9

pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Download PDF Report

Upload
lythuy
View
212
Download
0

Embed Size (px)

Citation preview

Page 1: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 2: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 3: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 4: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 5: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 6: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 7: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 8: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

Page 9: pure.knaw.nl · rons innervate brain stem nuclei and might thus be related to autonomic dis- turbances in MS. In MS the staining intensity for A VP was clearly lower and for OXT slightly

pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

pure.knaw.nl · Author: karinh Created Date: 7/1/2015 2:07:44 PM

Documents

CD74’and’OxytocinDRelated’Networks ... - Poster Talks · ... [CCK]%and%oxytocin% [OXT],%p=2.093e,4).%%% LowDG60vs. HighD,G60% Comparison%of%LowD60%vs%HighD60%showed% diﬀerenZal%expression%of%CD74%(upregulated,

CD74’and’OxytocinDRelated’Networks ... - Poster Talks · ... [CCK]%and%oxytocin% [OXT],%p=2.093e,4).%%% LowDG60vs. HighD,G60% Comparison%of%LowD60%vs%HighD60%showed% diﬀerenZal%expression%of%CD74%(upregulated,

Documents

pure.knaw.nl€¦ · Web view1Institute of Environmental Biology, Ecology & Biodiversity, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands2Dept. of Forest Mycology

pure.knaw.nl€¦ · Web view1Institute of Environmental Biology, Ecology & Biodiversity, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands2Dept. of Forest Mycology

Documents

Speciﬁcation and Estimation of Spatial Autoregressive ...econweb.umd.edu/~kelejian/Research/KP_0507.pdf · turbances to be generated by a spatial autoregressive process. Consistent

Speciﬁcation and Estimation of Spatial Autoregressive ...econweb.umd.edu/~kelejian/Research/KP_0507.pdf · turbances to be generated by a spatial autoregressive process. Consistent

Documents

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

Documents

ErweiterungenfürLibreOﬃce erstellen - amantke.de · 2 DerContainerOXTundsein Inhalt Innerhalb des komprimierten Datei-Containers OXT beﬁnden sich mehrere Dateien undesistregelmäßigaucheinespezielleStrukturangelegt

ErweiterungenfürLibreOﬃce erstellen - amantke.de · 2 DerContainerOXTundsein Inhalt Innerhalb des komprimierten Datei-Containers OXT beﬁnden sich mehrere Dateien undesistregelmäßigaucheinespezielleStrukturangelegt

Documents

pure.knaw.nl · 2 Department of Plant Pathology, University of Tsukuba, Tennodai, Tsukuba, Ibaraki, 305, Japan 3 Department of Plant Pathology, University of Stellenbosch, Shellenbosch,

pure.knaw.nl · 2 Department of Plant Pathology, University of Tsukuba, Tennodai, Tsukuba, Ibaraki, 305, Japan 3 Department of Plant Pathology, University of Stellenbosch, Shellenbosch,

Documents

Developmental Trauma, Attachment, and Addiction...before and after 15 min parent-child “play and touch” session Stimulatory Contact LOW HIGH LOW HIGH Affectionate Touch OXT Levels

Developmental Trauma, Attachment, and Addiction...before and after 15 min parent-child “play and touch” session Stimulatory Contact LOW HIGH LOW HIGH Affectionate Touch OXT Levels

Documents

MAHARISHI UNIVERSITY OF MANAGEMENT VEDIC LITERATURE … samhita/5.sushruta_kalpa.pdf · 2019-07-28 · ko…kl" Svrvw’Ty ' £*çSt u mdm Czit 31O ˙„yeNmyUr ¨i√¶" £oxt" x

MAHARISHI UNIVERSITY OF MANAGEMENT VEDIC LITERATURE … samhita/5.sushruta_kalpa.pdf · 2019-07-28 · ko…kl" Svrvw’Ty ' £*çSt u mdm Czit 31O ˙„yeNmyUr ¨i√¶" £oxt" x

Documents

pure.knaw.nl€¦ · Web viewActivating Senior Potential in Ageing Europe: an Employers’ Perspective. Wieteke Conen, Harry van Dalen, Kène Henkens, Joop Schippers. European Commission

pure.knaw.nl€¦ · Web viewActivating Senior Potential in Ageing Europe: an Employers’ Perspective. Wieteke Conen, Harry van Dalen, Kène Henkens, Joop Schippers. European Commission

Documents

pure.knaw.nl€¦ · Web viewRelationships between plant traits, soil properties and carbon fluxes differ between monocultures and mixed communities in temperate grassland. Jonathan

pure.knaw.nl€¦ · Web viewRelationships between plant traits, soil properties and carbon fluxes differ between monocultures and mixed communities in temperate grassland. Jonathan

Documents

pure.knaw.nl · PDF filewijkingen: 3', placenta-insufficiëntie: 2; solutio placentae: y, placenta praevia: 5; placenta circumvallata: 3', constrictie + torsie navelstreng: 1 ;

pure.knaw.nl · PDF filewijkingen: 3', placenta-insufficiëntie: 2; solutio placentae: y, placenta praevia: 5; placenta circumvallata: 3', constrictie + torsie navelstreng: 1 ;

Documents

$Legislative Assembly THURSDAY MARCH · ::\Ir. JENKI~SOX (Fr:ssifern): Pursuant to leave given n1e yesterday, I desire to present a Bill with reference to the suppression of dis turbances$

Legislative Assembly THURSDAY MARCH · ::\Ir. JENKI~SOX (Fr:ssifern): Pursuant to leave given n1e yesterday, I desire to present a Bill with reference to the suppression of dis turbances

Documents

JITTER CHARACTERIZATION IN SPACE MECHANISMSesmats.eu/esmatspapers/pastpapers/pdfs/2017/ayari.pdf · turbances using control schemes, over some bandwidth which depends on how the degrees

JITTER CHARACTERIZATION IN SPACE MECHANISMSesmats.eu/esmatspapers/pastpapers/pdfs/2017/ayari.pdf · turbances using control schemes, over some bandwidth which depends on how the degrees

Documents

HAARPatmosphere and the solar terrestrial environment. Dis- turbances originating at the Sun spread through this chain via the solar wind and solar radiation. They ulti- mately influence

HAARPatmosphere and the solar terrestrial environment. Dis- turbances originating at the Sun spread through this chain via the solar wind and solar radiation. They ulti- mately influence

Documents

OXYGEN ENRICHMENT SYSTEMS Providing PSA Oxygen Systems ... · Systems for a highly reliable on-site oxygen source with low capital and operating costs. Oxair OXT-Series ranges from

OXYGEN ENRICHMENT SYSTEMS Providing PSA Oxygen Systems ... · Systems for a highly reliable on-site oxygen source with low capital and operating costs. Oxair OXT-Series ranges from

Documents

High-resolution mapping of time since disturbance and forest … · 2018. 12. 6. · H. Gu et al.: High-resolution mapping of time since disturbance 6323 turbances of varying severity;

High-resolution mapping of time since disturbance and forest … · 2018. 12. 6. · H. Gu et al.: High-resolution mapping of time since disturbance 6323 turbances of varying severity;

Documents

$Mixer Filter Amplifier Real Computer Synthesizer System · Cominc v \oxt Month Sound Reinforcement and public ad- dress will be the subject matter for all of our feature articles$

Mixer Filter Amplifier Real Computer Synthesizer System · Cominc v \oxt Month Sound Reinforcement and public ad- dress will be the subject matter for all of our feature articles

Documents

Endocrine diseases, perspectives and care in Turner syndrome · ovarian failure (2). The main endocrine problems are short stature, ovarian failure, immune diseases and dis-turbances

Endocrine diseases, perspectives and care in Turner syndrome · ovarian failure (2). The main endocrine problems are short stature, ovarian failure, immune diseases and dis-turbances

Documents

Bases genéticas e a evolução do comportamentogrupoetco.org.br/arquivos_br/aulas/etologia_aula_12.pdf · · 2016-05-1928/05/2013 3 Nocaute do gene Oxt em camundongos - Não produzem

Bases genéticas e a evolução do comportamentogrupoetco.org.br/arquivos_br/aulas/etologia_aula_12.pdf · · 2016-05-1928/05/2013 3 Nocaute do gene Oxt em camundongos - Não produzem

Documents

pure.knaw.nl · Tulane University, Department of Medicine, and Veterans Administration Hospital, New Orleans, USA Summary. Using antibodies against A VT, ot-MSH, LHRH and somatostatin,

pure.knaw.nl · Tulane University, Department of Medicine, and Veterans Administration Hospital, New Orleans, USA Summary. Using antibodies against A VT, ot-MSH, LHRH and somatostatin,

Documents

Basteria - pure.knaw.nl · Basteria TIJDSCHRIFT VAN DE NEDERLANDSE MALACOLOGISCHE VERENIGING VOL. 26, NO. 5 en6, PAG.61—88 28-XII-1962 Thelifecycle of thewatersnailAplexa hypnorum

Basteria - pure.knaw.nl · Basteria TIJDSCHRIFT VAN DE NEDERLANDSE MALACOLOGISCHE VERENIGING VOL. 26, NO. 5 en6, PAG.61—88 28-XII-1962 Thelifecycle of thewatersnailAplexa hypnorum

Documents

pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23]

pure.knaw.nl functions observed during, e. g. sleep disturbances ... A sex difference does not occur until about the fourth year postnatally, ... [13], nucleoli [23]

Documents

pure.knaw.nl · contusio cerebri, lung embolism bronchopneunomia medullar mamma- carcinoma, multiple cerebral and meningeal metastases polymyalgia rheumatica; endocarditis; mitralis-

pure.knaw.nl · contusio cerebri, lung embolism bronchopneunomia medullar mamma- carcinoma, multiple cerebral and meningeal metastases polymyalgia rheumatica; endocarditis; mitralis-

Documents

Local oxytocin tempers anxiety by activating GABAA ... · the PVN in female prairie voles. We established a pharmacolog-ical paradigm demonstrating intra-PVN injections of Oxt prevent

Local oxytocin tempers anxiety by activating GABAA ... · the PVN in female prairie voles. We established a pharmacolog-ical paradigm demonstrating intra-PVN injections of Oxt prevent

Documents

ON SEISMIC RAYS AND WAVES* (Part One)authors.library.caltech.edu/47745/1/331.full.pdftematic study of the various phases of the propagation problem of seismic dis- turbances, both

ON SEISMIC RAYS AND WAVES* (Part One)authors.library.caltech.edu/47745/1/331.full.pdftematic study of the various phases of the propagation problem of seismic dis- turbances, both

Documents

The multi-scale nature of the solar wind - Springer · 2019-12-20 · bodies in the solar system. Although the connection between solar activity and dis-turbances in the Earth’s

The multi-scale nature of the solar wind - Springer · 2019-12-20 · bodies in the solar system. Although the connection between solar activity and dis-turbances in the Earth’s

Documents

Quantification of Integrated Watershed System Resilience: A … · 2018-03-03 · turbances and long-term climate change with these challenging con-ditions will be necessary for future

Quantification of Integrated Watershed System Resilience: A … · 2018-03-03 · turbances and long-term climate change with these challenging con-ditions will be necessary for future

Documents

pure.knaw.nl · visual pathway, the geniculohypothalamic tract (GHT) from the intergeniculate leaflet (IGL) of the lateral geniculate, containing neuropeptide-Y, which projects

pure.knaw.nl · visual pathway, the geniculohypothalamic tract (GHT) from the intergeniculate leaflet (IGL) of the lateral geniculate, containing neuropeptide-Y, which projects

Documents

pure.knaw.nl€¦ · Web viewImpact of peat mining, and restoration on methane turnover potentials and methane-cycling microorganisms in a northern bog. Max Reumer1, Monika Harnisz2,

pure.knaw.nl€¦ · Web viewImpact of peat mining, and restoration on methane turnover potentials and methane-cycling microorganisms in a northern bog. Max Reumer1, Monika Harnisz2,

Documents