3d positive T-cells (Figure 2F).
These findings might suggest a role for C3d in T- and B cell co-stimulation in skin
lesions of paucibacillary patients.
4
Complement in leprosy skin lesions
133
Figure 1. MAC and C3d deposition in skin of paucibacillary and multibacillary leprosy patients.
Representative immunohistochemical stainings of skin sections from control (A and B), paucibacillary
(C and D) and multibacillary (E and F) for C3d, detecting C3d, (C and E) or C9, detecting MAC (D and
F). (magnification; 50 µm) showing immunoreactivity for C3d within the dermis layer of the skin of both
paucibacillary (C) and multibacillary (E) (in brown) (see arrow). In addition, a strong MAC
immunoreactivity was found within the dermis layer of the skin of multibacillary patients (F) (see
arrow), indicating abundant local deposition of the active terminal complement product MAC in lesions
of multibacillary patients. The control biopsies of skin and nerve are negative for C3d and C9 (A, B).
Quantification of the staining (G and H), shows a significant higher amounts of C3d and MAC
deposits in skin lesions of multibacillary compared to paucibacillary patients (p=<0.05 and p=<0.001
respectively). Error bars indicate standard error of the mean.
C3d fragments co localize with T-cells in skin lesions of paucibacillary patients
We found C3d deposited in granulomatous lesions in the skin of paucibacillary
patients (Figure 1C). We tested whether the abundant lymphocytes and
macrophages that we observed in the H&E staining in granulomatous lesions of
paucibacillary patients (Figure 2A and B) were C3d positive by immunofluorescence
staining. We observed that both CD3+ T-cells and CD68+ macrophages co-localized
with the C3d fragment of complement in the skin lesions of paucibacillary patients
(Figure 2C and D). CD68+ cells were occasionally MAC positive in lesions of
paucibacillary patients (data not shown), but CD3+ T-cells were not. B- and T-cells
are known to express the CR2 receptor for C3d. To confirm our findings we analyzed
whether C3d also co-localized with the CR2/CD21 receptor. We observed that also
CD21 co-localized with C3d in skin lesions of paucibacillary patients (Figure 2E).
B cells were also found to co-localize with C3d in the skin lesions of these patients,
but these were not as frequently found as the C3d positive T-cells (Figure 2F).
These findings might suggest a role for C3d in T- and B cell co-stimulation in skin
lesions of paucibacillary patients.
Chapter 4
134
Figure 2. Representative stainings of skin sections from paucibacillary patients for H&E (A, B Zoom)
and immunofluorescence for CD3+
T cells and C3d (C) CD68+ macrophages and C3d (D) CD21
detecting the CR2 receptor and C3d (E) or CD20+ B cells and C3d (F). The H&E staining shows
abnormal granulomatous lesions in the skin (A). A zoom in of the H&E staining shows granulomas
with epithelioid cells surrounded by lymphocytes (B) Immunofluorescence on the sections indicated
that the T cells, the CR2 receptor and B-cells all co-localized with C3d in skin lesions of
paucibacullary patients.
MAC deposited on nerves in skin lesions of multibacillary patients.
We have previously shown that MAC can target the axons and cause nerve damage
in a model of M. leprae induced nerve damage [17]. MAC was also found deposited
on axons in nerve biopsies of leprosy patients. Here we showed that MAC is
abundantly present in skin biopsies of multibacillary patients, but not in paucibacillary
patients (Figure 1D and F). We were interested in the cellular localization of MAC in
skin lesions of multibacillary patients and whether MAC targets the nerve endings in
the skin of leprosy patients. H&E staining on skin biopsies of multibacillary patients
demonstrated numerous giant epithelioid cells in the skin lesions (Figure 3A and B).
Both complement markers C3d and MAC co-localized with CD68+ macrophages in
skin lesions of multibacillary patients (Figure 3C and D). In addition, we found that
MAC is deposited on nerves in skin lesion (Figure 3E), indicating that MAC attacks
the nerves. We previously determined in vitro that LAM is a dominant activator of
complement, here we show that also in the skin lesions MAC co-localized with M.
leprae antigen LAM, suggesting that LAM triggers complement activation in these
lesions (Figure 3F).
4
Complement in leprosy skin lesions
135
Figure 2. Representative stainings of skin sections from paucibacillary patients for H&E (A, B Zoom)
and immunofluorescence for CD3+
T cells and C3d (C) CD68+ macrophages and C3d (D) CD21
detecting the CR2 receptor and C3d (E) or CD20+ B cells and C3d (F). The H&E staining shows
abnormal granulomatous lesions in the skin (A). A zoom in of the H&E staining shows granulomas
with epithelioid cells surrounded by lymphocytes (B) Immunofluorescence on the sections indicated
that the T cells, the CR2 receptor and B-cells all co-localized with C3d in skin lesions of
paucibacullary patients.
MAC deposited on nerves in skin lesions of multibacillary patients.
We have previously shown that MAC can target the axons and cause nerve damage
in a model of M. leprae induced nerve damage [17]. MAC was also found deposited
on axons in nerve biopsies of leprosy patients. Here we showed that MAC is
abundantly present in skin biopsies of multibacillary patients, but not in paucibacillary
patients (Figure 1D and F). We were interested in the cellular localization of MAC in
skin lesions of multibacillary patients and whether MAC targets the nerve endings in
the skin of leprosy patients. H&E staining on skin biopsies of multibacillary patients
demonstrated numerous giant epithelioid cells in the skin lesions (Figure 3A and B).
Both complement markers C3d and MAC co-localized with CD68+ macrophages in
skin lesions of multibacillary patients (Figure 3C and D). In addition, we found that
MAC is deposited on nerves in skin lesion (Figure 3E), indicating that MAC attacks
the nerves. We previously determined in vitro that LAM is a dominant activator of
complement, here we show that also in the skin lesions MAC co-localized with M.
leprae antigen LAM, suggesting that LAM triggers complement activation in these
lesions (Figure 3F).
Chapter 4
136
Figure 3. H&E staining of LL leprosy skin (magnification; 100 µm) (A) and zoom-in (magnification; 25
µm) showing giant epithelioid cells in the skin lesion. Double staining of LL leprosy skin for
macrophage marker CD68 (red) with C3d (green) (C) and MAC (green) (D) showed co-localization of
both complement markers with macrophages (magnification; 25 µm). Staining for MAC with the
marker SMI31 that visualizes the nerves or LAM showed that these markers co-localized indicating
that MAC attacks the axons in the skin and that LAM could be a trigger for the complement activation
in the lesions.
MAC deposition in skin of leprosy patients with reactions.
Reversal reaction (RR) and erythema nodusum leprosum (ENL) can result in
extensive nerve damage and disabilities probably due to the immunological response
to M. leprae antigens. To determine the extent of MAC and C3d deposition in skin
biopsies of reaction leprosy patients we performed immunohistochemistry for C3d
and C9 detecting MAC. Skin biopsies of borderline lepromatous patients without
(Figure 4A, B) or with ENL (Figure 4C, D) or RR (Figure 4E, F) were analyzed. The
skin biopsies of borderline lepromatous patients that developed a RR showed a
significantly higher amount of C3d and MAC deposition compared borderline
lepromatous patients that did not develop a reaction (p=<0.05 and p=<0.01
respectively) (Figure 4E, F). In addition, we found that patients that developed ENL
showed a significantly higher amount of MAC deposition compared to borderline
lepromatous patients that did not develop a reaction (p=<0.01). Quantification of the
stainings indicates that patients who develop ENL or RR have a higher amount of
C3d and MAC deposition in skin lesions compared to patients without reaction
(Figure 4G, H).
4
Complement in leprosy skin lesions
137
Figure 3. H&E staining of LL leprosy skin (magnification; 100 µm) (A) and zoom-in (magnification; 25
µm) showing giant epithelioid cells in the skin lesion. Double staining of LL leprosy skin for
macrophage marker CD68 (red) with C3d (green) (C) and MAC (green) (D) showed co-localization of
both complement markers with macrophages (magnification; 25 µm). Staining for MAC with the
marker SMI31 that visualizes the nerves or LAM showed that these markers co-localized indicating
that MAC attacks the axons in the skin and that LAM could be a trigger for the complement activation
in the lesions.
MAC deposition in skin of leprosy patients with reactions.
Reversal reaction (RR) and erythema nodusum leprosum (ENL) can result in
extensive nerve damage and disabilities probably due to the immunological response
to M. leprae antigens. To determine the extent of MAC and C3d deposition in skin
biopsies of reaction leprosy patients we performed immunohistochemistry for C3d
and C9 detecting MAC. Skin biopsies of borderline lepromatous patients without
(Figure 4A, B) or with ENL (Figure 4C, D) or RR (Figure 4E, F) were analyzed. The
skin biopsies of borderline lepromatous patients that developed a RR showed a
significantly higher amount of C3d and MAC deposition compared borderline
lepromatous patients that did not develop a reaction (p=<0.05 and p=<0.01
respectively) (Figure 4E, F). In addition, we found that patients that developed ENL
showed a significantly higher amount of MAC deposition compared to borderline
lepromatous patients that did not develop a reaction (p=<0.01). Quantification of the
stainings indicates that patients who develop ENL or RR have a higher amount of
C3d and MAC deposition in skin lesions compared to patients without reaction
(Figure 4G, H).
Chapter 4
138
Figure 4. Representative immunohistochemical stainings of skin sections from BL (A and B), ENL (C
and D) and RR (E and F) for C3d (A, C and E) and MAC (B, D and F) (magnification; 100 µm).
Quantification of the staining (G and H), shows a significant higher amounts of C3d and MAC
deposits in skin lesions of BL compared to RR patients (p=<0.05 and p=<0.01 respectively). In
addition, patients that developed ENL had a higher amount of MAC deposition in the skin compared to
BL patients without a reaction (p=<0.01). Error bars indicate standard error of the mean.
LAM deposition in skin of paucibacillary and multibacillary leprosy patients.
We previously showed that LAM is the dominant activator of complement and
correlates with the amount of MAC deposition in nerve biopsies of leprosy patients.
Here we determined the amount of LAM deposition in skin biopsies of paucibacillary
and multibacillary patients. We found LAM deposited in both paucibacillary and
multibacillary skin lesions (Figure 5 B, C). Control skin were negative for LAM
deposition (Figure 5A). Quantification of the stainings showed that skin lesions of
multibacillary patients have a significantly higher amount of LAM deposition
compared to paucibacillary patients (p=<0.001) (Figure 5D).
Figure 5. Representative immunohistochemical stainings of skin sections from Control (A),
paucibacillary (B) and multibacillary (C) patients for LAM (magnification; 100 µm). Quantification of the
4
Complement in leprosy skin lesions
139
Figure 4. Representative immunohistochemical stainings of skin sections from BL (A and B), ENL (C
and D) and RR (E and F) for C3d (A, C and E) and MAC (B, D and F) (magnification; 100 µm).
Quantification of the staining (G and H), shows a significant higher amounts of C3d and MAC
deposits in skin lesions of BL compared to RR patients (p=<0.05 and p=<0.01 respectively). In
addition, patients that developed ENL had a higher amount of MAC deposition in the skin compared to
BL patients without a reaction (p=<0.01). Error bars indicate standard error of the mean.
LAM deposition in skin of paucibacillary and multibacillary leprosy patients.
We previously showed that LAM is the dominant activator of complement and
correlates with the amount of MAC deposition in nerve biopsies of leprosy patients.
Here we determined the amount of LAM deposition in skin biopsies of paucibacillary
and multibacillary patients. We found LAM deposited in both paucibacillary and
multibacillary skin lesions (Figure 5 B, C). Control skin were negative for LAM
deposition (Figure 5A). Quantification of the stainings showed that skin lesions of
multibacillary patients have a significantly higher amount of LAM deposition
compared to paucibacillary patients (p=<0.001) (Figure 5D).
Figure 5. Representative immunohistochemical stainings of skin sections from Control (A),
paucibacillary (B) and multibacillary (C) patients for LAM (magnification; 100 µm). Quantification of the
Chapter 4
140
staining (D), shows a significant higher amounts of LAM deposits in skin lesions of multibacillary
compared to paucibacillary patients (p=<0.001). Error bars indicate standard error of the mean.
LAM deposition in skin of patients with RR or ENL reaction.
We also analyzed skin biopsies of reactional patients for LAM deposition.
Interestingly, we found a significantly higher amount of LAM deposition in skin
biopsies of borderline lepromatous patients with ENL or RR compared to borderline
lepromatous patients with no reaction (p=<0.05 and p=<0.05, respectively) (Figure
6A, C, D). There was no significant difference between skin biopsies of borderline
lepromatous patients with ENL and borderline lepromatous patients with RR (Figure
6A, B, D).
Figure 6. Representative immunohistochemical stainings of skin sections from BL (A), ENL (B) and
RR(C) patients for LAM (magnification; 100 µm). Quantification of the staining (D), shows a significant
higher amounts of LAM deposits in skin lesions of RR and ENL compared to BL patients without a
reaction (p=<0.05 and p=<0.05, respectively). No statistical difference was found between ENL and
RR patients in the percentage of LAM deposition in skin lesions. Error bars indicate standard error of
the mean.
Complement deposition is associated with the LAM and bacterial index in skin
lesions.
We have previously shown that there is a correlation between bacterial antigen LAM
and complement deposition in nerve biopsies of leprosy patients [17]. We were
interested in whether there is a link between the amount of bacterial antigens/LAM
and the amount of complement activation in the skin biopsies of paucibacillary and
multibacillary leprosy patients. Here, we tested whether there is a correlation
between the extent of C3d staining and the bacterial index (BI) or LAM staining in
corresponding skin areas.
We found a highly significant positive correlation between the amount of C3d and BI
in leprosy skin lesions (r=0.9612, p<0.0001) (Figure 7A). In line with the finding we
also found that the percentage of MAC positive staining correlated with the BI in the
skin lesions (r=0.9909, p<0.0001) (Figure 7B). We also found a significant
association between LAM and C3d or MAC in the skin biopsies of leprosy patients
(r=0.9578, p< 0.0001 and r=0.8585, p<0.0001 respectively) (Figure 7D and E).
Overall, these data show a strong link between the presence of M. leprae antigens or
more specifically LAM and complement activation products in the skin lesions of
leprosy patients.
4
Complement in leprosy skin lesions
141
staining (D), shows a significant higher amounts of LAM deposits in skin lesions of multibacillary
compared to paucibacillary patients (p=<0.001). Error bars indicate standard error of the mean.
LAM deposition in skin of patients with RR or ENL reaction.
We also analyzed skin biopsies of reactional patients for LAM deposition.
Interestingly, we found a significantly higher amount of LAM deposition in skin
biopsies of borderline lepromatous patients with ENL or RR compared to borderline
lepromatous patients with no reaction (p=<0.05 and p=<0.05, respectively) (Figure
6A, C, D). There was no significant difference between skin biopsies of borderline
lepromatous patients with ENL and borderline lepromatous patients with RR (Figure
6A, B, D).
Figure 6. Representative immunohistochemical stainings of skin sections from BL (A), ENL (B) and
RR(C) patients for LAM (magnification; 100 µm). Quantification of the staining (D), shows a significant
higher amounts of LAM deposits in skin lesions of RR and ENL compared to BL patients without a
reaction (p=<0.05 and p=<0.05, respectively). No statistical difference was found between ENL and
RR patients in the percentage of LAM deposition in skin lesions. Error bars indicate standard error of
the mean.
Complement deposition is associated with the LAM and bacterial index in skin
lesions.
We have previously shown that there is a correlation between bacterial antigen LAM
and complement deposition in nerve biopsies of leprosy patients [17]. We were
interested in whether there is a link between the amount of bacterial antigens/LAM
and the amount of complement activation in the skin biopsies of paucibacillary and
multibacillary leprosy patients. Here, we tested whether there is a correlation
between the extent of C3d staining and the bacterial index (BI) or LAM staining in
corresponding skin areas.
We found a highly significant positive correlation between the amount of C3d and BI
in leprosy skin lesions (r=0.9612, p<0.0001) (Figure 7A). In line with the finding we
also found that the percentage of MAC positive staining correlated with the BI in the
skin lesions (r=0.9909, p<0.0001) (Figure 7B). We also found a significant
association between LAM and C3d or MAC in the skin biopsies of leprosy patients
(r=0.9578, p< 0.0001 and r=0.8585, p<0.0001 respectively) (Figure 7D and E).
Overall, these data show a strong link between the presence of M. leprae antigens or
more specifically LAM and complement activation products in the skin lesions of
leprosy patients.
Chapter 4
142
Figure 7. Bacterial Index (BI) and LAM deposition are associated with C3d and MAC deposition in
skin lesions of leprosy patients. The amount of C3d (a,c) and C9 (b,d) immunoreactivity significantly
correlated with the BI and LAM deposition in skin of paucibacillary and multibacillary (Pearson’s
correlation for BI, r=0.99909, p=<0.0001 and r=0.9612, p=<0.0001 respectively) (Pearson’s correlation
for LAM, r=0.9578, p=<0.0001 and r=0,8585, p=<0.0001 respectively), indicating an association
between the M.leprae BI or LAM and complement activation in leprosy skin.
MAC and LAM deposition in skin lesions of treated BL leprosy patients
We also analyzed skin lesions of leprosy patients after completion of treatment.
Interestingly, skin biopsies of a borderline lepromatous patients after treatment also
showed high levels of MAC deposition (Figure 8A). Along with these findings we
found also high levels of LAM deposition in the skin of these patients (Figure 8B).
This data stregthens the findings that MAC is not cleared by the current treatments.
Figure 8. Representative staining pattern with an antibody against for LAM, detecting M.leprae, or
C9, detecting MAC, in skin biopsies of a treated leprosy patients showing M.leprae antigen LAM (A)
as well as MAC (B) persist in the skin after completion of treatment (magnification; 50 µm).
4
Complement in leprosy skin lesions
143
Figure 7. Bacterial Index (BI) and LAM deposition are associated with C3d and MAC deposition in
skin lesions of leprosy patients. The amount of C3d (a,c) and C9 (b,d) immunoreactivity significantly
correlated with the BI and LAM deposition in skin of paucibacillary and multibacillary (Pearson’s
correlation for BI, r=0.99909, p=<0.0001 and r=0.9612, p=<0.0001 respectively) (Pearson’s correlation
for LAM, r=0.9578, p=<0.0001 and r=0,8585, p=<0.0001 respectively), indicating an association
between the M.leprae BI or LAM and complement activation in leprosy skin.
MAC and LAM deposition in skin lesions of treated BL leprosy patients
We also analyzed skin lesions of leprosy patients after completion of treatment.
Interestingly, skin biopsies of a borderline lepromatous patients after treatment also
showed high levels of MAC deposition (Figure 8A). Along with these findings we
found also high levels of LAM deposition in the skin of these patients (Figure 8B).
This data stregthens the findings that MAC is not cleared by the current treatments.
Figure 8. Representative staining pattern with an antibody against for LAM, detecting M.leprae, or
C9, detecting MAC, in skin biopsies of a treated leprosy patients showing M.leprae antigen LAM (A)
as well as MAC (B) persist in the skin after completion of treatment (magnification; 50 µm).
Chapter 4
144
4. Discussion
The aim of this study was to explore whether our previous observation in nerve
biopsies can be applied on the skin lesions of leprosy patients to evaluate the
association of complement activation products and persisting M. leprae antigen LAM
in nerve damaging pathology in leprosy. Consequently, we first determined whether
complement activation products are deposited in skin lesions of leprosy patients
throughout the spectrum in relation to the presence of M. leprae antigen LAM. In
addition, we examined the cellular localization of the complement activation products
and whether the deposition of MAC targets the axons in the skin lesions of leprosy
patients. Furthermore, we evaluated whether MAC together with M. leprae antigen
LAM persists in skin lesions of patients after treatment.
We show that C3d is deposited in the center and around granulomas in skin lesions
of paucibacillary patients whereas MAC deposition was rarely found in these lesions.
However, in paucibacillary patients C3d was found to co-localize with macrophages
and T-cells in skin lesions. We suggest that C3d might play an important role in the
inflammation in skin lesions of paucibacillary patients, through co-engagement of the
T-cell receptor and complement receptor 2 (CR2). CR2 is normally found on the
surface of B cells and is a receptor for C3d. Interestingly it has been shown by
different studies that a population of T-cells also has a CR2 receptor [22-24]. C3d
might bind to CR2 expressed on the surface of T-cells and, by ligand–receptor
interaction result in T-cell stimulation and enhancement of the adaptive immune
response. In the skin lesions of paucibacillary leprosy patients nerves were hardly
detected, probably the nerves are already destroyed by the inflammation, caused by
the reactive T-cells.
In skin lesions of multibacillary patients we show that complement component C3d
and MAC deposition was significantly higher compared to lesions of paucibacillary
patients. Also a significantly higher amount of LAM deposition was detected in the
skin lesions of multibacillary patients, compared to paucibacilly patients. These
findings are in line with what we previously observed in nerve biopsies of leprosy
patients, where we found significantly higher amount of LAM deposition in biopsies of
multibacillary compared to paucibacillary patients and LAM co-localizing with MAC on
the axons [17]. In the same study we showed that MAC could be activated by M.
leprae and its antigen LAM and cause nerve damage in mice, while inhibition of MAC
protects the nerve. Interestingly, MAC co-localized with LAM antigen as well as
nerves in the skin lesions, indicating that LAM might be a trigger for complement
activation involving the axonal component. MAC immunoreactivity extended also to
LAM-negative skin areas. This might suggest that the M. leprae antigen LAM
activates complement in the skin and that activated complement may drift from the
target site to adjacent areas attacking axons [3, 4]. It is generally assumed that the
early damage in leprosy patients predominantly occurs in non-myelinated C- fibers
and not in myelinated fibers. In the skin there are myelinated and non-myelinated
nerves, we suggests that the first hallmark of leprosy, loss of sensory nerves in the
skin, may be due to M. leprae antigen LAM which is involved in focal demyelination
and complement activation. We suggest that the nerve and tissue damage is
attributed to the inflammatory response generated in the surrounding tissue by LAM
and MAC.
The terminal complement components are recently associated with host
inflammatory responses generated by phagocytosis of complement-opsonized
particles involving macrophages [25]. In skin lesions of multibacillary patients, LAM is
4
Complement in leprosy skin lesions
145
4. Discussion
The aim of this study was to explore whether our previous observation in nerve
biopsies can be applied on the skin lesions of leprosy patients to evaluate the
association of complement activation products and persisting M. leprae antigen LAM
in nerve damaging pathology in leprosy. Consequently, we first determined whether
complement activation products are deposited in skin lesions of leprosy patients
throughout the spectrum in relation to the presence of M. leprae antigen LAM. In
addition, we examined the cellular localization of the complement activation products
and whether the deposition of MAC targets the axons in the skin lesions of leprosy
patients. Furthermore, we evaluated whether MAC together with M. leprae antigen
LAM persists in skin lesions of patients after treatment.
We show that C3d is deposited in the center and around granulomas in skin lesions
of paucibacillary patients whereas MAC deposition was rarely found in these lesions.
However, in paucibacillary patients C3d was found to co-localize with macrophages
and T-cells in skin lesions. We suggest that C3d might play an important role in the
inflammation in skin lesions of paucibacillary patients, through co-engagement of the
T-cell receptor and complement receptor 2 (CR2). CR2 is normally found on the
surface of B cells and is a receptor for C3d. Interestingly it has been shown by
different studies that a population of T-cells also has a CR2 receptor [22-24]. C3d
might bind to CR2 expressed on the surface of T-cells and, by ligand–receptor
interaction result in T-cell stimulation and enhancement of the adaptive immune
response. In the skin lesions of paucibacillary leprosy patients nerves were hardly
detected, probably the nerves are already destroyed by the inflammation, caused by
the reactive T-cells.
In skin lesions of multibacillary patients we show that complement component C3d
and MAC deposition was significantly higher compared to lesions of paucibacillary
patients. Also a significantly higher amount of LAM deposition was detected in the
skin lesions of multibacillary patients, compared to paucibacilly patients. These
findings are in line with what we previously observed in nerve biopsies of leprosy
patients, where we found significantly higher amount of LAM deposition in biopsies of
multibacillary compared to paucibacillary patients and LAM co-localizing with MAC on
the axons [17]. In the same study we showed that MAC could be activated by M.
leprae and its antigen LAM and cause nerve damage in mice, while inhibition of MAC
protects the nerve. Interestingly, MAC co-localized with LAM antigen as well as
nerves in the skin lesions, indicating that LAM might be a trigger for complement
activation involving the axonal component. MAC immunoreactivity extended also to
LAM-negative skin areas. This might suggest that the M. leprae antigen LAM
activates complement in the skin and that activated complement may drift from the
target site to adjacent areas attacking axons [3, 4]. It is generally assumed that the
early damage in leprosy patients predominantly occurs in non-myelinated C- fibers
and not in myelinated fibers. In the skin there are myelinated and non-myelinated
nerves, we suggests that the first hallmark of leprosy, loss of sensory nerves in the
skin, may be due to M. leprae antigen LAM which is involved in focal demyelination
and complement activation. We suggest that the nerve and tissue damage is
attributed to the inflammatory response generated in the surrounding tissue by LAM
and MAC.
The terminal complement components are recently associated with host
inflammatory responses generated by phagocytosis of complement-opsonized
particles involving macrophages [25]. In skin lesions of multibacillary patients, LAM is
Chapter 4
146
found abundantly present in macrophages, as seen a previous study [20]. In addition,
C3d and MAC were found also to co-localizing with giant macrophages in these
lesions. It has been suggested that during the process of complement mediated
phagocytosis MAC activates the inflammasome NLRP3 by ‘’jumping’’ from the
surface of complement-opsonized particles to plasma membranes of macrophages
and thereby activating caspase 1 and release of IL1-b and IL-18 [20]. Irrespective of
the mechanism, inflammasome activation plays an important role in the adaptive
immune response including recruiting leukocytes to the site of phagocytosis. This
mechanism might be involved in the skin lesions of multibacillary patients, where
MAC is shown to be on macrophages and might contribute to the nerve damage.
Previous studies have shown that a number of leprosy patients experienced a
reaction, RR or ENL, after the completion of 1 or 2 year of MDT. RR are severe and
of longer duration and are mainly associated with neuritis [26], and occurs mainly in
borderline patients (BT, mid-borderline and BL). Because acute nerve damage
occurs during RR reactions accompanied by and cell-mediated immunity, a role for
the immune system in causing nerve damage during RR has long been suspected
[27].
Here, we show that complement activation products C3d and MAC are deposited in
skin lesions of RR patients. We suggest that both C3d and MAC play an important
role in the nerve damage in the skin. It is likely that C3d co-stimulates auto reactive
T-cells whereas MAC lysis M. leprae infected cells to control the growth of M. leprae
bacilli in the lesions. We suggest that this inflammatory environment amplifies nerve
damage via the release of antigens and continuous activation of complement,
resulting in MAC deposition, which targets the axons.
Leprosy patients with BL and LL forms might experience ENL. During an ENL
reaction, neuritis may occur and cause permanent loss of function of the nerves. The
neuritis may be less aggressive than during a RR, but is still an important problem
during ENL. In ENL patients, it is suggested that inflammatory cytokines are at least
partially responsible for the clinical manifestations [28, 29]. In addition, it is suggested
that antigen antibody complexes are involved in the complement activation occurring
in ENL and thus are involved in complement-mediated inflammation. Interestingly,
skin lesions of ENL patients show an increased amount of MAC deposition compared
to BL patients with no reaction, suggesting a role for complement in reaction patients.
This is in line with a recent study that shows increased immunoreactivity for C1q in
skin lesions of both RR and ENL patients also proving increased activation of
complement in reaction patients [30]. We also found that LAM deposition was also
significantly higher in skin lesions of ENL and RR patients compared to BL patients
with no reaction. We previously showed that there is a correlation between the BI or
LAM and MAC deposition in nerves of leprosy patients [17]. Here, we show that both
the BI and LAM also correlate with C3d and MAC deposition in skin of leprosy
patients indicating a strong link between the presence of M. leprae antigens in skin
and complement activation. Bacterial antigen LAM can be a trigger for complement
activation even after the patients complete treatment. In a previous study, LAM
deposits were detected in lesions of leprosy patients after treatment [20]. We found
an extensive amount of both MAC and LAM deposition in skin lesions of BL patients
after treatment, indicating that treatment does not affect complement activation in the
patients. This data strengthens the findings that LAM is not cleared by the current
treatments. In view of our previous findings that link bacterial antigen LAM with MAC
deposition and that MAC could target the axons, we suggest that complement might
4
Complement in leprosy skin lesions
147
found abundantly present in macrophages, as seen a previous study [20]. In addition,
C3d and MAC were found also to co-localizing with giant macrophages in these
lesions. It has been suggested that during the process of complement mediated
phagocytosis MAC activates the inflammasome NLRP3 by ‘’jumping’’ from the
surface of complement-opsonized particles to plasma membranes of macrophages
and thereby activating caspase 1 and release of IL1-b and IL-18 [20]. Irrespective of
the mechanism, inflammasome activation plays an important role in the adaptive
immune response including recruiting leukocytes to the site of phagocytosis. This
mechanism might be involved in the skin lesions of multibacillary patients, where
MAC is shown to be on macrophages and might contribute to the nerve damage.
Previous studies have shown that a number of leprosy patients experienced a
reaction, RR or ENL, after the completion of 1 or 2 year of MDT. RR are severe and
of longer duration and are mainly associated with neuritis [26], and occurs mainly in
borderline patients (BT, mid-borderline and BL). Because acute nerve damage
occurs during RR reactions accompanied by and cell-mediated immunity, a role for
the immune system in causing nerve damage during RR has long been suspected
[27].
Here, we show that complement activation products C3d and MAC are deposited in
skin lesions of RR patients. We suggest that both C3d and MAC play an important
role in the nerve damage in the skin. It is likely that C3d co-stimulates auto reactive
T-cells whereas MAC lysis M. leprae infected cells to control the growth of M. leprae
bacilli in the lesions. We suggest that this inflammatory environment amplifies nerve
damage via the release of antigens and continuous activation of complement,
resulting in MAC deposition, which targets the axons.
Leprosy patients with BL and LL forms might experience ENL. During an ENL
reaction, neuritis may occur and cause permanent loss of function of the nerves. The
neuritis may be less aggressive than during a RR, but is still an important problem
during ENL. In ENL patients, it is suggested that inflammatory cytokines are at least
partially responsible for the clinical manifestations [28, 29]. In addition, it is suggested
that antigen antibody complexes are involved in the complement activation occurring
in ENL and thus are involved in complement-mediated inflammation. Interestingly,
skin lesions of ENL patients show an increased amount of MAC deposition compared
to BL patients with no reaction, suggesting a role for complement in reaction patients.
This is in line with a recent study that shows increased immunoreactivity for C1q in
skin lesions of both RR and ENL patients also proving increased activation of
complement in reaction patients [30]. We also found that LAM deposition was also
significantly higher in skin lesions of ENL and RR patients compared to BL patients
with no reaction. We previously showed that there is a correlation between the BI or
LAM and MAC deposition in nerves of leprosy patients [17]. Here, we show that both
the BI and LAM also correlate with C3d and MAC deposition in skin of leprosy
patients indicating a strong link between the presence of M. leprae antigens in skin
and complement activation. Bacterial antigen LAM can be a trigger for complement
activation even after the patients complete treatment. In a previous study, LAM
deposits were detected in lesions of leprosy patients after treatment [20]. We found
an extensive amount of both MAC and LAM deposition in skin lesions of BL patients
after treatment, indicating that treatment does not affect complement activation in the
patients. This data strengthens the findings that LAM is not cleared by the current
treatments. In view of our previous findings that link bacterial antigen LAM with MAC
deposition and that MAC could target the axons, we suggest that complement might
Chapter 4
148
play an important role in M. leprae pathology if the antigens are not completely
cleared from tissue after treatment. We suggest that complement mainly gets
activated in tissue of multibacillary and reaction leprosy patients via the lectin
pathway due to bacterial antigen LAM that triggers this pathway of the complement
system by binding of MBL or ficolins that come from the circulation and results in
MAC deposition on nerves in skin lesions, causing nerve damage.
In summary, complement activation products are found abundantly deposited in skin
lesions of leprosy patients. Skin lesions of multibacillary and reactional leprosy
patients and even after treatment were positive for MAC. We propose the following
model: In multibacillary patients and reactional leprosy patients LAM is the initial
trigger for complement activation and this results in MAC deposition on nerves in skin
lesions, causing nerve damage and inflammation. In paucibacillary patients MAC
deposition is absent to low. However, C3d positive T-cells are found in and around
granulomas in skin lesions, suggesting a possible role for C3d in co-stimulation by
binding CR2 on T-cells resulting in an enhanced immune response.
Our data suggests an important role for complement in M. leprae pathology in the
skin lesions of leprosy patients by either causing nerve damage via MAC deposition
or modulating the adaptive immune response through co-stimulation of T-cells via
C3d. It should be noted that this is a retrospective study; a follow up study, including
the longitudinal analysis of skin biopsies, will be important for a global and definite
conclusion.
Author’s contribution. NBEI performed the experiments, analyzed the data and generated the
figures for the final manuscript; CTS classified the leprosy patients; PR provided the skin biopsies and
validated the data; PKD, FB and VR formulated the project; FB and PKD coordinated the project; AI
advised on the project; NBEI wrote the manuscript.
4
Complement in leprosy skin lesions
149
play an important role in M. leprae pathology if the antigens are not completely
cleared from tissue after treatment. We suggest that complement mainly gets
activated in tissue of multibacillary and reaction leprosy patients via the lectin
pathway due to bacterial antigen LAM that triggers this pathway of the complement
system by binding of MBL or ficolins that come from the circulation and results in
MAC deposition on nerves in skin lesions, causing nerve damage.
In summary, complement activation products are found abundantly deposited in skin
lesions of leprosy patients. Skin lesions of multibacillary and reactional leprosy
patients and even after treatment were positive for MAC. We propose the following
model: In multibacillary patients and reactional leprosy patients LAM is the initial
trigger for complement activation and this results in MAC deposition on nerves in skin
lesions, causing nerve damage and inflammation. In paucibacillary patients MAC
deposition is absent to low. However, C3d positive T-cells are found in and around
granulomas in skin lesions, suggesting a possible role for C3d in co-stimulation by
binding CR2 on T-cells resulting in an enhanced immune response.
Our data suggests an important role for complement in M. leprae pathology in the
skin lesions of leprosy patients by either causing nerve damage via MAC deposition
or modulating the adaptive immune response through co-stimulation of T-cells via
C3d. It should be noted that this is a retrospective study; a follow up study, including
the longitudinal analysis of skin biopsies, will be important for a global and definite
conclusion.
Author’s contribution. NBEI performed the experiments, analyzed the data and generated the
figures for the final manuscript; CTS classified the leprosy patients; PR provided the skin biopsies and
validated the data; PKD, FB and VR formulated the project; FB and PKD coordinated the project; AI
advised on the project; NBEI wrote the manuscript.
Chapter 4
150
References
1. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966 Jul;34(3):255-73.
2. Browne SG. Self-healing leprosy: report on 2749 patients. Lepr Rev 1974 Jun;45(2):104-11.
3. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
4. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
5. Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968 Oct;36(4):400-4.
6. Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969 Nov 1;2(7627):933-5.
7. Malaviya AN, Pasricha A, Pasricha JS, Mehta JS. Significance of serologic abnormalities in lepromatous leprosy. Int J Lepr Other Mycobact Dis 1972 Oct;40(4):361-5.
8. Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am J Trop Med Hyg 1973 Nov;22(6):761-4.
9. Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am J Trop Med Hyg 1974 May;23(3):471-5.
10. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008 Apr;78(4):605-10.
11. Bahia E, I, Hakobyan S, Ramaglia V, et al. Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol 2016 Jan 8.
12. Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK. Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9(4):195-9.
13. Ramaglia V, King RH, Nourallah M, et al. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 2007 Jul 18;27(29):7663-72.
14. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
15. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008 Apr;172(4):1043-52.
16. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
17. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015 Mar 15.
18. Roche PW, Britton WJ, Failbus SS, Neupane KD, Theuvenet WJ. Serological monitoring of the response to chemotherapy in leprosy patients. Int J Lepr Other Mycobact Dis 1993 Mar;61(1):35-43.
19. Lockwood DN, Colston MJ, Khanolkar-Young SR. The detection of Mycobacterium leprae protein and carbohydrate antigens in skin and nerve from leprosy patients with type 1 (reversal) reactions. Am J Trop Med Hyg 2002 Apr;66(4):409-15.
20. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999 Jun;154(6):1793-804.
21. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014 Mar 1;192(5):2339-48.
22. Levy E, Ambrus J, Kahl L, Molina H, Tung K, Holers VM. T lymphocyte expression of complement receptor 2 (CR2/CD21): a role in adhesive cell-cell interactions and dysregulation in a patient with systemic lupus erythematosus (SLE). Clin Exp Immunol 1992 Nov;90(2):235-44.
23. Knopf PM, Rivera DS, Hai SH, McMurry J, Martin W, De Groot AS. Novel function of complement C3d as an autologous helper T-cell target. Immunol Cell Biol 2008 Mar;86(3):221-5.
24. Toapanta FR, Ross TM. Complement-mediated activation of the adaptive immune responses: role of C3d in linking the innate and adaptive immunity. Immunol Res 2006;36(1-3):197-210.
25. Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM. Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 2016 May 1;129(9):1928-39.
26. Balagon MV, Gelber RH, Abalos RM, Cellona RV. Reactions following completion of 1 and 2 year multidrug therapy (MDT). Am J Trop Med Hyg 2010 Sep;83(3):637-44.
27. Modlin RL, Gebhard JF, Taylor CR, Rea TH. In situ characterization of T lymphocyte subsets in the reactional states of leprosy. Clin Exp Immunol 1983 Jul;53(1):17-24.
28. Sarno EN, Grau GE, Vieira LM, Nery JA. Serum levels of tumour necrosis factor-alpha and interleukin-1 beta during leprosy reactional states. Clin Exp Immunol 1991 Apr;84(1):103-8.
29. Khanolkar-Young S, Rayment N, Brickell PM, et al. Tumour necrosis factor-alpha (TNF-alpha) synthesis is associated with the skin and peripheral nerve pathology of leprosy reversal reactions. Clin Exp Immunol 1995 Feb;99(2):196-202.
30. Dupnik KM, Bair TB, Maia AO, et al. Transcriptional Changes That Characterize the Immune Reactions of Leprosy. J Infect Dis 2014 Nov 14.
4
Complement in leprosy skin lesions
151
References
1. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966 Jul;34(3):255-73.
2. Browne SG. Self-healing leprosy: report on 2749 patients. Lepr Rev 1974 Jun;45(2):104-11.
3. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
4. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
5. Saitz EW, Dierks RE, Shepard CC. Complement and the second component of complement in leprosy. Int J Lepr Other Mycobact Dis 1968 Oct;36(4):400-4.
6. Wemambu SN, Turk JL, Waters MF, Rees RJ. Erythema nodosum leprosum: a clinical manifestation of the arthus phenomenon. Lancet 1969 Nov 1;2(7627):933-5.
7. Malaviya AN, Pasricha A, Pasricha JS, Mehta JS. Significance of serologic abnormalities in lepromatous leprosy. Int J Lepr Other Mycobact Dis 1972 Oct;40(4):361-5.
8. Petchclai B, Chutanondh R, Prasongsom S, Hiranras S, Ramasoota T. Complement profile in leprosy. Am J Trop Med Hyg 1973 Nov;22(6):761-4.
9. Gelber RH, Drutz DJ, Epstein WV, Fasal P. Clinical correlates of C1Q-precipitating substances in the sera of patients with leprosy. Am J Trop Med Hyg 1974 May;23(3):471-5.
10. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008 Apr;78(4):605-10.
11. Bahia E, I, Hakobyan S, Ramaglia V, et al. Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol 2016 Jan 8.
12. Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK. Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9(4):195-9.
13. Ramaglia V, King RH, Nourallah M, et al. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 2007 Jul 18;27(29):7663-72.
14. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
15. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008 Apr;172(4):1043-52.
16. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
17. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015 Mar 15.
18. Roche PW, Britton WJ, Failbus SS, Neupane KD, Theuvenet WJ. Serological monitoring of the response to chemotherapy in leprosy patients. Int J Lepr Other Mycobact Dis 1993 Mar;61(1):35-43.
19. Lockwood DN, Colston MJ, Khanolkar-Young SR. The detection of Mycobacterium leprae protein and carbohydrate antigens in skin and nerve from leprosy patients with type 1 (reversal) reactions. Am J Trop Med Hyg 2002 Apr;66(4):409-15.
20. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999 Jun;154(6):1793-804.
21. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014 Mar 1;192(5):2339-48.
22. Levy E, Ambrus J, Kahl L, Molina H, Tung K, Holers VM. T lymphocyte expression of complement receptor 2 (CR2/CD21): a role in adhesive cell-cell interactions and dysregulation in a patient with systemic lupus erythematosus (SLE). Clin Exp Immunol 1992 Nov;90(2):235-44.
23. Knopf PM, Rivera DS, Hai SH, McMurry J, Martin W, De Groot AS. Novel function of complement C3d as an autologous helper T-cell target. Immunol Cell Biol 2008 Mar;86(3):221-5.
24. Toapanta FR, Ross TM. Complement-mediated activation of the adaptive immune responses: role of C3d in linking the innate and adaptive immunity. Immunol Res 2006;36(1-3):197-210.
25. Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM. Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 2016 May 1;129(9):1928-39.
26. Balagon MV, Gelber RH, Abalos RM, Cellona RV. Reactions following completion of 1 and 2 year multidrug therapy (MDT). Am J Trop Med Hyg 2010 Sep;83(3):637-44.
27. Modlin RL, Gebhard JF, Taylor CR, Rea TH. In situ characterization of T lymphocyte subsets in the reactional states of leprosy. Clin Exp Immunol 1983 Jul;53(1):17-24.
28. Sarno EN, Grau GE, Vieira LM, Nery JA. Serum levels of tumour necrosis factor-alpha and interleukin-1 beta during leprosy reactional states. Clin Exp Immunol 1991 Apr;84(1):103-8.
29. Khanolkar-Young S, Rayment N, Brickell PM, et al. Tumour necrosis factor-alpha (TNF-alpha) synthesis is associated with the skin and peripheral nerve pathology of leprosy reversal reactions. Clin Exp Immunol 1995 Feb;99(2):196-202.
30. Dupnik KM, Bair TB, Maia AO, et al. Transcriptional Changes That Characterize the Immune Reactions of Leprosy. J Infect Dis 2014 Nov 14.
Lineke Borstlap. Vrij kort nadat ik met pensioen was gegaan kreeg ik klachten, ik
had veel spierkrampen in mijn hele lichaam en voelde mij behoorlijk moe. Wanneer
je hoort dat je ALS hebt komt er veel op je af en ga je op zoek naar informatie.
Bevestiging gaf gek genoeg ook rust. Het de kinderen vertellen vond ik erg moeilijk.
Aan vrienden vertelde ik dat ik graag films wilde maken voor mijn kleinkinderen, die
nog jong zijn en waarschijnlijk zich later weinig van mij zouden herinneren.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement upregulation and activation on motor neurons
and neuromuscular junction in the SOD1 G93A mouse model of
familial amyotrophic lateral sclerosis
Bianca Heurich1, Nawal Bahia el Idrissi 2, Rossen M Donev1, Susanne Petri 3, Peter
Claus 4, James Neal 5, B. Paul Morgan1, Valeria Ramaglia1,2 Journal of
Neuroimmunology, 2011 March.
1 Department of Infection, Immunity and Biochemistry, School of Medicine, Cardiff, UK; 2
Department of Genome Analysis, Academic Medical Centre, Amsterdam, The Netherlands; 3
Department of Neurology, Hannover Medical School, Germany; 4 Institute of Neuroanatomy,
Hannover Medical School, Germany; 5 Department of Histopathology, School of Medicine,
Cardiff, UK.
Lineke Borstlap. Vrij kort nadat ik met pensioen was gegaan kreeg ik klachten, ik
had veel spierkrampen in mijn hele lichaam en voelde mij behoorlijk moe. Wanneer
je hoort dat je ALS hebt komt er veel op je af en ga je op zoek naar informatie.
Bevestiging gaf gek genoeg ook rust. Het de kinderen vertellen vond ik erg moeilijk.
Aan vrienden vertelde ik dat ik graag films wilde maken voor mijn kleinkinderen, die
nog jong zijn en waarschijnlijk zich later weinig van mij zouden herinneren.
https://www.als.nl/voor-patient/het-verhaal-van/
Lineke Borstlap. Vrij kort nadat ik met pensioen was gegaan kreeg ik klachten, ik
had veel spierkrampen in mijn hele lichaam en voelde mij behoorlijk moe. Wanneer
je hoort dat je ALS hebt komt er veel op je af en ga je op zoek naar informatie.
Bevestiging gaf gek genoeg ook rust. Het de kinderen vertellen vond ik erg moeilijk.
Aan vrienden vertelde ik dat ik graag films wilde maken voor mijn kleinkinderen, die
nog jong zijn en waarschijnlijk zich later weinig van mij zouden herinneren.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement upregulation and activation on motor neurons
and neuromuscular junction in the SOD1 G93A mouse model of
familial amyotrophic lateral sclerosis
Bianca Heurich1, Nawal Bahia el Idrissi 2, Rossen M Donev1, Susanne Petri 3, Peter
Claus 4, James Neal 5, B. Paul Morgan1, Valeria Ramaglia1,2 Journal of
Neuroimmunology, 2011 March.
1 Department of Infection, Immunity and Biochemistry, School of Medicine, Cardiff, UK; 2
Department of Genome Analysis, Academic Medical Centre, Amsterdam, The Netherlands; 3
Department of Neurology, Hannover Medical School, Germany; 4 Institute of Neuroanatomy,
Hannover Medical School, Germany; 5 Department of Histopathology, School of Medicine,
Cardiff, UK.
5
Lineke Borstlap. Vrij kort nadat ik met pensioen was gegaan kreeg ik klachten, ik
had veel spierkrampen in mijn hele lichaam en voelde mij behoorlijk moe. Wanneer
je hoort dat je ALS hebt komt er veel op je af en ga je op zoek naar informatie.
Bevestiging gaf gek genoeg ook rust. Het de kinderen vertellen vond ik erg moeilijk.
Aan vrienden vertelde ik dat ik graag films wilde maken voor mijn kleinkinderen, die
nog jong zijn en waarschijnlijk zich later weinig van mij zouden herinneren.
https://www.als.nl/voor-patient/het-verhaal-van/
Chapter 5
154
Abstract
Complement activation products are elevated in cerebrospinal fluid, spinal cord and
motor cortex of patients with amyotrophic lateral sclerosis (ALS) but are untested in
models. We determined complement expression and activation in the SOD1 G93A
mouse model of familial ALS (fALS). At 126 days, C3 mRNA was upregulated in
spinal cord and C3 protein accumulated in astrocytes and motor neurons. C3
activation products C3b/iC3b were localized exclusively on motor neurons. At the
neuromuscular junction, deposits of C3b/iC3b and C1q were detected at day 47,
before the appearance of clinical symptoms, and remained detectable at
symptomatic stage (126 days). Our findings implicate complement in the denervation
of the muscle endplate by day 47 and destruction of the neuromuscular junction and
spinal neuron loss by day 126 in the SOD1 G93A mouse model of fALS.
Keywords: Amyotrophic lateral sclerosis, Complement, Motor neurons, Neuromuscular junction
1. Introduction
Amyotrophic lateral sclerosis (ALS), the most common adult-onset motor
neuron disease (Pasinelli and Brown, 2006), is characterized by progressive
degeneration of both upperand lower motor neurons, leading to muscle atrophy and
eventually death from respiratory paralysis (Mitchell and Borasio, 2007). With rare
exceptions, the cause of disease is unknown and the mechanism of motor neuron
injury occult. Most ALS cases (90%) are sporadic (sALS) while 10% are familial
(fALS); 15–20% of these are caused by mutations in copper/zinc superoxide
dismutase 1 (SOD1) (Rosen et al., 1993). Transgenic mice expressing the
commonest of these mutations, SOD1 G93A, develop a pathological and
clinical phenotype resembling human ALS (Gurney, 1994a).
Complement (C), a key component of innate immunity, has the capacity to cause
damage to self and is consequently implicated in many diseases (Walport,
2001a and Walport, 2001b). A role for C in the pathogenesis of ALS in humans is
suggested by the presence of C activation products, including C3c, C3d, C4d and
C3dg, in spinal cord and motor cortex, and in elevated concentrations in serum and
CSF (Annunziata and Volpi, 1985, Apostolski et al., 1991, Tsuboi and Yamada,
1994 and Goldknopf et al., 2006). In murine ALS models,upregulation of C1q and C4
in motor neurons (Lobsiger et al., 2007 and Ferraiuolo et al., 2007), and C3
upregulation in the anterior horn areas containing motor neuron degeneration
(Woodruff et al., 2008), are described. Surprisingly, C deposition at
the neuromuscular junction (NMJ) and motor end plate (MEP), principal sites of
degeneration in human and mouse ALS (Fischer et al., 2004), has not been reported.
We examined expression, localization and activation of C3 in spinal cord and MEP,
and C1q deposition at MEP, in the SOD1 G93A mouse model of fALS at
5
Complement in the SOD1G93A mouse
155
Abstract
Complement activation products are elevated in cerebrospinal fluid, spinal cord and
motor cortex of patients with amyotrophic lateral sclerosis (ALS) but are untested in
models. We determined complement expression and activation in the SOD1 G93A
mouse model of familial ALS (fALS). At 126 days, C3 mRNA was upregulated in
spinal cord and C3 protein accumulated in astrocytes and motor neurons. C3
activation products C3b/iC3b were localized exclusively on motor neurons. At the
neuromuscular junction, deposits of C3b/iC3b and C1q were detected at day 47,
before the appearance of clinical symptoms, and remained detectable at
symptomatic stage (126 days). Our findings implicate complement in the denervation
of the muscle endplate by day 47 and destruction of the neuromuscular junction and
spinal neuron loss by day 126 in the SOD1 G93A mouse model of fALS.
Keywords: Amyotrophic lateral sclerosis, Complement, Motor neurons, Neuromuscular junction
1. Introduction
Amyotrophic lateral sclerosis (ALS), the most common adult-onset motor
neuron disease (Pasinelli and Brown, 2006), is characterized by progressive
degeneration of both upperand lower motor neurons, leading to muscle atrophy and
eventually death from respiratory paralysis (Mitchell and Borasio, 2007). With rare
exceptions, the cause of disease is unknown and the mechanism of motor neuron
injury occult. Most ALS cases (90%) are sporadic (sALS) while 10% are familial
(fALS); 15–20% of these are caused by mutations in copper/zinc superoxide
dismutase 1 (SOD1) (Rosen et al., 1993). Transgenic mice expressing the
commonest of these mutations, SOD1 G93A, develop a pathological and
clinical phenotype resembling human ALS (Gurney, 1994a).
Complement (C), a key component of innate immunity, has the capacity to cause
damage to self and is consequently implicated in many diseases (Walport,
2001a and Walport, 2001b). A role for C in the pathogenesis of ALS in humans is
suggested by the presence of C activation products, including C3c, C3d, C4d and
C3dg, in spinal cord and motor cortex, and in elevated concentrations in serum and
CSF (Annunziata and Volpi, 1985, Apostolski et al., 1991, Tsuboi and Yamada,
1994 and Goldknopf et al., 2006). In murine ALS models,upregulation of C1q and C4
in motor neurons (Lobsiger et al., 2007 and Ferraiuolo et al., 2007), and C3
upregulation in the anterior horn areas containing motor neuron degeneration
(Woodruff et al., 2008), are described. Surprisingly, C deposition at
the neuromuscular junction (NMJ) and motor end plate (MEP), principal sites of
degeneration in human and mouse ALS (Fischer et al., 2004), has not been reported.
We examined expression, localization and activation of C3 in spinal cord and MEP,
and C1q deposition at MEP, in the SOD1 G93A mouse model of fALS at
Chapter 5
156
presymptomatic (47 days) and symptomatic (126 days) stages of disease
progression.
2. Materials and methods
2.1. Animals
G93A transgenic familial ALS mice [high copy number; B6SJLTg (SOD1-
G93A)1Gur/J] (Gurney, 1994b) and wildtype (B6SJL) littermates were free of
microbiological infection (FELASA screened). Mice were housed in groups at 20 °C
on 12:12 h light:dark cycle, with free access to food and water. Experimental
protocols complied with national animal care guidelines, licensed by the responsible
authority.
2.2. Tissue processing
SOD1 G93A and wildtype mice were killed at post-natal day 47 (presymptomatic
stage SOD1 G93A n = 5; wildtype n = 5) and post-natal day 126 (symptomatic stage
SOD1 G93A n = 7; wildtype n = 5) by CO2 inhalation. Spinal cord and gastrocnemius
muscle were dissected, post-fixed overnight in 4% paraformaldehyde/PBS at 4 °C,
cryoprotected in 30% sucrose/PBS for 72 h at 4 °C, then embedded in OCT (Sakura,
Zoeterwoude, NL), frozen in liquid nitrogen and stored at − 80 °C until used
for histology. A portion of spinal cord was fresh frozen for RNA analysis.
2.3. Molecular analyses
Total RNA was extracted from spinal cords using GeneElute Mammalian Total RNA
Miniprep kits (Sigma-Aldrich, Dorset, UK). cDNAs were synthesized using
TaqManReverse Transcription reagents (Applied Biosystems, Warrington, UK).
Reactions were run on the Mini Opticon Taqman (Bio-Rad, Hemel Hempstead, UK)
with SYBR GREEN Supermix and primer pairs described in Table 1. C component
copy number was calculated using the comparative Ct (∆∆Ct) method (Donev and
5
Complement in the SOD1G93A mouse
157
presymptomatic (47 days) and symptomatic (126 days) stages of disease
progression.
2. Materials and methods
2.1. Animals
G93A transgenic familial ALS mice [high copy number; B6SJLTg (SOD1-
G93A)1Gur/J] (Gurney, 1994b) and wildtype (B6SJL) littermates were free of
microbiological infection (FELASA screened). Mice were housed in groups at 20 °C
on 12:12 h light:dark cycle, with free access to food and water. Experimental
protocols complied with national animal care guidelines, licensed by the responsible
authority.
2.2. Tissue processing
SOD1 G93A and wildtype mice were killed at post-natal day 47 (presymptomatic
stage SOD1 G93A n = 5; wildtype n = 5) and post-natal day 126 (symptomatic stage
SOD1 G93A n = 7; wildtype n = 5) by CO2 inhalation. Spinal cord and gastrocnemius
muscle were dissected, post-fixed overnight in 4% paraformaldehyde/PBS at 4 °C,
cryoprotected in 30% sucrose/PBS for 72 h at 4 °C, then embedded in OCT (Sakura,
Zoeterwoude, NL), frozen in liquid nitrogen and stored at − 80 °C until used
for histology. A portion of spinal cord was fresh frozen for RNA analysis.
2.3. Molecular analyses
Total RNA was extracted from spinal cords using GeneElute Mammalian Total RNA
Miniprep kits (Sigma-Aldrich, Dorset, UK). cDNAs were synthesized using
TaqManReverse Transcription reagents (Applied Biosystems, Warrington, UK).
Reactions were run on the Mini Opticon Taqman (Bio-Rad, Hemel Hempstead, UK)
with SYBR GREEN Supermix and primer pairs described in Table 1. C component
copy number was calculated using the comparative Ct (∆∆Ct) method (Donev and
Chapter 5
158
Morgan, 2006) with results normalized against β-actin. At least two independent
experiments in triplicate were performed for each cDNA analyzed.
Table 1. Mouse Taqman primer sequences
Target gene Accession no. Primer Sequence 5’-3’
C3 NM_009778 Forward
Reverse
5’-AAGCATCAACACACCCAACA-3’
5’-CTTGAGCTCCATTCGTGACA-3’
fH NM_009888 Forward
Reverse
5’-GCACCCAGGCTACCTACAAA-3’
5’-AGATCCAACTGCCAGCCTAA-3’
Crry NM_013499 Forward
Reverse
5’-CCCATCACAGCTTCCTTCTG-3’
5’-CTTCAGCACTCGTCCAGGTT-3’
DAF NM_010016 Forward
Reverse
5’-CTTGCCTTGAGGATTTAGTATGG-3’
5’-CTAGCCTGTACCCTGGGTTG-3’
2.4. Immunohistochemistry
Transverse sections (7 µm) of lumbar spinal cord were fixed (cold acetone,
10 min),endogenous peroxidases were blocked in 0.03% H2O2/PBS (RT, 20 min),
and non-specific binding sites blocked in 10% normal goat serum (NGS)/PBS (RT,
20 min). Slides were incubated with appropriate primary antibodies (Table 2) diluted
in 1% bovine serum albumin(BSA) (90 min, RT), followed by biotinylated
secondary antibody (Table 2) in 1% BSA (30 min, RT), and peroxidase–
polystreptavidin (Sigma-Aldrich; 20 min RT) diluted 1:400 in 1% BSA. Controls
included irrelevant antibody of identical isotype and omission of primary antibody. To
visualize peroxidase activity, slides were incubated in 3,3-diaminobenzidine
tetrahydrochloride (DAB; Peroxidase Substrate Kit, VectorLabs, Peterborough, UK;
3 min) then counterstained with hematoxylin. Slides were dehydrated in ethanol and
mounted in Pertex (Histolab, Gothenburg, Sweden).
For fluorescent immunostaining, sections were pre-incubated with Image-iT FX
Signal Enhancer (Invitrogen, Renfrew, UK; 0.1 ml, 30 min, RT), then with mouse anti-
NeuN in PBS/BSA , followed by rat anti-C3 antibody (each diluted in 1% BSA,
incubated 60 min, RT). Bound antibody was detected using the mouse-on-mouse
Immunodetection Kit (Vector) according to manufacturer's instructions, followed
sequentially by FITC-labeled polystreptavidin (Sigma-Aldrich; 1:400 in PBS/BSA) and
rhodamine (TRITC)-conjugated goat anti-rat immunoglobulin (Table 2). Slides were
counterstained with Dapi (Sigma; 1:1000 in PBS/BSA) and mounted in anti-fade
medium (Fluor Save™, Calbiochem, Nottingham, UK).
For confocal microscopy, 40 µm muscle sections were permeabilized with 1%
TritonX-100 in PBS and blocked with 5% BSA for 1 h at RT, then incubated with
primary and secondary antibodies (Table 2; each overnight at RT). End-plates were
5
Complement in the SOD1G93A mouse
159
Morgan, 2006) with results normalized against β-actin. At least two independent
experiments in triplicate were performed for each cDNA analyzed.
Table 1. Mouse Taqman primer sequences
Target gene Accession no. Primer Sequence 5’-3’
C3 NM_009778 Forward
Reverse
5’-AAGCATCAACACACCCAACA-3’
5’-CTTGAGCTCCATTCGTGACA-3’
fH NM_009888 Forward
Reverse
5’-GCACCCAGGCTACCTACAAA-3’
5’-AGATCCAACTGCCAGCCTAA-3’
Crry NM_013499 Forward
Reverse
5’-CCCATCACAGCTTCCTTCTG-3’
5’-CTTCAGCACTCGTCCAGGTT-3’
DAF NM_010016 Forward
Reverse
5’-CTTGCCTTGAGGATTTAGTATGG-3’
5’-CTAGCCTGTACCCTGGGTTG-3’
2.4. Immunohistochemistry
Transverse sections (7 µm) of lumbar spinal cord were fixed (cold acetone,
10 min),endogenous peroxidases were blocked in 0.03% H2O2/PBS (RT, 20 min),
and non-specific binding sites blocked in 10% normal goat serum (NGS)/PBS (RT,
20 min). Slides were incubated with appropriate primary antibodies (Table 2) diluted
in 1% bovine serum albumin(BSA) (90 min, RT), followed by biotinylated
secondary antibody (Table 2) in 1% BSA (30 min, RT), and peroxidase–
polystreptavidin (Sigma-Aldrich; 20 min RT) diluted 1:400 in 1% BSA. Controls
included irrelevant antibody of identical isotype and omission of primary antibody. To
visualize peroxidase activity, slides were incubated in 3,3-diaminobenzidine
tetrahydrochloride (DAB; Peroxidase Substrate Kit, VectorLabs, Peterborough, UK;
3 min) then counterstained with hematoxylin. Slides were dehydrated in ethanol and
mounted in Pertex (Histolab, Gothenburg, Sweden).
For fluorescent immunostaining, sections were pre-incubated with Image-iT FX
Signal Enhancer (Invitrogen, Renfrew, UK; 0.1 ml, 30 min, RT), then with mouse anti-
NeuN in PBS/BSA , followed by rat anti-C3 antibody (each diluted in 1% BSA,
incubated 60 min, RT). Bound antibody was detected using the mouse-on-mouse
Immunodetection Kit (Vector) according to manufacturer's instructions, followed
sequentially by FITC-labeled polystreptavidin (Sigma-Aldrich; 1:400 in PBS/BSA) and
rhodamine (TRITC)-conjugated goat anti-rat immunoglobulin (Table 2). Slides were
counterstained with Dapi (Sigma; 1:1000 in PBS/BSA) and mounted in anti-fade
medium (Fluor Save™, Calbiochem, Nottingham, UK).
For confocal microscopy, 40 µm muscle sections were permeabilized with 1%
TritonX-100 in PBS and blocked with 5% BSA for 1 h at RT, then incubated with
primary and secondary antibodies (Table 2; each overnight at RT). End-plates were
Chapter 5
160
labeled with Alexa Fluor® 647-conjugated anti-α-bungarotoxin (Invitrogen; 5 µg/ml in
PBS/BSA, 1 h, RT). Sections were mounted as above and images captured with a
digital camera attached to a light/fluorescent microscope (DM LB2, Leica
Microsystems, Bucks, UK) or from a confocal imaging system (TCS SP2, Leica).
Table 2. Antibodies for immunohistochemistry
Antibody Clone Source Concentration / dilution
Primary antibodies Monoclonal rat anti-mouse C3
11H9
HyCult biotechnology (NL)
2µg/ml
Monoclonal rat anti-mouse iC3b/C3b/C3c
3/26
HyCult biotechnology
200µg/ml
Monoclonal mouse anti-mouse C1q JL-1 HyCult biotechnology
2µg/ml
Monoclonal mouse anti-mouse NeuN A60 Millipore (UK) 2µg/ml Polyclonal rabbit anti-rat/mouse C9
Made in house 2µg/ml
Rabbit polyclonal antiserum cocktail to neurofilaments
Biotrend (UK)
1:80
Secondary antibodies Biotinylated-polyclonal goat anti-rat
Vector labs (UK)
7.5µg/ml
Alexa-Fluor 488®-conjugated goat anti-rat
Invitrogen (UK)
20µg/ml
Alexa-Fluor 488®-conjugated goat anti-mouse
Invitrogen
20µg/ml
Rhodamine (TRITC)-conjugated donkey anti-rabbit
Jackson Immuno Research (UK)
1µg/ml
2.5. Quantitative analysis of immunohistochemistry
Quantitative analysis of C3 immunostaining was performed using Image Pro Plus
6.00 (Media Cybernatics, Wokingham, UK). Four non-consecutive sections of spinal
cord were scored for each animal in each group. Percentage immunoreactive area
per section was scored and expressed as mean ± SD.
2.6. Statistical analysis
Two tailed t test was performed for the analysis of qPCR and
C3 immunoreactivity data. Statistical significance was accepted when p ≤ 0.05.
5
Complement in the SOD1G93A mouse
161
labeled with Alexa Fluor® 647-conjugated anti-α-bungarotoxin (Invitrogen; 5 µg/ml in
PBS/BSA, 1 h, RT). Sections were mounted as above and images captured with a
digital camera attached to a light/fluorescent microscope (DM LB2, Leica
Microsystems, Bucks, UK) or from a confocal imaging system (TCS SP2, Leica).
Table 2. Antibodies for immunohistochemistry
Antibody Clone Source Concentration / dilution
Primary antibodies Monoclonal rat anti-mouse C3
11H9
HyCult biotechnology (NL)
2µg/ml
Monoclonal rat anti-mouse iC3b/C3b/C3c
3/26
HyCult biotechnology
200µg/ml
Monoclonal mouse anti-mouse C1q JL-1 HyCult biotechnology
2µg/ml
Monoclonal mouse anti-mouse NeuN A60 Millipore (UK) 2µg/ml Polyclonal rabbit anti-rat/mouse C9
Made in house 2µg/ml
Rabbit polyclonal antiserum cocktail to neurofilaments
Biotrend (UK)
1:80
Secondary antibodies Biotinylated-polyclonal goat anti-rat
Vector labs (UK)
7.5µg/ml
Alexa-Fluor 488®-conjugated goat anti-rat
Invitrogen (UK)
20µg/ml
Alexa-Fluor 488®-conjugated goat anti-mouse
Invitrogen
20µg/ml
Rhodamine (TRITC)-conjugated donkey anti-rabbit
Jackson Immuno Research (UK)
1µg/ml
2.5. Quantitative analysis of immunohistochemistry
Quantitative analysis of C3 immunostaining was performed using Image Pro Plus
6.00 (Media Cybernatics, Wokingham, UK). Four non-consecutive sections of spinal
cord were scored for each animal in each group. Percentage immunoreactive area
per section was scored and expressed as mean ± SD.
2.6. Statistical analysis
Two tailed t test was performed for the analysis of qPCR and
C3 immunoreactivity data. Statistical significance was accepted when p ≤ 0.05.
Chapter 5
162
3. Results
C component expression is not up-regulated in the spinal cord of
the SOD1 G93A mouse at presymptomatic stage, but is up-regulated in the late
symptomatic stage (Ferraiuolo et al., 2007 and Woodruff et al., 2008). Here we
determined whether C3 up-regulation at symptomatic stage, day 126, was also
paralleled by C3 activation in the spinal cord.
Expression of mRNA encoding C3 and C3 convertase regulators was measured in
spinal cords from 126 days old SOD1 G93A and wildtype mice. C3 mRNA was
elevated 12-fold in SOD1 G93A mice compared to wildtype (p ≤ 0.05), whereas
expression of the C3 convertase regulators CfH, DAF and Crry were not different
(Fig. 1). Abundant C3 proteinimmunoreactivity was detected in SOD1 G93A mice in
neurons and astrocytes in the ventral horn of the spinal cord, while wildtype cord
showed only faint neuronal staining (Fig. 2A-C and I, p < 0.05). Neuronal localization
was confirmed by co-staining with NeuN (Fig. 2D-F). C3 activation product
immunoreactivity, detected with the C3b/iC3b/C3c-specific antibody(clone 3/26), was
observed on ventral horn neurons but not astrocytes in SOD1 G93A spinal cord;
wildtype cord stained only in blood vessels (Fig. 2G and H). Staining for membrane
attack complex (MAC) using a proven anti-mouse C9 antibody, was consistently
negative in all spinal cord sections (not shown).
Figure 1. Complement C3, factor H, DAF and Crry mRNA relative levels in spinal cords of wildtype
(n=5) and SOD1 G93A (n=7) mice at 126 days, showing up-regulation of C3 mRNA in SOD1 G93A
spinal cord compared to wildtypes but no changes in the mRNA levels of fH, DAF and Crry regulators
of the C3 convertase.
5
Complement in the SOD1G93A mouse
163
3. Results
C component expression is not up-regulated in the spinal cord of
the SOD1 G93A mouse at presymptomatic stage, but is up-regulated in the late
symptomatic stage (Ferraiuolo et al., 2007 and Woodruff et al., 2008). Here we
determined whether C3 up-regulation at symptomatic stage, day 126, was also
paralleled by C3 activation in the spinal cord.
Expression of mRNA encoding C3 and C3 convertase regulators was measured in
spinal cords from 126 days old SOD1 G93A and wildtype mice. C3 mRNA was
elevated 12-fold in SOD1 G93A mice compared to wildtype (p ≤ 0.05), whereas
expression of the C3 convertase regulators CfH, DAF and Crry were not different
(Fig. 1). Abundant C3 proteinimmunoreactivity was detected in SOD1 G93A mice in
neurons and astrocytes in the ventral horn of the spinal cord, while wildtype cord
showed only faint neuronal staining (Fig. 2A-C and I, p < 0.05). Neuronal localization
was confirmed by co-staining with NeuN (Fig. 2D-F). C3 activation product
immunoreactivity, detected with the C3b/iC3b/C3c-specific antibody(clone 3/26), was
observed on ventral horn neurons but not astrocytes in SOD1 G93A spinal cord;
wildtype cord stained only in blood vessels (Fig. 2G and H). Staining for membrane
attack complex (MAC) using a proven anti-mouse C9 antibody, was consistently
negative in all spinal cord sections (not shown).
Figure 1. Complement C3, factor H, DAF and Crry mRNA relative levels in spinal cords of wildtype
(n=5) and SOD1 G93A (n=7) mice at 126 days, showing up-regulation of C3 mRNA in SOD1 G93A
spinal cord compared to wildtypes but no changes in the mRNA levels of fH, DAF and Crry regulators
of the C3 convertase.
Chapter 5
164
Figure 2. (A-C) Representative C3 immunostaining of ventral horn of the spinal cord in wildtype (A)
(n=5) and SOD1 G93A (B-C) (n=7) at 126 days, showing trace C3 immunoreactivity in wildtypes
contrasting with abundant C3 immunoreactivity in the SOD1 G93A cord localizing with astrocytes (C,
arrows) and neurons (C, arrowheads). (D-F) Double immunofluorescent staining of NeuN and C3,
showing co-localization in the SOD1 G93A cord at 126 days (D-F, arrows and F, in yellow). Note C3-
positive/NeuN-negative astrocytes. (G,H) Representative C3b/iC3b immunostaining of spinal cord
ventral horn showing blood vessel immunoreactivity in the wildtype (G, arrows head), contrasting with
strong neuronal immunoreactivity in SOD1 G93A at 126 days (H, arrow head). (I) Quantification of C3
immunoreactive area, showing higher level in SOD1 G93A spinal cords compared to wildtypes at 126
days. Data represent mean±SD. Statistical significance is for p≤0.05.
C deposition and activation have never been tested at the NMJ of SOD1 G93A mice.
Therefore we examined the NMJ/MEP of SOD1 G93A mice for C deposition and
activation at the presymptomatic (47 days) and symptomatic (126 days) stages.
NMJ/MEP was detected by double immunofluorescent staining with anti-
neurofilament (detects nerve terminals) and α-bungarotoxin (detects MEP). Confocal
microscopy showed abundant C3b/iC3b immunoreactivity in SOD1 G93A muscle, co-
localized with degenerated MEP at post-natal day 47 (Fig. 3A–H) and 126 (Fig. 3Q–
X); C1q immunoreactivity was present at the MEP (Fig. 3O) and nerve terminals
(Fig. 3O, arrows) at 47 days and still detectable at the MEP edge at 126 days
(Fig. 3AE–AF), implicating classical pathway activation, although IgG deposition was
absent from this site. No MAC staining was detected in SOD1 G93A muscle. In
contrast, wildtypes displayed no C3b/iC3b or C1q or MAC immunoreactivity in
muscle.
5
Complement in the SOD1G93A mouse
165
Figure 2. (A-C) Representative C3 immunostaining of ventral horn of the spinal cord in wildtype (A)
(n=5) and SOD1 G93A (B-C) (n=7) at 126 days, showing trace C3 immunoreactivity in wildtypes
contrasting with abundant C3 immunoreactivity in the SOD1 G93A cord localizing with astrocytes (C,
arrows) and neurons (C, arrowheads). (D-F) Double immunofluorescent staining of NeuN and C3,
showing co-localization in the SOD1 G93A cord at 126 days (D-F, arrows and F, in yellow). Note C3-
positive/NeuN-negative astrocytes. (G,H) Representative C3b/iC3b immunostaining of spinal cord
ventral horn showing blood vessel immunoreactivity in the wildtype (G, arrows head), contrasting with
strong neuronal immunoreactivity in SOD1 G93A at 126 days (H, arrow head). (I) Quantification of C3
immunoreactive area, showing higher level in SOD1 G93A spinal cords compared to wildtypes at 126
days. Data represent mean±SD. Statistical significance is for p≤0.05.
C deposition and activation have never been tested at the NMJ of SOD1 G93A mice.
Therefore we examined the NMJ/MEP of SOD1 G93A mice for C deposition and
activation at the presymptomatic (47 days) and symptomatic (126 days) stages.
NMJ/MEP was detected by double immunofluorescent staining with anti-
neurofilament (detects nerve terminals) and α-bungarotoxin (detects MEP). Confocal
microscopy showed abundant C3b/iC3b immunoreactivity in SOD1 G93A muscle, co-
localized with degenerated MEP at post-natal day 47 (Fig. 3A–H) and 126 (Fig. 3Q–
X); C1q immunoreactivity was present at the MEP (Fig. 3O) and nerve terminals
(Fig. 3O, arrows) at 47 days and still detectable at the MEP edge at 126 days
(Fig. 3AE–AF), implicating classical pathway activation, although IgG deposition was
absent from this site. No MAC staining was detected in SOD1 G93A muscle. In
contrast, wildtypes displayed no C3b/iC3b or C1q or MAC immunoreactivity in
muscle.
Chapter 5
166
Figure 3. Representative confocal microscopy images of the NMJ from wildtype (n=10) and SOD1
G93A mice (n=12) at 47 (A-P) and 126 days (Q-AF), immunostained for C3b/iC3b (A-H; Q-X) and C1q
(I-P; Y-AF), showing deposition of C3b/iC3b (G and W) and C1q (O and AE arrows) on the muscle
end-plate and nerve terminals (O, arrows) in SOD1 G93A mice. The nerve terminal is labelled with
polyclonal antiserum to neurofilaments (A, E, I, M, Q, U, Y, AC in red). The muscle end-plate is
labelled with α-bungarotoxin (B, F, J, N, R, V, Z, AD in magenta).
5
Complement in the SOD1G93A mouse
167
Figure 3. Representative confocal microscopy images of the NMJ from wildtype (n=10) and SOD1
G93A mice (n=12) at 47 (A-P) and 126 days (Q-AF), immunostained for C3b/iC3b (A-H; Q-X) and C1q
(I-P; Y-AF), showing deposition of C3b/iC3b (G and W) and C1q (O and AE arrows) on the muscle
end-plate and nerve terminals (O, arrows) in SOD1 G93A mice. The nerve terminal is labelled with
polyclonal antiserum to neurofilaments (A, E, I, M, Q, U, Y, AC in red). The muscle end-plate is
labelled with α-bungarotoxin (B, F, J, N, R, V, Z, AD in magenta).
Chapter 5
168
4. Discussion
The data show upregulation of C3 mRNA and protein in spinal cord ventral horn
neurons andastrocytes, and C3 activation product deposition restricted to ventral
horn neurons in the 126 days SOD1 G93A fALS model. C3 activation products and
C1q were also deposited on the denervated and degenerated SOD1 G93A MEP at
47 and 126 days.
Motor neuron pathology in the SOD1 G93A mouse begins distally
with denervation of NMJ by day 47, followed by motor axon loss between days 47–
80, and loss of lumbar cord neuronal cell bodies after day 80 (Fischer et al.,
2004). Axons express C components but lack C regulators (de Jonge et al., 2004),
rendering them vulnerable to C attack (Ramaglia et al., 2007). Presynaptic
neurons and perisynaptic Schwann cells are also sensitive to C attack and undergo
C-mediated damage in peripheral neuropathy models (O'Hanlon et al.,
2001 and Halstead et al., 2004). C3 fragment and C1q deposition at the denervated
MEP in SOD1 G93A mice implicate the classical C pathway in degeneration of distal
axons. A novel role for C1q/C3 in selective elimination of synaptic connections during
development was recently described (Stevens et al., 2007). Developmental
elimination of synapses involves tagging by C3 fragments and phagocytosis by
resident macrophages; our data suggest that this process is mimicked at the NMJ in
the SOD1 G93A mouse, leading to synapsedegeneration.
Although C3 biosynthesis was up-regulated in both motor neurons and astrocytes in
SOD1 G93A mice, C3 activation products deposit only on motor neurons, driving
their loss. Neighboring astrocytes resist C3 activation because they abundantly
express C3 convertase regulators (Griffiths et al., 2009), but contribute to neuronal
loss by increasing local synthesis of C components. Both neurons and astrocytes
must express mutant SOD1 for development of ALS pathology (Wang et al.,
2005, Gong et al., 2000 and Pramatarova et al., 2001). If expression of the mutant
SOD1 directly or indirectly drives up-regulation of C component synthesis, then it
may be that local C biosynthesis only breaches the threshold necessary for neuronal
damage when both neurons and astrocytes are involved.
Treatment with C inhibitors protects from early axonal degeneration and facilitates
regeneration and recovery in peripheral nerve injury (Ramaglia et al., 2009). Because
C is deposited and activated at the NMJ before denervation, and axonal loss
precedes motor neuron loss in ALS (Fischer et al., 2004), early intervention with C
inhibitors may protect the NMJ and stop further neuronal degeneration, offering the
prospect of therapy for this currently untreatable disorder.
Acknowledgments. We thank Dr. J. Verhaagen for kindly providing the mouse tissue for this study.
5
Complement in the SOD1G93A mouse
169
4. Discussion
The data show upregulation of C3 mRNA and protein in spinal cord ventral horn
neurons andastrocytes, and C3 activation product deposition restricted to ventral
horn neurons in the 126 days SOD1 G93A fALS model. C3 activation products and
C1q were also deposited on the denervated and degenerated SOD1 G93A MEP at
47 and 126 days.
Motor neuron pathology in the SOD1 G93A mouse begins distally
with denervation of NMJ by day 47, followed by motor axon loss between days 47–
80, and loss of lumbar cord neuronal cell bodies after day 80 (Fischer et al.,
2004). Axons express C components but lack C regulators (de Jonge et al., 2004),
rendering them vulnerable to C attack (Ramaglia et al., 2007). Presynaptic
neurons and perisynaptic Schwann cells are also sensitive to C attack and undergo
C-mediated damage in peripheral neuropathy models (O'Hanlon et al.,
2001 and Halstead et al., 2004). C3 fragment and C1q deposition at the denervated
MEP in SOD1 G93A mice implicate the classical C pathway in degeneration of distal
axons. A novel role for C1q/C3 in selective elimination of synaptic connections during
development was recently described (Stevens et al., 2007). Developmental
elimination of synapses involves tagging by C3 fragments and phagocytosis by
resident macrophages; our data suggest that this process is mimicked at the NMJ in
the SOD1 G93A mouse, leading to synapsedegeneration.
Although C3 biosynthesis was up-regulated in both motor neurons and astrocytes in
SOD1 G93A mice, C3 activation products deposit only on motor neurons, driving
their loss. Neighboring astrocytes resist C3 activation because they abundantly
express C3 convertase regulators (Griffiths et al., 2009), but contribute to neuronal
loss by increasing local synthesis of C components. Both neurons and astrocytes
must express mutant SOD1 for development of ALS pathology (Wang et al.,
2005, Gong et al., 2000 and Pramatarova et al., 2001). If expression of the mutant
SOD1 directly or indirectly drives up-regulation of C component synthesis, then it
may be that local C biosynthesis only breaches the threshold necessary for neuronal
damage when both neurons and astrocytes are involved.
Treatment with C inhibitors protects from early axonal degeneration and facilitates
regeneration and recovery in peripheral nerve injury (Ramaglia et al., 2009). Because
C is deposited and activated at the NMJ before denervation, and axonal loss
precedes motor neuron loss in ALS (Fischer et al., 2004), early intervention with C
inhibitors may protect the NMJ and stop further neuronal degeneration, offering the
prospect of therapy for this currently untreatable disorder.
Acknowledgments. We thank Dr. J. Verhaagen for kindly providing the mouse tissue for this study.
Chapter 5
170
References
Annunziata, P., Volpi, N., 1985. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol. Scand. 72, 61-64.
Apostolski, S., Nikolic, J., Bugarski-Prokopljevic, C., Miletic, V., Pavlovic, S., Filipovic, S., 1991. Serum and CSF immunological findings in ALS. Acta Neurol. Scand. 83, 96-98.
de Jonge, R.R., van Schaik, I.N., Vreijling, J.P., Troost, D., Baas, F., 2004. Expression of complement components in the peripheral nervous system. Hum. Mol. Genet. 13, 295-302.
Donev, R.M., Morgan, B.P., 2006. A quantitative method for comparison of expression of alternatively spliced genes using different primer pairs. J. Biochem. Biophys. Methods 66, 23-31.
Ferraiuolo, L., Heath, P.R., Holden, H., Kasher, P., Kirby, J., Shaw, P.J., 2007. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J. Neurosci. 27, 9201-9219.
Fischer, L.R., Culver, D.G., Tennant, P., Davis, A.A., Wang, M., Castellano-Sanchez, A., Khan, J., Polak, M.A., Glass, J.D., 2004. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp. Neurol. 185, 232-240.
Goldknopf, I.L., Sheta, E.A., Bryson, J., Folsom, B., Wilson, C., Duty, J., Yen, A.A., Appel, S.H., 2006. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem. Biophys. Res. Commun. 342, 1034-1039.
Gong, Y.H., Parsadanian, A.S., Andreeva, A., Snider, W.D., Elliott, J.L., 2000. Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. J. Neurosci. 20, 660-665.
Griffiths, M.R., Neal, J.W., Fontaine, M., Das, T., Gasque, P., 2009. Complement factor H, a marker of self protects against experimental autoimmune encephalomyelitis. J. Immunol. 182, 4368-4377.
Gurney, M.E., 1994a. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.
Gurney, M.E., 1994b. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.
Halstead, S.K., O'Hanlon, G.M., Humphreys, P.D., Morrison, D.B., Morgan, B.P., Todd, A.J., Plomp, J.J., Willison, H.J., 2004. Anti-disialoside antibodies kill perisynaptic Schwann cells and damage motor nerve terminals via membrane attack complex in a murine model of neuropathy. Brain 127, 2109-2123.
Lobsiger, C.S., Boillee, S., Cleveland, D.W., 2007. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc. Natl. Acad. Sci. U. S. A 104, 7319-7326.
Mitchell, J.D., Borasio, G.D., 2007. Amyotrophic lateral sclerosis. Lancet 369, 2031-2041.
O'Hanlon, G.M., Plomp, J.J., Chakrabarti, M., Morrison, I., Wagner, E.R., Goodyear, C.S., Yin, X., Trapp, B.D., Conner, J., Molenaar, P.C., Stewart, S., Rowan, E.G., Willison, H.J., 2001. Anti-GQ1b
ganglioside antibodies mediate complement-dependent destruction of the motor nerve terminal. Brain 124, 893-906.
Pasinelli, P., Brown, R.H., 2006. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat. Rev. Neurosci. 7, 710-723.
Pramatarova, A., Laganiere, J., Roussel, J., Brisebois, K., Rouleau, G.A., 2001. Neuron-specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to motor impairment. J. Neurosci. 21, 3369-3374.
Ramaglia, V., King, R.H., Nourallah, M., Wolterman, R., de Jonge, R., Ramkema, M., Vigar, M.A., van der, W.S., Morgan, B.P., Troost, D., Baas, F., 2007. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J. Neurosci. 27, 7663-7672.
Ramaglia, V., Tannemaat, M.R., de, K.M., Wolterman, R., Vigar, M.A., King, R.H., Morgan, B.P., Baas, F., 2009. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol. Immunol. 47, 302-309.
Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J.P., Deng, H.X., ., 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62.
Stevens, B., Allen, N.J., Vazquez, L.E., Howell, G.R., Christopherson, K.S., Nouri, N., Micheva, K.D., Mehalow, A.K., Huberman, A.D., Stafford, B., Sher, A., Litke, A.M., Lambris, J.D., Smith, S.J., John, S.W., Barres, B.A., 2007. The classical complement cascade mediates CNS synapse elimination. Cell 131, 1164-1178.
Tsuboi, Y., Yamada, T., 1994. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 57, 859-861.
Walport, M.J., 2001a. Complement. First of two parts. N. Engl. J. Med. 344, 1058-1066.
Walport, M.J., 2001b. Complement. Second of two parts. N. Engl. J. Med. 344, 1140-1144.
Wang, J., Ma, J.H., Giffard, R.G., 2005. Overexpression of copper/zinc superoxide dismutase decreases ischemia-like astrocyte injury. Free Radic. Biol. Med. 38, 1112-1118.
Woodruff, T.M., Costantini, K.J., Crane, J.W., Atkin, J.D., Monk, P.N., Taylor, S.M., Noakes, P.G., 2008. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J. Immunol. 181, 8727-8734.
5
Complement in the SOD1G93A mouse
171
References
Annunziata, P., Volpi, N., 1985. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol. Scand. 72, 61-64.
Apostolski, S., Nikolic, J., Bugarski-Prokopljevic, C., Miletic, V., Pavlovic, S., Filipovic, S., 1991. Serum and CSF immunological findings in ALS. Acta Neurol. Scand. 83, 96-98.
de Jonge, R.R., van Schaik, I.N., Vreijling, J.P., Troost, D., Baas, F., 2004. Expression of complement components in the peripheral nervous system. Hum. Mol. Genet. 13, 295-302.
Donev, R.M., Morgan, B.P., 2006. A quantitative method for comparison of expression of alternatively spliced genes using different primer pairs. J. Biochem. Biophys. Methods 66, 23-31.
Ferraiuolo, L., Heath, P.R., Holden, H., Kasher, P., Kirby, J., Shaw, P.J., 2007. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J. Neurosci. 27, 9201-9219.
Fischer, L.R., Culver, D.G., Tennant, P., Davis, A.A., Wang, M., Castellano-Sanchez, A., Khan, J., Polak, M.A., Glass, J.D., 2004. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp. Neurol. 185, 232-240.
Goldknopf, I.L., Sheta, E.A., Bryson, J., Folsom, B., Wilson, C., Duty, J., Yen, A.A., Appel, S.H., 2006. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem. Biophys. Res. Commun. 342, 1034-1039.
Gong, Y.H., Parsadanian, A.S., Andreeva, A., Snider, W.D., Elliott, J.L., 2000. Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. J. Neurosci. 20, 660-665.
Griffiths, M.R., Neal, J.W., Fontaine, M., Das, T., Gasque, P., 2009. Complement factor H, a marker of self protects against experimental autoimmune encephalomyelitis. J. Immunol. 182, 4368-4377.
Gurney, M.E., 1994a. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.
Gurney, M.E., 1994b. Transgenic-mouse model of amyotrophic lateral sclerosis. N. Engl. J. Med. 331, 1721-1722.
Halstead, S.K., O'Hanlon, G.M., Humphreys, P.D., Morrison, D.B., Morgan, B.P., Todd, A.J., Plomp, J.J., Willison, H.J., 2004. Anti-disialoside antibodies kill perisynaptic Schwann cells and damage motor nerve terminals via membrane attack complex in a murine model of neuropathy. Brain 127, 2109-2123.
Lobsiger, C.S., Boillee, S., Cleveland, D.W., 2007. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc. Natl. Acad. Sci. U. S. A 104, 7319-7326.
Mitchell, J.D., Borasio, G.D., 2007. Amyotrophic lateral sclerosis. Lancet 369, 2031-2041.
O'Hanlon, G.M., Plomp, J.J., Chakrabarti, M., Morrison, I., Wagner, E.R., Goodyear, C.S., Yin, X., Trapp, B.D., Conner, J., Molenaar, P.C., Stewart, S., Rowan, E.G., Willison, H.J., 2001. Anti-GQ1b
ganglioside antibodies mediate complement-dependent destruction of the motor nerve terminal. Brain 124, 893-906.
Pasinelli, P., Brown, R.H., 2006. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat. Rev. Neurosci. 7, 710-723.
Pramatarova, A., Laganiere, J., Roussel, J., Brisebois, K., Rouleau, G.A., 2001. Neuron-specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to motor impairment. J. Neurosci. 21, 3369-3374.
Ramaglia, V., King, R.H., Nourallah, M., Wolterman, R., de Jonge, R., Ramkema, M., Vigar, M.A., van der, W.S., Morgan, B.P., Troost, D., Baas, F., 2007. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J. Neurosci. 27, 7663-7672.
Ramaglia, V., Tannemaat, M.R., de, K.M., Wolterman, R., Vigar, M.A., King, R.H., Morgan, B.P., Baas, F., 2009. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol. Immunol. 47, 302-309.
Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J.P., Deng, H.X., ., 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62.
Stevens, B., Allen, N.J., Vazquez, L.E., Howell, G.R., Christopherson, K.S., Nouri, N., Micheva, K.D., Mehalow, A.K., Huberman, A.D., Stafford, B., Sher, A., Litke, A.M., Lambris, J.D., Smith, S.J., John, S.W., Barres, B.A., 2007. The classical complement cascade mediates CNS synapse elimination. Cell 131, 1164-1178.
Tsuboi, Y., Yamada, T., 1994. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J. Neurol. Neurosurg. Psychiatry 57, 859-861.
Walport, M.J., 2001a. Complement. First of two parts. N. Engl. J. Med. 344, 1058-1066.
Walport, M.J., 2001b. Complement. Second of two parts. N. Engl. J. Med. 344, 1140-1144.
Wang, J., Ma, J.H., Giffard, R.G., 2005. Overexpression of copper/zinc superoxide dismutase decreases ischemia-like astrocyte injury. Free Radic. Biol. Med. 38, 1112-1118.
Woodruff, T.M., Costantini, K.J., Crane, J.W., Atkin, J.D., Monk, P.N., Taylor, S.M., Noakes, P.G., 2008. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J. Immunol. 181, 8727-8734.
Robbert Jan Stuit. Het begon bij mij bij mijn linkerhand die niet meer deed wat hij
moest doen. Ik leefde mijn leven in een sneltreinvaart en besteedde in eerste
instantie geen aandacht aan deze klacht. Na een half jaar besloot ik toch naar de
huisarts te gaan. Dan hoor je dat je ALS hebt. ‘Wát gaan we eraan doen?’, vroeg ik.
‘Niets’, wat het antwoord.” Mijn diagnose dwong me tot nadenken over mijn eigen
leven en hoe je dat ingericht hebt. Sinds acht maanden ben ik de vader van Alec.
Mijn vrouw Hiske en ik hebben natuurlijk de afweging gemaakt of je in onze situatie
een gezin wil beginnen. Ook ben ik getest op alle bekende genetische afwijkingen
die verband houden met ALS, want ik zou het niet verantwoord vinden om iets over
te dragen.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement activation at the motor end-plates in Amyotrophic
lateral sclerosis
Nawal Bahia El Idrissi1, Sanne Bosch1, Valeria Ramaglia1, Eleonora Aronica2, Frank
Baas1, Dirk Troost2 Journal of Neuroinflammation, 2016 March.
1 Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, 1105 AZ, The Netherlands.* equal contribution
Robbert Jan Stuit. Het begon bij mij bij mijn linkerhand die niet meer deed wat hij
moest doen. Ik leefde mijn leven in een sneltreinvaart en besteedde in eerste
instantie geen aandacht aan deze klacht. Na een half jaar besloot ik toch naar de
huisarts te gaan. Dan hoor je dat je ALS hebt. ‘Wát gaan we eraan doen?’, vroeg ik.
‘Niets’, wat het antwoord.” Mijn diagnose dwong me tot nadenken over mijn eigen
leven en hoe je dat ingericht hebt. Sinds acht maanden ben ik de vader van Alec.
Mijn vrouw Hiske en ik hebben natuurlijk de afweging gemaakt of je in onze situatie
een gezin wil beginnen. Ook ben ik getest op alle bekende genetische afwijkingen
die verband houden met ALS, want ik zou het niet verantwoord vinden om iets over
te dragen.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement activation at the motor end-plates in Amyotrophic
lateral sclerosis
Nawal Bahia El Idrissi1, Sanne Bosch1, Valeria Ramaglia1, Eleonora Aronica2, Frank
Baas1, Dirk Troost2 Journal of Neuroinflammation, 2016 March.
1 Department of Genome Analysis and 2 Department of Neuropathology, Academic Medical
Center, Amsterdam, 1105 AZ, The Netherlands.* equal contribution
6
Chapter 6
174
Abstract
Background: Amyotrophic lateral sclerosis (ALS) is a fatal progressive
neurodegenerative disease with no available therapy. Components of the innate
immune system are activated in spinal cord and central nervous system of ALS
patients. Studies in the SOD1G93A mouse show deposition of C1q and C3/C3b at the
motor end-plate of before neurological symptoms are apparent, suggesting that
complement activation precedes neurodegeneration in this model. To obtain a better
understanding of the role of complement at the motor end-plates in human ALS
pathology, we analysed post-mortem tissue of ALS donors for complement activation
and its regulators.
Methods: Post-mortem intercostal muscle biopsies were collected at autopsy from
ALS (n=11) and control (n=6) donors. The samples were analysed for C1q,
membrane attack complex (MAC), CD55 and CD59 on the motor end-plates, using
immunofluorescence or immunohistochemistry.
Results: Here, we show that complement activation products and regulators are
deposited on the motor end-plates of ALS patients. C1q co-localized with
neurofilament in the intercostal muscle of ALS donors and was absent in controls
(P=0.001). In addition, C1q was found deposited on the motor end-plates in the
intercostal muscle. MAC was also found deposited on motor end-plates that were
innervated by nerves in intercostal muscle of ALS donors, but not in controls
(P=0.001).
High levels of the regulators CD55 and CD59 were detected at the motor end-plates
of ALS donors, but not in controls, suggesting to an attempt to counteract
complement activation and prevent MAC deposition on the end-plates before they
are lost.
Conclusions: This study provides evidence that complement activation products are
deposited on innervated motor end-plates in the intercostal muscle of ALS donors,
indicating that complement activation may precede end-plate denervation in human
ALS. This study adds to the understanding of ALS pathology in man and identifies
complement as potential modifier of the disease process.
Keywords: Amyotrophic lateral sclerosis, motor end-plates, complement, C1q, MAC, CD55, CD59
6
Complement on motor end-plates in ALS
175
Abstract
Background: Amyotrophic lateral sclerosis (ALS) is a fatal progressive
neurodegenerative disease with no available therapy. Components of the innate
immune system are activated in spinal cord and central nervous system of ALS
patients. Studies in the SOD1G93A mouse show deposition of C1q and C3/C3b at the
motor end-plate of before neurological symptoms are apparent, suggesting that
complement activation precedes neurodegeneration in this model. To obtain a better
understanding of the role of complement at the motor end-plates in human ALS
pathology, we analysed post-mortem tissue of ALS donors for complement activation
and its regulators.
Methods: Post-mortem intercostal muscle biopsies were collected at autopsy from
ALS (n=11) and control (n=6) donors. The samples were analysed for C1q,
membrane attack complex (MAC), CD55 and CD59 on the motor end-plates, using
immunofluorescence or immunohistochemistry.
Results: Here, we show that complement activation products and regulators are
deposited on the motor end-plates of ALS patients. C1q co-localized with
neurofilament in the intercostal muscle of ALS donors and was absent in controls
(P=0.001). In addition, C1q was found deposited on the motor end-plates in the
intercostal muscle. MAC was also found deposited on motor end-plates that were
innervated by nerves in intercostal muscle of ALS donors, but not in controls
(P=0.001).
High levels of the regulators CD55 and CD59 were detected at the motor end-plates
of ALS donors, but not in controls, suggesting to an attempt to counteract
complement activation and prevent MAC deposition on the end-plates before they
are lost.
Conclusions: This study provides evidence that complement activation products are
deposited on innervated motor end-plates in the intercostal muscle of ALS donors,
indicating that complement activation may precede end-plate denervation in human
ALS. This study adds to the understanding of ALS pathology in man and identifies
complement as potential modifier of the disease process.
Keywords: Amyotrophic lateral sclerosis, motor end-plates, complement, C1q, MAC, CD55, CD59
Chapter 6
176
Background
Amyotrophic lateral sclerosis (ALS) is the most common adult-onset motor neuron
disease [1]. It is characterized by progressive loss of both upper and lower motor
neurons, leading to muscle atrophy and eventually death [2]. Most ALS cases (90%)
are sporadic, while 10% are familial. Many genes have been identified for familial
ALS. C9orf72, FUS, TARDBP are the most frequently affected genes. Mutation in the
gene encoding for the copper-zinc superoxide dismutase-1 (SOD-1) is found in about
10 % of familial cases of the disease. The transgenic SOD1G93A rodent model
recapitulates onset and progression of ALS.
The mechanisms leading to ALS are still unclear, both cell autonomous and non-cell
autonomous mechanisms are involved [3-5]. A role of neuroinflammation [6-8] and
early involvement of the neuromuscular junction in the SOD1G93A rodent model has
been suggested [9, 10]. The complement system has been also associated with
neuroinflammation in the ALS rodent model [8, 11]. Complement is a key component
of the innate immunity, but it can cause harm to tissue. Regulators of the
complement system permit elimination of pathogens or dead cells without injuring the
host. When this balance is disrupted, complement activation causes injury to the host
and contributes to pathology in various diseases [12-14].
A role for complement in the pathogenesis of ALS in man is suggested by different
researchers. Elevated concentrations of complement activation products in serum
and cerebrospinal fluid were detected in ALS patients. In spinal cord and motor
cortex of patients with sporadic ALS, mRNA for C1q and C4 and protein levels of
complement proteins C1q, C3 and MAC were elevated [15]. In addition, C1q and C4
were upregulated in motor neurons in murine ALS models, [16, 17], whereas C3 was
upregulated in the anterior horn areas containing motor neuron degeneration [11].
Other studies have also shown upregulation of the major proinflammatory C5a
receptor, during disease progression in mouse motor neurons [18]. SOD1G93A rat
treated with C5aR antagonist displayed a significant extension of survival time and a
reduction in end-stage motor scores, suggesting an important role for complement in
the disease progression [11]. Increased expression of complement components
C1qB, C4, factors B, C3, C5 and a decrease in the expression of the regulators
CD55 (regulator of C3) and CD59a (regulator of MAC) was detected in the lumbar
spinal cord of SOD1G93A mice [19].
We have previously shown that complement activation products C3/C3b and C1q
were present at the motor end-plates of SOD1G93A mice before the appearance of
symptoms and remained detectable at the symptomatic stage, suggesting that
complement activation precedes neurodegeneration and plays an early role in this
model [20]. Early damage at the end-plates is in line with the "dying-back"
mechanism. Retrograde degeneration is detected in ALS patients [21, 22] and in
transgenic SOD1G93A mice retraction of motor axons from their muscle synapse has
been shown to occur before any symptoms of the disease appear in the muscle [23],
suggesting the disease starts at the motor end-plates.
Here, we analyzed whether key complement components and regulators are also
deposited at the motor end-plates in post-mortem intercostal muscle of human ALS
cases. We tested for the presence of complement components C1q, MAC, regulators
CD55 and CD59 in this tissue.
6
Complement on motor end-plates in ALS
177
Background
Amyotrophic lateral sclerosis (ALS) is the most common adult-onset motor neuron
disease [1]. It is characterized by progressive loss of both upper and lower motor
neurons, leading to muscle atrophy and eventually death [2]. Most ALS cases (90%)
are sporadic, while 10% are familial. Many genes have been identified for familial
ALS. C9orf72, FUS, TARDBP are the most frequently affected genes. Mutation in the
gene encoding for the copper-zinc superoxide dismutase-1 (SOD-1) is found in about
10 % of familial cases of the disease. The transgenic SOD1G93A rodent model
recapitulates onset and progression of ALS.
The mechanisms leading to ALS are still unclear, both cell autonomous and non-cell
autonomous mechanisms are involved [3-5]. A role of neuroinflammation [6-8] and
early involvement of the neuromuscular junction in the SOD1G93A rodent model has
been suggested [9, 10]. The complement system has been also associated with
neuroinflammation in the ALS rodent model [8, 11]. Complement is a key component
of the innate immunity, but it can cause harm to tissue. Regulators of the
complement system permit elimination of pathogens or dead cells without injuring the
host. When this balance is disrupted, complement activation causes injury to the host
and contributes to pathology in various diseases [12-14].
A role for complement in the pathogenesis of ALS in man is suggested by different
researchers. Elevated concentrations of complement activation products in serum
and cerebrospinal fluid were detected in ALS patients. In spinal cord and motor
cortex of patients with sporadic ALS, mRNA for C1q and C4 and protein levels of
complement proteins C1q, C3 and MAC were elevated [15]. In addition, C1q and C4
were upregulated in motor neurons in murine ALS models, [16, 17], whereas C3 was
upregulated in the anterior horn areas containing motor neuron degeneration [11].
Other studies have also shown upregulation of the major proinflammatory C5a
receptor, during disease progression in mouse motor neurons [18]. SOD1G93A rat
treated with C5aR antagonist displayed a significant extension of survival time and a
reduction in end-stage motor scores, suggesting an important role for complement in
the disease progression [11]. Increased expression of complement components
C1qB, C4, factors B, C3, C5 and a decrease in the expression of the regulators
CD55 (regulator of C3) and CD59a (regulator of MAC) was detected in the lumbar
spinal cord of SOD1G93A mice [19].
We have previously shown that complement activation products C3/C3b and C1q
were present at the motor end-plates of SOD1G93A mice before the appearance of
symptoms and remained detectable at the symptomatic stage, suggesting that
complement activation precedes neurodegeneration and plays an early role in this
model [20]. Early damage at the end-plates is in line with the "dying-back"
mechanism. Retrograde degeneration is detected in ALS patients [21, 22] and in
transgenic SOD1G93A mice retraction of motor axons from their muscle synapse has
been shown to occur before any symptoms of the disease appear in the muscle [23],
suggesting the disease starts at the motor end-plates.
Here, we analyzed whether key complement components and regulators are also
deposited at the motor end-plates in post-mortem intercostal muscle of human ALS
cases. We tested for the presence of complement components C1q, MAC, regulators
CD55 and CD59 in this tissue.
Chapter 6
178
Methods
Ethics Statements
Tissue was obtained and used in accordance with the Declaration of Helsinki and the
Academic Medical Center Research Code provided by the Medical Ethics
Committee. Informed consent was obtained from all the patients.
Tissue processing human intercostal muscle
Post-mortem intercostal muscle biopsies were collected at autopsy from sex-
matched ALS (n=11) and control (n=6) donors at the Department of neuropathology
of the Academic Medical Center (University of Amsterdam). All cases were reviewed
by a neuropathologist and diagnosed according to the standard histopathological
criteria. None of our patients were on respiratory support. Muscle samples were snap
frozen in liquid nitrogen and stored at -80ºC until processed. Detailed information
about sex, age, and clinical features of ALS and control donors are given in Table 1
and 2. In this study we included material from ALS donors with familial and sporadic
ALS. We used age-matched controls, which did not suffer from neuromuscular or
neurological disease. The tissue was subsequently embedded in Tissue-Tek,
Optimal Cutting Temperature compound (OCT) (Sakura, Zoeterwoude, NL) and cut
using cryostat (Reichert Jung; Leica, Nussloch, Germany); cryosections of 6 µm and
40 µm were cut and stored at -80ºC until immune- and fluorescence stainings were
performed.
Table 1 Demographic and clinical data of ALS donors
Patient nr Gender Age of onset PMD (hrs) Disease duration (yrs) ALS type
1 F 66 6 4,5 Sporadic ALS
2 F 61 unknown 1 Sporadic ALS
3 M 56 10 3,5 Sporadic ALS
4 F 80 unknown 2 Sporadic ALS
5 M 68 unknown 3,5 Familial ALS ♦
6 F 57 9.5 3,5 Sporadic ALS
7 M 62 unknown 4 Sporadic ALS
8 M 72 unknown X Sporadic ALS
9 M 68 unknown 3,5 Sporadic ALS
10 M 54 unknown 1.5 Familial ALS
11 F 58 10 - 11 2 Sporadic ALS
PMD= post-mortem delay. All the cases analysed show classical pathology with motor cell loss and degeneration of the
corticospinal tracts, including P62 and phosphorylated TDP43 inclusions in motor cells,♦ C9ORF repeat
Table 2 Demographic and clinical data control donors
Patient nr Gender Age PMD (hrs)
1 M 69 5 - 6
2 F 65 Unknown
3 F 55 3,5 – 4
4 M 73 11
5 M 62 4 -8
6 F 68 10
6
Complement on motor end-plates in ALS
179
Methods
Ethics Statements
Tissue was obtained and used in accordance with the Declaration of Helsinki and the
Academic Medical Center Research Code provided by the Medical Ethics
Committee. Informed consent was obtained from all the patients.
Tissue processing human intercostal muscle
Post-mortem intercostal muscle biopsies were collected at autopsy from sex-
matched ALS (n=11) and control (n=6) donors at the Department of neuropathology
of the Academic Medical Center (University of Amsterdam). All cases were reviewed
by a neuropathologist and diagnosed according to the standard histopathological
criteria. None of our patients were on respiratory support. Muscle samples were snap
frozen in liquid nitrogen and stored at -80ºC until processed. Detailed information
about sex, age, and clinical features of ALS and control donors are given in Table 1
and 2. In this study we included material from ALS donors with familial and sporadic
ALS. We used age-matched controls, which did not suffer from neuromuscular or
neurological disease. The tissue was subsequently embedded in Tissue-Tek,
Optimal Cutting Temperature compound (OCT) (Sakura, Zoeterwoude, NL) and cut
using cryostat (Reichert Jung; Leica, Nussloch, Germany); cryosections of 6 µm and
40 µm were cut and stored at -80ºC until immune- and fluorescence stainings were
performed.
Table 1 Demographic and clinical data of ALS donors
Patient nr Gender Age of onset PMD (hrs) Disease duration (yrs) ALS type
1 F 66 6 4,5 Sporadic ALS
2 F 61 unknown 1 Sporadic ALS
3 M 56 10 3,5 Sporadic ALS
4 F 80 unknown 2 Sporadic ALS
5 M 68 unknown 3,5 Familial ALS ♦
6 F 57 9.5 3,5 Sporadic ALS
7 M 62 unknown 4 Sporadic ALS
8 M 72 unknown X Sporadic ALS
9 M 68 unknown 3,5 Sporadic ALS
10 M 54 unknown 1.5 Familial ALS
11 F 58 10 - 11 2 Sporadic ALS
PMD= post-mortem delay. All the cases analysed show classical pathology with motor cell loss and degeneration of the
corticospinal tracts, including P62 and phosphorylated TDP43 inclusions in motor cells,♦ C9ORF repeat
Table 2 Demographic and clinical data control donors
Patient nr Gender Age PMD (hrs)
1 M 69 5 - 6
2 F 65 Unknown
3 F 55 3,5 – 4
4 M 73 11
5 M 62 4 -8
6 F 68 10
Chapter 6
180
Nonspecific esterase reaction followed by immunostaining
Fresh frozen sections of 6 µm were tested for the nonspecific esterase (NE) reaction
according to the technique of Lehrer & Ornstein (1959) [24]. After the NE staining,
the sections were fixed for 10 minutes in 4% paraformaldehyde (PFA) and after
washed in PBS. The sections were permeabalized in PBS/0,2% TritonX and blocked
for 1 hour at room temperature (RT) using PBS/ 5% Fetal Calf Serum (FCS) /0,2%
TritonX (blockmix). The primary antibodies anti-C5b-9 for MAC recognizes a neo-
epitope in C9 (aE11 clone, DAKO, Carpinteria, CA), anti-C1q (Dako, F 0254,
Denmark) or anti-DAF (Decay-accelerating factor) (Abcam, Ab20145, Cambridge,
MA, USA) were diluted in Blockmix according to Table 3 and incubated for 1 hour at
room temperature. The sections were washed with PBS 3 times and incubated with
the secondary antibody Powervision poly-AP anti-mouse IgG or poly-AP anti- rabbit
IgG (immunologic, DPVM55A, Netherlands) for 45 minutes. After washing, the
sections were developed with VECTOR Blue Alkaline Phosphatase (AP) Substrate
Kit (SK-5300). The sections were air-dried and mounted using VectaMount (Vector
laboratories, H-5000-60, USA).
Table 3 Primary antibodies and their dilutions
Antigen Species Specificity Type Dilution Art.#/Company
Neurofilament heavy
chain (NF-H)
Rabbit
polyclonal
Anti-
Neurofilament
Anti-
human
1:1000 ab8135/Abcam
MAC (ae11 clone) Mouse
monoclonal
Anti-C5b-9
complex
Anti-
human
1:200 M0777/Dako
FITC-Conjugated C1q
Complement
Polyclonal
Rabbit
Anti-C1q Anti-
human
1:50 F0254/Dako
FITC- Conjugated DAF Mouse-
monoclonal
Anti-CD55 Anti-
human
1:40 555693/BD
pharmigen
CD59 Mouse-
monoclonal
Anti-CD59 Anti-
human
1:50 HM2120/Hycult
C1q Polyclonal
rabbit
Anti-C1q Anti-
human
1:50 F 0254/Dako
FITC- conjugated C3c
Complement
Polyclonal
rabbit
Anti- C3 Anti-
human
1:50 ab4212/Abcam
DAF Mouse-
monoclonal
Anti-CD55 Anti-
human
1:150 Ab20145/Abcam
Synaptophysin Rabbit-
monoclonal
Anti-
Synaptophysin
Anti-
human
1:50 RM-9111-
S/Thermo
scientific
Synaptophysin Mouse-
monoclonal
Anti-
Synaptophysin
Anti-
human
1:200 M0776/Dako
S100b Rabbit
polyclonal
Anti-S100b Anti-
human
1:100 Z0311/Dako
S100b Mouse-
monoclonal
Anti-S100b Anti-
human
1:500 S2532/Sigma
6
Complement on motor end-plates in ALS
181
Nonspecific esterase reaction followed by immunostaining
Fresh frozen sections of 6 µm were tested for the nonspecific esterase (NE) reaction
according to the technique of Lehrer & Ornstein (1959) [24]. After the NE staining,
the sections were fixed for 10 minutes in 4% paraformaldehyde (PFA) and after
washed in PBS. The sections were permeabalized in PBS/0,2% TritonX and blocked
for 1 hour at room temperature (RT) using PBS/ 5% Fetal Calf Serum (FCS) /0,2%
TritonX (blockmix). The primary antibodies anti-C5b-9 for MAC recognizes a neo-
epitope in C9 (aE11 clone, DAKO, Carpinteria, CA), anti-C1q (Dako, F 0254,
Denmark) or anti-DAF (Decay-accelerating factor) (Abcam, Ab20145, Cambridge,
MA, USA) were diluted in Blockmix according to Table 3 and incubated for 1 hour at
room temperature. The sections were washed with PBS 3 times and incubated with
the secondary antibody Powervision poly-AP anti-mouse IgG or poly-AP anti- rabbit
IgG (immunologic, DPVM55A, Netherlands) for 45 minutes. After washing, the
sections were developed with VECTOR Blue Alkaline Phosphatase (AP) Substrate
Kit (SK-5300). The sections were air-dried and mounted using VectaMount (Vector
laboratories, H-5000-60, USA).
Table 3 Primary antibodies and their dilutions
Antigen Species Specificity Type Dilution Art.#/Company
Neurofilament heavy
chain (NF-H)
Rabbit
polyclonal
Anti-
Neurofilament
Anti-
human
1:1000 ab8135/Abcam
MAC (ae11 clone) Mouse
monoclonal
Anti-C5b-9
complex
Anti-
human
1:200 M0777/Dako
FITC-Conjugated C1q
Complement
Polyclonal
Rabbit
Anti-C1q Anti-
human
1:50 F0254/Dako
FITC- Conjugated DAF Mouse-
monoclonal
Anti-CD55 Anti-
human
1:40 555693/BD
pharmigen
CD59 Mouse-
monoclonal
Anti-CD59 Anti-
human
1:50 HM2120/Hycult
C1q Polyclonal
rabbit
Anti-C1q Anti-
human
1:50 F 0254/Dako
FITC- conjugated C3c
Complement
Polyclonal
rabbit
Anti- C3 Anti-
human
1:50 ab4212/Abcam
DAF Mouse-
monoclonal
Anti-CD55 Anti-
human
1:150 Ab20145/Abcam
Synaptophysin Rabbit-
monoclonal
Anti-
Synaptophysin
Anti-
human
1:50 RM-9111-
S/Thermo
scientific
Synaptophysin Mouse-
monoclonal
Anti-
Synaptophysin
Anti-
human
1:200 M0776/Dako
S100b Rabbit
polyclonal
Anti-S100b Anti-
human
1:100 Z0311/Dako
S100b Mouse-
monoclonal
Anti-S100b Anti-
human
1:500 S2532/Sigma
Chapter 6
182
Animals
SOD1G93A transgenic ALS mice [high copy number; B6SJLTg (SOD1-G93A)1Gur/J]
(Gurney, 1994b) and wildtype (B6SJL) littermates were housed in groups at 20 °C on
12:12 h light:dark cycle, with free access to food and water. Experimental protocols
complied with national animal care guidelines, licensed by the responsible authority.
All animals were free of microbiological infection (FELASA screened).
Tissue processing SODG93A and wildtype mice
SOD1G93A and wildtype mice were sacrificed at post-natal day 47 (presymptomatic
stage SOD1G93A n = 4; wildtype n = 4) by CO2 inhalation. Gastrocnemius muscle was
dissected, post-fixed overnight in 4%paraformaldehyde/PBS at 4 °C, cryoprotected in
30% sucrose/PBS for 72 h at 4 °C, embedded in Tissue-TEK OTC, cryosections of
40µm were cut and stored at − 80 °C until used for histology.
Immunofluorescence staining
For immunofluorescence staining of SOD1G93A gastrocnemius muscle and human
intercostal muscle tissue, sections were air-dried and fixed for 10 minutes in 4% PFA
at -20 ºC. Slides were washed in PBS and permeabalized in PBS/0,2% TritonX.
Subsequently, sections were blocked for 1 hour at room temperature (RT) using
PBS/ 5% Fetal FCS /0,2% TritonX (blockmix). Primary antibodies were diluted in
blockmix according to Table 3 and incubated overnight at 4ºC. The following primary
antibodies were used (see table 3 for specifications); anti-neurofilament heavy-chain
(NF-H, Abcam, Cambridge UK) nerves, anti-Synaptophysin detecting the motor
nerve terminal (RM-911-S/Thermo scientific, USA or M0776/Dako, Carpinteria, CA),
anti-S100b recognizing the terminal Schwann cells (Z0311/Dako, Carpinteria, CA or
S2532 /Sigma, USA), anti-C5b-9 for MAC (aE11 clone, Dako, Carpinteria, CA), anti-
C1q-FITC conjugated (DAKO, Denmark), anti-C3c-FITC conjugated recognizing C3c
part of C3 and C3b, anti-DAF-FITC conjugated detecting the regulator of complement
CD55 (BD Pharmingen), anti-CD59 detecting the regulator of MAC (Hycult Biotech).
The sections were washed in PBS and secondary antibodies was applied, diluted
according to Table 4 in blockmix and incubated for two hours at RT. Used secondary
antibodies are anti-mouse FITC (Jackson Immunoresearch, West Grove, PA), anti-
Rabbit and anti-mouse CY3 (Jackson Immunoresearch, West Grove, PA) and anti-
mouse Cy5 (Invitrogen, Germany). After washing off the secondary antibody, α–
Bungratoxin (α–BTX)-Alexa 488 conjugate (α-BTX; Molecular Probes) (1:500), which
binds to post-synaptic acetylcholine receptors on the muscle fibers, was applied for
20 minutes at room temperature to the sections to visualize the end-plates. The
sections then were washed in PBS and air-dried. Vectashield medium (Vector
Laboratories Inc, Burlingame, USA) was used for mounting.
Table 4 Secondary antibodies, dilutions and exitation/emission rate
Fluorochrome Specificity Dilution Art.#/Company Exitation/
Emission
FITC Anti- mouse 1:150 Jackson ImmunoResearch/ 200-542-037 493-519
Cy3 Anti-mouse 1:150 Jackson ImmunoResearch/ 200-162-037 550/570
Cy3 Anti-Rabbit 1:150 Jackson ImmunoResearch/711-165-152 550/570
Cy5 Anti-mouse 1:450 Invitrogen/A10524 649/665
Alexa488-α-
BTX
Snake 1:500 Anti- nicotinic acetylcholinereceptor 495/519
6
Complement on motor end-plates in ALS
183
Animals
SOD1G93A transgenic ALS mice [high copy number; B6SJLTg (SOD1-G93A)1Gur/J]
(Gurney, 1994b) and wildtype (B6SJL) littermates were housed in groups at 20 °C on
12:12 h light:dark cycle, with free access to food and water. Experimental protocols
complied with national animal care guidelines, licensed by the responsible authority.
All animals were free of microbiological infection (FELASA screened).
Tissue processing SODG93A and wildtype mice
SOD1G93A and wildtype mice were sacrificed at post-natal day 47 (presymptomatic
stage SOD1G93A n = 4; wildtype n = 4) by CO2 inhalation. Gastrocnemius muscle was
dissected, post-fixed overnight in 4%paraformaldehyde/PBS at 4 °C, cryoprotected in
30% sucrose/PBS for 72 h at 4 °C, embedded in Tissue-TEK OTC, cryosections of
40µm were cut and stored at − 80 °C until used for histology.
Immunofluorescence staining
For immunofluorescence staining of SOD1G93A gastrocnemius muscle and human
intercostal muscle tissue, sections were air-dried and fixed for 10 minutes in 4% PFA
at -20 ºC. Slides were washed in PBS and permeabalized in PBS/0,2% TritonX.
Subsequently, sections were blocked for 1 hour at room temperature (RT) using
PBS/ 5% Fetal FCS /0,2% TritonX (blockmix). Primary antibodies were diluted in
blockmix according to Table 3 and incubated overnight at 4ºC. The following primary
antibodies were used (see table 3 for specifications); anti-neurofilament heavy-chain
(NF-H, Abcam, Cambridge UK) nerves, anti-Synaptophysin detecting the motor
nerve terminal (RM-911-S/Thermo scientific, USA or M0776/Dako, Carpinteria, CA),
anti-S100b recognizing the terminal Schwann cells (Z0311/Dako, Carpinteria, CA or
S2532 /Sigma, USA), anti-C5b-9 for MAC (aE11 clone, Dako, Carpinteria, CA), anti-
C1q-FITC conjugated (DAKO, Denmark), anti-C3c-FITC conjugated recognizing C3c
part of C3 and C3b, anti-DAF-FITC conjugated detecting the regulator of complement
CD55 (BD Pharmingen), anti-CD59 detecting the regulator of MAC (Hycult Biotech).
The sections were washed in PBS and secondary antibodies was applied, diluted
according to Table 4 in blockmix and incubated for two hours at RT. Used secondary
antibodies are anti-mouse FITC (Jackson Immunoresearch, West Grove, PA), anti-
Rabbit and anti-mouse CY3 (Jackson Immunoresearch, West Grove, PA) and anti-
mouse Cy5 (Invitrogen, Germany). After washing off the secondary antibody, α–
Bungratoxin (α–BTX)-Alexa 488 conjugate (α-BTX; Molecular Probes) (1:500), which
binds to post-synaptic acetylcholine receptors on the muscle fibers, was applied for
20 minutes at room temperature to the sections to visualize the end-plates. The
sections then were washed in PBS and air-dried. Vectashield medium (Vector
Laboratories Inc, Burlingame, USA) was used for mounting.
Table 4 Secondary antibodies, dilutions and exitation/emission rate
Fluorochrome Specificity Dilution Art.#/Company Exitation/
Emission
FITC Anti- mouse 1:150 Jackson ImmunoResearch/ 200-542-037 493-519
Cy3 Anti-mouse 1:150 Jackson ImmunoResearch/ 200-162-037 550/570
Cy3 Anti-Rabbit 1:150 Jackson ImmunoResearch/711-165-152 550/570
Cy5 Anti-mouse 1:450 Invitrogen/A10524 649/665
Alexa488-α-
BTX
Snake 1:500 Anti- nicotinic acetylcholinereceptor 495/519
Chapter 6
184
Microscopy
The 40 µm muscle sections were analyzed for the positivity for Fluorophores Cy3
(550-570 nm), Cy5 (649/665 nm) and alpha-bungeratoxin- Alexa488 (488-520 nm)
using a Leica TCS SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk,
The Netherlands). For each view, Z-stacks (Objective 40x/1.30 Oil; 290µm x 290µm)
of 40 µm thick muscle tissue were made. The images were analyzed using Leica
LCS software (LEICA).
Quantification
For each view, Z-stacks of 40 µm thick muscle were examined and scored on the
total number of immunoreactivity for Alexa488-α-BTX/MAC, Alexa488- α-BTX /CD59
positive end-plates as well as the total number of NF-H staining co-localizing with
specific complement antibodies C1q and CD55 (Table 3). For each muscle sample of
an individual donor 20 non-overlapping microscopic views of 40 µm thick sections
were examined (total volume 6.73 x107 µm3).
Each motor end-plate identified with Alexa488- α-BTX on the surface of a muscle
fiber was counted and the length of the end-plates were measured in both ALS and
control muscle biopsies. The size of end-plates was measured using Leica
application suite X software (LASX software, Microsystems B.V., Rijswijk, The
Netherlands) 3D visualizer, excluding the end-plates that were not completely in the
3D image. The number of immunoreactive area per section was scored and
expressed as standard deviation of the mean (SD).
Statistical analysis
Data analysis was performed using GraphPad Prism version 5.0 (GraphPad
Software Inc, San Diego, CA, USA) statistical package. Student’s t test was
performed for statistical analyses comparing two groups. For comparison of more
than two groups, one-way ANOVA with Bonferroni multiple comparison post-hoc test
was used when the data was normally distributed. For non-normally distributed data
the Kruskal-Wallis test was used. Differences were considered statistically significant
when P ≤ 0.05.
6
Complement on motor end-plates in ALS
185
Microscopy
The 40 µm muscle sections were analyzed for the positivity for Fluorophores Cy3
(550-570 nm), Cy5 (649/665 nm) and alpha-bungeratoxin- Alexa488 (488-520 nm)
using a Leica TCS SP8 X Confocal Microscope (LEICA Microsystems B.V., Rijswijk,
The Netherlands). For each view, Z-stacks (Objective 40x/1.30 Oil; 290µm x 290µm)
of 40 µm thick muscle tissue were made. The images were analyzed using Leica
LCS software (LEICA).
Quantification
For each view, Z-stacks of 40 µm thick muscle were examined and scored on the
total number of immunoreactivity for Alexa488-α-BTX/MAC, Alexa488- α-BTX /CD59
positive end-plates as well as the total number of NF-H staining co-localizing with
specific complement antibodies C1q and CD55 (Table 3). For each muscle sample of
an individual donor 20 non-overlapping microscopic views of 40 µm thick sections
were examined (total volume 6.73 x107 µm3).
Each motor end-plate identified with Alexa488- α-BTX on the surface of a muscle
fiber was counted and the length of the end-plates were measured in both ALS and
control muscle biopsies. The size of end-plates was measured using Leica
application suite X software (LASX software, Microsystems B.V., Rijswijk, The
Netherlands) 3D visualizer, excluding the end-plates that were not completely in the
3D image. The number of immunoreactive area per section was scored and
expressed as standard deviation of the mean (SD).
Statistical analysis
Data analysis was performed using GraphPad Prism version 5.0 (GraphPad
Software Inc, San Diego, CA, USA) statistical package. Student’s t test was
performed for statistical analyses comparing two groups. For comparison of more
than two groups, one-way ANOVA with Bonferroni multiple comparison post-hoc test
was used when the data was normally distributed. For non-normally distributed data
the Kruskal-Wallis test was used. Differences were considered statistically significant
when P ≤ 0.05.
Chapter 6
186
Results
Motor end-plates in ALS intercostal muscle
The size and number of motor end-plates were analyzed in the intercostal muscle of
ALS donors and age and sex matched controls. For analysis of both nerves and
motor end-plates, confocal microscopy was performed on 40 µm thick intercostal
muscle sections of ALS and control donors that were stained for Alexa 448 α-BTX
detecting the motor end-plates and neurofilament heavy chain antibody (NF-H).
Alexa 448 α-BTX positive and negative end-plates were expected in the intercostal
muscle of ALS post-mortem tissue given that the average age of the ALS donors was
64 years and that failure of the respiratory muscle occurs in the end-stage of the
disease in these patients. All control muscles showed co-localization of α-BTX and
NF-H. The BTX-positive end-plates were divided in 2 groups 1) end-plates co-
localizing with NF-H (innervated) (Fig. 1A, B), 2) end-plates that showed no co-
localization with NF-H (denervated) (Fig. 1C).
The average number of α-BTX positive end-plates in the intercostal muscles were 87
in controls and 17 in ALS donors per 20 non-overlapping microscopic views. Thus,
the intercostal muscle of ALS donors showed a significantly lower number of α-BTX
positive motor end-plates (P= 0.0003) (Fig. 1D). The percentage of innervated and
denervated end-plates were 30% and 70% respectively, whereas the control donors
show 100 % innervation. We also analyzed the size of the α-BTX positive end-plates
in the intercostal muscle of two ALS patients and two age-matched controls. The
controls showed a mean of 16,9 µm [SD 4,34) (n=2) and the ALS cases showed a
mean of 11.10 µm [SD 6,44) (P=<0.0001) (n=2) (Fig. 1E). All end-plates in the 20
non-overlapping views were counted.
Fig. 1. Number and size of α-BTX positive end-plates in intercostal muscle of ALS donors. Confocal
microscopic images of motor end-plates from controls (A) and ALS donors (B, C) double-labeled with
α- bungarotoxin (α-BTX, Alexa488) and antibodies against neurofilament (NF-H, CY3). All controls
showed co-localization of NF-H with α-BTX (white arrow). In ALS, both innervated end-plates, (panel
B) and denervated end-plates (panel C) were detected. The number and size of α-BTX positive end-
plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle sections, is shown in panels
(D and E). Both number and size of α-BTX positive end-plates of ALS donors (n=2) is reduced
compared to controls (n=2) (P=0.0003 and P=<0.0001 respectively). Error bar represents standard
deviation of the mean.
6
Complement on motor end-plates in ALS
187
Results
Motor end-plates in ALS intercostal muscle
The size and number of motor end-plates were analyzed in the intercostal muscle of
ALS donors and age and sex matched controls. For analysis of both nerves and
motor end-plates, confocal microscopy was performed on 40 µm thick intercostal
muscle sections of ALS and control donors that were stained for Alexa 448 α-BTX
detecting the motor end-plates and neurofilament heavy chain antibody (NF-H).
Alexa 448 α-BTX positive and negative end-plates were expected in the intercostal
muscle of ALS post-mortem tissue given that the average age of the ALS donors was
64 years and that failure of the respiratory muscle occurs in the end-stage of the
disease in these patients. All control muscles showed co-localization of α-BTX and
NF-H. The BTX-positive end-plates were divided in 2 groups 1) end-plates co-
localizing with NF-H (innervated) (Fig. 1A, B), 2) end-plates that showed no co-
localization with NF-H (denervated) (Fig. 1C).
The average number of α-BTX positive end-plates in the intercostal muscles were 87
in controls and 17 in ALS donors per 20 non-overlapping microscopic views. Thus,
the intercostal muscle of ALS donors showed a significantly lower number of α-BTX
positive motor end-plates (P= 0.0003) (Fig. 1D). The percentage of innervated and
denervated end-plates were 30% and 70% respectively, whereas the control donors
show 100 % innervation. We also analyzed the size of the α-BTX positive end-plates
in the intercostal muscle of two ALS patients and two age-matched controls. The
controls showed a mean of 16,9 µm [SD 4,34) (n=2) and the ALS cases showed a
mean of 11.10 µm [SD 6,44) (P=<0.0001) (n=2) (Fig. 1E). All end-plates in the 20
non-overlapping views were counted.
Fig. 1. Number and size of α-BTX positive end-plates in intercostal muscle of ALS donors. Confocal
microscopic images of motor end-plates from controls (A) and ALS donors (B, C) double-labeled with
α- bungarotoxin (α-BTX, Alexa488) and antibodies against neurofilament (NF-H, CY3). All controls
showed co-localization of NF-H with α-BTX (white arrow). In ALS, both innervated end-plates, (panel
B) and denervated end-plates (panel C) were detected. The number and size of α-BTX positive end-
plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle sections, is shown in panels
(D and E). Both number and size of α-BTX positive end-plates of ALS donors (n=2) is reduced
compared to controls (n=2) (P=0.0003 and P=<0.0001 respectively). Error bar represents standard
deviation of the mean.
Chapter 6
188
C1q deposition on the motor end-plates in the intercostal muscle of ALS
donors
C1q deposits were detected before the appearance of clinical symptoms at the
muscle end-plate of the SOD1G93A mouse model [20]. This suggests that complement
activation is an early event. Here, we tested in an overview experiment whether C1q
deposits are also present in the muscle of ALS donors and if C1q is specifically
deposited on the motor end-plate. Immunofluorescence for NF-H and C1q was
performed on intercostal muscle of control (Fig. 2A, B, C) and ALS (Fig. 2D, E, F)
donors. For each individual, we analyzed 20 non-overlapping Z-stacks in 40 µm thick
sections using confocal microscopy. C1q immunoreactivity was present in the
majority of the intercostal muscle tissue of ALS donors (Fig. 2D, E, F). An average of
14 [control vs ALS P=0.001) of the C1q immunoreactive regions in the intercostal
muscle of ALS donors were co-localizing with NF-H staining (Fig. 2G, black bar). An
additional 20 areas [control versus ALS P=0.001) of the C1q immunoreactivity were
found in the vicinity of NF-H staining (Fig. 2G, grey bar). No C1q immunoreactivity
was detected in the intercostal muscle of age-matched controls (Fig. 2B). The NF-H
immunoreactivity was generally stronger in intercostal muscles of control compared
to ALS donors (data not shown).
To determine whether C1q is deposited on the end-plates we performed a NE
staining on frozen intercostal muscle of control and ALS donors to visualize the end-
plates followed by an immunostaining for C1q. The immunostaining showed an
extensive amount of C1q deposited on and around the end-plates of ALS donors
(Fig. 2I). No C1q deposition was detected in on the end-plates of control donors (Fig.
2H). We also detected C1q on the cellular elements synaptophysin (SYN) and S100b
indicating C1q is also deposited at the motor nerve terminal and terminal schwann
cell in the intercostal muscle of ALS donors (Supplement figure 1B, D- arrows), but
not in controls (Supplement figure 1A, C).
Fig. 2. Confocal microscopic images of intercostal muscle from controls (A, B, C) and ALS donors (D,
E, F) double-labeled with antibodies against neurofilament (NF-H, CY3) and antibodies against
classical pathway component of the complement system C1q (C1q, FITC). C1q deposition was
detected on the nerves as well as near the nerve endings (white asterisks in F) in muscle of ALS
donors but not in controls.(G) Quantification showed C1q positive staining co-localizing with nerves
and in the vicinity of nerve endings (white head arrow pointing to NF-H and asterisk on C1q in F) in
the intercostal muscle of ALS donors, but not in controls (P= 0.001 and P=0.001, respectively). NE
6
Complement on motor end-plates in ALS
189
C1q deposition on the motor end-plates in the intercostal muscle of ALS
donors
C1q deposits were detected before the appearance of clinical symptoms at the
muscle end-plate of the SOD1G93A mouse model [20]. This suggests that complement
activation is an early event. Here, we tested in an overview experiment whether C1q
deposits are also present in the muscle of ALS donors and if C1q is specifically
deposited on the motor end-plate. Immunofluorescence for NF-H and C1q was
performed on intercostal muscle of control (Fig. 2A, B, C) and ALS (Fig. 2D, E, F)
donors. For each individual, we analyzed 20 non-overlapping Z-stacks in 40 µm thick
sections using confocal microscopy. C1q immunoreactivity was present in the
majority of the intercostal muscle tissue of ALS donors (Fig. 2D, E, F). An average of
14 [control vs ALS P=0.001) of the C1q immunoreactive regions in the intercostal
muscle of ALS donors were co-localizing with NF-H staining (Fig. 2G, black bar). An
additional 20 areas [control versus ALS P=0.001) of the C1q immunoreactivity were
found in the vicinity of NF-H staining (Fig. 2G, grey bar). No C1q immunoreactivity
was detected in the intercostal muscle of age-matched controls (Fig. 2B). The NF-H
immunoreactivity was generally stronger in intercostal muscles of control compared
to ALS donors (data not shown).
To determine whether C1q is deposited on the end-plates we performed a NE
staining on frozen intercostal muscle of control and ALS donors to visualize the end-
plates followed by an immunostaining for C1q. The immunostaining showed an
extensive amount of C1q deposited on and around the end-plates of ALS donors
(Fig. 2I). No C1q deposition was detected in on the end-plates of control donors (Fig.
2H). We also detected C1q on the cellular elements synaptophysin (SYN) and S100b
indicating C1q is also deposited at the motor nerve terminal and terminal schwann
cell in the intercostal muscle of ALS donors (Supplement figure 1B, D- arrows), but
not in controls (Supplement figure 1A, C).
Fig. 2. Confocal microscopic images of intercostal muscle from controls (A, B, C) and ALS donors (D,
E, F) double-labeled with antibodies against neurofilament (NF-H, CY3) and antibodies against
classical pathway component of the complement system C1q (C1q, FITC). C1q deposition was
detected on the nerves as well as near the nerve endings (white asterisks in F) in muscle of ALS
donors but not in controls.(G) Quantification showed C1q positive staining co-localizing with nerves
and in the vicinity of nerve endings (white head arrow pointing to NF-H and asterisk on C1q in F) in
the intercostal muscle of ALS donors, but not in controls (P= 0.001 and P=0.001, respectively). NE
Chapter 6
190
staining (dark brown) followed by an immune staining for C1q (blue) showed (I) C1q deposition on the
end-plates of ALS donors (white arrow in I and enlargement of the area as insert) (H) by contrast, no
C1q deposition was found deposited on the motor end-plates in the intercostal muscle of control
donors. Numbers of C1q positive nerve endings in 20 non-overlapping Z-stacks in 40 µm thick
intercostal muscle sections is given on the Y-axis. Error bar represents standard deviation of the
mean. n.d.= not detected.
MAC deposition on the motor end-plates in the intercostal muscle of ALS
donors
To determine whether the terminal pathway of the complement system is also
activated in ALS, we tested for MAC deposition at the motor end-plates. We analyzed
the intercostal muscle of ALS donors. The presence of MAC on innervated or
denervated motor end-plates was measured using immunofluorescence and confocal
microscopy on 40 µm thick sections. We analyzed 20 non-overlapping Z-stacks.
Human intercostal muscle of control (Fig. 3A, B, C, D) and ALS donors (Fig. 3E, F,
G, H) were stained for NF-H, α-BTX detecting end-plates and C9neo epitope, a
component of the terminal complement complex MAC (C5b9). MAC immunoreactivity
was detected on and around nerves and on motor end-plates in ALS patients (Fig.
3E, F, G, H). A strong MAC immunoreactiviy was detected (Fig. 3H- asterisks within
insert) on the end-plates with a weak α-BTX immunoreactivity (Fig. 3H- arrow within
insert). By contrast, a weak MAC immunoreactivity (Fig. 3H- asterisks) was detected
on end-plates with strong α-BTX immunoreactivity (Fig. 3H- arrow) and nerves
innervating the motor end-plate (Fig. 3H- arrow head). We suggest there might be a
highly relevant anti-correlation between MAC and α-BTX immunoreactivity in the
ALS samples. However, the high variability between the biological specimens and
the low number of end-plates detected in these samples make it difficult to draw
a firm conclusions based on the measurement of fluorescence intensities.
No MAC immunoreactivity was detected on or around the end-plates of control
donors (Fig. 3C, D). Quantification showed a mean of 6 innervated [controls vs ALS
donors P=0.01) and 11 denervated [control versus ALS donors P=0.01) MAC positive
motor end-plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle
sections (Fig. 3I).
To determine whether MAC is deposited on the motor end-plates we performed
immunostainings for MAC followed by NE staining on the intercostal muscle of
control (Fig. 3J) and ALS donors (Fig. 3K). We found MAC deposition on the motor
end-plates in the intercostal muscle of ALS donors, but not in controls, suggesting
that the terminal pathway of the complement system is activated on the motor end-
plates. We also detected MAC on the cellular elements synaptophysin (SYN) and
S100b indicating MAC is also deposited at the motor nerve terminal and terminal
schwann cell in the intercostal muscle of ALS donors (Supplement figure 3B, D-
arrows), but not in controls (Supplement figure 3A, C).
6
Complement on motor end-plates in ALS
191
staining (dark brown) followed by an immune staining for C1q (blue) showed (I) C1q deposition on the
end-plates of ALS donors (white arrow in I and enlargement of the area as insert) (H) by contrast, no
C1q deposition was found deposited on the motor end-plates in the intercostal muscle of control
donors. Numbers of C1q positive nerve endings in 20 non-overlapping Z-stacks in 40 µm thick
intercostal muscle sections is given on the Y-axis. Error bar represents standard deviation of the
mean. n.d.= not detected.
MAC deposition on the motor end-plates in the intercostal muscle of ALS
donors
To determine whether the terminal pathway of the complement system is also
activated in ALS, we tested for MAC deposition at the motor end-plates. We analyzed
the intercostal muscle of ALS donors. The presence of MAC on innervated or
denervated motor end-plates was measured using immunofluorescence and confocal
microscopy on 40 µm thick sections. We analyzed 20 non-overlapping Z-stacks.
Human intercostal muscle of control (Fig. 3A, B, C, D) and ALS donors (Fig. 3E, F,
G, H) were stained for NF-H, α-BTX detecting end-plates and C9neo epitope, a
component of the terminal complement complex MAC (C5b9). MAC immunoreactivity
was detected on and around nerves and on motor end-plates in ALS patients (Fig.
3E, F, G, H). A strong MAC immunoreactiviy was detected (Fig. 3H- asterisks within
insert) on the end-plates with a weak α-BTX immunoreactivity (Fig. 3H- arrow within
insert). By contrast, a weak MAC immunoreactivity (Fig. 3H- asterisks) was detected
on end-plates with strong α-BTX immunoreactivity (Fig. 3H- arrow) and nerves
innervating the motor end-plate (Fig. 3H- arrow head). We suggest there might be a
highly relevant anti-correlation between MAC and α-BTX immunoreactivity in the
ALS samples. However, the high variability between the biological specimens and
the low number of end-plates detected in these samples make it difficult to draw
a firm conclusions based on the measurement of fluorescence intensities.
No MAC immunoreactivity was detected on or around the end-plates of control
donors (Fig. 3C, D). Quantification showed a mean of 6 innervated [controls vs ALS
donors P=0.01) and 11 denervated [control versus ALS donors P=0.01) MAC positive
motor end-plates in 20 non-overlapping Z-stacks in 40 µm thick intercostal muscle
sections (Fig. 3I).
To determine whether MAC is deposited on the motor end-plates we performed
immunostainings for MAC followed by NE staining on the intercostal muscle of
control (Fig. 3J) and ALS donors (Fig. 3K). We found MAC deposition on the motor
end-plates in the intercostal muscle of ALS donors, but not in controls, suggesting
that the terminal pathway of the complement system is activated on the motor end-
plates. We also detected MAC on the cellular elements synaptophysin (SYN) and
S100b indicating MAC is also deposited at the motor nerve terminal and terminal
schwann cell in the intercostal muscle of ALS donors (Supplement figure 3B, D-
arrows), but not in controls (Supplement figure 3A, C).
Chapter 6
192
Fig. 3. Representative confocal images of triple-immunofluorescence staining for neurofilament (NF-H,
CY3), motor end-plates with α-BTX (Alexa488) and complement component C5b-9 with MAC (CY5) in
control (A, B, C, D) and ALS intercostal muscle (E, F, G, H), shows presence of MAC (white asterisks
in h and enlarged in the insert) on end-plates (white arrows in h) and around nerves in ALS intercostal
muscle (white arrow head in h), but not in controls (C, D). Quantification showed a significantly higher
percentage of MAC positive innervated end-plates (P=0.001) and denervated end-plates (P=0.001) in
ALS intercostal muscle compared to controls. Numbers of MAC positive end-plates in 20 non-
overlapping Z-stacks in 40 µm thick intercostal muscle sections is given on the Y-axis. Error bar
represents standard deviation of the mean (I). NE staining (dark brown) followed by an immune
staining for MAC (blue) showed (K) MAC deposition deposited on the end-plates of ALS donors (white
arrow in K; enlarged in the insert), (J) but not on end-plates of control donors. n.d.= not detected.
CD55 on the motor end-plates in the intercostal muscle of ALS donors
Regulators such as CD55 and CD59 protect tissues against an attack by the
complement system. The role of these regulators in the pathogenesis in ALS is of
interest. CD55 acts on the membranes of self-cells to circumvent the deposition of
C3b on their surfaces [25]. We found C3/C3b deposition in the intercostal muscle of
ALS donors deposited at the motor nerve terminal and terminal schwann cells
(Supplement figure 2B, D- arrows), but not in controls (Supplement figure 2A, C).
Therefore we analyzed whether CD55 is also deposited in the intercostal muscle ALS
donors. We analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using
confocal microscopy. Human intercostal muscle of control (Fig. 4A, B, C) and ALS
donors (Fig. 4D, E, F) were stained for NF-H and CD55. We identified strong staining
for CD55 on and around nerves in the intercostal muscle of ALS donors (Fig. 4F), but
not in controls (Fig. 4C). Quantification showed a significantly higher percentage of
CD55 positive staining. Not all staining co-localized with NF-H in the intercostal
muscle of ALS donors (Fig. 4G- grey bar).
To determine whether CD55 is deposited on the end-plates, a NE staining on frozen
intercostal muscle of control and ALS donors was performed to visualize the end-
plates followed by immunostaining for CD55. No CD55 deposition was detected on
the end-plates of control donors (Fig. 4C, H), by contrast an extensive amount of
CD55 was found deposited on and around the end-plates of ALS donors (Fig. 4I),
suggesting an increased regulation of the common complement pathway on the end-
plates. We also detected CD55 on the cellular elements synaptophysin (SYN) and
S100b indicating CD55 is also deposited at the motor nerve terminal and terminal
schwann cell in the intercostal muscle of ALS donors (Supplement figure 4B, D-
arrows), but not in controls (Supplement figure 4A, C).
6
Complement on motor end-plates in ALS
193
Fig. 3. Representative confocal images of triple-immunofluorescence staining for neurofilament (NF-H,
CY3), motor end-plates with α-BTX (Alexa488) and complement component C5b-9 with MAC (CY5) in
control (A, B, C, D) and ALS intercostal muscle (E, F, G, H), shows presence of MAC (white asterisks
in h and enlarged in the insert) on end-plates (white arrows in h) and around nerves in ALS intercostal
muscle (white arrow head in h), but not in controls (C, D). Quantification showed a significantly higher
percentage of MAC positive innervated end-plates (P=0.001) and denervated end-plates (P=0.001) in
ALS intercostal muscle compared to controls. Numbers of MAC positive end-plates in 20 non-
overlapping Z-stacks in 40 µm thick intercostal muscle sections is given on the Y-axis. Error bar
represents standard deviation of the mean (I). NE staining (dark brown) followed by an immune
staining for MAC (blue) showed (K) MAC deposition deposited on the end-plates of ALS donors (white
arrow in K; enlarged in the insert), (J) but not on end-plates of control donors. n.d.= not detected.
CD55 on the motor end-plates in the intercostal muscle of ALS donors
Regulators such as CD55 and CD59 protect tissues against an attack by the
complement system. The role of these regulators in the pathogenesis in ALS is of
interest. CD55 acts on the membranes of self-cells to circumvent the deposition of
C3b on their surfaces [25]. We found C3/C3b deposition in the intercostal muscle of
ALS donors deposited at the motor nerve terminal and terminal schwann cells
(Supplement figure 2B, D- arrows), but not in controls (Supplement figure 2A, C).
Therefore we analyzed whether CD55 is also deposited in the intercostal muscle ALS
donors. We analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using
confocal microscopy. Human intercostal muscle of control (Fig. 4A, B, C) and ALS
donors (Fig. 4D, E, F) were stained for NF-H and CD55. We identified strong staining
for CD55 on and around nerves in the intercostal muscle of ALS donors (Fig. 4F), but
not in controls (Fig. 4C). Quantification showed a significantly higher percentage of
CD55 positive staining. Not all staining co-localized with NF-H in the intercostal
muscle of ALS donors (Fig. 4G- grey bar).
To determine whether CD55 is deposited on the end-plates, a NE staining on frozen
intercostal muscle of control and ALS donors was performed to visualize the end-
plates followed by immunostaining for CD55. No CD55 deposition was detected on
the end-plates of control donors (Fig. 4C, H), by contrast an extensive amount of
CD55 was found deposited on and around the end-plates of ALS donors (Fig. 4I),
suggesting an increased regulation of the common complement pathway on the end-
plates. We also detected CD55 on the cellular elements synaptophysin (SYN) and
S100b indicating CD55 is also deposited at the motor nerve terminal and terminal
schwann cell in the intercostal muscle of ALS donors (Supplement figure 4B, D-
arrows), but not in controls (Supplement figure 4A, C).
Chapter 6
194
Fig. 4. Representative confocal double-immunofluorescence for neurofilament (NF-H, CY3) and CD55
detected with anti-DAF (FITC) in control (A, B, C) and ALS (D, E, F) intercostal muscle, shows CD55
deposition in ALS intercostal muscle on and around nerves (white asterisks on CD55 and arrow head
pointing to NF-H in F), but not in control tissue (C). Quantification showed CD55 deposition co-
localizing with nerves or in the vicinity of nerves in the intercostal muscle of ALS donors, but not in
controls (P=0.01 and P=0.0001, respectively) (G). Numbers of CD55 positive end-plates in 20 non-
overlapping Z-stacks in 40 µm thick intercostal muscle sections is given on the Y-axis. Error bar
represents standard deviation of the mean n.d.= not detected. NE staining (dark brown) followed by an
immune staining for CD55 (blue) showing (I) CD55 deposition on the motor end-plates (white arrow in
I) in the intercostal muscle of ALS donors,(H) but no CD55 deposition in controls.
CD59 on the motor end-plates in the intercostal muscle of ALS donor
The glycolipid anchored protein CD59 has a binding site for both C8 and C9 and as
such can prevent formation of MAC [26, 27]. Immunofluorescence staining for NF-H,
α-BTX detecting end-plates and the regulator CD59 was performed on intercostal
muscle of control (Fig. 5A, B, C and D) and ALS (Fig. 5E, F, G and H) donors. We
analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using confocal
microscopy. CD59 was found abundantly present on and around the motor end-
plates in the intercostal muscle of ALS donors (Fig. 5G, H - asterisks), but was
negative in the intercostal muscle of control donors (Fig. 5C, D). Quantification
showed that this difference is significant for both innervated and denervated motor
end-plates of ALS donors (Fig. 5I) [P=0.05, P=0.05 respectively). In addition, we
show that CD59 is also deposited on the motor nerve terminal and terminal schwann
cells in the intercostal muscle of ALS donors (Supplement figure 5B, D- arrows), but
not in controls (Supplement figure 5A, C).
6
Complement on motor end-plates in ALS
195
Fig. 4. Representative confocal double-immunofluorescence for neurofilament (NF-H, CY3) and CD55
detected with anti-DAF (FITC) in control (A, B, C) and ALS (D, E, F) intercostal muscle, shows CD55
deposition in ALS intercostal muscle on and around nerves (white asterisks on CD55 and arrow head
pointing to NF-H in F), but not in control tissue (C). Quantification showed CD55 deposition co-
localizing with nerves or in the vicinity of nerves in the intercostal muscle of ALS donors, but not in
controls (P=0.01 and P=0.0001, respectively) (G). Numbers of CD55 positive end-plates in 20 non-
overlapping Z-stacks in 40 µm thick intercostal muscle sections is given on the Y-axis. Error bar
represents standard deviation of the mean n.d.= not detected. NE staining (dark brown) followed by an
immune staining for CD55 (blue) showing (I) CD55 deposition on the motor end-plates (white arrow in
I) in the intercostal muscle of ALS donors,(H) but no CD55 deposition in controls.
CD59 on the motor end-plates in the intercostal muscle of ALS donor
The glycolipid anchored protein CD59 has a binding site for both C8 and C9 and as
such can prevent formation of MAC [26, 27]. Immunofluorescence staining for NF-H,
α-BTX detecting end-plates and the regulator CD59 was performed on intercostal
muscle of control (Fig. 5A, B, C and D) and ALS (Fig. 5E, F, G and H) donors. We
analyzed 20 non-overlapping Z-stacks in 40 µm thick sections using confocal
microscopy. CD59 was found abundantly present on and around the motor end-
plates in the intercostal muscle of ALS donors (Fig. 5G, H - asterisks), but was
negative in the intercostal muscle of control donors (Fig. 5C, D). Quantification
showed that this difference is significant for both innervated and denervated motor
end-plates of ALS donors (Fig. 5I) [P=0.05, P=0.05 respectively). In addition, we
show that CD59 is also deposited on the motor nerve terminal and terminal schwann
cells in the intercostal muscle of ALS donors (Supplement figure 5B, D- arrows), but
not in controls (Supplement figure 5A, C).
Chapter 6
196
Fig. 5. Representative confocal triple-immunofluorescence for neurofilament (NF-H, CY3), end-plates
detected with α-BTX (Alexa488) and the regulator CD59 (Cy5) in control (A, B, C, D) and ALS (E, F,
G, H) intercostal muscle, showing deposition of CD59 (white asterisks in h, enlarged in insert) in ALS
intercostal muscle tissue on denervated end-plates (white arrow pointing to α-BTX and arrow head
pointing to NF-H in H) , but not in controls. Quantification shows CD59 positive innervated and
denervated motor end-plates in the intercostal muscle of ALS donors, but not in controls (P=0.05 and
P=0.05, respectively). Data represents standard deviation of the mean. n.d. = not detected.
Discussion
Although a role for complement has been found in many neurodegenerative diseases
[28-34], it contribution to disease progression in animal models for ALS is
controversial [35, 36]. We previously provided evidence for an early role of the
complement system in ALS in the SOD1G93A mouse model of familial ALS [20].
Fischer and colleagues suggest that ALS pathology starts at the muscle end-plates
proceeding to the spinal cord and subsequently the brain [23]. In addition, several
physiological and morphological alterations have been reported on the muscle end-
plates from in vivo and ex vivo mouse and rat preparations [37-43].
To obtain a better understanding of the role of complement in human ALS pathology,
we analyzed post-mortem tissue of ALS donors for complement activation and its
regulators. We found a lower number and a decreased size of the α-BTX positive
end-plates in the tissue of ALS donors compared to controls, suggesting that the
end-plates in the intercostal muscle of ALS patients are affected.
In the ALS muscle we found deposition of complement activation products C1q and
C3, but not in controls. C1q and C3 were detected on and around the end-plates, but
also on the nerve terminal and terminal schwann cells. C1q and C3 mRNA and
protein levels were found elevated in spinal cord and motor cortex of patients with
sporadic ALS [15]. In murine ALS models, C1q was also upregulated in motor
neurons [16], whereas C3 is up-regulated in the anterior horn areas containing motor
neuron degeneration. Expression profiling in the mutant SOD1 motor neurons,
showed that C1q genes were upregulated early in the disease. C1q can bind
antibody aggregates and activate the classic complement pathway [11, 17]. This data
suggests a role for C1q and C3 in ALS. However, a study by Lobsiger et al.
6
Complement on motor end-plates in ALS
197
Fig. 5. Representative confocal triple-immunofluorescence for neurofilament (NF-H, CY3), end-plates
detected with α-BTX (Alexa488) and the regulator CD59 (Cy5) in control (A, B, C, D) and ALS (E, F,
G, H) intercostal muscle, showing deposition of CD59 (white asterisks in h, enlarged in insert) in ALS
intercostal muscle tissue on denervated end-plates (white arrow pointing to α-BTX and arrow head
pointing to NF-H in H) , but not in controls. Quantification shows CD59 positive innervated and
denervated motor end-plates in the intercostal muscle of ALS donors, but not in controls (P=0.05 and
P=0.05, respectively). Data represents standard deviation of the mean. n.d. = not detected.
Discussion
Although a role for complement has been found in many neurodegenerative diseases
[28-34], it contribution to disease progression in animal models for ALS is
controversial [35, 36]. We previously provided evidence for an early role of the
complement system in ALS in the SOD1G93A mouse model of familial ALS [20].
Fischer and colleagues suggest that ALS pathology starts at the muscle end-plates
proceeding to the spinal cord and subsequently the brain [23]. In addition, several
physiological and morphological alterations have been reported on the muscle end-
plates from in vivo and ex vivo mouse and rat preparations [37-43].
To obtain a better understanding of the role of complement in human ALS pathology,
we analyzed post-mortem tissue of ALS donors for complement activation and its
regulators. We found a lower number and a decreased size of the α-BTX positive
end-plates in the tissue of ALS donors compared to controls, suggesting that the
end-plates in the intercostal muscle of ALS patients are affected.
In the ALS muscle we found deposition of complement activation products C1q and
C3, but not in controls. C1q and C3 were detected on and around the end-plates, but
also on the nerve terminal and terminal schwann cells. C1q and C3 mRNA and
protein levels were found elevated in spinal cord and motor cortex of patients with
sporadic ALS [15]. In murine ALS models, C1q was also upregulated in motor
neurons [16], whereas C3 is up-regulated in the anterior horn areas containing motor
neuron degeneration. Expression profiling in the mutant SOD1 motor neurons,
showed that C1q genes were upregulated early in the disease. C1q can bind
antibody aggregates and activate the classic complement pathway [11, 17]. This data
suggests a role for C1q and C3 in ALS. However, a study by Lobsiger et al.
Chapter 6
198
demonstrates no significant pathogenic role for C1q and C3 proteins in the SOD1G93A
ALS mice survival, contradicting a possible role for complement in this model [44].
This study however did not analyse downstream pathways, like the extrinsic pathway
of complement which can lead to C5 cleavage and does not need C1q and C3
proteins for activation and MAC formation, which may be the key point at which
complement-mediated neurotoxicity occurs in these ALS models [35, 45].
A role for MAC in the pathology of neurological disorders is suggested, including ALS
[31]. In serum of ALS patients the terminal complement activation products C5a and
MAC are elevated [46]. MAC can damage tissue and target nerves in different
neurodegenerative models [34, 47], suggesting a role for MAC in degeneration.
Furthermore, we show that MAC is deposited on the motor end-plates of SOD1G93A
mouse model on day 47 in the SOD1G93A mouse model, suggesting that MAC
deposition is an early event in this model (Supplement Figure 6). This result is by
contrast to a previous analysis of the SODG93A mice [20]. In that study, no MAC was
detected on the end-plates of the SODG93A mice. We attribute this difference to the
use of another antibody for the detection of C5b9. We used a monoclonal mouse
anti-human C9neo, this antibody gives a specific signal on both frozen human and
mouse sections. It detects C9neo and not C9, therefore it is also more specific to
recognise the C9 within the MAC, whereas the polyclonal mouse anti-rat C9 that was
used previously either gives no staining or a lot of background on frozen sections.
Since we find MAC deposition consistently on end-plates in both human and mouse
muscle, an artefact is excluded.
The present study shows deposition of MAC at the muscle end-plates of ALS donors.
We show strong MAC immunoreactiviy on the end-plates with a weak α-BTX
immunoreactivity in the intercostal muscle of ALS donors. By contrast, a weak MAC
immunoreactivity was detected on end-plates with strong α-BTX immunoreactivity.
This is compatible with a model in which MAC deposition occurs before loss of the
end-plates, in fact MAC could be a contributor to disease progression and end-plate
pathology. In addition, MAC was also found co-localizing with the motor nerve
terminal and terminal Schwann cells.
The propensity of the MAC to “drift” from the site of activation and deposit on other
sites may even result in more damage to the muscle. In general, cells are protected
from complement attack by multiple complement regulators, preventing damage. This
protection can be overwhelmed resulting in damage to tissue and drives inflammation
[48, 49].
CD55 and CD59 restrict complement activation by inhibiting C3/C5 convertase
activities and membrane attack complex formation, respectively. In the actively
immunized experimental autoimmune myasthenia gravis mice deficient in either
CD55 or CD59 a significant increase in complement deposition at the end-plates was
observed and worsened disease outcome associated with increased levels of serum
cytokines was observed [50].
Here we show that also the regulators of the common pathway CD55 and the
terminal pathway CD59, are deposited on the motor end-plates of ALS donors, but
not in controls. In addition, the motor nerve terminal and terminal schwann cells were
also co-localizing with CD55 and CD59. Upregulation of the complement regulators
CD55 and CD59 on the motor end-plates of ALS patients, probably is an attempt to
dampen the high level of complement activation and protect the tissue.
6
Complement on motor end-plates in ALS
199
demonstrates no significant pathogenic role for C1q and C3 proteins in the SOD1G93A
ALS mice survival, contradicting a possible role for complement in this model [44].
This study however did not analyse downstream pathways, like the extrinsic pathway
of complement which can lead to C5 cleavage and does not need C1q and C3
proteins for activation and MAC formation, which may be the key point at which
complement-mediated neurotoxicity occurs in these ALS models [35, 45].
A role for MAC in the pathology of neurological disorders is suggested, including ALS
[31]. In serum of ALS patients the terminal complement activation products C5a and
MAC are elevated [46]. MAC can damage tissue and target nerves in different
neurodegenerative models [34, 47], suggesting a role for MAC in degeneration.
Furthermore, we show that MAC is deposited on the motor end-plates of SOD1G93A
mouse model on day 47 in the SOD1G93A mouse model, suggesting that MAC
deposition is an early event in this model (Supplement Figure 6). This result is by
contrast to a previous analysis of the SODG93A mice [20]. In that study, no MAC was
detected on the end-plates of the SODG93A mice. We attribute this difference to the
use of another antibody for the detection of C5b9. We used a monoclonal mouse
anti-human C9neo, this antibody gives a specific signal on both frozen human and
mouse sections. It detects C9neo and not C9, therefore it is also more specific to
recognise the C9 within the MAC, whereas the polyclonal mouse anti-rat C9 that was
used previously either gives no staining or a lot of background on frozen sections.
Since we find MAC deposition consistently on end-plates in both human and mouse
muscle, an artefact is excluded.
The present study shows deposition of MAC at the muscle end-plates of ALS donors.
We show strong MAC immunoreactiviy on the end-plates with a weak α-BTX
immunoreactivity in the intercostal muscle of ALS donors. By contrast, a weak MAC
immunoreactivity was detected on end-plates with strong α-BTX immunoreactivity.
This is compatible with a model in which MAC deposition occurs before loss of the
end-plates, in fact MAC could be a contributor to disease progression and end-plate
pathology. In addition, MAC was also found co-localizing with the motor nerve
terminal and terminal Schwann cells.
The propensity of the MAC to “drift” from the site of activation and deposit on other
sites may even result in more damage to the muscle. In general, cells are protected
from complement attack by multiple complement regulators, preventing damage. This
protection can be overwhelmed resulting in damage to tissue and drives inflammation
[48, 49].
CD55 and CD59 restrict complement activation by inhibiting C3/C5 convertase
activities and membrane attack complex formation, respectively. In the actively
immunized experimental autoimmune myasthenia gravis mice deficient in either
CD55 or CD59 a significant increase in complement deposition at the end-plates was
observed and worsened disease outcome associated with increased levels of serum
cytokines was observed [50].
Here we show that also the regulators of the common pathway CD55 and the
terminal pathway CD59, are deposited on the motor end-plates of ALS donors, but
not in controls. In addition, the motor nerve terminal and terminal schwann cells were
also co-localizing with CD55 and CD59. Upregulation of the complement regulators
CD55 and CD59 on the motor end-plates of ALS patients, probably is an attempt to
dampen the high level of complement activation and protect the tissue.
Chapter 6
200
Since, we also detected MAC deposition at the motor end-plates of the ALS donors,
the upregulation of CD55 and CD59 is not sufficient to protect the end-plates from
MAC attack.
Conclusions
In summary, we demonstrated that complement activation products C1q and MAC
are deposited on motor end-plates in post-mortem tissue of ALS donors. MAC was
found deposited on motor end-plates that were innervated by nerves, indicating that
complement activation may precede motor-endplate denervation.
Here, we showed that the regulators CD55 and CD59 are also expressed on the
motor end-plates, indicating an attempt to control the activation. This process is
probably not efficient enough because MAC can still be detected on the α-BTX
positive motor end-plates. Since a role for MAC in the pathology of neurological
disorders is suggested [31], detecting complement deposited at the end-plates of
ALS donors, before the end-plates are lost, suggests that complement is an early
event in ALS and might play an important role in the motor end-plate pathology in
ALS. This observation is in line with earlier studies suggesting a "dying-back"
mechanism in ALS, meaning the disease probably starts at the motor end-plates [23].
Although this study was performed using post-mortem intercostal muscle tissue of
ALS patients and there may be some limitations to our conclusions about
complement being involved in motor end-plate degeneration, this study adds to the
understanding of ALS pathology in man.
Authors’ contributions
This work is supported by the NWO Mozaiek grant to NBEI [grant number 017.009.026]. NBEI and SB
performed the experiments; NBEI analyzed the data and generated the figures; EA and DT advised on
the project and provided the material; FB and DT coordinated the project; NBEI, VR and FB
formulated the project; NBEI wrote the manuscript.
Acknowledgements
We thank Prof. Joost Verhaagen for kindly providing us gastrocnemius muscle from wildtype and
SOD1G93A
mice.
6
Complement on motor end-plates in ALS
201
Since, we also detected MAC deposition at the motor end-plates of the ALS donors,
the upregulation of CD55 and CD59 is not sufficient to protect the end-plates from
MAC attack.
Conclusions
In summary, we demonstrated that complement activation products C1q and MAC
are deposited on motor end-plates in post-mortem tissue of ALS donors. MAC was
found deposited on motor end-plates that were innervated by nerves, indicating that
complement activation may precede motor-endplate denervation.
Here, we showed that the regulators CD55 and CD59 are also expressed on the
motor end-plates, indicating an attempt to control the activation. This process is
probably not efficient enough because MAC can still be detected on the α-BTX
positive motor end-plates. Since a role for MAC in the pathology of neurological
disorders is suggested [31], detecting complement deposited at the end-plates of
ALS donors, before the end-plates are lost, suggests that complement is an early
event in ALS and might play an important role in the motor end-plate pathology in
ALS. This observation is in line with earlier studies suggesting a "dying-back"
mechanism in ALS, meaning the disease probably starts at the motor end-plates [23].
Although this study was performed using post-mortem intercostal muscle tissue of
ALS patients and there may be some limitations to our conclusions about
complement being involved in motor end-plate degeneration, this study adds to the
understanding of ALS pathology in man.
Authors’ contributions
This work is supported by the NWO Mozaiek grant to NBEI [grant number 017.009.026]. NBEI and SB
performed the experiments; NBEI analyzed the data and generated the figures; EA and DT advised on
the project and provided the material; FB and DT coordinated the project; NBEI, VR and FB
formulated the project; NBEI wrote the manuscript.
Acknowledgements
We thank Prof. Joost Verhaagen for kindly providing us gastrocnemius muscle from wildtype and
SOD1G93A
mice.
Chapter 6
202
References
1. Pasinelli P, Brown RH. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-23.
2. Mitchell JD, Borasio GD. Amyotrophic lateral sclerosis. Lancet 2007;369:2031-41.
3. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002;35:1067-83.
4. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006;312:1389-92.
5. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007;10:608-14.
6. Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 2004;27:723-49.
7. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008;10:405-43.
8. Woodruff TM, Costantini KJ, Taylor SM, Noakes PG. Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-58.
9. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4:e5390.
10. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009;9:341-6.
11. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008;181:8727-34.
12. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-97.
13. Leslie M. Immunology. The new view of complement. Science 2012;337:1034-7.
14. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012;217:1034-46.
15. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-20.
16. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007;27:9201-19.
17. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007;104:7319-26.
18. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009;210:52-62.
19. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
20. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011;235:104-9.
21. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001;24:564-73.
22. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:136-40.
23. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-40.
24. LEHRER GM, ORNSTEIN L. A diazo coupling method for the electron microscopic localization of cholinesterase. J Biophys Biochem Cytol 1959;6:399-406.
25. Lin F, Fukuoka Y, Spicer A, et al. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies. Immunology 2001;104:215-25.
26. Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP. Control of the complement system. Adv Immunol 1996;61:201-83.
27. Stahel PF, Flierl MA, Morgan BP, et al. Absence of the complement regulatory molecule CD59a leads to exacerbated neuropathology after traumatic brain injury in mice. J Neuroinflammation 2009;6:2.
28. Leinhase I, Holers VM, Thurman JM, et al. Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
29. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-4.
30. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-46.
31. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.
32. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-52.
33. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-9.
34. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014;192:2339-48.
35. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014;111:E3-E4.
6
Complement on motor end-plates in ALS
203
References
1. Pasinelli P, Brown RH. Molecular biology of amyotrophic lateral sclerosis: insights from genetics. Nat Rev Neurosci 2006;7:710-23.
2. Mitchell JD, Borasio GD. Amyotrophic lateral sclerosis. Lancet 2007;369:2031-41.
3. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002;35:1067-83.
4. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006;312:1389-92.
5. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007;10:608-14.
6. Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 2004;27:723-49.
7. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008;10:405-43.
8. Woodruff TM, Costantini KJ, Taylor SM, Noakes PG. Role of complement in motor neuron disease: animal models and therapeutic potential of complement inhibitors. Adv Exp Med Biol 2008;632:143-58.
9. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4:e5390.
10. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009;9:341-6.
11. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008;181:8727-34.
12. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010;11:785-97.
13. Leslie M. Immunology. The new view of complement. Science 2012;337:1034-7.
14. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012;217:1034-46.
15. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011;42:211-20.
16. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007;27:9201-19.
17. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007;104:7319-26.
18. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009;210:52-62.
19. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
20. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011;235:104-9.
21. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001;24:564-73.
22. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004;5:136-40.
23. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004;185:232-40.
24. LEHRER GM, ORNSTEIN L. A diazo coupling method for the electron microscopic localization of cholinesterase. J Biophys Biochem Cytol 1959;6:399-406.
25. Lin F, Fukuoka Y, Spicer A, et al. Tissue distribution of products of the mouse decay-accelerating factor (DAF) genes. Exploitation of a Daf1 knock-out mouse and site-specific monoclonal antibodies. Immunology 2001;104:215-25.
26. Liszewski MK, Farries TC, Lublin DM, Rooney IA, Atkinson JP. Control of the complement system. Adv Immunol 1996;61:201-83.
27. Stahel PF, Flierl MA, Morgan BP, et al. Absence of the complement regulatory molecule CD59a leads to exacerbated neuropathology after traumatic brain injury in mice. J Neuroinflammation 2009;6:2.
28. Leinhase I, Holers VM, Thurman JM, et al. Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
29. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003;23:1070-4.
30. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004;21:1831-46.
31. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007;44:999-1010.
32. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008;172:1043-52.
33. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009;47:302-9.
34. Fluiter K, Opperhuizen AL, Morgan BP, Baas F, Ramaglia V. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain injury in mice. J Immunol 2014;192:2339-48.
35. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014;111:E3-E4.
Chapter 6
204
36. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014;111:E5.
37. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006;26:2661-72.
38. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988;85:7371-4.
39. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992;42:2175-80.
40. Appel SH, Engelhardt JI, Garcia J, Stefani E. Autoimmunity and ALS: a comparison of animal models of immune-mediated motor neuron destruction and human ALS. Adv Neurol 1991;56:405-12.
41. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998;21:81-90.
42. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002;69:110-6.
43. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002;113:1066-71.
44. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013;110:E4385-E4392.
45. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006;12:682-7.
46. Mantovani S, Gordon R, Macmaw JK, et al. Elevation of the terminal complement activation products C5a and C5b-9 in ALS patient blood. J Neuroimmunol 2014;276:213-8.
47. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015;129:653-67.
48. Walport MJ. Complement. First of two parts. N Engl J Med 2001;344:1058-66.
49. Walport MJ. Complement. Second of two parts. N Engl J Med 2001;344:1140-4.
50. Soltys J, Halperin JA, Xuebin Q. DAF/CD55 and Protectin/CD59 modulate adaptive immunity and disease outcome in experimental autoimmune myasthenia gravis. J Neuroimmunol 2012;244:63-9.
SUPPLEMENTARY FIGURES
Supl. Fig. 1. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-C1q (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows C1q co-
localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no C1q
deposition in controls.
6
Complement on motor end-plates in ALS
205
36. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014;111:E5.
37. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006;26:2661-72.
38. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988;85:7371-4.
39. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992;42:2175-80.
40. Appel SH, Engelhardt JI, Garcia J, Stefani E. Autoimmunity and ALS: a comparison of animal models of immune-mediated motor neuron destruction and human ALS. Adv Neurol 1991;56:405-12.
41. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998;21:81-90.
42. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002;69:110-6.
43. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002;113:1066-71.
44. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013;110:E4385-E4392.
45. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006;12:682-7.
46. Mantovani S, Gordon R, Macmaw JK, et al. Elevation of the terminal complement activation products C5a and C5b-9 in ALS patient blood. J Neuroimmunol 2014;276:213-8.
47. Bahia E, I, Das PK, Fluiter K, et al. M. leprae components induce nerve damage by complement activation: identification of lipoarabinomannan as the dominant complement activator. Acta Neuropathol 2015;129:653-67.
48. Walport MJ. Complement. First of two parts. N Engl J Med 2001;344:1058-66.
49. Walport MJ. Complement. Second of two parts. N Engl J Med 2001;344:1140-4.
50. Soltys J, Halperin JA, Xuebin Q. DAF/CD55 and Protectin/CD59 modulate adaptive immunity and disease outcome in experimental autoimmune myasthenia gravis. J Neuroimmunol 2012;244:63-9.
SUPPLEMENTARY FIGURES
Supl. Fig. 1. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-C1q (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows C1q co-
localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no C1q
deposition in controls.
Chapter 6
206
Supl. Fig. 2. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-C3c recognizing C3c part of C3 and C3b (FITC) in control (A, C) and ALS (B, D)
intercostal muscle, shows C3c co- localizing with both synaptophysin and S100b (White arrow in B
and D respectively), but no C3c deposition in controls.
Supl. Fig. 3. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with an antibody detecting MAC (FITC) in control (A, C) and ALS (B, D) intercostal muscle,
shows MAC deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow
in B and D respectively), but no MAC deposition in controls.
Supl. Fig. 4. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-CD55 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD55 co-
localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no CD55
deposition in controls.
Supl. Fig. 5. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-CD59 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD59
6
Complement on motor end-plates in ALS
207
Supl. Fig. 2. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-C3c recognizing C3c part of C3 and C3b (FITC) in control (A, C) and ALS (B, D)
intercostal muscle, shows C3c co- localizing with both synaptophysin and S100b (White arrow in B
and D respectively), but no C3c deposition in controls.
Supl. Fig. 3. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with an antibody detecting MAC (FITC) in control (A, C) and ALS (B, D) intercostal muscle,
shows MAC deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow
in B and D respectively), but no MAC deposition in controls.
Supl. Fig. 4. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-CD55 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD55 co-
localizing with both synaptophysin and S100b (White arrow in B and D respectively), but no CD55
deposition in controls.
Supl. Fig. 5. Representative confocal immunofluorescence for synaptophysin (SYN-CY3) detecting
the motor nerve terminal (A, B) or S100b (CY3) detecting the terminal schwann cells (C, D) double
stained with anti-CD59 (FITC) in control (A, C) and ALS (B, D) intercostal muscle, shows CD59
Chapter 6
208
deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow in B and D
respectively), but no CD59 deposition in controls.
Supl. Fig. 6. Representative confocal microscopy images of the motor end-plate from wildtype (n = 4)
(A) and SOD1G93A
mice (n = 4) at 47 (B), immunostained for neurofilament NF-H (white arrow head in
A and B), MAC with C5b9 (white asterisk in B) and the muscle end-plate with α-BTX (Alexa488),
showing deposition of MAC (white asterisk in B) on the innervated motor end-plate (white arrow
pointing to NF-H co-localizing with α-BTX) in SOD1G93A
mice, but not in the wildtype mice. Bar= 20µm
deposition on both the motor nerve terminal and the terminal Schwann cells (White arrow in B and D
respectively), but no CD59 deposition in controls.
Supl. Fig. 6. Representative confocal microscopy images of the motor end-plate from wildtype (n = 4)
(A) and SOD1G93A
mice (n = 4) at 47 (B), immunostained for neurofilament NF-H (white arrow head in
A and B), MAC with C5b9 (white asterisk in B) and the muscle end-plate with α-BTX (Alexa488),
showing deposition of MAC (white asterisk in B) on the innervated motor end-plate (white arrow
pointing to NF-H co-localizing with α-BTX) in SOD1G93A
mice, but not in the wildtype mice. Bar= 20µm
Ineke van Kleef-Peters. Gelukkig is de laatste jaren de bekendheid van ALS bij het
publiek zeer sterk toegenomen. Door de velen acties en campagnes van o.a.
Stichting ALS Nederland, kennen de meeste mensen de ziekte nu wel. Ook heeft
sociale media, o.a. Facebook en diverse Forumsites er aan bijgedragen dat
lotgenoten elkaar gevonden hebben, informatie en tips delen, maar vooral elkaar
steunen door dik en dun. Helaas altijd met het verdrietige moment als er weer een
lotgenoot is overleden of heeft gekozen voor levensbeëindiging omdat de periode
aan het einde van een ALS patiënt vaak ondragelijk is.
Zelf heb ik (nu 51 jaar) 3 jaar de diagnose. Mijn broer (nu 52 jaar) leeft nu 9 jaar met
ALS.
Het Nichtje (nu 66 jaar) leeft nu 7 jaar met ALS. Hoewel ieder persoon met ALS
anders is en het verloop zeer moeilijk te voorspellen is blijven wij kracht vinden in het
motto: “Niet kijken naar wat niet meer lukt maar kijken wat wij nog wel kunnen”. Voor
ons een manier om toch positief te blijven.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement component C6 inhibition decreases neurological
disability in female transgenic SOD1G93A mouse model of
Amyotrophic Lateral Sclerosis
Nawal Bahia El Idrissi1, Kees Fluiter1, Fernando G. Vieira2 and Frank Baas1 Annals
of neurodegenerative disorders, 2016 October.
1Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The
Netherlands and 2 ALS Therapy Development Institute, 300 Technology Square, Cambridge,
MA 02139, USA
Ineke van Kleef-Peters. Gelukkig is de laatste jaren de bekendheid van ALS bij het
publiek zeer sterk toegenomen. Door de velen acties en campagnes van o.a.
Stichting ALS Nederland, kennen de meeste mensen de ziekte nu wel. Ook heeft
sociale media, o.a. Facebook en diverse Forumsites er aan bijgedragen dat
lotgenoten elkaar gevonden hebben, informatie en tips delen, maar vooral elkaar
steunen door dik en dun. Helaas altijd met het verdrietige moment als er weer een
lotgenoot is overleden of heeft gekozen voor levensbeëindiging omdat de periode
aan het einde van een ALS patiënt vaak ondragelijk is.
Zelf heb ik (nu 51 jaar) 3 jaar de diagnose. Mijn broer (nu 52 jaar) leeft nu 9 jaar met
ALS.
Het Nichtje (nu 66 jaar) leeft nu 7 jaar met ALS. Hoewel ieder persoon met ALS
anders is en het verloop zeer moeilijk te voorspellen is blijven wij kracht vinden in het
motto: “Niet kijken naar wat niet meer lukt maar kijken wat wij nog wel kunnen”. Voor
ons een manier om toch positief te blijven.
https://www.als.nl/voor-patient/het-verhaal-van/
Complement component C6 inhibition decreases neurological
disability in female transgenic SOD1G93A mouse model of
Amyotrophic Lateral Sclerosis
Nawal Bahia El Idrissi1, Kees Fluiter1, Fernando G. Vieira2 and Frank Baas1 Annals
of neurodegenerative disorders, 2016 October.
1Department of Genome Analysis, Academic Medical Center, Amsterdam, 1105 AZ, The
Netherlands and 2 ALS Therapy Development Institute, 300 Technology Square, Cambridge,
MA 02139, USA
7
Chapter 7
212
Abstract
Introduction. Amyotrophic lateral sclerosis (ALS) is a rapidly progressive motor
neuron disease. Activated complement products including the membrane attack
complex (MAC) are found in serum, cerebrospinal fluid, spinal cord, motor cortex and
at the neuromuscular junction of SOD1G93A mice and ALS patients. Inhibiting
membrane attack complex (MAC) formation facilitates axonal regeneration and
recovery. Therefore we tested whether inhibition of MAC formation affects the
disease progression in the SOD1G93A mouse model of familial ALS.
Methods. Female (n=32) and male (n=32) SOD1G93A mice were dosed
subcutaneously with either a complement factor 6 (C6) RNA antagonist (C6-ODN) or
Phosphate Buffered Saline (PBS). Treatment started at day 50 and the experiment
was terminated at day 180. Male SOD1G93A mice have 10-fold higher levels of C6
compared to female SOD1G93A mice. Mice were continuously treated with 1mg/kg/day
of C6 ODN using an osmotic minipump. The weight, onset, survival and neurological
severity scores were assessed.
Results. Female SOD1G93A mice treated with C6 ODN showed a lower neurological
severity score compared to the vehicle controls (p=0.002). The male SOD1G93A
transgenic mice, who had high endogenous expression of C6, the disease onset,
survival and neurological severity in the C6 ODN treated group progressed in the
same manner as the vehicle control (p=0.826, p=0.891 and p=>0.998 respectively).
Combined, the male and female C6 ODN treated SOD1G93A mice together
progressed in a manner that was not significantly different from the vehicle control
animals (p=0.20).
Conclusion. In general this data shows that C6 ODN treatment in female SOD1G93A
mice who already have low endogenous levels of C6 shows reduced neurological
severity and a trend towards delayed onset of disease.
Keywords: Amyotrophic lateral sclerosis, Complement factor C6, antisense oligonucleotide,
SOD1G93A
mouse
7
C6 inhibition in the SOD1G93A mouse
213
Abstract
Introduction. Amyotrophic lateral sclerosis (ALS) is a rapidly progressive motor
neuron disease. Activated complement products including the membrane attack
complex (MAC) are found in serum, cerebrospinal fluid, spinal cord, motor cortex and
at the neuromuscular junction of SOD1G93A mice and ALS patients. Inhibiting
membrane attack complex (MAC) formation facilitates axonal regeneration and
recovery. Therefore we tested whether inhibition of MAC formation affects the
disease progression in the SOD1G93A mouse model of familial ALS.
Methods. Female (n=32) and male (n=32) SOD1G93A mice were dosed
subcutaneously with either a complement factor 6 (C6) RNA antagonist (C6-ODN) or
Phosphate Buffered Saline (PBS). Treatment started at day 50 and the experiment
was terminated at day 180. Male SOD1G93A mice have 10-fold higher levels of C6
compared to female SOD1G93A mice. Mice were continuously treated with 1mg/kg/day
of C6 ODN using an osmotic minipump. The weight, onset, survival and neurological
severity scores were assessed.
Results. Female SOD1G93A mice treated with C6 ODN showed a lower neurological
severity score compared to the vehicle controls (p=0.002). The male SOD1G93A
transgenic mice, who had high endogenous expression of C6, the disease onset,
survival and neurological severity in the C6 ODN treated group progressed in the
same manner as the vehicle control (p=0.826, p=0.891 and p=>0.998 respectively).
Combined, the male and female C6 ODN treated SOD1G93A mice together
progressed in a manner that was not significantly different from the vehicle control
animals (p=0.20).
Conclusion. In general this data shows that C6 ODN treatment in female SOD1G93A
mice who already have low endogenous levels of C6 shows reduced neurological
severity and a trend towards delayed onset of disease.
Keywords: Amyotrophic lateral sclerosis, Complement factor C6, antisense oligonucleotide,
SOD1G93A
mouse
Chapter 7
214
Introduction
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder
characterized by a progressive loss of both upper and lower motor neurons, but the
fundamental processes that lead to the death of neurons are also not fully
understood [1].
Studies have established an earlier role for the adaptive and innate immune systems
in the onset and progression of ALS [2-6].
The complement system, a key component of innate immunity, helps the body to kill
pathogens and remove dead cells after physiological turnover or injury [7, 8].
Complement activation and amplification occurs on the outside of the target cell. The
processes starts by the binding of molecules of the classical, alternative, or lectin
pathways [9]. The classical pathway targets antigen-antibody complexes, viruses,
gram negative bacteria and apoptotic cells [7]. The mannose-binding lectin pathway
binds polysaccharide and destroys pathogens. The alternative pathway gets
activated by spontaneous hydrolysis of Complement component 3 (C3) and plays an
important role in the immune surveillance of tumors. All the three pathways merge
into a final common pathway and results in the formation of the membrane attack
complex (MAC), a pore forming conformation, which consists of C5b, C6, C7, C8,
and a number of C9 molecules [10]. Because of the capacity of complement to cause
harm to self tissue, activation of the pathways is tightly controlled by regulators.
These regulators permit elimination of pathogens or dead cells without injuring the
host. When this balance is disrupted, complement activation causes injury and
contributes to pathology in various diseases.
We have shown that the MAC damages axons in an acute peripheral nerve crush
model, [11] the natural regulator, CD59, of the MAC protects axons from early
degeneration [12]. This neuroprotective effect can also be achieved with inhibitors of
complement activation. It has also been established that administration of
complement inhibitory therapeutics accelerates nerve regeneration and functional
recovery [13]. Activation of complement resulting in the formation of the MAC is a key
determinant of post-traumatic neuroaxonal loss in the CNS, as demonstrated by
studies of traumatic CNS injury in man [14, 15] and animal models [16-18]. In
addition, complement activation has been linked to the pathogenesis of a number of
neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease and
multiple sclerosis [19].
A role for complement in the pathogenesis of ALS in man is also suggested by the
presence of complement activation products, including C3c, C3d, C4d and C3dg, in
spinal cord and motor cortex, and in elevated concentrations in serum and CSF [20-
23].
mRNA and protein levels of the classical pathway of C (C1q and C4) and
downstream components (C3 and MAC) are elevated in spinal cord and motor cortex
of patients with sporadic ALS [6]. In murine ALS models, C1q and C4 are
upregulated in motor neurons [24, 25], whereas C3 is upregulated in the anterior
horn areas containing motor neuron degeneration [26]. In addition, we showed that
complement is activated at the neuromuscular junction of the SOD1G93A mouse
model of familial ALS at pre-symptomatic stage and before axonal damage is
detected, suggesting that complement activation precedes neurodegeneration of
synapses in this model [27]. In post-mortem intercostal muscle of ALS patients we
7
C6 inhibition in the SOD1G93A mouse
215
Introduction
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder
characterized by a progressive loss of both upper and lower motor neurons, but the
fundamental processes that lead to the death of neurons are also not fully
understood [1].
Studies have established an earlier role for the adaptive and innate immune systems
in the onset and progression of ALS [2-6].
The complement system, a key component of innate immunity, helps the body to kill
pathogens and remove dead cells after physiological turnover or injury [7, 8].
Complement activation and amplification occurs on the outside of the target cell. The
processes starts by the binding of molecules of the classical, alternative, or lectin
pathways [9]. The classical pathway targets antigen-antibody complexes, viruses,
gram negative bacteria and apoptotic cells [7]. The mannose-binding lectin pathway
binds polysaccharide and destroys pathogens. The alternative pathway gets
activated by spontaneous hydrolysis of Complement component 3 (C3) and plays an
important role in the immune surveillance of tumors. All the three pathways merge
into a final common pathway and results in the formation of the membrane attack
complex (MAC), a pore forming conformation, which consists of C5b, C6, C7, C8,
and a number of C9 molecules [10]. Because of the capacity of complement to cause
harm to self tissue, activation of the pathways is tightly controlled by regulators.
These regulators permit elimination of pathogens or dead cells without injuring the
host. When this balance is disrupted, complement activation causes injury and
contributes to pathology in various diseases.
We have shown that the MAC damages axons in an acute peripheral nerve crush
model, [11] the natural regulator, CD59, of the MAC protects axons from early
degeneration [12]. This neuroprotective effect can also be achieved with inhibitors of
complement activation. It has also been established that administration of
complement inhibitory therapeutics accelerates nerve regeneration and functional
recovery [13]. Activation of complement resulting in the formation of the MAC is a key
determinant of post-traumatic neuroaxonal loss in the CNS, as demonstrated by
studies of traumatic CNS injury in man [14, 15] and animal models [16-18]. In
addition, complement activation has been linked to the pathogenesis of a number of
neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease and
multiple sclerosis [19].
A role for complement in the pathogenesis of ALS in man is also suggested by the
presence of complement activation products, including C3c, C3d, C4d and C3dg, in
spinal cord and motor cortex, and in elevated concentrations in serum and CSF [20-
23].
mRNA and protein levels of the classical pathway of C (C1q and C4) and
downstream components (C3 and MAC) are elevated in spinal cord and motor cortex
of patients with sporadic ALS [6]. In murine ALS models, C1q and C4 are
upregulated in motor neurons [24, 25], whereas C3 is upregulated in the anterior
horn areas containing motor neuron degeneration [26]. In addition, we showed that
complement is activated at the neuromuscular junction of the SOD1G93A mouse
model of familial ALS at pre-symptomatic stage and before axonal damage is
detected, suggesting that complement activation precedes neurodegeneration of
synapses in this model [27]. In post-mortem intercostal muscle of ALS patients we
Chapter 7
216
also showed complement deposited at the neuromuscular junctions before they were
lost, suggesting an early role for complement in the disease [28].
These data suggest that activation of the complement system occurs early in the
disease process and persists while disease progresses. In this way it is could be a
continuous source of neuroinflammation. Like in other neurological diseases we
propose that MAC is involved in causing secondary damage driving the progressive
loss of motor neuron function. Therefore, we used a Locked Nucleic Acid (LNA)
modified oligonucleotide that uses antisense principles to target the mRNA of C6 (C6
ODN), one of the proteins necessary to form the MAC. Here, we tested whether
targeting complement C6 and thus inhibiting MAC formation results in a delay of
disease progression in a murine model of familial ALS. We expected to find a delay in
the disease progression and a lower neurological severity score in the C6 ODN
treated SOD1G93A mice compared to the controls.
Material and Methods
Mice
All the animal experiments were carried out by ALS Therapy Development Institute
(ALSTDI) after prior approval from ALSTDI Institutional Animal Care and Use
Committee and in accordance with approved institutional protocol.
Female and male SOD1G93A mice (strain name B6SJL-Tg (SOD1-G93A)) were
obtained from The Jackson Laboratory (‘JAX’, Bar Harbor, Maine) and bred by JAX.
This mixed hybrid SOD1G93A colony was kept by breeding a B6/SJLTg (SOD1G93A)
male to B6/SJL F1 female mice. To check for presence of the copynumber of the
transgene in the progeny, tail biopsies were collected by the breeder from 14-day-old
pups, then PCR-genotyped (according to JAX copy number protocol) [29].
Transgenic mice are shipped at age 35–45 days, allowing at least a week to
acclimatize to the facility (a 12-h light/ dark cycle).
C6 antisense oligonucleotide synthesis
The C6 Locked Nucleic Acid (LNA) oligonucleotides were synthesized with
phosphorothioate backbones and 5-methyl cytosine residues (medC) by Ribotask
(Odense, Denmark) on a Mermade 12™, using 2g NittoPhase™ (BioAutomation). All
oligonucleotides were HPLC purified (> 90%). C6 oligonucleotide (C6 ODN): 5’A A C
t t g c t g g g A A T 3’ LNA in capital letters and DNA in lowercase.
7
C6 inhibition in the SOD1G93A mouse
217
also showed complement deposited at the neuromuscular junctions before they were
lost, suggesting an early role for complement in the disease [28].
These data suggest that activation of the complement system occurs early in the
disease process and persists while disease progresses. In this way it is could be a
continuous source of neuroinflammation. Like in other neurological diseases we
propose that MAC is involved in causing secondary damage driving the progressive
loss of motor neuron function. Therefore, we used a Locked Nucleic Acid (LNA)
modified oligonucleotide that uses antisense principles to target the mRNA of C6 (C6
ODN), one of the proteins necessary to form the MAC. Here, we tested whether
targeting complement C6 and thus inhibiting MAC formation results in a delay of
disease progression in a murine model of familial ALS. We expected to find a delay in
the disease progression and a lower neurological severity score in the C6 ODN
treated SOD1G93A mice compared to the controls.
Material and Methods
Mice
All the animal experiments were carried out by ALS Therapy Development Institute
(ALSTDI) after prior approval from ALSTDI Institutional Animal Care and Use
Committee and in accordance with approved institutional protocol.
Female and male SOD1G93A mice (strain name B6SJL-Tg (SOD1-G93A)) were
obtained from The Jackson Laboratory (‘JAX’, Bar Harbor, Maine) and bred by JAX.
This mixed hybrid SOD1G93A colony was kept by breeding a B6/SJLTg (SOD1G93A)
male to B6/SJL F1 female mice. To check for presence of the copynumber of the
transgene in the progeny, tail biopsies were collected by the breeder from 14-day-old
pups, then PCR-genotyped (according to JAX copy number protocol) [29].
Transgenic mice are shipped at age 35–45 days, allowing at least a week to
acclimatize to the facility (a 12-h light/ dark cycle).
C6 antisense oligonucleotide synthesis
The C6 Locked Nucleic Acid (LNA) oligonucleotides were synthesized with
phosphorothioate backbones and 5-methyl cytosine residues (medC) by Ribotask
(Odense, Denmark) on a Mermade 12™, using 2g NittoPhase™ (BioAutomation). All
oligonucleotides were HPLC purified (> 90%). C6 oligonucleotide (C6 ODN): 5’A A C
t t g c t g g g A A T 3’ LNA in capital letters and DNA in lowercase.
Chapter 7
218
Dose testing and qPCR for C6
Firstly, we tested the affective dose for downregulating C6 mRNA in male and female
SOD1G93A mice. Male and female SOD1G93A mice were dosed subcutaneously using
Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) (model
1004; DURECT Corporation, Cupertino, CA 95014) with either 1mg/kg, 2mg/kg,
3mg/kg of C6 ODN or Phosphate Buffered Saline (PBS) for 28 days (each group n=3
per gender/dose of treatment). qPCR for C6 was performed on the liver to determine
the amount of C6 inhibition by the drugs. RNA from the liver of C6 LNA-DNA -
wingmer treated mice or controls was isolated using Trizol according to the
instructions of the manufacturer (Invitrogen). cDNA was generated using oligo-dT
primer and SuperScriptII enzyme (Invitrogen). qPCR was performed using Universal
probe primers (Roche) and a Lightcycler 480 (Roche). Primers specific for C6 were
used (C6-forward 5’-CAGAGAAAAATGAACATTCCCATTA; C6-reverse 5’-
TTCTTGTGGGAAGCTTTAATGAC). Amplification of C6 mRNA was quantified using
LightCycler software (Roche Diagnostics). Values were normalized to the
housekeeping gene Hypoxanthine-guanine phosphoribosyltransferase (HPRT-
forward 5’ GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-
CAATCAAGACGTTCTTTCCAGTT). All reactions were done in quadruplicate and
qPCR conditions were as standard recommended by the manufacturer (Roche).
Effect of C6 treatment on blood parameters
In addition to the liver for qPCR (previous paragraph) also blood samples were
collected from each mouse in ethylene diamine tetra-acetic acid (EDTA) tubes. The
concentration of red blood cells (RBC), Hemoglobin (Hb), Hematocrit (HCT) and
Mean Corpus Volume (MCV) and other parameters in the blood were measured
using the Sysmex XE-5000 Automated Hematology System (SYSMEX AMERICA,
INC.) according to manufacturer procedure.
Experimental design
Secondly, we tested in another experiment whether inhibition of C6 in female and
male SODG93A slowed the progression of the disease. The design of the SODG93A
experiment was previously described by Scott et al. 2008 [29]. Briefly, mice are
separated into treatment and vehicle cohorts at age day 45. To ensure minimal
variability between cohorts, each cohort is defined by the following constraints:
balanced for gender, males (n=32) and females (n=32); age-matched; littermate
matched. Littermates are defined as offspring of the same non-transgenic dam and
transgenic sire, born on the same day. Specifically, each male (and female) in the
treatment group has a littermate brother (and sister, respectively) in vehicle group;
bodyweight balanced. The weights of each mouse are recorded at day 50; the
average weight is determined for males and females separately.
This study was performed blinded. Treatment with 1 mg/kg/day of C6 ODN started at
day 50, when the animals did not yet exhibit any sign of motor dysfunction
(presymptomatic stage). However, at is this stage, complement deposition is already
detected at the neuromuscular junctions of the SODG93A mice [27]. Administration of
the drugs was performed subcutaneous by osmotic minipumps. Each mouse was
weighed and neurological score of both hind legs were assessed daily during this
study. The neurological score employed a scale of 0 to 4 that was developed by
observation at ALSTDI [29], with 0 representing normal, 1 representing mild defect, 2
7
C6 inhibition in the SOD1G93A mouse
219
Dose testing and qPCR for C6
Firstly, we tested the affective dose for downregulating C6 mRNA in male and female
SOD1G93A mice. Male and female SOD1G93A mice were dosed subcutaneously using
Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) (model
1004; DURECT Corporation, Cupertino, CA 95014) with either 1mg/kg, 2mg/kg,
3mg/kg of C6 ODN or Phosphate Buffered Saline (PBS) for 28 days (each group n=3
per gender/dose of treatment). qPCR for C6 was performed on the liver to determine
the amount of C6 inhibition by the drugs. RNA from the liver of C6 LNA-DNA -
wingmer treated mice or controls was isolated using Trizol according to the
instructions of the manufacturer (Invitrogen). cDNA was generated using oligo-dT
primer and SuperScriptII enzyme (Invitrogen). qPCR was performed using Universal
probe primers (Roche) and a Lightcycler 480 (Roche). Primers specific for C6 were
used (C6-forward 5’-CAGAGAAAAATGAACATTCCCATTA; C6-reverse 5’-
TTCTTGTGGGAAGCTTTAATGAC). Amplification of C6 mRNA was quantified using
LightCycler software (Roche Diagnostics). Values were normalized to the
housekeeping gene Hypoxanthine-guanine phosphoribosyltransferase (HPRT-
forward 5’ GGTCCATTCCTATGACTGTAGATTTT; HPRT-reverse 5’-
CAATCAAGACGTTCTTTCCAGTT). All reactions were done in quadruplicate and
qPCR conditions were as standard recommended by the manufacturer (Roche).
Effect of C6 treatment on blood parameters
In addition to the liver for qPCR (previous paragraph) also blood samples were
collected from each mouse in ethylene diamine tetra-acetic acid (EDTA) tubes. The
concentration of red blood cells (RBC), Hemoglobin (Hb), Hematocrit (HCT) and
Mean Corpus Volume (MCV) and other parameters in the blood were measured
using the Sysmex XE-5000 Automated Hematology System (SYSMEX AMERICA,
INC.) according to manufacturer procedure.
Experimental design
Secondly, we tested in another experiment whether inhibition of C6 in female and
male SODG93A slowed the progression of the disease. The design of the SODG93A
experiment was previously described by Scott et al. 2008 [29]. Briefly, mice are
separated into treatment and vehicle cohorts at age day 45. To ensure minimal
variability between cohorts, each cohort is defined by the following constraints:
balanced for gender, males (n=32) and females (n=32); age-matched; littermate
matched. Littermates are defined as offspring of the same non-transgenic dam and
transgenic sire, born on the same day. Specifically, each male (and female) in the
treatment group has a littermate brother (and sister, respectively) in vehicle group;
bodyweight balanced. The weights of each mouse are recorded at day 50; the
average weight is determined for males and females separately.
This study was performed blinded. Treatment with 1 mg/kg/day of C6 ODN started at
day 50, when the animals did not yet exhibit any sign of motor dysfunction
(presymptomatic stage). However, at is this stage, complement deposition is already
detected at the neuromuscular junctions of the SODG93A mice [27]. Administration of
the drugs was performed subcutaneous by osmotic minipumps. Each mouse was
weighed and neurological score of both hind legs were assessed daily during this
study. The neurological score employed a scale of 0 to 4 that was developed by
observation at ALSTDI [29], with 0 representing normal, 1 representing mild defect, 2
Chapter 7
220
moderate, 3 strong and 4 paralysis of hind limb. Date and cause of death are
recorded for each mouse. To determine ‘survival’ reliably and humanely, an artificial
endpoint is used, defined by the inability of a mouse to right itself in 30 seconds after
being placed on its side. The moribund mice are scored as ‘Died of ALS’, and are
euthanized.
Statistical analysis
All data were analyzed using SPSS statistics 23 package (SPSS Inc, Chicago, USA)
for Windows. The data is presented as the standard deviation of the mean. Kaplan-
Meier survival and onset curves were compared using the log rank test. For the
longitudinal analysis of repeated measurements of clinical scores in time the non-
linear mixed model analyses was used. For comparison of more than two groups
One way ANOVA with Bonferroni multiple comparison post hoc test was used.
Significance was determined as p < 0.05.
Results
Dose testing
We first tested the effect of escalating doses of the C6 ODN on blood parameters
and C6 mRNA levels in the SOD1G93A mice. In the SODG93A strain used, the female
mice have 10 times lower C6 levels than males and at the same dose, they are thus
more effectively depleted of C6 as compared to male mice. Eight-10 weeks old male
and female SOD1G93A mice (before disease onset) were dosed subcutaneously using
Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) with either 1
mg/kg/day, 2 mg/kg/day or 3 mg/kg/day of C6 ODN and the controls were dosed with
PBS for 28 days. The effect of treatment on C6 mRNA levels in liver was analyzed by
qPCR.
This showed that 1mg/kg/day of C6 ODN treatment results in more than 70%
reduction of C6 in the female SOD1G93A mice (Mean vehicle control 0.099 standard
deviation 0.021 versus mean 1mg/kg/day C6 treatment 0.034 standard deviation
0.012] (Figure 1A) and only 30% reduction in male SOD1G93A mice (Mean vehicle
control 1.159 standard deviation 0.329 versus mean 1mg/kg/day C6 treatment 0.795
standard deviation 0.208] (Figure 1B).
Treatment with 2mg/kg/day of C6 ODN treatment resulted in almost a complete
knock down of C6 in female SOD1G93A mice (Mean vehicle control 0.099 standard
deviation 0.021 versus mean 2 mg/kg/day C6 treatment 0.014 standard deviation
0.007] (Figure 1A) and more than 80% reduction of C6 in male SOD1G93A mice
(Mean vehicle control 1.159 standard deviation 0.329 versus mean 2 mg/kg/day C6
treatment 0.199 standard deviation 0.055] (Figure 1B).
7
C6 inhibition in the SOD1G93A mouse
221
moderate, 3 strong and 4 paralysis of hind limb. Date and cause of death are
recorded for each mouse. To determine ‘survival’ reliably and humanely, an artificial
endpoint is used, defined by the inability of a mouse to right itself in 30 seconds after
being placed on its side. The moribund mice are scored as ‘Died of ALS’, and are
euthanized.
Statistical analysis
All data were analyzed using SPSS statistics 23 package (SPSS Inc, Chicago, USA)
for Windows. The data is presented as the standard deviation of the mean. Kaplan-
Meier survival and onset curves were compared using the log rank test. For the
longitudinal analysis of repeated measurements of clinical scores in time the non-
linear mixed model analyses was used. For comparison of more than two groups
One way ANOVA with Bonferroni multiple comparison post hoc test was used.
Significance was determined as p < 0.05.
Results
Dose testing
We first tested the effect of escalating doses of the C6 ODN on blood parameters
and C6 mRNA levels in the SOD1G93A mice. In the SODG93A strain used, the female
mice have 10 times lower C6 levels than males and at the same dose, they are thus
more effectively depleted of C6 as compared to male mice. Eight-10 weeks old male
and female SOD1G93A mice (before disease onset) were dosed subcutaneously using
Alzet osmotic mini pumps (the pump doses 0.11 µl per hour for 28 days) with either 1
mg/kg/day, 2 mg/kg/day or 3 mg/kg/day of C6 ODN and the controls were dosed with
PBS for 28 days. The effect of treatment on C6 mRNA levels in liver was analyzed by
qPCR.
This showed that 1mg/kg/day of C6 ODN treatment results in more than 70%
reduction of C6 in the female SOD1G93A mice (Mean vehicle control 0.099 standard
deviation 0.021 versus mean 1mg/kg/day C6 treatment 0.034 standard deviation
0.012] (Figure 1A) and only 30% reduction in male SOD1G93A mice (Mean vehicle
control 1.159 standard deviation 0.329 versus mean 1mg/kg/day C6 treatment 0.795
standard deviation 0.208] (Figure 1B).
Treatment with 2mg/kg/day of C6 ODN treatment resulted in almost a complete
knock down of C6 in female SOD1G93A mice (Mean vehicle control 0.099 standard
deviation 0.021 versus mean 2 mg/kg/day C6 treatment 0.014 standard deviation
0.007] (Figure 1A) and more than 80% reduction of C6 in male SOD1G93A mice
(Mean vehicle control 1.159 standard deviation 0.329 versus mean 2 mg/kg/day C6
treatment 0.199 standard deviation 0.055] (Figure 1B).
Chapter 7
222
Figure 1. C6 qPCR of SOD1G93A
mice treated with C6 ODN. Female and male SOD1G93A
mice were
subcutaneously treated with either 1mg/kg, 2mg/kg or 3mg/kg of C6 ODN for 28 days to test the
amount of C6 inhibition compared to the controls that were treated with PBS (each group n=3). After
treatment the liver was analyzed for C6 levels by qPCR. C6 mRNA levels in male SOD1G93A
mice were
found to be 10 folds higher than female SOD1G93A
mice (note the x-axis). The results show that (A)
1mg/kg/day of C6 ODN results in more than 70% reduction of C6 in the female SOD1G93A
mice, (B)
while in the male SOD1G93A
mice 2mg/kg of C6 ODN results in a reduction of more than 80%. Error
bar indicates standard deviation of the mean.
We also tested the effect of C6 ODN treatment on blood parameters. A details
analysis of blood parameters showed that concentrations of 3 mg/kg/day of treatment
lowered the count of red blood cells (RBC) (mean PBS 9.27 M/µl standard deviation
0.36 versus mean C6 treated 7.2 M/µl standard deviation 0.5; p<0.0001] (Figure 2A),
hemoglobin (Hb) (mean PBS 12.4 g/dL standard deviation 0.7 versus mean C6
treated 9.4 g/dL standard deviation 0.5; p<0.0001] (Figure 2B), hematocrit (HCT)
(mean PBS 43.1% standard deviation 3.2 versus mean C6 treated 33.8 % standard
deviation 2.6; p=0.0003] (Figure 2C) in the C6 antagonist treated SOD1G93A mice
compared to the PBS treated control group. The red cell distribution width (RDW) and
neutrophils (NEU) counts were also lower in this group compared to the PBS treated
group (p= 0.0003 and p= 0.0039, respectively) (see table 1). Moreover, the levels of
mean corpuscular hemoglobin (MCH) and Mean corpuscular hemoglobin
concentration (MCHC) were slightly lower in the SOD1G93A mice compared to the
PBS treated control group, but the difference was not statistically significant (p=
0.053 and p=0.056, respectively) (see table 1). In contrast, the percentage of
lymphocytes increased significantly in the mice that were treated with 3 mg/kg/day of
the C6 ODN compared to the PBS control group (p=0.027). However, the percentage
of The Mean Corpus Volume (MCV) (Figure 2D) and other clinical chemistry
parameters were unaltered (see table 1).
In view of the effect on RBC we decided to start with 1 mg/kg/day of C6 ODN
treatment.
7
C6 inhibition in the SOD1G93A mouse
223
Figure 1. C6 qPCR of SOD1G93A
mice treated with C6 ODN. Female and male SOD1G93A
mice were
subcutaneously treated with either 1mg/kg, 2mg/kg or 3mg/kg of C6 ODN for 28 days to test the
amount of C6 inhibition compared to the controls that were treated with PBS (each group n=3). After
treatment the liver was analyzed for C6 levels by qPCR. C6 mRNA levels in male SOD1G93A
mice were
found to be 10 folds higher than female SOD1G93A
mice (note the x-axis). The results show that (A)
1mg/kg/day of C6 ODN results in more than 70% reduction of C6 in the female SOD1G93A
mice, (B)
while in the male SOD1G93A
mice 2mg/kg of C6 ODN results in a reduction of more than 80%. Error
bar indicates standard deviation of the mean.
We also tested the effect of C6 ODN treatment on blood parameters. A details
analysis of blood parameters showed that concentrations of 3 mg/kg/day of treatment
lowered the count of red blood cells (RBC) (mean PBS 9.27 M/µl standard deviation
0.36 versus mean C6 treated 7.2 M/µl standard deviation 0.5; p<0.0001] (Figure 2A),
hemoglobin (Hb) (mean PBS 12.4 g/dL standard deviation 0.7 versus mean C6
treated 9.4 g/dL standard deviation 0.5; p<0.0001] (Figure 2B), hematocrit (HCT)
(mean PBS 43.1% standard deviation 3.2 versus mean C6 treated 33.8 % standard
deviation 2.6; p=0.0003] (Figure 2C) in the C6 antagonist treated SOD1G93A mice
compared to the PBS treated control group. The red cell distribution width (RDW) and
neutrophils (NEU) counts were also lower in this group compared to the PBS treated
group (p= 0.0003 and p= 0.0039, respectively) (see table 1). Moreover, the levels of
mean corpuscular hemoglobin (MCH) and Mean corpuscular hemoglobin
concentration (MCHC) were slightly lower in the SOD1G93A mice compared to the
PBS treated control group, but the difference was not statistically significant (p=
0.053 and p=0.056, respectively) (see table 1). In contrast, the percentage of
lymphocytes increased significantly in the mice that were treated with 3 mg/kg/day of
the C6 ODN compared to the PBS control group (p=0.027). However, the percentage
of The Mean Corpus Volume (MCV) (Figure 2D) and other clinical chemistry
parameters were unaltered (see table 1).
In view of the effect on RBC we decided to start with 1 mg/kg/day of C6 ODN
treatment.
Chapter 7
224
Figure 2. Slightly lowered the concentration of red blood cells during treatment with C6 ODN in
SOD1G93A
mice. Treatment of male and female SOD1G93A
mice with 2 or 3 mg/kg/day of C6 ODN
(each group n=6) shows a slightly decrease in the levels of (A) Red blood cells (RBC), (B) Hemoglobin
(Hb), (C) Hematocrit (HCT) and (D) Mean Corpus Volume (MCV) counts compared to vehicle controls.
This effect is not measured in treatment of SOD1G93A
mice with 1 mg/kg/day of C6 ODN. Error bar
indicates standard deviation of the mean.
Tabel 1. Blood parameters of C6 ODN (3 mg/kg/day) and PBS treated SOD1G93A
mice.
Parameter Treatment N Mean SD SEM P value
Neutrophils (K/uL) PBS 6 1,66 0,30 0,12
Neutrophils (K/uL) C6 antagonist 6 1,06 0,25 0,10 0,0039
Lymfocytes (%) PBS 6 77,99 4,61 1,88
Lymfocytes (%) C6 antagonist 6 83,69 2,85 1,16 0,0277
Neutrophils (%) PBS 6 16,45 5,60 2,29
Neutrophils (%) C6 antagonist 6 10,74 2,79 1,14 0,0493
Red blood cells (M/uL) PBS 6 9,27 0,36 0,15
Red blood cells (M/uL) C6 antagonist 6 7,20 0,50 0,21 <0.0001
Hemoglobin (g/dL) PBS 6 12,4 0,7 0,3
Hemoglobin (g/dL) C6 antagonist 6 9,4 0,5 0,2 <0.0001
Hematocriet (%) PBS 6 43,1 3,2 1,3
Hematocriet (%) C6 antagonist 6 33,8 2,6 1,1 0,0003
Mean corpuscular hemoglobin (pg) PBS 6 14,6 2,0 0,8
mean corpuscular hemoglobin (pg) C6 antagonist 6 12,7 0,7 0,3 0,0532
Mean corpuscular hemoglobin concentration (g/dL) PBS 6 30,2 4,0 1,6
Mean corpuscular hemoglobin concentration (g/dL) C6 antagonist 6 26,6 1,0 0,4 0,0568
Red cell distribution width (%) PBS 6 18,0 0,3 0,1
red cell distribution width (%) C6 antagonist 6 16,7 0,5 0,2 0,0003
White blood cells (K/uL) PBS 6 10,60 2,11 0,86
White blood cells (K/uL) C6 antagonist 6 10,00 1,51 0,62 0,5843
Lymfocytes (K/uL) PBS 6 8,33 2,08 0,85
Lymfocytes (K/uL) C6 antagonist 6 8,37 1,35 0,55 0,9705
Monocytes (K/uL) PBS 6 0,44 0,13 0,05
Monocytes (K/uL) C6 antagonist 6 0,46 0,13 0,05 0,8781
Eosinophils (K/uL) PBS 6 0,13 0,08 0,03
Eosinophils (K/uL) C6 antagonist 6 0,09 0,04 0,02 0,2607
Basophils (K/uL) PBS 6 0,03 0,03 0,01
Basophils (K/uL) C6 antagonist 6 0,02 0,03 0,01 0,6611
Mean Corpus Volume (fL) PBS 6 114,7 166,7 68,1
Mean Corpus Volume (fL) C6 antagonist 6 46,9 1,4 0,6 0,3428
Platelets (K/uL) PBS 6 960 185 76
Platelets (K/uL) C6 antagonist 6 922 255 104 0,7718
Mean platelet volume (fL) PBS 6 5,0 0,3 0,1
Mean platelet volume (fL) C6 antagonist 6 4,8 0,4 0,2 0,3923
7
C6 inhibition in the SOD1G93A mouse
225
Figure 2. Slightly lowered the concentration of red blood cells during treatment with C6 ODN in
SOD1G93A
mice. Treatment of male and female SOD1G93A
mice with 2 or 3 mg/kg/day of C6 ODN
(each group n=6) shows a slightly decrease in the levels of (A) Red blood cells (RBC), (B) Hemoglobin
(Hb), (C) Hematocrit (HCT) and (D) Mean Corpus Volume (MCV) counts compared to vehicle controls.
This effect is not measured in treatment of SOD1G93A
mice with 1 mg/kg/day of C6 ODN. Error bar
indicates standard deviation of the mean.
Tabel 1. Blood parameters of C6 ODN (3 mg/kg/day) and PBS treated SOD1G93A
mice.
Parameter Treatment N Mean SD SEM P value
Neutrophils (K/uL) PBS 6 1,66 0,30 0,12
Neutrophils (K/uL) C6 antagonist 6 1,06 0,25 0,10 0,0039
Lymfocytes (%) PBS 6 77,99 4,61 1,88
Lymfocytes (%) C6 antagonist 6 83,69 2,85 1,16 0,0277
Neutrophils (%) PBS 6 16,45 5,60 2,29
Neutrophils (%) C6 antagonist 6 10,74 2,79 1,14 0,0493
Red blood cells (M/uL) PBS 6 9,27 0,36 0,15
Red blood cells (M/uL) C6 antagonist 6 7,20 0,50 0,21 <0.0001
Hemoglobin (g/dL) PBS 6 12,4 0,7 0,3
Hemoglobin (g/dL) C6 antagonist 6 9,4 0,5 0,2 <0.0001
Hematocriet (%) PBS 6 43,1 3,2 1,3
Hematocriet (%) C6 antagonist 6 33,8 2,6 1,1 0,0003
Mean corpuscular hemoglobin (pg) PBS 6 14,6 2,0 0,8
mean corpuscular hemoglobin (pg) C6 antagonist 6 12,7 0,7 0,3 0,0532
Mean corpuscular hemoglobin concentration (g/dL) PBS 6 30,2 4,0 1,6
Mean corpuscular hemoglobin concentration (g/dL) C6 antagonist 6 26,6 1,0 0,4 0,0568
Red cell distribution width (%) PBS 6 18,0 0,3 0,1
red cell distribution width (%) C6 antagonist 6 16,7 0,5 0,2 0,0003
White blood cells (K/uL) PBS 6 10,60 2,11 0,86
White blood cells (K/uL) C6 antagonist 6 10,00 1,51 0,62 0,5843
Lymfocytes (K/uL) PBS 6 8,33 2,08 0,85
Lymfocytes (K/uL) C6 antagonist 6 8,37 1,35 0,55 0,9705
Monocytes (K/uL) PBS 6 0,44 0,13 0,05
Monocytes (K/uL) C6 antagonist 6 0,46 0,13 0,05 0,8781
Eosinophils (K/uL) PBS 6 0,13 0,08 0,03
Eosinophils (K/uL) C6 antagonist 6 0,09 0,04 0,02 0,2607
Basophils (K/uL) PBS 6 0,03 0,03 0,01
Basophils (K/uL) C6 antagonist 6 0,02 0,03 0,01 0,6611
Mean Corpus Volume (fL) PBS 6 114,7 166,7 68,1
Mean Corpus Volume (fL) C6 antagonist 6 46,9 1,4 0,6 0,3428
Platelets (K/uL) PBS 6 960 185 76
Platelets (K/uL) C6 antagonist 6 922 255 104 0,7718
Mean platelet volume (fL) PBS 6 5,0 0,3 0,1
Mean platelet volume (fL) C6 antagonist 6 4,8 0,4 0,2 0,3923
Chapter 7
226
The effect of C6 inhibition on onset of the disease and survival in in female
SODG93A mice
The aim of the treatment with the C6 ODN is to knock down mouse C6 mRNA and
protein and reduce functional membrane attack complex (MAC) activity. To test
whether MAC is a potential target for treatment of familial ALS we tested our C6 ODN
in the murine SOD1G93A model. C6 ODN treated female (n=16) and male (n=16)
SODG93A mice were compared to PBS treated female (n=16) and male (n=16)
SODG93A mice. All SOD1G93A mice were sex and litter matched and screened for
SOD-1 copy number before entering the study. C6 ODN was administrated starting at
day 50 after birth and was dosed subcutaneously until death using Alzet osmotic
minipumps at a 1 mg/kg/day dose. We analysed the onset and survival of female and
male SODG93A mice during treatment with C6 ODN and compared this to SODG93A
mice treated with PBS.
We show no statistically significant effects on median onset or survival in either
female or male C6 ODN treated SODG93A mice compared to vehicle controls. Female
SODG93A mice treated with PBS on average have an onset of the disease around day
110 and all the animals die from disease around day 130 (Figure 3A). Although the
onset and survival curve of the C6 ODN treated female SODG93A mice showed a
different disease progression compared to the controls (Figure 3 A and B), there
were no statistical difference in onset and survival (Kaplan-Meier log rank test
p=0.169 and p= 0.354 respectively). Also in the male SODG93A mice treated with
1mg/kg/day of C6 ODN, no significant effect on the onset and survival was observed
compared to the vehicle controls (Kaplan-Meier log rank test p=0.826 and p=0.891
respectively) (Figure 4 A, B).
Figure 3. Later onset and extension of survival time in female SOD1G93A
mice following C6 ODN
treatment. Female SOD1G93A
mice were subcutaneously dosed starting from day 50 with either PBS
(red) or C6 ODN with 1mg/kg/day (blue). (A) Seven out of the 12 C6 ODN treated female SOD1G93A
had a later onset of the disease compared to PBS treated controls. (B) Three out of the 16 C6 ODN-
treated female SOD1G93A
mice died earlier compared the vehicle group and 7 out of the 16 mice
survived longer compared to PBS treated controls. The differences in onset and survival between the
C6 ODN treated females SOD1G93A
mice and vehicle controls were not significantly different by
Kaplan-Meier log rank test (p=0.169 and p=0.354, respectively).
7
C6 inhibition in the SOD1G93A mouse
227
The effect of C6 inhibition on onset of the disease and survival in in female
SODG93A mice
The aim of the treatment with the C6 ODN is to knock down mouse C6 mRNA and
protein and reduce functional membrane attack complex (MAC) activity. To test
whether MAC is a potential target for treatment of familial ALS we tested our C6 ODN
in the murine SOD1G93A model. C6 ODN treated female (n=16) and male (n=16)
SODG93A mice were compared to PBS treated female (n=16) and male (n=16)
SODG93A mice. All SOD1G93A mice were sex and litter matched and screened for
SOD-1 copy number before entering the study. C6 ODN was administrated starting at
day 50 after birth and was dosed subcutaneously until death using Alzet osmotic
minipumps at a 1 mg/kg/day dose. We analysed the onset and survival of female and
male SODG93A mice during treatment with C6 ODN and compared this to SODG93A
mice treated with PBS.
We show no statistically significant effects on median onset or survival in either
female or male C6 ODN treated SODG93A mice compared to vehicle controls. Female
SODG93A mice treated with PBS on average have an onset of the disease around day
110 and all the animals die from disease around day 130 (Figure 3A). Although the
onset and survival curve of the C6 ODN treated female SODG93A mice showed a
different disease progression compared to the controls (Figure 3 A and B), there
were no statistical difference in onset and survival (Kaplan-Meier log rank test
p=0.169 and p= 0.354 respectively). Also in the male SODG93A mice treated with
1mg/kg/day of C6 ODN, no significant effect on the onset and survival was observed
compared to the vehicle controls (Kaplan-Meier log rank test p=0.826 and p=0.891
respectively) (Figure 4 A, B).
Figure 3. Later onset and extension of survival time in female SOD1G93A
mice following C6 ODN
treatment. Female SOD1G93A
mice were subcutaneously dosed starting from day 50 with either PBS
(red) or C6 ODN with 1mg/kg/day (blue). (A) Seven out of the 12 C6 ODN treated female SOD1G93A
had a later onset of the disease compared to PBS treated controls. (B) Three out of the 16 C6 ODN-
treated female SOD1G93A
mice died earlier compared the vehicle group and 7 out of the 16 mice
survived longer compared to PBS treated controls. The differences in onset and survival between the
C6 ODN treated females SOD1G93A
mice and vehicle controls were not significantly different by
Kaplan-Meier log rank test (p=0.169 and p=0.354, respectively).
Chapter 7
228
Figure 4. No effect on the onset and survival time in male SOD1G93A
mice following C6 ODN
treatment. Male SOD1G93A
mice were subcutaneously dosed starting from day 50 with either PBS
(red) or C6 ODN with 1mg/kg/day (blue). No difference was observed in the proportion at onset (A)
and the fraction of survival (B) of the male C6 ODN-treated animals compared to the controls by
Kaplan-Meier log rank test (p=0.826 and p=0.891, respectively).
C6 inhibition delays progression of disease in female SODG93A mice as
measured by neurological score
The body weight of the C6 ODN and control treated SOD1G93A mice was measured
every day together with the neurological score. At the end-stage of the disease (day
120) the vehicle control mice dropped in weight (mean= 0.8 gram) while the treated
female SOD1G93A mice that were still alive maintained their body weight (Supplement
Figure 1A). In contrast, male treated SOD1G93A mice showed a decrease in body
weight similar to control (Supplement Figure 1B).
The neurological score of female and male SODG93A mice treated with C6 ODN or
PBS was assessed daily on a scale of 0 to 4, with 0 being normal and 4 being
completely paralyzed of both hind legs. C6 ODN treated female SODG93A mice,
progressed in a manner that was slower than vehicle controls (p=0.002) (Figure 5A).
Together with the maintained body weight this suggests that these mice were
performing better than the vehicle controls. However, C6 ODN-treated male
SODG93A mice did not progress differently from the vehicle controls (p=0.997), as also
observed for the body weight of these mice (Figure 5B).
7
C6 inhibition in the SOD1G93A mouse
229
Figure 4. No effect on the onset and survival time in male SOD1G93A
mice following C6 ODN
treatment. Male SOD1G93A
mice were subcutaneously dosed starting from day 50 with either PBS
(red) or C6 ODN with 1mg/kg/day (blue). No difference was observed in the proportion at onset (A)
and the fraction of survival (B) of the male C6 ODN-treated animals compared to the controls by
Kaplan-Meier log rank test (p=0.826 and p=0.891, respectively).
C6 inhibition delays progression of disease in female SODG93A mice as
measured by neurological score
The body weight of the C6 ODN and control treated SOD1G93A mice was measured
every day together with the neurological score. At the end-stage of the disease (day
120) the vehicle control mice dropped in weight (mean= 0.8 gram) while the treated
female SOD1G93A mice that were still alive maintained their body weight (Supplement
Figure 1A). In contrast, male treated SOD1G93A mice showed a decrease in body
weight similar to control (Supplement Figure 1B).
The neurological score of female and male SODG93A mice treated with C6 ODN or
PBS was assessed daily on a scale of 0 to 4, with 0 being normal and 4 being
completely paralyzed of both hind legs. C6 ODN treated female SODG93A mice,
progressed in a manner that was slower than vehicle controls (p=0.002) (Figure 5A).
Together with the maintained body weight this suggests that these mice were
performing better than the vehicle controls. However, C6 ODN-treated male
SODG93A mice did not progress differently from the vehicle controls (p=0.997), as also
observed for the body weight of these mice (Figure 5B).
Chapter 7
230
Figure 5. Reduction of the neurological disability in female SODG93A
mice following C6 ODN
treatment. The neurological score of female (A) and male (B) SODG93A
mice treated with C6 ODN or
PBS was assessed daily from day 50 onwards on a scale of 0 to 4, with 0 being normal and 4 being
completely paralyzed of both hind legs. (A)The neurological disability decreased significantly in female
SODG93A
treated with C6 ODN compared to the PBS treated controls (p=0.002). (B) No effect in the
neurological disability was observed in the male SODG93A
mice treated with C6 ODN compared to the
PBS treated controls (p=0.997).
Discussion
Components of the innate immune system have been implicated in the pathogenesis
of ALS. Especially, complement activation has long been implicated in the
pathogenesis of ALS, with numerous clinical and animal studies demonstrating
strong complement factor up-regulation, including C1q and C3, in regions of motor
neuron death [30]. We recently showed complement components C1q, C3 and MAC
deposited on motor endplates of SOD1G93A mice before appearance of clinical
symptoms, suggesting that complement activation might play an early role in the
disease [27]. In addition, we showed C1q and MAC deposition on the motor
endplates of ALS patients before denervation, suggesting that complement plays an
early role in ALS patients [28]. Recently, the terminal MAC has been shown to
activate inflammasome NLRP3 in macrophages and thereby activate caspase 1 and
promote the release of IL1-b and IL-18. This process is suggested to induce
inflammatory immune responses that may contribute to damage in disease [31].
To analyze the role of the terminal pathway in the disease, we tested whether
inhibition of the terminal pathway using C6 antisense oligonucleotides, which
downregulates C6 and prevents formation of MAC has an effect on the survival and
neurological disabilities in the SOD1G93A mouse model of familial ALS. Our dose
finding study in the SOD1G93A transgenic mice showed a marginal effect of the ODN
on the levels of red blood cells, hemoglobin, hematocrit, red cell distribution width
and neutrophils after treatment with a higher dose than 1 mg/kg/day of C6 mRNA
antagonist. Long term toxicity is an important issue in this types of studies, therefore,
to avoid introduction of confounding factors, we have treated animals with a low dose
of 1mg/kg/day. Animals have to be doses for a long period, starting at day 50. Since
the expression of C6 mRNA is much lower in female than male SOD1G93A mice, we
7
C6 inhibition in the SOD1G93A mouse
231
Figure 5. Reduction of the neurological disability in female SODG93A
mice following C6 ODN
treatment. The neurological score of female (A) and male (B) SODG93A
mice treated with C6 ODN or
PBS was assessed daily from day 50 onwards on a scale of 0 to 4, with 0 being normal and 4 being
completely paralyzed of both hind legs. (A)The neurological disability decreased significantly in female
SODG93A
treated with C6 ODN compared to the PBS treated controls (p=0.002). (B) No effect in the
neurological disability was observed in the male SODG93A
mice treated with C6 ODN compared to the
PBS treated controls (p=0.997).
Discussion
Components of the innate immune system have been implicated in the pathogenesis
of ALS. Especially, complement activation has long been implicated in the
pathogenesis of ALS, with numerous clinical and animal studies demonstrating
strong complement factor up-regulation, including C1q and C3, in regions of motor
neuron death [30]. We recently showed complement components C1q, C3 and MAC
deposited on motor endplates of SOD1G93A mice before appearance of clinical
symptoms, suggesting that complement activation might play an early role in the
disease [27]. In addition, we showed C1q and MAC deposition on the motor
endplates of ALS patients before denervation, suggesting that complement plays an
early role in ALS patients [28]. Recently, the terminal MAC has been shown to
activate inflammasome NLRP3 in macrophages and thereby activate caspase 1 and
promote the release of IL1-b and IL-18. This process is suggested to induce
inflammatory immune responses that may contribute to damage in disease [31].
To analyze the role of the terminal pathway in the disease, we tested whether
inhibition of the terminal pathway using C6 antisense oligonucleotides, which
downregulates C6 and prevents formation of MAC has an effect on the survival and
neurological disabilities in the SOD1G93A mouse model of familial ALS. Our dose
finding study in the SOD1G93A transgenic mice showed a marginal effect of the ODN
on the levels of red blood cells, hemoglobin, hematocrit, red cell distribution width
and neutrophils after treatment with a higher dose than 1 mg/kg/day of C6 mRNA
antagonist. Long term toxicity is an important issue in this types of studies, therefore,
to avoid introduction of confounding factors, we have treated animals with a low dose
of 1mg/kg/day. Animals have to be doses for a long period, starting at day 50. Since
the expression of C6 mRNA is much lower in female than male SOD1G93A mice, we
Chapter 7
232
anticipated on a specific effect in females. Therefore, we compared males and
females at the lowest dose (1 mg/kg/day) expecting so see an effect if any in females
and not in males.
We detected changes in body weight, onset, survival and neurological disability
between the treated female SOD1G93A mice when compared to vehicle controls.
Although only a significant difference was found for the neurological disability, there
seems to be a trend that the female SOD1G93A mice perform better than the vehicle
controls. In the male mice, the C6 ODN treated male SOD1G93A mice behaved similar
to vehicle treated animals. No trend or significant difference was observed in body
weight, onset, survival and neurological disability.
Although a role for complement has been suggested in ALS, its contribution to
disease progression in animal models for ALS is controversial. Previously, Lobsiger
et al. demonstrated that SOD-1 transgenic mice deficient in complement components
C1q and C3 do not have extended survival, concluding that the upstream
complement components do not affect overall disease in familial ALS [32]. Another
study showed that suppressing complement-mediated inflammation in SOD1G93A ALS
rats, either by treating with a selective complement C5a receptor (CD88) antagonist
or by analyzing CD88-deleted SOD1G93A mice extends survival [26]. This data
suggests that if there is a role for complement in ALS, there might be an important
role for the terminal pathway of the complement system. The terminal complement
pathway can get activated in absence of C1q and C3 via the “extrinsic pathway,”
which can bypass the traditional upstream activation pathways that rely on
complement factor C3 [33]. In addition, C3a and C5a has shown to be locally
produced by antigen presenting cells and T cells facilitating T cell activation and
cytokine production, showing that complement can also be locally produced [34].
We show that female C6 ODN -treated mice maintained a body weight when
considering group average body weight over time. At the end-stage of the disease
(day120) the vehicle control mice dropped in weight while the treated mice that were
still alive maintained their body weight, suggesting an effect of the treatment on the
body weight in the female SOD1G93A mice.
Seven out of the 12 C6 ODN treated female SOD1G93A had a later onset of the
disease compared to vehicle controls. Some treated females survived longer than the
vehicle treated animals. However, three female mice died earlier than expected. This
was not observed in males that were treated with 1mg/kg/day of C6 ODN. We have
no explanation for the early death of the 3 females.
Neurological score progression, showed that C6 ODN treated SOD1G93A female
animals progressed slower than their PBS treated controls. Although, this effects
were not observed in male SOD1G93A our data suggests that treatment with 1
mg/kg/day continuously infused subcutaneous C6 ODN, had an effect on female
SOD1G93A mice. The difference in outcome of the disease between male and female
SOD1G93A mice might be explained by the ten-fold difference in C6 levels in the male
SOD1G93A mice compared to females. Therefore, we suggest that a higher
concentration of C6 ODN might have an effect on the outcome of the disease in male
SOD1G93A mice.
7
C6 inhibition in the SOD1G93A mouse
233
anticipated on a specific effect in females. Therefore, we compared males and
females at the lowest dose (1 mg/kg/day) expecting so see an effect if any in females
and not in males.
We detected changes in body weight, onset, survival and neurological disability
between the treated female SOD1G93A mice when compared to vehicle controls.
Although only a significant difference was found for the neurological disability, there
seems to be a trend that the female SOD1G93A mice perform better than the vehicle
controls. In the male mice, the C6 ODN treated male SOD1G93A mice behaved similar
to vehicle treated animals. No trend or significant difference was observed in body
weight, onset, survival and neurological disability.
Although a role for complement has been suggested in ALS, its contribution to
disease progression in animal models for ALS is controversial. Previously, Lobsiger
et al. demonstrated that SOD-1 transgenic mice deficient in complement components
C1q and C3 do not have extended survival, concluding that the upstream
complement components do not affect overall disease in familial ALS [32]. Another
study showed that suppressing complement-mediated inflammation in SOD1G93A ALS
rats, either by treating with a selective complement C5a receptor (CD88) antagonist
or by analyzing CD88-deleted SOD1G93A mice extends survival [26]. This data
suggests that if there is a role for complement in ALS, there might be an important
role for the terminal pathway of the complement system. The terminal complement
pathway can get activated in absence of C1q and C3 via the “extrinsic pathway,”
which can bypass the traditional upstream activation pathways that rely on
complement factor C3 [33]. In addition, C3a and C5a has shown to be locally
produced by antigen presenting cells and T cells facilitating T cell activation and
cytokine production, showing that complement can also be locally produced [34].
We show that female C6 ODN -treated mice maintained a body weight when
considering group average body weight over time. At the end-stage of the disease
(day120) the vehicle control mice dropped in weight while the treated mice that were
still alive maintained their body weight, suggesting an effect of the treatment on the
body weight in the female SOD1G93A mice.
Seven out of the 12 C6 ODN treated female SOD1G93A had a later onset of the
disease compared to vehicle controls. Some treated females survived longer than the
vehicle treated animals. However, three female mice died earlier than expected. This
was not observed in males that were treated with 1mg/kg/day of C6 ODN. We have
no explanation for the early death of the 3 females.
Neurological score progression, showed that C6 ODN treated SOD1G93A female
animals progressed slower than their PBS treated controls. Although, this effects
were not observed in male SOD1G93A our data suggests that treatment with 1
mg/kg/day continuously infused subcutaneous C6 ODN, had an effect on female
SOD1G93A mice. The difference in outcome of the disease between male and female
SOD1G93A mice might be explained by the ten-fold difference in C6 levels in the male
SOD1G93A mice compared to females. Therefore, we suggest that a higher
concentration of C6 ODN might have an effect on the outcome of the disease in male
SOD1G93A mice.
Chapter 7
234
Conclusions
Overall, we show that the current treatment regimen resulted in differences in female
treated SOD1G93A mice compared to controls but did not significantly improve the
timing of disease onset, the rate of neurological disease progression, or extend
survival in males.
This study suggests that complement inhibition in female SOD G93A mice might
reduce disease severity, based on the results of the female SOD1G93A mice. The lack
of effects in male SOD1G93A mice prevents us to convincingly show that the
hypothesis is correct. Further investigations on the role of C6 in familial ALS disease
progression with a higher dose of the C6 inhibitor are needed.
Acknowledgements
We thank Prof. A.H. Zwinderman from the Clinical Methods & Public Health department of the
Academic Medical Center Amsterdam for the support on the statistical analysis of the data.
Funding acknowledgements
We thank the Netherlands Organization for Scientific Research (NWO) for supporting this work. NWO
Mozaiek grant to NBEI [grant number 017.009.026].
Conflict of Interest
FB and KF are founders of Regenesance BV and are listed as inventors on patents owned by
Regensence BV regarding C6 inhibition for clinical applications.
References
1. Rothstein JD. Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009 Jan;65 Suppl 1:S3-S9.
2. Engelhardt JI, Tajti J, Appel SH. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993 Jan;50(1):30-6.
3. McGeer PL, McGeer EG. Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002 Oct;26(4):459-70.
4. Chiu IM, Phatnani H, Kuligowski M, et al. Activation of innate and humoral immunity in the peripheral nervous system of ALS transgenic mice. Proc Natl Acad Sci U S A 2009 Dec 8;106(49):20960-5.
5. Dibaj P, Steffens H, Zschuntzsch J, et al. In Vivo imaging reveals distinct inflammatory activity of CNS microglia versus PNS macrophages in a mouse model for ALS. PLoS One 2011;6(3):e17910.
6. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011 Jun;42(3):211-20.
7. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
8. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
9. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol 2007 Jan;7(1):9-18.
10. Cole DS, Morgan BP. Beyond lysis: how complement influences cell fate. Clin Sci (Lond) 2003 May;104(5):455-66.
11. Ramaglia V, King RH, Nourallah M, et al. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 2007 Jul 18;27(29):7663-72.
12. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
13. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
14. Stahel PF, Morganti-Kossmann MC, Perez D, et al. Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001 Aug;18(8):773-81.
15. Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR. Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997 Mar;73(1-2):63-9.
16. Leinhase I, Holers VM, Thurman JM, et al. Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
17. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003 Sep;23(9):1070-4.
7
C6 inhibition in the SOD1G93A mouse
235
Conclusions
Overall, we show that the current treatment regimen resulted in differences in female
treated SOD1G93A mice compared to controls but did not significantly improve the
timing of disease onset, the rate of neurological disease progression, or extend
survival in males.
This study suggests that complement inhibition in female SOD G93A mice might
reduce disease severity, based on the results of the female SOD1G93A mice. The lack
of effects in male SOD1G93A mice prevents us to convincingly show that the
hypothesis is correct. Further investigations on the role of C6 in familial ALS disease
progression with a higher dose of the C6 inhibitor are needed.
Acknowledgements
We thank Prof. A.H. Zwinderman from the Clinical Methods & Public Health department of the
Academic Medical Center Amsterdam for the support on the statistical analysis of the data.
Funding acknowledgements
We thank the Netherlands Organization for Scientific Research (NWO) for supporting this work. NWO
Mozaiek grant to NBEI [grant number 017.009.026].
Conflict of Interest
FB and KF are founders of Regenesance BV and are listed as inventors on patents owned by
Regensence BV regarding C6 inhibition for clinical applications.
References
1. Rothstein JD. Current hypotheses for the underlying biology of amyotrophic lateral sclerosis. Ann Neurol 2009 Jan;65 Suppl 1:S3-S9.
2. Engelhardt JI, Tajti J, Appel SH. Lymphocytic infiltrates in the spinal cord in amyotrophic lateral sclerosis. Arch Neurol 1993 Jan;50(1):30-6.
3. McGeer PL, McGeer EG. Inflammatory processes in amyotrophic lateral sclerosis. Muscle Nerve 2002 Oct;26(4):459-70.
4. Chiu IM, Phatnani H, Kuligowski M, et al. Activation of innate and humoral immunity in the peripheral nervous system of ALS transgenic mice. Proc Natl Acad Sci U S A 2009 Dec 8;106(49):20960-5.
5. Dibaj P, Steffens H, Zschuntzsch J, et al. In Vivo imaging reveals distinct inflammatory activity of CNS microglia versus PNS macrophages in a mouse model for ALS. PLoS One 2011;6(3):e17910.
6. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011 Jun;42(3):211-20.
7. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
8. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
9. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol 2007 Jan;7(1):9-18.
10. Cole DS, Morgan BP. Beyond lysis: how complement influences cell fate. Clin Sci (Lond) 2003 May;104(5):455-66.
11. Ramaglia V, King RH, Nourallah M, et al. The membrane attack complex of the complement system is essential for rapid Wallerian degeneration. J Neurosci 2007 Jul 18;27(29):7663-72.
12. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
13. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
14. Stahel PF, Morganti-Kossmann MC, Perez D, et al. Intrathecal levels of complement-derived soluble membrane attack complex (sC5b-9) correlate with blood-brain barrier dysfunction in patients with traumatic brain injury. J Neurotrauma 2001 Aug;18(8):773-81.
15. Kossmann T, Stahel PF, Morganti-Kossmann MC, Jones JL, Barnum SR. Elevated levels of the complement components C3 and factor B in ventricular cerebrospinal fluid of patients with traumatic brain injury. J Neuroimmunol 1997 Mar;73(1-2):63-9.
16. Leinhase I, Holers VM, Thurman JM, et al. Reduced neuronal cell death after experimental brain injury in mice lacking a functional alternative pathway of complement activation. BMC Neurosci 2006;7:55.
17. Rancan M, Morganti-Kossmann MC, Barnum SR, et al. Central nervous system-targeted complement inhibition mediates neuroprotection after closed head injury in transgenic mice. J Cereb Blood Flow Metab 2003 Sep;23(9):1070-4.
Chapter 7
236
18. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004 Dec;21(12):1831-46.
19. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007 Feb;44(5):999-1010.
20. Annunziata P, Volpi N. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol Scand 1985 Jul;72(1):61-4.
21. Apostolski S, Nikolic J, Bugarski-Prokopljevic C, Miletic V, Pavlovic S, Filipovic S. Serum and CSF immunological findings in ALS. Acta Neurol Scand 1991 Feb;83(2):96-8.
22. Tsuboi Y, Yamada T. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 1994 Jul;57(7):859-61.
23. Goldknopf IL, Sheta EA, Bryson J, et al. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem Biophys Res Commun 2006 Apr 21;342(4):1034-9.
24. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007 May 1;104(18):7319-26.
25. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007 Aug 22;27(34):9201-19.
26. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008 Dec 15;181(12):8727-34.
27. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011 Jun;235(1-2):104-9.
28. Bahia E, I, Bosch S, Ramaglia V, Aronica E, Baas F, Troost D. Complement activation at the motor end-plates in amyotrophic lateral sclerosis. J Neuroinflammation 2016;13(1):72.
29. Scott S, Kranz JE, Cole J, et al. Design, power, and interpretation of studies in the standard murine model of ALS. Amyotroph Lateral Scler 2008;9(1):4-15.
30. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
31. Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM. Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 2016 May 1;129(9):1928-39.
32. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013 Nov 12;110(46):E4385-E4392.
33. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006 Jun;12(6):682-7.
34. Strainic MG, Liu J, Huang D, et al. Locally produced complement fragments C5a and C3a provide both costimulatory and survival signals to naive CD4+ T cells. Immunity 2008 Mar;28(3):425-35.
SUPPLEMENTARY FIGURE
Supplement Figure 1. Body weight maintained in the C6 ODN treated female SOD1G93A
mice.
Bodyweight of female (A) and male (B) SOD1G93A
mice treated subcutaneously with PBS (red) or 1
mg/kg/day C6 ODN (blue) was daily measured starting from day 50, showing that (A) female C6 ODN
-treated animals maintain the body weight considering group average body weight over time, but gain
weight at the end-stage of the disease. The vehicle control female mice drop weight at the end-stage
of the disease. (B) No difference was observed in bodyweight of the male C6 ODN -treated animals
compared to the controls.
7
C6 inhibition in the SOD1G93A mouse
237
18. Anderson AJ, Robert S, Huang W, Young W, Cotman CW. Activation of complement pathways after contusion-induced spinal cord injury. J Neurotrauma 2004 Dec;21(12):1831-46.
19. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007 Feb;44(5):999-1010.
20. Annunziata P, Volpi N. High levels of C3c in the cerebrospinal fluid from amyotrophic lateral sclerosis patients. Acta Neurol Scand 1985 Jul;72(1):61-4.
21. Apostolski S, Nikolic J, Bugarski-Prokopljevic C, Miletic V, Pavlovic S, Filipovic S. Serum and CSF immunological findings in ALS. Acta Neurol Scand 1991 Feb;83(2):96-8.
22. Tsuboi Y, Yamada T. Increased concentration of C4d complement protein in CSF in amyotrophic lateral sclerosis. J Neurol Neurosurg Psychiatry 1994 Jul;57(7):859-61.
23. Goldknopf IL, Sheta EA, Bryson J, et al. Complement C3c and related protein biomarkers in amyotrophic lateral sclerosis and Parkinson's disease. Biochem Biophys Res Commun 2006 Apr 21;342(4):1034-9.
24. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007 May 1;104(18):7319-26.
25. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007 Aug 22;27(34):9201-19.
26. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008 Dec 15;181(12):8727-34.
27. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011 Jun;235(1-2):104-9.
28. Bahia E, I, Bosch S, Ramaglia V, Aronica E, Baas F, Troost D. Complement activation at the motor end-plates in amyotrophic lateral sclerosis. J Neuroinflammation 2016;13(1):72.
29. Scott S, Kranz JE, Cole J, et al. Design, power, and interpretation of studies in the standard murine model of ALS. Amyotroph Lateral Scler 2008;9(1):4-15.
30. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
31. Suresh R, Chandrasekaran P, Sutterwala FS, Mosser DM. Complement-mediated 'bystander' damage initiates host NLRP3 inflammasome activation. J Cell Sci 2016 May 1;129(9):1928-39.
32. Lobsiger CS, Boillee S, Pozniak C, et al. C1q induction and global complement pathway activation do not contribute to ALS toxicity in mutant SOD1 mice. Proc Natl Acad Sci U S A 2013 Nov 12;110(46):E4385-E4392.
33. Huber-Lang M, Sarma JV, Zetoune FS, et al. Generation of C5a in the absence of C3: a new complement activation pathway. Nat Med 2006 Jun;12(6):682-7.
34. Strainic MG, Liu J, Huang D, et al. Locally produced complement fragments C5a and C3a provide both costimulatory and survival signals to naive CD4+ T cells. Immunity 2008 Mar;28(3):425-35.
SUPPLEMENTARY FIGURE
Supplement Figure 1. Body weight maintained in the C6 ODN treated female SOD1G93A
mice.
Bodyweight of female (A) and male (B) SOD1G93A
mice treated subcutaneously with PBS (red) or 1
mg/kg/day C6 ODN (blue) was daily measured starting from day 50, showing that (A) female C6 ODN
-treated animals maintain the body weight considering group average body weight over time, but gain
weight at the end-stage of the disease. The vehicle control female mice drop weight at the end-stage
of the disease. (B) No difference was observed in bodyweight of the male C6 ODN -treated animals
compared to the controls.
Discussion & Summary
Neuroinflammation caused by complement effects inherited and acquired
disease progression
Discussion & Summary
Neuroinflammation caused by complement effects inherited and acquired
disease progression
8
Chapter 8
240
Discussion & Summary
Neurodegeneration is a key aspect of a large number of diseases including;
Parkinson’s disease, Alzheimer, Amyotrophic lateral sclerosis and many more.
Although these are different diseases, they have a common feature; immune
activation and inflammation. Immune activation has physiological roles and maintains
homeostatis in the body. But unbalanced or uncontrolled activation of the immune
system may result in inflammation and pathology in different neurodegenerative
diseases.
Mechanisms underlying neuroinflammation have been a focus of research in the past
decades. Emerging evidence indicates that neuroinflammation is caused by a local
immune response and contributes to neurodegeneration. Neuroinflammation is of
interest because it might contribute to neuronal dysfunction, loss of neurons and
axons in neurodegenerative diseases due to the production of neurotoxic mediators.
A better understanding of the interaction of the inflammatory components of the
immune system with damaged or stressed tissue is crucial to determine the beneficial
effects for therapeutic strategies. A major unanswered question is whether
pharmacological inhibition of inflammatory components or inflammation pathways is
able to slow down the course of disease in man.
Both the innate and adaptive immune response are involved in neurodegeneration.
Pattern Recognition Receptors (PRRs) are an important part of the immune system.
Cells of the innate immune system express these receptors, which recognize
pathogen-associated molecular patterns (PAMPs) from pathogens or danger-
associated molecular patterns (DAMPs) from damaged or stressed tissue.
After injury or disease PRRs can trigger cells to develop an immune responses by
sensing PAMPs or DAMPs in the environment. Toll like receptors (TLRs) are
important PRRs involved in triggering the innate immune response. This leads to the
activation of transcription factor NFkb, the expression of pro-inflammatory genes,
increased levels of the inflammatory cytokines, and consequently activation of the
adaptive immune response.
The recognition of PAMPs and DAMPs include the detection of altered self cells and
discrimination from non-self that is not dangerous and pathogens [1]. When this
discrimination between dangerous signals and non- harmful signals is not made this
leads to autoimmunity.
The complement system has been regarded as a key player in adaptive immunity [2].
It is a bridge between de innate and adaptive immune response. It consists of soluble
and membrane associated proteins, that get activated via three pathways whereby
one protein promotes the sequential binding of the following protein [3]. Regardless
of the trigger, activation results in the cleavage of C3, followed by cleavage of C5 and
formation of the membrane attack complex (MAC), which forms pores in the cell
membrane resulting in lysis of the target cell. The complement system plays an
important role in the defense against pathogens by identifying, opsonizing and lysis
of the infected cells. Activation of the complement system by PAMPs induces C3
and C5 cleavage and generates anaphylatoxins C3a and C5a as well as the opsonin
C3b [4]. Different phagocytic cells take up opsonized pathogens and provoke their
lysis by MAC [5] and anaphylatoxins mediate the migration and recruitment of
immune cells to the site of infection, were acute inflammatory reaction is initiated [4,
6].
8
Discussion & Summary
241
Discussion & Summary
Neurodegeneration is a key aspect of a large number of diseases including;
Parkinson’s disease, Alzheimer, Amyotrophic lateral sclerosis and many more.
Although these are different diseases, they have a common feature; immune
activation and inflammation. Immune activation has physiological roles and maintains
homeostatis in the body. But unbalanced or uncontrolled activation of the immune
system may result in inflammation and pathology in different neurodegenerative
diseases.
Mechanisms underlying neuroinflammation have been a focus of research in the past
decades. Emerging evidence indicates that neuroinflammation is caused by a local
immune response and contributes to neurodegeneration. Neuroinflammation is of
interest because it might contribute to neuronal dysfunction, loss of neurons and
axons in neurodegenerative diseases due to the production of neurotoxic mediators.
A better understanding of the interaction of the inflammatory components of the
immune system with damaged or stressed tissue is crucial to determine the beneficial
effects for therapeutic strategies. A major unanswered question is whether
pharmacological inhibition of inflammatory components or inflammation pathways is
able to slow down the course of disease in man.
Both the innate and adaptive immune response are involved in neurodegeneration.
Pattern Recognition Receptors (PRRs) are an important part of the immune system.
Cells of the innate immune system express these receptors, which recognize
pathogen-associated molecular patterns (PAMPs) from pathogens or danger-
associated molecular patterns (DAMPs) from damaged or stressed tissue.
After injury or disease PRRs can trigger cells to develop an immune responses by
sensing PAMPs or DAMPs in the environment. Toll like receptors (TLRs) are
important PRRs involved in triggering the innate immune response. This leads to the
activation of transcription factor NFkb, the expression of pro-inflammatory genes,
increased levels of the inflammatory cytokines, and consequently activation of the
adaptive immune response.
The recognition of PAMPs and DAMPs include the detection of altered self cells and
discrimination from non-self that is not dangerous and pathogens [1]. When this
discrimination between dangerous signals and non- harmful signals is not made this
leads to autoimmunity.
The complement system has been regarded as a key player in adaptive immunity [2].
It is a bridge between de innate and adaptive immune response. It consists of soluble
and membrane associated proteins, that get activated via three pathways whereby
one protein promotes the sequential binding of the following protein [3]. Regardless
of the trigger, activation results in the cleavage of C3, followed by cleavage of C5 and
formation of the membrane attack complex (MAC), which forms pores in the cell
membrane resulting in lysis of the target cell. The complement system plays an
important role in the defense against pathogens by identifying, opsonizing and lysis
of the infected cells. Activation of the complement system by PAMPs induces C3
and C5 cleavage and generates anaphylatoxins C3a and C5a as well as the opsonin
C3b [4]. Different phagocytic cells take up opsonized pathogens and provoke their
lysis by MAC [5] and anaphylatoxins mediate the migration and recruitment of
immune cells to the site of infection, were acute inflammatory reaction is initiated [4,
6].
Chapter 8
242
Humans deficiencies of complement components can result in a wide range of
diseases [7, 8]. Deficiencies in the classical pathway components C1 and C4 are
associated with an increased incidence of immune complex disease and recurrent
bacterial infection. A common immune complex disease is systemic lupus
erythematosus (SLE) [9]. Complement deficiency in this case leads to the failure to
clear circulating immune complexes. Consecutively this leads to the deposition of the
complexes in tissues and an associated inflammatory response. Deficiencies for C2
are also associated with frequent bacterial infection and an increased risk of
cardiovascular disease. In addition, deficiencies in complement component C3
results in problems with the coating of pathogenic cells with opsonin to promote
phagocytosis. This deficiency can lead to severe recurrent infections, such as sepsis
early in life. On the other hand deficiencies of the components of the terminal
complement pathway (C5-C9) result in less serious infections and have a better
prognosis.
Complement also plays an important role in synapse remodeling during development,
showing a direct link between nerve elimination and complement. Activated
complement components are soluble and can drift from their site of activation to
adjacent areas, MAC can damage adjacent healthy tissue and enhance inflammation
[5, 10], thereby resulting in more tissue damage. We have shown that formation of
the MAC contributes to early clearance of myelin proteins and to axonal damage after
traumatic injury of the peripheral nerve, while inhibition of MAC formation reduces
nerve damage and improves regeneration and functional recovery [11-13]. Activation
of the complement system occurs early in the disease process and persists while
disease progresses. Regulators of the complement system permit elimination of
pathogens or dead cells without injuring the host. When this balance is disrupted,
complement activation causes injury to the host and contributes to pathology in
various diseases [14-16]. In this way complement can be a continuous source of
neuroinflammation.
Complement proteins are abundantly present in most neurodegenerative diseases
and can have pathological roles in neurological conditions offers broad scope for
therapeutic intervention. Our hypothesis is that MAC may play an important role in
nerve damage and that inhibition of MAC, using a C6 antisence/ RNA antagonist, is
protective. In this thesis I describe research in which we tested whether this is the
case in an animal model of M.leprae induced nerve damage and in the SOD1G93A
mouse model of Amyotrophic lateral sclerosis.
MAC contributes to pathology in a model of M. leprae induced nerve damage
Nerve damage in leprosy is widely regarded as an important problem in patients,
persisting long after the patients have completed treatment [17]. However, the nerve
damage should be regarded as an early sign of leprosy, because the loss of
sensation in patients with suspected leprosy is considered the hall mark of early
disease [18]. Despite advances in our knowledge of the pathogenesis of leprosy
spectrum, the understanding of the mechanisms of nerve damage in leprosy-
associated neuropathy remains poor. Progress has been limited by the lack of
established experimental models for studying leprosy-induced neuropathy. Here we
used a mouse model of M .leprae-induced nerve damage to test whether inhibition of
MAC using an C6 antisense/ RNA antagonist is protective.
8
Discussion & Summary
243
Humans deficiencies of complement components can result in a wide range of
diseases [7, 8]. Deficiencies in the classical pathway components C1 and C4 are
associated with an increased incidence of immune complex disease and recurrent
bacterial infection. A common immune complex disease is systemic lupus
erythematosus (SLE) [9]. Complement deficiency in this case leads to the failure to
clear circulating immune complexes. Consecutively this leads to the deposition of the
complexes in tissues and an associated inflammatory response. Deficiencies for C2
are also associated with frequent bacterial infection and an increased risk of
cardiovascular disease. In addition, deficiencies in complement component C3
results in problems with the coating of pathogenic cells with opsonin to promote
phagocytosis. This deficiency can lead to severe recurrent infections, such as sepsis
early in life. On the other hand deficiencies of the components of the terminal
complement pathway (C5-C9) result in less serious infections and have a better
prognosis.
Complement also plays an important role in synapse remodeling during development,
showing a direct link between nerve elimination and complement. Activated
complement components are soluble and can drift from their site of activation to
adjacent areas, MAC can damage adjacent healthy tissue and enhance inflammation
[5, 10], thereby resulting in more tissue damage. We have shown that formation of
the MAC contributes to early clearance of myelin proteins and to axonal damage after
traumatic injury of the peripheral nerve, while inhibition of MAC formation reduces
nerve damage and improves regeneration and functional recovery [11-13]. Activation
of the complement system occurs early in the disease process and persists while
disease progresses. Regulators of the complement system permit elimination of
pathogens or dead cells without injuring the host. When this balance is disrupted,
complement activation causes injury to the host and contributes to pathology in
various diseases [14-16]. In this way complement can be a continuous source of
neuroinflammation.
Complement proteins are abundantly present in most neurodegenerative diseases
and can have pathological roles in neurological conditions offers broad scope for
therapeutic intervention. Our hypothesis is that MAC may play an important role in
nerve damage and that inhibition of MAC, using a C6 antisence/ RNA antagonist, is
protective. In this thesis I describe research in which we tested whether this is the
case in an animal model of M.leprae induced nerve damage and in the SOD1G93A
mouse model of Amyotrophic lateral sclerosis.
MAC contributes to pathology in a model of M. leprae induced nerve damage
Nerve damage in leprosy is widely regarded as an important problem in patients,
persisting long after the patients have completed treatment [17]. However, the nerve
damage should be regarded as an early sign of leprosy, because the loss of
sensation in patients with suspected leprosy is considered the hall mark of early
disease [18]. Despite advances in our knowledge of the pathogenesis of leprosy
spectrum, the understanding of the mechanisms of nerve damage in leprosy-
associated neuropathy remains poor. Progress has been limited by the lack of
established experimental models for studying leprosy-induced neuropathy. Here we
used a mouse model of M .leprae-induced nerve damage to test whether inhibition of
MAC using an C6 antisense/ RNA antagonist is protective.
Chapter 8
244
Previous studies showed that loss of myelin proteins can be induced by M. leprae in
the absence of lymphocytes in Rag knockout mice [19]. These data suggest the
existence of host innate factors that interact with a pathogen-associated molecule
(PAM) causing the initial damage. Mannose Binding lectin (MBL) contains
carbohydrate recognition domains. During bacterial infections MBL mediates defence
phagocytosis and extracellular complement activation via the lectin pathway.
In Chapter 2 of this thesis we demonstrated that M.leprae lipoarabinomannan (LAM)
is the most dominant activator of the complement system mainly via MBL/ the lectin
pathway. We suggest that LAM interacts with the nerve and initiates complement
activation resulting in the in situ formation of the MAC, causing nerve damage. In a
model of M.leprae induced nerve damage we show that preventing MAC formation by
antisense oligonucleotide-based therapy protects the nerve from M. leprae-induced
damage, implying a role for the complement pathway in M. leprae associated nerve
damage. Antibodies to mycobacterial antigens, such as lipoarabinomannan (LAM)
are found in leprosy patients, suggesting an immune response to the M.leprae
antigens [20]. Deposits of MAC are detected in thickened cutaneous sensory nerves
of leprosy patients, suggesting a role for MAC in leprosy pathology [21].
We explored the extent of complement deposition, including MAC, in series of nerve
biopsies from patients with full blown leprosy at either of the two poles of the disease
spectrum, showing an association between the amount of MAC deposition and LAM
immunoreactivity in nerves of leprosy patients. LAM persists in lesions of leprosy
patients long after treatment. Antigens from dead bacilli can provoke immunological
reactions, such as reversal reaction, causing serious nerve damage and subsequent
disabilities. M. leprae antigens can trigger complement activation. A previous studies
showed the localization of persisting M. leprae antigens in leprosy patients with
nerve damage, even after treatment [22, 23]. In addition, IgG anti-LAM antibody
levels remained stable or increased, while PGL-1 antibodies decreased after
treatment [24]. Both RR and ENL reactions appear to be due to the persistence of
antigens like lipoarabinomannan (LAM) or PGL-I [25]. Altogether, our findings
strongly point to an important role of complement in chronic nerve damage in leprosy.
Terminal Complement Complex elevated In Reactional Leprosy
Leprosy patients can change in clinical and immunohistopathological status during
the course of the disease. This is common for patients during or after treatment, that
could develop a reaction. Previous studies have also indicated an important role for
complement in the disease, showing a normal or increased level of complement
components by serological and pathological studies [26]. Therefore we examined
whether increased systemic levels of complement activation could be detected in
leprosy patients and whether complement products and regulators might be useful
markers of leprosy disease state. In Chapter 3 we show that the activation products
terminal complement complex (TCC), C4d and iC3b were specifically elevated in
Bangladeshi patients with reaction at intake compared to endemic controls. In
addition, levels of the regulator Clusterin were also elevated in MB patients
irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that
irrespective of a reaction, serum TCC levels were significantly increased in patients
with reactions compared to patients without reactions. Our data also showed that
TCC levels stayed elevated after treatment, this suggests that treatment with either
MDT or steroids does not lower complement activation in reaction patients,
reinforcing the possibility that complement contributes to the nerve damage in these
8
Discussion & Summary
245
Previous studies showed that loss of myelin proteins can be induced by M. leprae in
the absence of lymphocytes in Rag knockout mice [19]. These data suggest the
existence of host innate factors that interact with a pathogen-associated molecule
(PAM) causing the initial damage. Mannose Binding lectin (MBL) contains
carbohydrate recognition domains. During bacterial infections MBL mediates defence
phagocytosis and extracellular complement activation via the lectin pathway.
In Chapter 2 of this thesis we demonstrated that M.leprae lipoarabinomannan (LAM)
is the most dominant activator of the complement system mainly via MBL/ the lectin
pathway. We suggest that LAM interacts with the nerve and initiates complement
activation resulting in the in situ formation of the MAC, causing nerve damage. In a
model of M.leprae induced nerve damage we show that preventing MAC formation by
antisense oligonucleotide-based therapy protects the nerve from M. leprae-induced
damage, implying a role for the complement pathway in M. leprae associated nerve
damage. Antibodies to mycobacterial antigens, such as lipoarabinomannan (LAM)
are found in leprosy patients, suggesting an immune response to the M.leprae
antigens [20]. Deposits of MAC are detected in thickened cutaneous sensory nerves
of leprosy patients, suggesting a role for MAC in leprosy pathology [21].
We explored the extent of complement deposition, including MAC, in series of nerve
biopsies from patients with full blown leprosy at either of the two poles of the disease
spectrum, showing an association between the amount of MAC deposition and LAM
immunoreactivity in nerves of leprosy patients. LAM persists in lesions of leprosy
patients long after treatment. Antigens from dead bacilli can provoke immunological
reactions, such as reversal reaction, causing serious nerve damage and subsequent
disabilities. M. leprae antigens can trigger complement activation. A previous studies
showed the localization of persisting M. leprae antigens in leprosy patients with
nerve damage, even after treatment [22, 23]. In addition, IgG anti-LAM antibody
levels remained stable or increased, while PGL-1 antibodies decreased after
treatment [24]. Both RR and ENL reactions appear to be due to the persistence of
antigens like lipoarabinomannan (LAM) or PGL-I [25]. Altogether, our findings
strongly point to an important role of complement in chronic nerve damage in leprosy.
Terminal Complement Complex elevated In Reactional Leprosy
Leprosy patients can change in clinical and immunohistopathological status during
the course of the disease. This is common for patients during or after treatment, that
could develop a reaction. Previous studies have also indicated an important role for
complement in the disease, showing a normal or increased level of complement
components by serological and pathological studies [26]. Therefore we examined
whether increased systemic levels of complement activation could be detected in
leprosy patients and whether complement products and regulators might be useful
markers of leprosy disease state. In Chapter 3 we show that the activation products
terminal complement complex (TCC), C4d and iC3b were specifically elevated in
Bangladeshi patients with reaction at intake compared to endemic controls. In
addition, levels of the regulator Clusterin were also elevated in MB patients
irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that
irrespective of a reaction, serum TCC levels were significantly increased in patients
with reactions compared to patients without reactions. Our data also showed that
TCC levels stayed elevated after treatment, this suggests that treatment with either
MDT or steroids does not lower complement activation in reaction patients,
reinforcing the possibility that complement contributes to the nerve damage in these
Chapter 8
246
patients. These findings imply that the analysis of the complement system might be
of value for the diagnosis and prognosis of leprosy disease status. Unfortunately, the
limitations of this study such as the samples being collected in the field situations and
the lack of EDTA in the serum samples, any elaborate interpretation regarding the
mechanism of high level of TCC in leprosy patients with reaction are not possible at
this stage of the study. The lack of especially EDTA in collection tubes might have
resulted in in vitro generation of TCC which continues in serum. On the other hand,
all the samples studied were processed similarly; therefore, any comparative values
relating the disease state is considered as true reflection. The best way forward
would be a prospective study on complement activation in leprosy, to confirm
conclusively whether circulating complement activation products such as TCC can be
applied as biomarkers for diagnosis of patients at a risk of developing a reaction.
A role for complement C3d on T cell function in leprosy
We demonstrated that M. leprae specific component LAM activates the complement
system and is associated with complement activation in nerves of leprosy patients.
Therefore, we were interested whether LAM deposition is also seen in conjunction
with the complement components C3d and MAC in the skin lesions of leprosy
patients and which cells are positive for complement activation products. This is
important to understand the role for complement in skin lesion pathology of leprosy
patients. In Chapter 4 I describe an analysis of complement and inflammatory cells in
skin lesions of leprosy patients. I demonstrate that C3d, MAC and LAM deposition
was significantly higher in the skin biopsies of multibacillary compared to
paucibacillary, with a significant association between the bacterial index/ LAM and
C3d or MAC in the skin biopsies of leprosy patients. In addition, MAC positivity was
increased in both ENL and RR skin lesions compared to non-reactional leprosy
patients.
Co-stimulation is essential for the development of an effective immune response. It
is well known that paucibacillary leprosy patients have a stronger cell mediated
immune response. For the activation of lymphocytes both antigen specific signal from
their antigen and co-stimulation are required. Co-stimulation for B cells can also be
provided by complement receptors. During an infection complement may be activated
resulting in C3b binding to the pathogens. C3b is degraded into a fragment iC3b or
C3b then cleaved to C3dg, and eventually to C3d. B cells express complement
receptor CR2 or CD21 to bind to C3d. CR2 on mature B cells forms a complex
with CD19 and CD81. This additional co-stimulation by C3d results in B-cell being
more sensitive to the antigens of this pathogen. Interestingly, different studies have
shown that a population of T cells also has a CR2 receptor for C3d binding [27-29]. In
skin lesions of paucibacillary patients we found C3d positive T-cells in and
surrounding granulomas, but hardly any MAC deposition compared to multibacillary
patients. C3d on the T-cells might be involved in co-stimulation by binding CR2 on T-
cells resulting in an enhanced cell mediated immune response in paucibacillary
patients. We considered that C3d might bind to CR2 expressed on the surface of T
cells and, by ligand–receptor interaction, result in T cell stimulation and
enhancement of the adaptive immune response. In this way, C3d might play an
important role in the inflammation in skin lesions of paucibacillary patients. Axons
were hardly detected in skin lesions of paucibacillary patients, probably the nerves
are destroyed.
8
Discussion & Summary
247
patients. These findings imply that the analysis of the complement system might be
of value for the diagnosis and prognosis of leprosy disease status. Unfortunately, the
limitations of this study such as the samples being collected in the field situations and
the lack of EDTA in the serum samples, any elaborate interpretation regarding the
mechanism of high level of TCC in leprosy patients with reaction are not possible at
this stage of the study. The lack of especially EDTA in collection tubes might have
resulted in in vitro generation of TCC which continues in serum. On the other hand,
all the samples studied were processed similarly; therefore, any comparative values
relating the disease state is considered as true reflection. The best way forward
would be a prospective study on complement activation in leprosy, to confirm
conclusively whether circulating complement activation products such as TCC can be
applied as biomarkers for diagnosis of patients at a risk of developing a reaction.
A role for complement C3d on T cell function in leprosy
We demonstrated that M. leprae specific component LAM activates the complement
system and is associated with complement activation in nerves of leprosy patients.
Therefore, we were interested whether LAM deposition is also seen in conjunction
with the complement components C3d and MAC in the skin lesions of leprosy
patients and which cells are positive for complement activation products. This is
important to understand the role for complement in skin lesion pathology of leprosy
patients. In Chapter 4 I describe an analysis of complement and inflammatory cells in
skin lesions of leprosy patients. I demonstrate that C3d, MAC and LAM deposition
was significantly higher in the skin biopsies of multibacillary compared to
paucibacillary, with a significant association between the bacterial index/ LAM and
C3d or MAC in the skin biopsies of leprosy patients. In addition, MAC positivity was
increased in both ENL and RR skin lesions compared to non-reactional leprosy
patients.
Co-stimulation is essential for the development of an effective immune response. It
is well known that paucibacillary leprosy patients have a stronger cell mediated
immune response. For the activation of lymphocytes both antigen specific signal from
their antigen and co-stimulation are required. Co-stimulation for B cells can also be
provided by complement receptors. During an infection complement may be activated
resulting in C3b binding to the pathogens. C3b is degraded into a fragment iC3b or
C3b then cleaved to C3dg, and eventually to C3d. B cells express complement
receptor CR2 or CD21 to bind to C3d. CR2 on mature B cells forms a complex
with CD19 and CD81. This additional co-stimulation by C3d results in B-cell being
more sensitive to the antigens of this pathogen. Interestingly, different studies have
shown that a population of T cells also has a CR2 receptor for C3d binding [27-29]. In
skin lesions of paucibacillary patients we found C3d positive T-cells in and
surrounding granulomas, but hardly any MAC deposition compared to multibacillary
patients. C3d on the T-cells might be involved in co-stimulation by binding CR2 on T-
cells resulting in an enhanced cell mediated immune response in paucibacillary
patients. We considered that C3d might bind to CR2 expressed on the surface of T
cells and, by ligand–receptor interaction, result in T cell stimulation and
enhancement of the adaptive immune response. In this way, C3d might play an
important role in the inflammation in skin lesions of paucibacillary patients. Axons
were hardly detected in skin lesions of paucibacillary patients, probably the nerves
are destroyed.
Chapter 8
248
MAC that was found deposited on the axons and co- localizing with LAM in lesions
of multibacillary patients. This suggests that MAC is attacking the axons in skin
lesions with LAM as a trigger for complement activation.
We conclude that signatures of complement activation are abundantly present in skin
lesions of leprosy patients, even after treatment, suggesting that inflammation
triggered by complement activation might contribute to nerve damage in the lesions
of these patients and that this should be regarded as an important factor in M. leprae
pathology.
In the second part of my thesis I describe work on ALS, a progressive
neurodegenerative disease. ALS was chosen because of the previous work
describing complement activation products in both patients and animal models of this
disease.
Complement is deposited at the presymptomatic stage on motor end-plates of
SOD1G93A mice
Mechanisms leading to the neurodegenerative disease ALS are still unclear. Both cell
autonomous and non-cell autonomous mechanisms are involved in the disease [30-
32]. Different studies suggest an important role for neuroinflammation in the disease
[33-35]. The involvement of complement as an inflammatory component in the
pathogenesis of ALS in man is suggested by different researchers. Elevated levels of
complement activation products in serum and cerebrospinal fluid were detected in
ALS patients. Levels of mRNA for C1q and C4 and protein levels of complement
proteins C1q, C3 and MAC were elevated in spinal cord and motor cortex of patients
with sporadic ALS [36]. In the murine mouse model of ALS C1q and C4 were
upregulated in motor neurons [37, 38]. Other studies have also shown upregulation
of the major proinflammatory C5a receptor, during disease progression in mouse
motor neurons [39]. SOD1G93A rat treated with C5aR antagonist had an extension of
survival time and a reduction in end-stage motor scores compared to the untreated
rats. This data suggests an important role for complement in the progression of ALS
[35]. Also, increased expression of complement components C1qB, C4, factors B,
C3, C5 and a decrease in the expression of the regulators CD55 (regulator of C3)
and CD59a (regulator of MAC) was detected in the lumbar spinal cord of SOD1G93A
8
Discussion & Summary
249
MAC that was found deposited on the axons and co- localizing with LAM in lesions
of multibacillary patients. This suggests that MAC is attacking the axons in skin
lesions with LAM as a trigger for complement activation.
We conclude that signatures of complement activation are abundantly present in skin
lesions of leprosy patients, even after treatment, suggesting that inflammation
triggered by complement activation might contribute to nerve damage in the lesions
of these patients and that this should be regarded as an important factor in M. leprae
pathology.
In the second part of my thesis I describe work on ALS, a progressive
neurodegenerative disease. ALS was chosen because of the previous work
describing complement activation products in both patients and animal models of this
disease.
Complement is deposited at the presymptomatic stage on motor end-plates of
SOD1G93A mice
Mechanisms leading to the neurodegenerative disease ALS are still unclear. Both cell
autonomous and non-cell autonomous mechanisms are involved in the disease [30-
32]. Different studies suggest an important role for neuroinflammation in the disease
[33-35]. The involvement of complement as an inflammatory component in the
pathogenesis of ALS in man is suggested by different researchers. Elevated levels of
complement activation products in serum and cerebrospinal fluid were detected in
ALS patients. Levels of mRNA for C1q and C4 and protein levels of complement
proteins C1q, C3 and MAC were elevated in spinal cord and motor cortex of patients
with sporadic ALS [36]. In the murine mouse model of ALS C1q and C4 were
upregulated in motor neurons [37, 38]. Other studies have also shown upregulation
of the major proinflammatory C5a receptor, during disease progression in mouse
motor neurons [39]. SOD1G93A rat treated with C5aR antagonist had an extension of
survival time and a reduction in end-stage motor scores compared to the untreated
rats. This data suggests an important role for complement in the progression of ALS
[35]. Also, increased expression of complement components C1qB, C4, factors B,
C3, C5 and a decrease in the expression of the regulators CD55 (regulator of C3)
and CD59a (regulator of MAC) was detected in the lumbar spinal cord of SOD1G93A
Chapter 8
250
mice [40]. This data points towards a disrupted regulation of the complement system
in this model.
In the SOD1G93A rodent model, an early involvement of the motor end-plate has been
shown [41, 42]. Retrograde degeneration is detected in ALS patients [43, 44]. In
addition, several physiological and morphological alterations have been reported on
the muscle end-plates from in vivo and ex vivo mouse and rat preparations [45-51].
These data suggest that some parts of ALS pathology start at the muscle end-plates
and might proceed to the spinal cord and subsequently the brain [52, 53] , ‘’a dying
back mechanism’’.
In chapter 5 we determined complement expression and activation in the SOD1G93A
mouse model of familial ALS (fALS). We show that complement components C1q
and C3 are deposited on the motor end-plates at the presymptomatic, symptomactic
and endstage of the disease. At the end stage of the disease, C3 mRNA was
upregulated in spinal cord and C3 protein accumulated in astrocytes and motor
neurons. While, complement activation products C3/C3b and C1q were detected at
the motor end-plates of SOD1G93A mice before the appearance of clinical symptoms
and remained detectable at the symptomatic stage, suggesting that complement
activation on the motor end-plates precedes neurodegeneration and plays an early
role in this model [54].
MAC deposition on motor endplates of ALS patients
In Chapter 5 we did not show deposition of MAC on motor end-plates of SOD1G93A
mice. Since our hypothesis is that MAC contributes to tissue damage in disease, we
show in Chapter 6 of this thesis that MAC is also deposited on the motor end-plates
of SOD1G93A mice at the presymptomatic stage.
We determined that complement components C1q and C3 are deposited on the
motor end-plates of SOD1G93A mice and suggest that the complement system might
play an important role in disease. An important question is whether what we observe
in a mouse model of the disease is also what happens in the patient. In Chapter 6
we show that complement activation products and regulators are deposited on the
motor end-plates of ALS patients. In intercostal muscle biopsies of ALS patients we
see two patterns of MAC immunoreactivity. On the end-plates with a weak α-BTX
immunoreactivity, strong signal for MAC immunoreactivity was seen. By contrast, a
weak MAC immunoreactivity was detected on end-plates with strong α-BTX
immunoreactivity. This is in line with a model in which MAC deposition occurs before
loss of the end-plates. Moreover, MAC was found deposited on motor end-plates that
were innervated by nerves, indicating that complement activation may precede
motor-endplate denervation. C1q, C3 and MAC were also detected on the motor
nerve-terminal and terminal Schwann cells. In general, regulators protect cells from
complement-mediated damage. We show that the regulators CD55 and CD59 are
both expressed on the motor end-plates, indicating an attempt to control the
activation. This process is probably not efficient enough because MAC can still be
detected on the α-BTX positive motor end-plates. Since a role for MAC in the
pathology of neurological disorders is suggested [55], detecting complement
deposited at the end-plates of ALS donors, before the end-plates are lost,
8
Discussion & Summary
251
mice [40]. This data points towards a disrupted regulation of the complement system
in this model.
In the SOD1G93A rodent model, an early involvement of the motor end-plate has been
shown [41, 42]. Retrograde degeneration is detected in ALS patients [43, 44]. In
addition, several physiological and morphological alterations have been reported on
the muscle end-plates from in vivo and ex vivo mouse and rat preparations [45-51].
These data suggest that some parts of ALS pathology start at the muscle end-plates
and might proceed to the spinal cord and subsequently the brain [52, 53] , ‘’a dying
back mechanism’’.
In chapter 5 we determined complement expression and activation in the SOD1G93A
mouse model of familial ALS (fALS). We show that complement components C1q
and C3 are deposited on the motor end-plates at the presymptomatic, symptomactic
and endstage of the disease. At the end stage of the disease, C3 mRNA was
upregulated in spinal cord and C3 protein accumulated in astrocytes and motor
neurons. While, complement activation products C3/C3b and C1q were detected at
the motor end-plates of SOD1G93A mice before the appearance of clinical symptoms
and remained detectable at the symptomatic stage, suggesting that complement
activation on the motor end-plates precedes neurodegeneration and plays an early
role in this model [54].
MAC deposition on motor endplates of ALS patients
In Chapter 5 we did not show deposition of MAC on motor end-plates of SOD1G93A
mice. Since our hypothesis is that MAC contributes to tissue damage in disease, we
show in Chapter 6 of this thesis that MAC is also deposited on the motor end-plates
of SOD1G93A mice at the presymptomatic stage.
We determined that complement components C1q and C3 are deposited on the
motor end-plates of SOD1G93A mice and suggest that the complement system might
play an important role in disease. An important question is whether what we observe
in a mouse model of the disease is also what happens in the patient. In Chapter 6
we show that complement activation products and regulators are deposited on the
motor end-plates of ALS patients. In intercostal muscle biopsies of ALS patients we
see two patterns of MAC immunoreactivity. On the end-plates with a weak α-BTX
immunoreactivity, strong signal for MAC immunoreactivity was seen. By contrast, a
weak MAC immunoreactivity was detected on end-plates with strong α-BTX
immunoreactivity. This is in line with a model in which MAC deposition occurs before
loss of the end-plates. Moreover, MAC was found deposited on motor end-plates that
were innervated by nerves, indicating that complement activation may precede
motor-endplate denervation. C1q, C3 and MAC were also detected on the motor
nerve-terminal and terminal Schwann cells. In general, regulators protect cells from
complement-mediated damage. We show that the regulators CD55 and CD59 are
both expressed on the motor end-plates, indicating an attempt to control the
activation. This process is probably not efficient enough because MAC can still be
detected on the α-BTX positive motor end-plates. Since a role for MAC in the
pathology of neurological disorders is suggested [55], detecting complement
deposited at the end-plates of ALS donors, before the end-plates are lost,
Chapter 8
252
complement activation could be an early event in ALS and might play an important
role in the motor end-plate pathology in ALS. This observation is in line with earlier
studies suggesting a "dying-back" mechanism in ALS, meaning the disease probably
starts at the motor end-plates [52]. However, this study is performed using post-
mortem tissue and thus analysing the end stage of disease. So we cannot detect the
early changes. Although there may be some limitations to our conclusions about
complement being involved in motor end-plate degeneration, this study adds to the
understanding of ALS pathology in man.
C6 inhibition in female SOD1G93A mice decreases neurological disability
Complement products are abundantly present in tissue of ALS patients, including
MAC which is found in serum, cerebrospinal fluid, spinal cord, motor cortex and at
the neuromuscular junction of SOD1G93A mice and ALS patients. We propose that
MAC might be involved in causing secondary damage driving the progressive loss of
motor neuron function in ALS. Despite the evidence of complement activation in
ALS, the role of the complement system and its contribution to disease progression in
animal models for ALS is controversial [56, 57]. Therefore, we tested whether
inhibiting MAC formation with a C6 antisense/ RNA antagonist (C6 ODN) results in
a delay of disease progression in a murine model of ALS.
In Chapter 7 describes the effect of complement inhibition using 1 mg/kg/day C6
ODN in SOD1G93A mice on the survival, body weight and neurological score. No
significant effects on median onset or survival in either female or male C6 ODN
treated SODG93A mice compared to vehicle controls. The onset and survival curve of
the C6 ODN treated female SODG93A mice showed a different disease progression
compared to the controls, but there were no statistical difference in onset and
survival. . At the end-stage of the disease (day 120) the vehicle control mice dropped
in weight while the treated female SOD1G93A mice that were still alive maintained their
body weight. Interestingly, C6 ODN treated female SODG93A mice, progressed in a
manner that was slower than vehicle controls (p=0.002). Together with the
maintained body weight this suggests that these mice were performing better than
the vehicle controls.
The treated male SOD1G93A mice progressed in the same manner as the vehicle
controls. No significant effect on the onset and survival was observed compared to
the vehicle controls. In addition, the male treated SOD1G93A mice showed a decrease
in body weight similar to control and the neurological score of was not different from
the vehicle controls, suggesting no effect of treatment on the male SOD1G93A mice.
The difference in progression of the disease in treated male and female SOD1G93A
mice is probably due to the C6 mRNA levels in these animals. We treated both with
1mg/kg/day, while C6 mRNA is much lower in female than male SOD1G93A mice (ten-
fold difference). This study suggests that complement inhibition in female SOD G93A
mice might reduce disease severity, based on the results of the female SOD1G93A
mice. The lack of effects in male SOD1G93A mice prevents us to convincingly show
that the hypothesis is correct. Therefore, we suggest further investigations with a
higher concentration of C6 ODN which might have an effect on the outcome of the
disease in male SOD1G93A mice.
In summary, the data presented in this thesis shows that complement activation
occurs in various neuroregenerative conditions, both inherited and acquired. I see
associations between complement activation products and disease severity in
8
Discussion & Summary
253
complement activation could be an early event in ALS and might play an important
role in the motor end-plate pathology in ALS. This observation is in line with earlier
studies suggesting a "dying-back" mechanism in ALS, meaning the disease probably
starts at the motor end-plates [52]. However, this study is performed using post-
mortem tissue and thus analysing the end stage of disease. So we cannot detect the
early changes. Although there may be some limitations to our conclusions about
complement being involved in motor end-plate degeneration, this study adds to the
understanding of ALS pathology in man.
C6 inhibition in female SOD1G93A mice decreases neurological disability
Complement products are abundantly present in tissue of ALS patients, including
MAC which is found in serum, cerebrospinal fluid, spinal cord, motor cortex and at
the neuromuscular junction of SOD1G93A mice and ALS patients. We propose that
MAC might be involved in causing secondary damage driving the progressive loss of
motor neuron function in ALS. Despite the evidence of complement activation in
ALS, the role of the complement system and its contribution to disease progression in
animal models for ALS is controversial [56, 57]. Therefore, we tested whether
inhibiting MAC formation with a C6 antisense/ RNA antagonist (C6 ODN) results in
a delay of disease progression in a murine model of ALS.
In Chapter 7 describes the effect of complement inhibition using 1 mg/kg/day C6
ODN in SOD1G93A mice on the survival, body weight and neurological score. No
significant effects on median onset or survival in either female or male C6 ODN
treated SODG93A mice compared to vehicle controls. The onset and survival curve of
the C6 ODN treated female SODG93A mice showed a different disease progression
compared to the controls, but there were no statistical difference in onset and
survival. . At the end-stage of the disease (day 120) the vehicle control mice dropped
in weight while the treated female SOD1G93A mice that were still alive maintained their
body weight. Interestingly, C6 ODN treated female SODG93A mice, progressed in a
manner that was slower than vehicle controls (p=0.002). Together with the
maintained body weight this suggests that these mice were performing better than
the vehicle controls.
The treated male SOD1G93A mice progressed in the same manner as the vehicle
controls. No significant effect on the onset and survival was observed compared to
the vehicle controls. In addition, the male treated SOD1G93A mice showed a decrease
in body weight similar to control and the neurological score of was not different from
the vehicle controls, suggesting no effect of treatment on the male SOD1G93A mice.
The difference in progression of the disease in treated male and female SOD1G93A
mice is probably due to the C6 mRNA levels in these animals. We treated both with
1mg/kg/day, while C6 mRNA is much lower in female than male SOD1G93A mice (ten-
fold difference). This study suggests that complement inhibition in female SOD G93A
mice might reduce disease severity, based on the results of the female SOD1G93A
mice. The lack of effects in male SOD1G93A mice prevents us to convincingly show
that the hypothesis is correct. Therefore, we suggest further investigations with a
higher concentration of C6 ODN which might have an effect on the outcome of the
disease in male SOD1G93A mice.
In summary, the data presented in this thesis shows that complement activation
occurs in various neuroregenerative conditions, both inherited and acquired. I see
associations between complement activation products and disease severity in
Chapter 8
254
leprosy and ALS. Preventing terminal pathway activation has an effect on
demyelination in a model for M. leprae induced nerve damage, and on the disease
severity in SODG93A mice. Overall, these experiments show that complement
components are putative targets for future therapies modulating disease severity.
References
1. Le FG, Kemper C. Complement: coming full circle. Arch Immunol Ther Exp (Warsz ) 2009 Nov;57(6):393-407.
2. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol 2007 Jan;7(1):9-18.
3. Sarma JV, Ward PA. The complement system. Cell Tissue Res 2011 Jan;343(1):227-35.
4. Klos A, Tenner AJ, Johswich KO, Ager RR, Reis ES, Kohl J. The role of the anaphylatoxins in health and disease. Mol Immunol 2009 Sep;46(14):2753-66.
5. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
6. Hartmann K, Henz BM, Kruger-Krasagakes S, et al. C3a and C5a stimulate chemotaxis of human mast cells. Blood 1997 Apr 15;89(8):2863-70.
7. Heurich M, Martinez-Barricarte R, Francis NJ, et al. Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk. Proc Natl Acad Sci U S A 2011 May 24;108(21):8761-6.
8. Mayilyan KR. Complement genetics, deficiencies, and disease associations. Protein Cell 2012 Jul;3(7):487-96.
9. Korb LC, Ahearn JM. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J Immunol 1997 May 15;158(10):4525-8.
10. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
11. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
12. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
13. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008 Apr;172(4):1043-52.
14. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010 Sep;11(9):785-97.
15. Leslie M. Immunology. The new view of complement. Science 2012 Aug 31;337(6098):1034-7.
16. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012 Nov;217(11):1034-46.
17. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin Microbiol Rev 2006 Apr;19(2):338-81.
18. WHO Expert Committee on Leprosy. World Health Organ Tech Rep Ser 1998;874:1-43.
19. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL. Contact-dependent demyelination by Mycobacterium leprae in the absence of immune cells. Science 2002 May 3;296(5569):927-31.
8
Discussion & Summary
255
leprosy and ALS. Preventing terminal pathway activation has an effect on
demyelination in a model for M. leprae induced nerve damage, and on the disease
severity in SODG93A mice. Overall, these experiments show that complement
components are putative targets for future therapies modulating disease severity.
References
1. Le FG, Kemper C. Complement: coming full circle. Arch Immunol Ther Exp (Warsz ) 2009 Nov;57(6):393-407.
2. Kemper C, Atkinson JP. T-cell regulation: with complements from innate immunity. Nat Rev Immunol 2007 Jan;7(1):9-18.
3. Sarma JV, Ward PA. The complement system. Cell Tissue Res 2011 Jan;343(1):227-35.
4. Klos A, Tenner AJ, Johswich KO, Ager RR, Reis ES, Kohl J. The role of the anaphylatoxins in health and disease. Mol Immunol 2009 Sep;46(14):2753-66.
5. Walport MJ. Complement. First of two parts. N Engl J Med 2001 Apr 5;344(14):1058-66.
6. Hartmann K, Henz BM, Kruger-Krasagakes S, et al. C3a and C5a stimulate chemotaxis of human mast cells. Blood 1997 Apr 15;89(8):2863-70.
7. Heurich M, Martinez-Barricarte R, Francis NJ, et al. Common polymorphisms in C3, factor B, and factor H collaborate to determine systemic complement activity and disease risk. Proc Natl Acad Sci U S A 2011 May 24;108(21):8761-6.
8. Mayilyan KR. Complement genetics, deficiencies, and disease associations. Protein Cell 2012 Jul;3(7):487-96.
9. Korb LC, Ahearn JM. C1q binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J Immunol 1997 May 15;158(10):4525-8.
10. Walport MJ. Complement. Second of two parts. N Engl J Med 2001 Apr 12;344(15):1140-4.
11. Ramaglia V, King RH, Morgan BP, Baas F. Deficiency of the complement regulator CD59a exacerbates Wallerian degeneration. Mol Immunol 2009 May;46(8-9):1892-6.
12. Ramaglia V, Tannemaat MR, de KM, et al. Complement inhibition accelerates regeneration in a model of peripheral nerve injury. Mol Immunol 2009 Dec;47(2-3):302-9.
13. Ramaglia V, Wolterman R, de KM, et al. Soluble complement receptor 1 protects the peripheral nerve from early axon loss after injury. Am J Pathol 2008 Apr;172(4):1043-52.
14. Ricklin D, Hajishengallis G, Yang K, Lambris JD. Complement: a key system for immune surveillance and homeostasis. Nat Immunol 2010 Sep;11(9):785-97.
15. Leslie M. Immunology. The new view of complement. Science 2012 Aug 31;337(6098):1034-7.
16. de Cordoba SR, Tortajada A, Harris CL, Morgan BP. Complement dysregulation and disease: from genes and proteins to diagnostics and drugs. Immunobiology 2012 Nov;217(11):1034-46.
17. Scollard DM, Adams LB, Gillis TP, Krahenbuhl JL, Truman RW, Williams DL. The continuing challenges of leprosy. Clin Microbiol Rev 2006 Apr;19(2):338-81.
18. WHO Expert Committee on Leprosy. World Health Organ Tech Rep Ser 1998;874:1-43.
19. Rambukkana A, Zanazzi G, Tapinos N, Salzer JL. Contact-dependent demyelination by Mycobacterium leprae in the absence of immune cells. Science 2002 May 3;296(5569):927-31.
Chapter 8
256
20. Lockwood DN, Colston MJ, Khanolkar-Young SR. The detection of Mycobacterium leprae protein and carbohydrate antigens in skin and nerve from leprosy patients with type 1 (reversal) reactions. Am J Trop Med Hyg 2002 Apr;66(4):409-15.
21. Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK. Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9(4):195-9.
22. Shetty VP, Suchitra K, Uplekar MW, Antia NH. Persistence of Mycobacterium leprae in the peripheral nerve as compared to the skin of multidrug-treated leprosy patients. Lepr Rev 1992 Dec;63(4):329-36.
23. Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol 1994;88(4):300-6.
24. Roche PW, Britton WJ, Failbus SS, Neupane KD, Theuvenet WJ. Serological monitoring of the response to chemotherapy in leprosy patients. Int J Lepr Other Mycobact Dis 1993 Mar;61(1):35-43.
25. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999 Jun;154(6):1793-804.
26. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008 Apr;78(4):605-10.
27. Levy E, Ambrus J, Kahl L, Molina H, Tung K, Holers VM. T lymphocyte expression of complement receptor 2 (CR2/CD21): a role in adhesive cell-cell interactions and dysregulation in a patient with systemic lupus erythematosus (SLE). Clin Exp Immunol 1992 Nov;90(2):235-44.
28. Knopf PM, Rivera DS, Hai SH, McMurry J, Martin W, De Groot AS. Novel function of complement C3d as an autologous helper T-cell target. Immunol Cell Biol 2008 Mar;86(3):221-5.
29. Toapanta FR, Ross TM. Complement-mediated activation of the adaptive immune responses: role of C3d in linking the innate and adaptive immunity. Immunol Res 2006;36(1-3):197-210.
30. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002 Sep 12;35(6):1067-83.
31. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006 Jun 2;312(5778):1389-92.
32. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007 May;10(5):608-14.
33. Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 2004;27:723-49.
34. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008 Mar;10(3):405-43.
35. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008 Dec 15;181(12):8727-34.
36. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011 Jun;42(3):211-20.
37. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007 Aug 22;27(34):9201-19.
38. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007 May 1;104(18):7319-26.
39. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009 May 29;210(1-2):52-62.
40. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
41. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4(4):e5390.
42. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009 Jun;9(3):341-6.
43. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001 Apr;24(4):564-73.
44. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004 Sep;5(3):136-40.
45. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006 Mar 8;26(10):2661-72.
46. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988 Oct;85(19):7371-4.
47. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992 Nov;42(11):2175-80.
48. Appel SH, Engelhardt JI, Garcia J, Stefani E. Immunoglobulins from animal models of motor neuron disease and from human amyotrophic lateral sclerosis patients passively transfer physiological abnormalities to the neuromuscular junction. Proc Natl Acad Sci U S A 1991 Jan 15;88(2):647-51.
49. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998 Jan;21(1):81-90.
50. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002 Jul 1;69(1):110-6.
51. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002 Jul;113(7):1066-71.
8
Discussion & Summary
257
20. Lockwood DN, Colston MJ, Khanolkar-Young SR. The detection of Mycobacterium leprae protein and carbohydrate antigens in skin and nerve from leprosy patients with type 1 (reversal) reactions. Am J Trop Med Hyg 2002 Apr;66(4):409-15.
21. Parkash O, Kumar V, Mukherjee A, Sengupta U, Malaviya GN, Girdhar BK. Membrane attack complex in thickened cutaneous sensory nerves of leprosy patients. Acta Leprol 1995;9(4):195-9.
22. Shetty VP, Suchitra K, Uplekar MW, Antia NH. Persistence of Mycobacterium leprae in the peripheral nerve as compared to the skin of multidrug-treated leprosy patients. Lepr Rev 1992 Dec;63(4):329-36.
23. Shetty VP, Uplekar MW, Antia NH. Immunohistological localization of mycobacterial antigens within the peripheral nerves of treated leprosy patients and their significance to nerve damage in leprosy. Acta Neuropathol 1994;88(4):300-6.
24. Roche PW, Britton WJ, Failbus SS, Neupane KD, Theuvenet WJ. Serological monitoring of the response to chemotherapy in leprosy patients. Int J Lepr Other Mycobact Dis 1993 Mar;61(1):35-43.
25. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P. Immunohistological analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum. Association of Mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999 Jun;154(6):1793-804.
26. Gomes GI, Nahn EP, Jr., Santos RK, Da Silva WD, Kipnis TL. The functional state of the complement system in leprosy. Am J Trop Med Hyg 2008 Apr;78(4):605-10.
27. Levy E, Ambrus J, Kahl L, Molina H, Tung K, Holers VM. T lymphocyte expression of complement receptor 2 (CR2/CD21): a role in adhesive cell-cell interactions and dysregulation in a patient with systemic lupus erythematosus (SLE). Clin Exp Immunol 1992 Nov;90(2):235-44.
28. Knopf PM, Rivera DS, Hai SH, McMurry J, Martin W, De Groot AS. Novel function of complement C3d as an autologous helper T-cell target. Immunol Cell Biol 2008 Mar;86(3):221-5.
29. Toapanta FR, Ross TM. Complement-mediated activation of the adaptive immune responses: role of C3d in linking the innate and adaptive immunity. Immunol Res 2006;36(1-3):197-210.
30. Raoul C, Estevez AG, Nishimune H, et al. Motoneuron death triggered by a specific pathway downstream of Fas. potentiation by ALS-linked SOD1 mutations. Neuron 2002 Sep 12;35(6):1067-83.
31. Boillee S, Yamanaka K, Lobsiger CS, et al. Onset and progression in inherited ALS determined by motor neurons and microglia. Science 2006 Jun 2;312(5778):1389-92.
32. Di Giorgio FP, Carrasco MA, Siao MC, Maniatis T, Eggan K. Non-cell autonomous effect of glia on motor neurons in an embryonic stem cell-based ALS model. Nat Neurosci 2007 May;10(5):608-14.
33. Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 2004;27:723-49.
34. Cozzolino M, Ferri A, Carri MT. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxid Redox Signal 2008 Mar;10(3):405-43.
35. Woodruff TM, Costantini KJ, Crane JW, et al. The complement factor C5a contributes to pathology in a rat model of amyotrophic lateral sclerosis. J Immunol 2008 Dec 15;181(12):8727-34.
36. Sta M, Sylva-Steenland RM, Casula M, et al. Innate and adaptive immunity in amyotrophic lateral sclerosis: evidence of complement activation. Neurobiol Dis 2011 Jun;42(3):211-20.
37. Ferraiuolo L, Heath PR, Holden H, Kasher P, Kirby J, Shaw PJ. Microarray analysis of the cellular pathways involved in the adaptation to and progression of motor neuron injury in the SOD1 G93A mouse model of familial ALS. J Neurosci 2007 Aug 22;27(34):9201-19.
38. Lobsiger CS, Boillee S, Cleveland DW. Toxicity from different SOD1 mutants dysregulates the complement system and the neuronal regenerative response in ALS motor neurons. Proc Natl Acad Sci U S A 2007 May 1;104(18):7319-26.
39. Humayun S, Gohar M, Volkening K, et al. The complement factor C5a receptor is upregulated in NFL-/- mouse motor neurons. J Neuroimmunol 2009 May 29;210(1-2):52-62.
40. Lee JD, Kamaruzaman NA, Fung JN, et al. Dysregulation of the complement cascade in the hSOD1G93A transgenic mouse model of amyotrophic lateral sclerosis. J Neuroinflammation 2013;10:119.
41. Dupuis L, Gonzalez de Aguilar JL, Echaniz-Laguna A, et al. Muscle mitochondrial uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor neurons. PLoS One 2009;4(4):e5390.
42. Dupuis L, Loeffler JP. Neuromuscular junction destruction during amyotrophic lateral sclerosis: insights from transgenic models. Curr Opin Pharmacol 2009 Jun;9(3):341-6.
43. Eisen A, Weber M. The motor cortex and amyotrophic lateral sclerosis. Muscle Nerve 2001 Apr;24(4):564-73.
44. Karlsborg M, Rosenbaum S, Wiegell M, et al. Corticospinal tract degeneration and possible pathogenesis in ALS evaluated by MR diffusion tensor imaging. Amyotroph Lateral Scler Other Motor Neuron Disord 2004 Sep;5(3):136-40.
45. Pagani MR, Reisin RC, Uchitel OD. Calcium signaling pathways mediating synaptic potentiation triggered by amyotrophic lateral sclerosis IgG in motor nerve terminals. J Neurosci 2006 Mar 8;26(10):2661-72.
46. Uchitel OD, Appel SH, Crawford F, Sczcupak L. Immunoglobulins from amyotrophic lateral sclerosis patients enhance spontaneous transmitter release from motor-nerve terminals. Proc Natl Acad Sci U S A 1988 Oct;85(19):7371-4.
47. Uchitel OD, Scornik F, Protti DA, Fumberg CG, Alvarez V, Appel SH. Long-term neuromuscular dysfunction produced by passive transfer of amyotrophic lateral sclerosis immunoglobulins. Neurology 1992 Nov;42(11):2175-80.
48. Appel SH, Engelhardt JI, Garcia J, Stefani E. Immunoglobulins from animal models of motor neuron disease and from human amyotrophic lateral sclerosis patients passively transfer physiological abnormalities to the neuromuscular junction. Proc Natl Acad Sci U S A 1991 Jan 15;88(2):647-51.
49. O'Shaughnessy TJ, Yan H, Kim J, et al. Amyotrophic lateral sclerosis: serum factors enhance spontaneous and evoked transmitter release at the neuromuscular junction. Muscle Nerve 1998 Jan;21(1):81-90.
50. Mohamed HA, Mosier DR, Zou LL, et al. Immunoglobulin Fc gamma receptor promotes immunoglobulin uptake, immunoglobulin-mediated calcium increase, and neurotransmitter release in motor neurons. J Neurosci Res 2002 Jul 1;69(1):110-6.
51. Muchnik S, Losavio A, De LS. Effect of amyotrophic lateral sclerosis serum on calcium channels related to spontaneous acetylcholine release. Clin Neurophysiol 2002 Jul;113(7):1066-71.
Chapter 8
258
52. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004 Feb;185(2):232-40.
53. Moloney EB, de WF, Verhaagen J. ALS as a distal axonopathy: molecular mechanisms affecting neuromuscular junction stability in the presymptomatic stages of the disease. Front Neurosci 2014;8:252.
54. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011 Jun;235(1-2):104-9.
55. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007 Feb;44(5):999-1010.
56. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E3-E4.
57. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E5.
Nederlandse Samenvatting
Dutch summary
52. Fischer LR, Culver DG, Tennant P, et al. Amyotrophic lateral sclerosis is a distal axonopathy: evidence in mice and man. Exp Neurol 2004 Feb;185(2):232-40.
53. Moloney EB, de WF, Verhaagen J. ALS as a distal axonopathy: molecular mechanisms affecting neuromuscular junction stability in the presymptomatic stages of the disease. Front Neurosci 2014;8:252.
54. Heurich B, El Idrissi NB, Donev RM, et al. Complement upregulation and activation on motor neurons and neuromuscular junction in the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis. J Neuroimmunol 2011 Jun;235(1-2):104-9.
55. Bonifati DM, Kishore U. Role of complement in neurodegeneration and neuroinflammation. Mol Immunol 2007 Feb;44(5):999-1010.
56. Woodruff TM, Lee JD, Noakes PG. Role for terminal complement activation in amyotrophic lateral sclerosis disease progression. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E3-E4.
57. Lobsiger CS, Cleveland DW. Reply to Woodruff et al.: C1q and C3-dependent complement pathway activation does not contribute to disease in SOD1 mutant ALS mice. Proc Natl Acad Sci U S A 2014 Jan 7;111(1):E5.
Nederlandse Samenvatting
Dutch summary
S
Nederlandse Samenvatting - Dutch summary
260
Nederlandse Samenvatting (Dutch summary)
Lepra is een chronische infectie ziekte veroorzaakt door de bacterie Mycobacterium
leprae (M. leprae). Nog steeds treft deze ziekte jaarlijks 214.000 nieuwe patiënten.
Lepra veroorzaakt zenuwschade die kan leiden tot misvormingen en invaliditeit. Niet
alle leprapatiënten krijgen echter zenuwschade en het is onbekend waarom sommige
zieken wel zenuw problemen krijgen en andere niet.
Amyotrofische lateraal sclerose (ALS) is een progressieve neurodegeneratieve
ziekte, die leidt tot zwakte en atrofie van de skeletspieren. De voornaamste reden
van overlijden is verzwakking van de ademhalingsspieren. De ziekte wordt
veroorzaakt door het afsterven van cellen (motorneuronen) in de hersenen en het
ruggenmerg die de skeletspieren activeren. Er is geen genezende behandeling van
ALS en de verwachte levensduur na diagnose is tussen de twee en vijf jaar. Daarom
is een effectieve behandeling voor ALS dringend nodig.
Wat hebben lepra en ALS als ziekten gemeen? Neurodegeneratie en ontsteking, zijn
belangrijke elementen van beide aandoeningen. Steeds meer onderzoekers leggen
een verband tussen ontsteking en neurodegeneratie. Een ontstekingsreactie wordt in
het algemeen veroorzaakt door ons immuunsysteem. Het complementsysteem is een
onderdeel van het aangeboren immuunsysteem. Recent onderzoek uit ons
laboratorium bewees dat het eindproduct van het complement systeem, het
membrane attack complex (MAC), herstel na mechanische zenuwschade blijkt tegen
te gaan. Remming van MAC door geneesmiddelen bleek herstel na mechanische
zenuwletstel te versnellen. Onderzoek heeft aangetoond dat het complementsysteem
in bepaalde lepragevallen geactiveerd is en dat dit geassocieerd is met
ziekteverschijnselen. In het ruggenmerg en de motorische cortex van ALS patiënten
is complement ook geactiveerd. De rol hiervan is onduidelijk. In dit proefschrift willen
we de rol van complement bij het ontstaan van zenuwschade in lepra en bij het
verlies van motorische eindplaten in ALS onderzoeken. De hypothese van ons
onderzoek is dat het complementsysteem het beloop van de ziekte mede bepaalt.
Daarnaast willen we onderzoeken of complementinhibitie het ziektebeeld in lepra en
ALS verbetert. Hiervoor gebruiken we een C6 antisense oligonucleotide (C6 ODN),
dat C6 mRNA bindt en er voor zorgt dat MAC niet gevormd kan worden ( C6 is
onderdeel van het MAC complex). Dit met het idee dat C6 remming en daarmee ook
remming van MAC de schade in lepra en ALS kan beperken.
De inleiding in hoofdstuk 1 beschrijft de structuur van de zenuw en de
veranderingen die plaatsvinden bij zenuwbeschadiging en welke rol ontsteking hierbij
speelt. Daarnaast wordt er uitgelegd wat het complementsysteem is, hoe het
gereguleerd wordt en wat er gebeurt bij ontregeling van dit systeem. Tenslotte wordt
beschreven wat Lepra en ALS zijn en wat er bekend is over het complementsysteem
in deze ziekten.
Hoofdstuk 2 beschrijft het effect van C6 complement remming in een muizenmodel,
waarbij dode leprabacteriën, geïsoleerd uit leprapatiënten, geïnjecteerd worden in de
zenuw van de muis. In dit muismodel hebben we laten zien dat de C6 remming met
behulp van een C6 antisense oligonucleotide inderdaad zenuwschade kan beperken.
In vitro laten we zien dat lepra antigen lipoarabinomannan een sterke
complementactivator is. Ook laten we zien dat in zenuwbiopten van lepra patiënten
MAC zich aan de axon hecht, wat suggereert dat MAC de zenuw aanvalt. Daarom
S
Nederlandse Samenvatting - Dutch summary
261
Nederlandse Samenvatting (Dutch summary)
Lepra is een chronische infectie ziekte veroorzaakt door de bacterie Mycobacterium
leprae (M. leprae). Nog steeds treft deze ziekte jaarlijks 214.000 nieuwe patiënten.
Lepra veroorzaakt zenuwschade die kan leiden tot misvormingen en invaliditeit. Niet
alle leprapatiënten krijgen echter zenuwschade en het is onbekend waarom sommige
zieken wel zenuw problemen krijgen en andere niet.
Amyotrofische lateraal sclerose (ALS) is een progressieve neurodegeneratieve
ziekte, die leidt tot zwakte en atrofie van de skeletspieren. De voornaamste reden
van overlijden is verzwakking van de ademhalingsspieren. De ziekte wordt
veroorzaakt door het afsterven van cellen (motorneuronen) in de hersenen en het
ruggenmerg die de skeletspieren activeren. Er is geen genezende behandeling van
ALS en de verwachte levensduur na diagnose is tussen de twee en vijf jaar. Daarom
is een effectieve behandeling voor ALS dringend nodig.
Wat hebben lepra en ALS als ziekten gemeen? Neurodegeneratie en ontsteking, zijn
belangrijke elementen van beide aandoeningen. Steeds meer onderzoekers leggen
een verband tussen ontsteking en neurodegeneratie. Een ontstekingsreactie wordt in
het algemeen veroorzaakt door ons immuunsysteem. Het complementsysteem is een
onderdeel van het aangeboren immuunsysteem. Recent onderzoek uit ons
laboratorium bewees dat het eindproduct van het complement systeem, het
membrane attack complex (MAC), herstel na mechanische zenuwschade blijkt tegen
te gaan. Remming van MAC door geneesmiddelen bleek herstel na mechanische
zenuwletstel te versnellen. Onderzoek heeft aangetoond dat het complementsysteem
in bepaalde lepragevallen geactiveerd is en dat dit geassocieerd is met
ziekteverschijnselen. In het ruggenmerg en de motorische cortex van ALS patiënten
is complement ook geactiveerd. De rol hiervan is onduidelijk. In dit proefschrift willen
we de rol van complement bij het ontstaan van zenuwschade in lepra en bij het
verlies van motorische eindplaten in ALS onderzoeken. De hypothese van ons
onderzoek is dat het complementsysteem het beloop van de ziekte mede bepaalt.
Daarnaast willen we onderzoeken of complementinhibitie het ziektebeeld in lepra en
ALS verbetert. Hiervoor gebruiken we een C6 antisense oligonucleotide (C6 ODN),
dat C6 mRNA bindt en er voor zorgt dat MAC niet gevormd kan worden ( C6 is
onderdeel van het MAC complex). Dit met het idee dat C6 remming en daarmee ook
remming van MAC de schade in lepra en ALS kan beperken.
De inleiding in hoofdstuk 1 beschrijft de structuur van de zenuw en de
veranderingen die plaatsvinden bij zenuwbeschadiging en welke rol ontsteking hierbij
speelt. Daarnaast wordt er uitgelegd wat het complementsysteem is, hoe het
gereguleerd wordt en wat er gebeurt bij ontregeling van dit systeem. Tenslotte wordt
beschreven wat Lepra en ALS zijn en wat er bekend is over het complementsysteem
in deze ziekten.
Hoofdstuk 2 beschrijft het effect van C6 complement remming in een muizenmodel,
waarbij dode leprabacteriën, geïsoleerd uit leprapatiënten, geïnjecteerd worden in de
zenuw van de muis. In dit muismodel hebben we laten zien dat de C6 remming met
behulp van een C6 antisense oligonucleotide inderdaad zenuwschade kan beperken.
In vitro laten we zien dat lepra antigen lipoarabinomannan een sterke
complementactivator is. Ook laten we zien dat in zenuwbiopten van lepra patiënten
MAC zich aan de axon hecht, wat suggereert dat MAC de zenuw aanvalt. Daarom
Nederlandse Samenvatting - Dutch summary
262
suggereren we dat complement inhibitie de zenuwschade in leprapatiënten kan
beperken.
In hoofdstuk 3 worden de waarden van complement activatieproducten en
regulatoren in serum van leprapatiënten zonder en met een reactie beschreven. We
laten zien dat leprapatiënten met een reactie hogere waarden hebben voor bepaalde
complementfactoren. Metingen van complement in serum monsters van
leprapatiënten uit Ethiopië, laten zien dat TCC (niet-membraangebonden MAC)
waarden hoger zijn in patiënten met reactie dan in patiënten zonder reactie.
Daarnaast zijn drie patiënten gevolgd voor en na behandeling. Bij deze patiënten zijn
de TCC waardes niet gedaald na de behandeling. Dit is een indicatie dat
complement nog steeds geactiveerd blijft, zelfs nadat de bacterie dood is. Dit
suggereert ook dat de behandeling met een cocktail van antibiotica geen effect heeft
op complementactivatie. De regulator van TCC was hoger in leprapatiënten dan in de
controles. Onze analyse van de data suggereert dat complementfactoren in serum
van leprapatiënten waarschijnlijk kunnen bijdragen aan de diagnose en prognose van
de status van de ziekte.
Hoofdstuk 4 beschrijft de rol van het complementsysteem, de immuuncellen en het
lepra-antigen lipoarabinomannan in huidbiopten van leprapatiënten. In dit hoofdstuk
laten we zien dat er meer complementdepositie in huidbiopten van multibacillaire
patiënten is vergeleken met paucibacillaire patiënten. Ook laten we zien dat
patiënten met een ernstige vorm van lepra veel meer complement depositie hebben
in huidbiopten vergeleken met patiënten die een minder ernstige vorm hebben. De
depositie van complement activatieproducten C3d en MAC correleert sterk met de
depositie van lipoarabinomannan in huidbiopten van leprapatiënten. Dit suggereert
dat lipoarabinomannan een rol speelt bij complementdepositie in huidbiopten van
leprapatiënten. Aangezien lipoarabinomannan en MAC beide nog lang na
behandeling in huidbiopten van leprapatiënten te detecteren zijn, concluderen we dat
behandeling de ontsteking niet dempt. Een belangrijke bevinding in dit hoofdstuk is
dat complement factor C3d op de T-cellen zitten van paucibacillaire patiënten in de
granulomen. Uit de literatuur weten we dat C3d een belangrijke rol kan spelen bij het
activeren van T-cellen.
In Hoofdstuk 5 wordt de analyse van complementactivatie op de motorische
eindplaten van SOD1G93A muizen op verschillende tijdspunten beschreven. SOD1G93A
muizen vertonen naarmate ze ouder worden een ziekte die op ALS lijkt. We laten hier
zien dat op dag 126 na geboorte van de muizen het C3 mRNA op-gereguleerd is in
het ruggenmerg en dat C3 eiwit geaccumuleerd is in de astrocyten en de
motorneuronen. Daarnaast laten we zien dat complement activatieproducten C1q en
C3b/iC3b te detecteren zijn op eindplaten van SOD1G93A muizen voordat de muizen
klinische symptomen vertonen (dag 47 na geboorte). Ons idee is dat het
complementsysteem een belangrijke rol speelt bij schade aan de eindplaten in het
beginstadium van de ziekte.
Hoofdstuk 6 beschrijft de aanwezigheid van complementactivatie en
regulatieproducten op de motorische eind-platen van ALS patiënten na overlijden.
We laten zien dat complement activatieproducten C1q en MAC op de eindplaten te
detecteren zijn. MAC depositie was hoger op eindplaten die zwaar beschadigd
waren, terwijl eindplaten die minder beschadigd waren weinig MAC gedeponeerd
was. De complementregulatoren CD55 en CD59 waren beide opgereguleerd op de
eindplaten van ALS patiënten. Dit suggereert dat alhoewel er regulatie is, het
S
Nederlandse Samenvatting - Dutch summary
263
suggereren we dat complement inhibitie de zenuwschade in leprapatiënten kan
beperken.
In hoofdstuk 3 worden de waarden van complement activatieproducten en
regulatoren in serum van leprapatiënten zonder en met een reactie beschreven. We
laten zien dat leprapatiënten met een reactie hogere waarden hebben voor bepaalde
complementfactoren. Metingen van complement in serum monsters van
leprapatiënten uit Ethiopië, laten zien dat TCC (niet-membraangebonden MAC)
waarden hoger zijn in patiënten met reactie dan in patiënten zonder reactie.
Daarnaast zijn drie patiënten gevolgd voor en na behandeling. Bij deze patiënten zijn
de TCC waardes niet gedaald na de behandeling. Dit is een indicatie dat
complement nog steeds geactiveerd blijft, zelfs nadat de bacterie dood is. Dit
suggereert ook dat de behandeling met een cocktail van antibiotica geen effect heeft
op complementactivatie. De regulator van TCC was hoger in leprapatiënten dan in de
controles. Onze analyse van de data suggereert dat complementfactoren in serum
van leprapatiënten waarschijnlijk kunnen bijdragen aan de diagnose en prognose van
de status van de ziekte.
Hoofdstuk 4 beschrijft de rol van het complementsysteem, de immuuncellen en het
lepra-antigen lipoarabinomannan in huidbiopten van leprapatiënten. In dit hoofdstuk
laten we zien dat er meer complementdepositie in huidbiopten van multibacillaire
patiënten is vergeleken met paucibacillaire patiënten. Ook laten we zien dat
patiënten met een ernstige vorm van lepra veel meer complement depositie hebben
in huidbiopten vergeleken met patiënten die een minder ernstige vorm hebben. De
depositie van complement activatieproducten C3d en MAC correleert sterk met de
depositie van lipoarabinomannan in huidbiopten van leprapatiënten. Dit suggereert
dat lipoarabinomannan een rol speelt bij complementdepositie in huidbiopten van
leprapatiënten. Aangezien lipoarabinomannan en MAC beide nog lang na
behandeling in huidbiopten van leprapatiënten te detecteren zijn, concluderen we dat
behandeling de ontsteking niet dempt. Een belangrijke bevinding in dit hoofdstuk is
dat complement factor C3d op de T-cellen zitten van paucibacillaire patiënten in de
granulomen. Uit de literatuur weten we dat C3d een belangrijke rol kan spelen bij het
activeren van T-cellen.
In Hoofdstuk 5 wordt de analyse van complementactivatie op de motorische
eindplaten van SOD1G93A muizen op verschillende tijdspunten beschreven. SOD1G93A
muizen vertonen naarmate ze ouder worden een ziekte die op ALS lijkt. We laten hier
zien dat op dag 126 na geboorte van de muizen het C3 mRNA op-gereguleerd is in
het ruggenmerg en dat C3 eiwit geaccumuleerd is in de astrocyten en de
motorneuronen. Daarnaast laten we zien dat complement activatieproducten C1q en
C3b/iC3b te detecteren zijn op eindplaten van SOD1G93A muizen voordat de muizen
klinische symptomen vertonen (dag 47 na geboorte). Ons idee is dat het
complementsysteem een belangrijke rol speelt bij schade aan de eindplaten in het
beginstadium van de ziekte.
Hoofdstuk 6 beschrijft de aanwezigheid van complementactivatie en
regulatieproducten op de motorische eind-platen van ALS patiënten na overlijden.
We laten zien dat complement activatieproducten C1q en MAC op de eindplaten te
detecteren zijn. MAC depositie was hoger op eindplaten die zwaar beschadigd
waren, terwijl eindplaten die minder beschadigd waren weinig MAC gedeponeerd
was. De complementregulatoren CD55 en CD59 waren beide opgereguleerd op de
eindplaten van ALS patiënten. Dit suggereert dat alhoewel er regulatie is, het
Nederlandse Samenvatting - Dutch summary
264
systeem niet efficiënt genoeg is om de complement-gemedieerde ontsteking te
beperken.
Hoofdstuk 7 beschrijft het effect van complementremming in SOD1G93A muizen op
overleving, gewicht en neurologische score. We laten hier zien dat C6 remming geen
effect heeft op overleving, gewicht en neurologische score in mannetjes muizen. In
vrouwtjes muizen laten we zien dat C6 remming wel enig effect vertoont op
overleving en gewicht, maar niet significant verschillend van de controlemuizen.
Daarentegen, heeft C6 remming wel een duidelijke effect op de neurologische score
van vrouwtjes muizen. De behandelde vrouwtjes muizen hebben een lagere
neurologische score dan de controles. Wij denken dat de behandeling niet heeft
gewerkt bij de mannetjes muizen omdat deze tienvoudig hogere C6 waardes
hebben. Wij suggereren dat een behandeling met een hogere concentratie van C6
oligonucleotide een betere resultaat zal leveren.
In hoofdstuk 8 worden de resultaten van alle hoofdstukken gerapporteerd en
besproken.
List of publications
About the author
Dankwoord
PhD portfolio
systeem niet efficiënt genoeg is om de complement-gemedieerde ontsteking te
beperken.
Hoofdstuk 7 beschrijft het effect van complementremming in SOD1G93A muizen op
overleving, gewicht en neurologische score. We laten hier zien dat C6 remming geen
effect heeft op overleving, gewicht en neurologische score in mannetjes muizen. In
vrouwtjes muizen laten we zien dat C6 remming wel enig effect vertoont op
overleving en gewicht, maar niet significant verschillend van de controlemuizen.
Daarentegen, heeft C6 remming wel een duidelijke effect op de neurologische score
van vrouwtjes muizen. De behandelde vrouwtjes muizen hebben een lagere
neurologische score dan de controles. Wij denken dat de behandeling niet heeft
gewerkt bij de mannetjes muizen omdat deze tienvoudig hogere C6 waardes
hebben. Wij suggereren dat een behandeling met een hogere concentratie van C6
oligonucleotide een betere resultaat zal leveren.
In hoofdstuk 8 worden de resultaten van alle hoofdstukken gerapporteerd en
besproken.
List of publications
About the author
Dankwoord
PhD portfolio
266
List of publications
List of publications
1. Heurich B, Bahia El Idrissi N, Donev RM, Petri S, Claus P, Neal J, Morgan BP, Ramaglia
V. Complement upregulation and activation on motor neurons and neuromuscular junction in
the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis, 2011, J
Neuroimmunol.235(1-2):104-9.
2. Nawal Bahia El Idrissi, Pranab K. Das, Kees Fluiter, Patricia S. Rosa, Jeroen Vreijling,
Dirk Troost, B. Paul Morgan, Frank Baas , Valeria Ramaglia. M. leprae components induce
nerve damage by complement activation: identification of lipoarabinomannan as the
dominant complement activator, 2015, Acta Neuropathologica, Volume 129, Issue 5, pp 653-
667.
3. Bahia El Idrissi N, Hakobyan S, Ramaglia V, Geluk A, Morgan BP, Das PK, Baas F.
Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating
Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol. 2016 Jan 8. doi:
10.1111/cei.12767.
4. Nawal Bahia El Idrissi, Sanne Bosch, Valeria Ramaglia, Eleonora Aronica, Frank
Baas, and Dirk Troost. Complement activation at the motor end-plates in amyotrophic lateral
sclerosis. J Neuroinflammation. 2016; 13: 72.
5. Nawal Bahia El Idrissi, Kees Fluiter, Fernando G. Vieira and Frank Baas. Complement
Component C6 Inhibition Decreases Neurological Disability in Female Transgenic SOD1
G93A
Mouse Model of Amyotrophic Lateral Sclerosis. Ann Neurodegener Dis 1(3): 1015.
About the author
Nawal Bahia el Idrissi was born on 6th of September 1985 in Amsterdam. She
graduated in 2003 at the Calandlyceum in Amsterdam. Her interest for science made
her choose for the Higher Laboratory Education at the Inholland in Alkmaar. In 2007
she graduated and decided to start a Master in Biomolecular sciences at the Free
University in Amsterdam. To learn about clinical trials and business and
communication she decided to follow a second master ‘Management Policy Analysis
and Entrepreneurship in the Health and Life Sciences’ at the Free university. For her
final internships she decided to go abroad to the La Jolla Institute for Allergy and
Immunology in San Diego. She graduated in 2009 for the Master Biomolecular
sciences. In the same year she started working at the medical department of the
pharmaceutical company Genzyme in Almere. In 2010 she graduated for the master
Management Policy Analysis and Entrepreneurship in the Health and Life Sciences.
In September 2010 she started a PhD project at the Academic Medical Center in
Amsterdam under supervision of Prof. F. Baas and Dr. P.K. Das. Where she studied
the role of complement in nerve damage in leprosy. In 2012 she applied for the
Mozaïek grant from the Netherlands Organization for Scientific Research. She wrote
a research proposal on the role of complement in Amyotrophic lateral sclerosis. After
defending the research proposal she was awarded € 200.000 based on merit. She
worked on both the leprosy and the Amyotrophic lateral sclerosis project during her
PhD, which resulted in interesting publication.
267
About the Author
List of publications
1. Heurich B, Bahia El Idrissi N, Donev RM, Petri S, Claus P, Neal J, Morgan BP, Ramaglia
V. Complement upregulation and activation on motor neurons and neuromuscular junction in
the SOD1 G93A mouse model of familial amyotrophic lateral sclerosis, 2011, J
Neuroimmunol.235(1-2):104-9.
2. Nawal Bahia El Idrissi, Pranab K. Das, Kees Fluiter, Patricia S. Rosa, Jeroen Vreijling,
Dirk Troost, B. Paul Morgan, Frank Baas , Valeria Ramaglia. M. leprae components induce
nerve damage by complement activation: identification of lipoarabinomannan as the
dominant complement activator, 2015, Acta Neuropathologica, Volume 129, Issue 5, pp 653-
667.
3. Bahia El Idrissi N, Hakobyan S, Ramaglia V, Geluk A, Morgan BP, Das PK, Baas F.
Complement Activation In Leprosy: A Retrospective Study Shows Elevated Circulating
Terminal Complement Complex In Reactional Leprosy. Clin Exp Immunol. 2016 Jan 8. doi:
10.1111/cei.12767.
4. Nawal Bahia El Idrissi, Sanne Bosch, Valeria Ramaglia, Eleonora Aronica, Frank
Baas, and Dirk Troost. Complement activation at the motor end-plates in amyotrophic lateral
sclerosis. J Neuroinflammation. 2016; 13: 72.
5. Nawal Bahia El Idrissi, Kees Fluiter, Fernando G. Vieira and Frank Baas. Complement
Component C6 Inhibition Decreases Neurological Disability in Female Transgenic SOD1
G93A
Mouse Model of Amyotrophic Lateral Sclerosis. Ann Neurodegener Dis 1(3): 1015.
About the author
Nawal Bahia el Idrissi was born on 6th of September 1985 in Amsterdam. She
graduated in 2003 at the Calandlyceum in Amsterdam. Her interest for science made
her choose for the Higher Laboratory Education at the Inholland in Alkmaar. In 2007
she graduated and decided to start a Master in Biomolecular sciences at the Free
University in Amsterdam. To learn about clinical trials and business and
communication she decided to follow a second master ‘Management Policy Analysis
and Entrepreneurship in the Health and Life Sciences’ at the Free university. For her
final internships she decided to go abroad to the La Jolla Institute for Allergy and
Immunology in San Diego. She graduated in 2009 for the Master Biomolecular
sciences. In the same year she started working at the medical department of the
pharmaceutical company Genzyme in Almere. In 2010 she graduated for the master
Management Policy Analysis and Entrepreneurship in the Health and Life Sciences.
In September 2010 she started a PhD project at the Academic Medical Center in
Amsterdam under supervision of Prof. F. Baas and Dr. P.K. Das. Where she studied
the role of complement in nerve damage in leprosy. In 2012 she applied for the
Mozaïek grant from the Netherlands Organization for Scientific Research. She wrote
a research proposal on the role of complement in Amyotrophic lateral sclerosis. After
defending the research proposal she was awarded € 200.000 based on merit. She
worked on both the leprosy and the Amyotrophic lateral sclerosis project during her
PhD, which resulted in interesting publication.
268
Dankwoord
Dankwoord
Bij een proefschrift hoort natuurlijk ook een dankwoord. Ik wil iedereen bedanken die
een bijdrage heeft geleverd aan mijn onderzoek en proefschrift. Daarnaast wil ik ook
iedereen bedanken die me de afgelopen jaren heeft gesteund, geholpen en
geluisterd heeft naar mijn getetter over van alles en nog wat. Ik heb mijn
promotietraject met veel plezier doorlopen, bedankt voor alle mooie momenten!
Allereerst wil ik mijn promotor Prof. Frank Baas en mijn co-promotors Prof. Pran K.
Das en Dr. Valeria Ramaglia bedanken voor hun steun gedurende mijn
promotietraject.
Frank, bedankt dat je me in jouw lab de ruimte hebt gegeven me te ontwikkelen tot
een goede onderzoeker. Ik mocht tijd vrijmaken om een persoonlijke beurs aan te
vragen, congressen/bijeenkomsten bij te wonen en contacten te leggen met andere
wetenschappers. Onze discussies over mijn wetenschappelijke data zijn zeer
waardevol geweest voor mijn onderzoeken. Ik heb veel geleerd van jouw kritische
blik en dit waardeer ik enorm. Bedankt!
Pran, thank you for sharing your expertise on leprosy with me. I appreciate the time
and effort you invested in me. I know you don’t like to work with computers, that is
why we had long discussions over the phone about the papers before they got
published. The conversations were really informative and helped me deliver good
research. Yelling on the phone, was not really necessary. You were just in
Birmingham I can hear you through the phone, really I can!! :D
Kees, je straalt altijd een gevoel van rust uit. Bedankt dat je altijd ZEN bent geweest,
op momenten dat het even hectisch was :). Je hebt mij geleerd dat ik me niet zo druk
moet maken en dat alles goed komt! Ik heb ook veel genoten van onze interessante
gesprekken over, dat veel sporten niet gezond is en dat er niet veel voor ons zal
veranderen als Donald Trump president wordt. Ik wil je natuurlijk ook bedanken dat ik
deel uit mocht maken van een belangrijk moment in je leven, je bruiloft met Juliejet!
Valeria, thank you for introducing me to the world of complement activation in the
peripheral nerves. You were really helpful at the beginning of my PhD! I also enjoyed
the time that we spent at the gym and of course shopping for nice clothes and shoes!
Thank you!
Prof. Dirk Troost, bedankt dat je me met open armen hebt ontvangen op je afdeling.
Je stond altijd open voor het bespreken van mijn data en kwam altijd met goede
inzichten in hoe iets beter kan. Ik heb veel van je geleerd en je bent een enorme
steun geweest!
Prof. Eleonora Aronica, je stond altijd voor mij klaar zodra ik materiaal nodig had voor
mijn onderzoek. Bedankt voor de beminnelijke manier waarop je mij te hulp schoot,
zonder jou was mijn ALS onderzoek niet zo efficiënt verlopen! Grazie!
Als ik aan de neuropathologie afdeling denk, dan sta ik meteen stil bij de koffietijd.
Dirk, alle leuke verhalen over de wetenschap van tegenwoordig en jouw investment
avonturen in het buitenland vond ik geweldig!
Lieve Astrid, bedankt dat je me altijd begroette met een grote glimlach en dat er altijd
plek voor me was tijdens de koffietijd :-). Ik wil je enorm bedanken voor je oprechte
interesse in mij en mijn onderzoek. Ik heb altijd genoten van onze gezellige
gesprekjes. Je bent echt een lieverd!
René, als ik aan de neuropathologie afdeling denk dan ben jij niet te missen! Toen ik
net begon met mijn promotietraject had ik geen idee wat materiaal plakken of snijden
inhield. Bedankt dat je me de microtoom hebt leren gebruiken! Je had veel geduld en
was er altijd om mij te helpen, zelfs als je het heel erg druk had. Ik vond het jammer
dat je het AMC verliet, maar gelukkig hoefde ik je niet te missen! Samen met Loesje
pannenkoeken eten, wandelingen maken en naar Arabische muziek luisteren.
Bedankt voor alle gezellige momenten!
Jasper, bedankt voor alle gezellige gesprekken tijdens de koffietijd en natuurlijk voor
alle antilichamen die ik kwam ‘’lenen’’.
Wijze Clifton, jij bent er altijd als ik hulp of advies nodig heb! Zelfs als je geen tijd hebt
of ziek bent krijg ik nog een uitgebreide e-mail over hoe ik het beste het een en ander
kan aanpakken. Bedankt dat je me verder helpt in het leven!
Anand, zelfs bij de laatste loodjes heb jij nog de tijd genomen mijn introductie en
artikel door te lezen. Ik heb daar zeker wat aan gehad, bedankt!
269
Dankwoord
Dankwoord
Bij een proefschrift hoort natuurlijk ook een dankwoord. Ik wil iedereen bedanken die
een bijdrage heeft geleverd aan mijn onderzoek en proefschrift. Daarnaast wil ik ook
iedereen bedanken die me de afgelopen jaren heeft gesteund, geholpen en
geluisterd heeft naar mijn getetter over van alles en nog wat. Ik heb mijn
promotietraject met veel plezier doorlopen, bedankt voor alle mooie momenten!
Allereerst wil ik mijn promotor Prof. Frank Baas en mijn co-promotors Prof. Pran K.
Das en Dr. Valeria Ramaglia bedanken voor hun steun gedurende mijn
promotietraject.
Frank, bedankt dat je me in jouw lab de ruimte hebt gegeven me te ontwikkelen tot
een goede onderzoeker. Ik mocht tijd vrijmaken om een persoonlijke beurs aan te
vragen, congressen/bijeenkomsten bij te wonen en contacten te leggen met andere
wetenschappers. Onze discussies over mijn wetenschappelijke data zijn zeer
waardevol geweest voor mijn onderzoeken. Ik heb veel geleerd van jouw kritische
blik en dit waardeer ik enorm. Bedankt!
Pran, thank you for sharing your expertise on leprosy with me. I appreciate the time
and effort you invested in me. I know you don’t like to work with computers, that is
why we had long discussions over the phone about the papers before they got
published. The conversations were really informative and helped me deliver good
research. Yelling on the phone, was not really necessary. You were just in
Birmingham I can hear you through the phone, really I can!! :D
Kees, je straalt altijd een gevoel van rust uit. Bedankt dat je altijd ZEN bent geweest,
op momenten dat het even hectisch was :). Je hebt mij geleerd dat ik me niet zo druk
moet maken en dat alles goed komt! Ik heb ook veel genoten van onze interessante
gesprekken over, dat veel sporten niet gezond is en dat er niet veel voor ons zal
veranderen als Donald Trump president wordt. Ik wil je natuurlijk ook bedanken dat ik
deel uit mocht maken van een belangrijk moment in je leven, je bruiloft met Juliejet!
Valeria, thank you for introducing me to the world of complement activation in the
peripheral nerves. You were really helpful at the beginning of my PhD! I also enjoyed
the time that we spent at the gym and of course shopping for nice clothes and shoes!
Thank you!
Prof. Dirk Troost, bedankt dat je me met open armen hebt ontvangen op je afdeling.
Je stond altijd open voor het bespreken van mijn data en kwam altijd met goede
inzichten in hoe iets beter kan. Ik heb veel van je geleerd en je bent een enorme
steun geweest!
Prof. Eleonora Aronica, je stond altijd voor mij klaar zodra ik materiaal nodig had voor
mijn onderzoek. Bedankt voor de beminnelijke manier waarop je mij te hulp schoot,
zonder jou was mijn ALS onderzoek niet zo efficiënt verlopen! Grazie!
Als ik aan de neuropathologie afdeling denk, dan sta ik meteen stil bij de koffietijd.
Dirk, alle leuke verhalen over de wetenschap van tegenwoordig en jouw investment
avonturen in het buitenland vond ik geweldig!
Lieve Astrid, bedankt dat je me altijd begroette met een grote glimlach en dat er altijd
plek voor me was tijdens de koffietijd :-). Ik wil je enorm bedanken voor je oprechte
interesse in mij en mijn onderzoek. Ik heb altijd genoten van onze gezellige
gesprekjes. Je bent echt een lieverd!
René, als ik aan de neuropathologie afdeling denk dan ben jij niet te missen! Toen ik
net begon met mijn promotietraject had ik geen idee wat materiaal plakken of snijden
inhield. Bedankt dat je me de microtoom hebt leren gebruiken! Je had veel geduld en
was er altijd om mij te helpen, zelfs als je het heel erg druk had. Ik vond het jammer
dat je het AMC verliet, maar gelukkig hoefde ik je niet te missen! Samen met Loesje
pannenkoeken eten, wandelingen maken en naar Arabische muziek luisteren.
Bedankt voor alle gezellige momenten!
Jasper, bedankt voor alle gezellige gesprekken tijdens de koffietijd en natuurlijk voor
alle antilichamen die ik kwam ‘’lenen’’.
Wijze Clifton, jij bent er altijd als ik hulp of advies nodig heb! Zelfs als je geen tijd hebt
of ziek bent krijg ik nog een uitgebreide e-mail over hoe ik het beste het een en ander
kan aanpakken. Bedankt dat je me verder helpt in het leven!
Anand, zelfs bij de laatste loodjes heb jij nog de tijd genomen mijn introductie en
artikel door te lezen. Ik heb daar zeker wat aan gehad, bedankt!
270
Dankwoord
Bram, jij bent er altijd als ik iets nodig heb op de pathologie afdeling; materiaal uit het
archief, kleuringen of coupes. Je zegt nooit NEE. Ik vraag me soms af of je bang
voor me bent :D. Bedankt, je bent een held!
Zonder de hulp van en de energieke sfeer in de genoom analyse afdeling was dit
proefschrift er niet geweest. Ik wil daarom al mijn collega’s in het lab bedanken. Ik
heb veel genoten van de lab lunches, waar we allen bijeenkwamen en een gezellige
tijd hadden.
Ruud, Patrick, Linda, Ferry, Jeroen, Anneloor, Marjan, Fred, Suze, Ted, Marja en
Lydia bedankt voor alle gezellige gesprekken tijdens de koffie!
Van de ‘’oude’’ generatie PhD studenten wil ik bedanken: Marleen, Joeri, Diana,
Hyung, Judith en Yasmin.
Marleen bedankt voor de kerstmarkt wandelingen in het AMC en je mentale support
tijdens mijn promotie. Je stond altijd klaar om gezellig te babbelen over het
onderzoek, je lievelingssport en je studententijd. Ik heb erg genoten van je verhalen
en vond het een eer om aanwezig te mogen zijn op je bruiloft. Ik kom je zeker
binnenkort opzoeken als de kleine er is!
Hyung, bedankt dat je een positieve bijdrage aan de sfeer in de kamer gaf met je
gezang en je apensprongen.
Joeri, bedankt voor het samen vieren van onze verjaardagen en je leuke grappen. Ik
zal nooit meer je opmerking ’’ alles kan stuk’’ vergeten.
De ‘’nieuwe’’ generatie PhD studenten: Iliana, Johanna, Veerle, Bart, Tessa, Anna,
Ghazaleh en Celine. Dank jullie wel voor de werkgerelateerde en niet-
werkgerelateerde discussies. Ook wil ik jullie bedanken voor de gezelligheid tijdens
de ‘’pizza dagen’’ en natuurlijk alle leuke gesprekken in de ‘’pizza app’’.
Iliana, moromouuuuuu thanks for getting me so excited about the cells you see under
the microscope. I love your passion for your sections, it’s like family! I also enjoy(ed)
all our coffee breaks, great conversations and being a part of your wedding! I’m not
going to miss you, because we are good friends and we will for sure stay in touch!
Filakia!
Tessa, bedankt dat je altijd zo vrolijk en positief bent! En niet te vergeten, je niest
altijd op het juiste moment! Ik vond het leuk om in Griekenland jou en Xavier beter te
leren kennen :D.
Anna, bedankt dat je alle hoelahoep ervaringen met ons wilde delen in de aio kamer!
Lou, jouw levendigheid ga ik echt missen!! Bedankt voor de gezelligheid, je bent
zeker één van mijn favoriete collega’s :D. Ik vond het leuk om al jouw vakantie- ,
klusjes- en werkverhalen te horen. Maar, wat ik ook leuk vond waren de momenten
waarop ik jou lastig viel of andersom :- ).
Mamaaaa Mia, zonder al het werk wat jij voor het lab doet/betekent zou ik mijn werk
niet efficiënt kunnen uitvoeren. Bedankt voor alle bestellingen, notulen, oplossingen
voor alle problemen en natuurlijk dat je voor een lange tijd onze lab lunches hebt
georganiseerd! You make life easier!
Marit, ik heb je de laatste jaren leren kennen als een sterke vrouw. Bedankt voor de
gesprekken en natuurlijk je gezang op het lab!
Susan, dank je wel voor je humor en dat je me zo nu en dan een cracker met
geitenkaas voert!
Martin, jij bent echt een persoon die de juiste grappen maakt op het juiste moment!
Keep calm and ….Dank je wel daarvoor!
Olaf, bedankt dat ik altijd herinnerd werd aan lunchtijd zodra jij de aio kamer
binnenloopt!
Jelly, het is algemeen bekend, maar ik zeg het toch maar je bent knettergek!
Natuurlijk in een positieve zin :), bedankt voor al je droge humor!
Carin, bedankt dat je altijd open stond voor een gesprek en een luisterend oor bood.
Ik wil alle studenten bedanken voor hun harde werk, waarmee ze zeker een bijdrage
hebben geleverd aan mijn onderzoek.
Rob, ik wil je bedanken voor alle leuke gesprekken over je talent, koken! Ik ben blij
dat ik je een beetje kon helpen met je gerechten uit de Marokkaanse keuken!
271
Bram, jij bent er altijd als ik iets nodig heb op de pathologie afdeling; materiaal uit het
archief, kleuringen of coupes. Je zegt nooit NEE. Ik vraag me soms af of je bang
voor me bent :D. Bedankt, je bent een held!
Zonder de hulp van en de energieke sfeer in de genoom analyse afdeling was dit
proefschrift er niet geweest. Ik wil daarom al mijn collega’s in het lab bedanken. Ik
heb veel genoten van de lab lunches, waar we allen bijeenkwamen en een gezellige
tijd hadden.
Ruud, Patrick, Linda, Ferry, Jeroen, Anneloor, Marjan, Fred, Suze, Ted, Marja en
Lydia bedankt voor alle gezellige gesprekken tijdens de koffie!
Van de ‘’oude’’ generatie PhD studenten wil ik bedanken: Marleen, Joeri, Diana,
Hyung, Judith en Yasmin.
Marleen bedankt voor de kerstmarkt wandelingen in het AMC en je mentale support
tijdens mijn promotie. Je stond altijd klaar om gezellig te babbelen over het
onderzoek, je lievelingssport en je studententijd. Ik heb erg genoten van je verhalen
en vond het een eer om aanwezig te mogen zijn op je bruiloft. Ik kom je zeker
binnenkort opzoeken als de kleine er is!
Hyung, bedankt dat je een positieve bijdrage aan de sfeer in de kamer gaf met je
gezang en je apensprongen.
Joeri, bedankt voor het samen vieren van onze verjaardagen en je leuke grappen. Ik
zal nooit meer je opmerking ’’ alles kan stuk’’ vergeten.
De ‘’nieuwe’’ generatie PhD studenten: Iliana, Johanna, Veerle, Bart, Tessa, Anna,
Ghazaleh en Celine. Dank jullie wel voor de werkgerelateerde en niet-
werkgerelateerde discussies. Ook wil ik jullie bedanken voor de gezelligheid tijdens
de ‘’pizza dagen’’ en natuurlijk alle leuke gesprekken in de ‘’pizza app’’.
Iliana, moromouuuuuu thanks for getting me so excited about the cells you see under
the microscope. I love your passion for your sections, it’s like family! I also enjoy(ed)
all our coffee breaks, great conversations and being a part of your wedding! I’m not
going to miss you, because we are good friends and we will for sure stay in touch!
Filakia!
Dankwoord
Tessa, bedankt dat je altijd zo vrolijk en positief bent! En niet te vergeten, je niest
altijd op het juiste moment! Ik vond het leuk om in Griekenland jou en Xavier beter te
leren kennen :D.
Anna, bedankt dat je alle hoelahoep ervaringen met ons wilde delen in de aio kamer!
Lou, jouw levendigheid ga ik echt missen!! Bedankt voor de gezelligheid, je bent
zeker één van mijn favoriete collega’s :D. Ik vond het leuk om al jouw vakantie- ,
klusjes- en werkverhalen te horen. Maar, wat ik ook leuk vond waren de momenten
waarop ik jou lastig viel of andersom :- ).
Mamaaaa Mia, zonder al het werk wat jij voor het lab doet/betekent zou ik mijn werk
niet efficiënt kunnen uitvoeren. Bedankt voor alle bestellingen, notulen, oplossingen
voor alle problemen en natuurlijk dat je voor een lange tijd onze lab lunches hebt
georganiseerd! You make life easier!
Marit, ik heb je de laatste jaren leren kennen als een sterke vrouw. Bedankt voor de
gesprekken en natuurlijk je gezang op het lab!
Susan, dank je wel voor je humor en dat je me zo nu en dan een cracker met
geitenkaas voert!
Martin, jij bent echt een persoon die de juiste grappen maakt op het juiste moment!
Keep calm and ….Dank je wel daarvoor!
Olaf, bedankt dat ik altijd herinnerd werd aan lunchtijd zodra jij de aio kamer
binnenloopt!
Jelly, het is algemeen bekend, maar ik zeg het toch maar je bent knettergek!
Natuurlijk in een positieve zin :), bedankt voor al je droge humor!
Carin, bedankt dat je altijd open stond voor een gesprek en een luisterend oor bood.
Ik wil alle studenten bedanken voor hun harde werk, waarmee ze zeker een bijdrage
hebben geleverd aan mijn onderzoek.
Rob, ik wil je bedanken voor alle leuke gesprekken over je talent, koken! Ik ben blij
dat ik je een beetje kon helpen met je gerechten uit de Marokkaanse keuken!
272
BEDANKT ALLEMAAL!! Ik heb altijd met veel plezier met jullie samengewerkt en ga
jullie zeker missen!
Dr. Marcos Virmond, thank you for giving me the opportunity to work in your lab in
Bauru. I discovered a lot of animals on the campus and had a great time!
Patricia, thank you for all your help during my PhD and of course my experience of
celebrating Christmas in the summer with your family in Sao Paulo. Cleverson, thank
you for teaching me a lot about leprosy pathology!
Gina thank you for taking the time to make the cover for my book. It is beautiful!
Lieve Maarten, Ik was blij dat ik weer in het AMC kwam werken, dan hadden we weer
vaker contact. Dank je wel dat je me tijdens mijn stage de weg hebt gewezen op het
Virologie lab, ik heb veel van je geleerd! Vergeet niet je camera mee te nemen
tijdens mijn promotie!
Ik wil ook al mijn lieve vrienden bedanken: Monique, Yodith, Carmen, Nancy, Wilma,
Meryam, Svetle, Iliana en Ken, bedankt voor alle gezellige momenten en alle steun!
Derphartox, Q.M. Gastmann Wichers stichting, Leprastichting, bedankt voor het
financieel ondersteunen van het drukken van mijn proefschrift!
Uiteraard wil ik de NWO en de Leprastichting bedanken voor het financieren van mijn
promotietraject.
Ik wil de promotiecommissie bedanken voor de tijd die ze gestoken hebben in het
beoordelen van mijn proefschrift.
Mijn dankwoord is natuurlijk niet compleet zonder mijn lieve ouders, broer en zusje.
Ik wil hen bedanken voor alle steun tijdens mijn promotietraject en natuurlijk al de
jaren ervoor. Van jongs af aan heb ik ervan gedroomd een bijdrage te leveren aan
patiënten. Ik ben nu ´´Dr. Nawal Bahia El Idrissi´´ geworden. Mama en papa, bedankt
dat jullie me hebben geleerd dat alles mogelijk is als je er echt voor gaat! en Lieve
broer, bedankt voor al je nuchtere adviezen en humor! Zussieee, bedankt voor alle
gezelligheid die we samen hebben, films, reizen, uiteten en natuurlijk je ’’business
mind set’’, ik leer veel van je! Ik weet dat ik altijd bij jullie terecht kan en dat is fijn. Ik
hou van jullie!!
PhD portfolio
Name PhD student: N. Bahia el Idrissi
Name PhD supervisor: Prof. F. Baas
1. PhD training
Courses organized by ONWAR or AMC Year Workload (hrs)
Introductory course ONWAR 2010-2014 15
Swammerdam Lectures 2010-2016 20
AMC world of science 2010 24
ONWAR retreat 2010-2014 75
Laboratory safety 7
Laboratory animal science (art.9) 2011 100
Macroscpic, microscopic and pathologic
anatomy of the mouse
2011 32
Functional neuroanatomy 2012 40
Degenerative diseases of the nervous
system
2012 40
Grant writing March 2012 50
Molecular neurobiology 2013 56
Scientific writing in english 2014 50
BROK GCP 2016 34
Dankwoord
PhD Portfolio
273
BEDANKT ALLEMAAL!! Ik heb altijd met veel plezier met jullie samengewerkt en ga
jullie zeker missen!
Dr. Marcos Virmond, thank you for giving me the opportunity to work in your lab in
Bauru. I discovered a lot of animals on the campus and had a great time!
Patricia, thank you for all your help during my PhD and of course my experience of
celebrating Christmas in the summer with your family in Sao Paulo. Cleverson, thank
you for teaching me a lot about leprosy pathology!
Gina thank you for taking the time to make the cover for my book. It is beautiful!
Lieve Maarten, Ik was blij dat ik weer in het AMC kwam werken, dan hadden we weer
vaker contact. Dank je wel dat je me tijdens mijn stage de weg hebt gewezen op het
Virologie lab, ik heb veel van je geleerd! Vergeet niet je camera mee te nemen
tijdens mijn promotie!
Ik wil ook al mijn lieve vrienden bedanken: Monique, Yodith, Carmen, Nancy, Wilma,
Meryam, Svetle, Iliana en Ken, bedankt voor alle gezellige momenten en alle steun!
Derphartox, Q.M. Gastmann Wichers stichting, Leprastichting, bedankt voor het
financieel ondersteunen van het drukken van mijn proefschrift!
Uiteraard wil ik de NWO en de Leprastichting bedanken voor het financieren van mijn
promotietraject.
Ik wil de promotiecommissie bedanken voor de tijd die ze gestoken hebben in het
beoordelen van mijn proefschrift.
Mijn dankwoord is natuurlijk niet compleet zonder mijn lieve ouders, broer en zusje.
Ik wil hen bedanken voor alle steun tijdens mijn promotietraject en natuurlijk al de
jaren ervoor. Van jongs af aan heb ik ervan gedroomd een bijdrage te leveren aan
patiënten. Ik ben nu ´´Dr. Nawal Bahia El Idrissi´´ geworden. Mama en papa, bedankt
dat jullie me hebben geleerd dat alles mogelijk is als je er echt voor gaat! en Lieve
broer, bedankt voor al je nuchtere adviezen en humor! Zussieee, bedankt voor alle
gezelligheid die we samen hebben, films, reizen, uiteten en natuurlijk je ’’business
mind set’’, ik leer veel van je! Ik weet dat ik altijd bij jullie terecht kan en dat is fijn. Ik
hou van jullie!!
PhD portfolio
Name PhD student: N. Bahia el Idrissi
Name PhD supervisor: Prof. F. Baas
1. PhD training
Courses organized by ONWAR or AMC Year Workload (hrs)
Introductory course ONWAR 2010-2014 15
Swammerdam Lectures 2010-2016 20
AMC world of science 2010 24
ONWAR retreat 2010-2014 75
Laboratory safety 7
Laboratory animal science (art.9) 2011 100
Macroscpic, microscopic and pathologic
anatomy of the mouse
2011 32
Functional neuroanatomy 2012 40
Degenerative diseases of the nervous
system
2012 40
Grant writing March 2012 50
Molecular neurobiology 2013 56
Scientific writing in english 2014 50
BROK GCP 2016 34
PhD Portfolio
274
Presentation during Master classes Year Workload (hrs)
Master class held by Prof. Robert Modlin.
Title Presentation: The role of the complement
system in nerve damage in Leprosy.
2011 5
Pathology research day held by Prof. Eleonora
Aronica.
Title Presentation: Role for Complement in nerve
damage in leprosy.
2012 5
Master class held by Prof. Paul Morgan.
Title Presentation: Complement levels in serum
samples of leprosy patients.
2012 5
Conferences Year
PNS conference Maryland Baltimore, US 2011
Conference Complement in human diseases, Leiden, Netherlands 2011
12th Brazilian Congress of Leprosy, Maceio, Brazil 2011
XXIV International Complement Workshop, Chania, Crete, Greece 2012
International leprosy conference, Brussels, Belgium 2013
Retreats Year
FBI Immunology retreat, Egmond aan zee, Netherlands 2011
Genetics retreat 2013
Genetics retreat 2014
Meetings Year
NLR Leprosy meeting 2010-2015
Scientific ALS meeting Utrecht (ALS centrum) 2014
Weekly departement meeting 2010-2016
Journal club 2010-2016
Groupmeetings 2010-2016
Collaborations Year Workload (hrs)
Lauro Souza Lima Institute, Bauru-SP, Brazil 2011 105
2. Teaching
Tutoring and supervising Year
Supervising bachelor students 2012-2014
Supervising Sanne Bosch: Complement activation at the end-
plates of ALS donors.
2012-2013
3. Grants
Personal grant Organization Year Amount
Mozaiekbeurs NWO 2012 € 200.000
PhD Portfolio
275
Presentation during Master classes Year Workload (hrs)
Master class held by Prof. Robert Modlin.
Title Presentation: The role of the complement
system in nerve damage in Leprosy.
2011 5
Pathology research day held by Prof. Eleonora
Aronica.
Title Presentation: Role for Complement in nerve
damage in leprosy.
2012 5
Master class held by Prof. Paul Morgan.
Title Presentation: Complement levels in serum
samples of leprosy patients.
2012 5
Conferences Year
PNS conference Maryland Baltimore, US 2011
Conference Complement in human diseases, Leiden, Netherlands 2011
12th Brazilian Congress of Leprosy, Maceio, Brazil 2011
XXIV International Complement Workshop, Chania, Crete, Greece 2012
International leprosy conference, Brussels, Belgium 2013
Retreats Year
FBI Immunology retreat, Egmond aan zee, Netherlands 2011
Genetics retreat 2013
Genetics retreat 2014
Meetings Year
NLR Leprosy meeting 2010-2015
Scientific ALS meeting Utrecht (ALS centrum) 2014
Weekly departement meeting 2010-2016
Journal club 2010-2016
Groupmeetings 2010-2016
Collaborations Year Workload (hrs)
Lauro Souza Lima Institute, Bauru-SP, Brazil 2011 105
2. Teaching
Tutoring and supervising Year
Supervising bachelor students 2012-2014
Supervising Sanne Bosch: Complement activation at the end-
plates of ALS donors.
2012-2013
3. Grants
Personal grant Organization Year Amount
Mozaiekbeurs NWO 2012 € 200.000