Protein Engineering of Chit42 Towards Improvement of Chitinase and Antifungal Activities

Protein Engineering of Chit42 Towards Improvement of Chitinaseand Antifungal Activities

Mojegan Kowsari • Mostafa Motallebi •

Mohammadreza Zamani

Received: 26 May 2013 / Accepted: 15 October 2013 / Published online: 10 December 2013

� Springer Science+Business Media New York 2013

Abstract The antagonism of Trichoderma strains usually

correlates with the secretion of fungal cell wall degrading

enzymes such as chitinases. Chitinase Chit42 is believed to

play an important role in the biocontrol activity of Trich-

oderma strains as a biocontrol agent against phytopatho-

genic fungi. Chit42 lacks a chitin-binding domain (ChBD)

which is involved in its binding activity to insoluble chitin.

In this study, a chimeric chitinase with improved enzyme

activity was produced by fusing a ChBD from T. atroviride

chitinase 18–10 to Chit42. The improved chitinase con-

taining a ChBD displayed a 1.7-fold higher specific activity

than chit42. This increase suggests that the ChBD provides

a strong binding capacity to insoluble chitin. Moreover,

Chit42-ChBD transformants showed higher antifungal

activity towards seven phytopathogenic fungal species.

Introduction

Trichoderma harzianum is one of the most potent biocon-

trol agents against a wide range of economically important

aerial and soilborn plant pathogens [26]. It appears that the

main mechanism involved in biocontrol by T. harzianum is

the release of lytic enzymes [15, 21]. Chitinases are con-

sidered key hydrolytic enzymes in the lysis of cell walls of

fungi, and they play an important role in biological control

[12, 27]. Among Trichoderma chitinases, Chit42 is essen-

tial for biocontrol activities against phytopathogenic fungi

[19]. The lytic activity of Trichoderma strains could be

improved by gene overexpression together with enzyme

modification. Only a few of the fungal chitinases contain a

chitin-binding domain (ChBD) which is linked to the cat-

alytic site via a linker region. Chit42 in T. harzianum does

not contain a ChBD [2, 19, 32]. Previous studies have

shown that ChBDs exhibited remarkably high specificity to

chitin, and its binding activity was reversible [14]. It is

expected that, owing to its small size, the ChBD would

have minimal interference with the tertiary structure of the

fusion protein [6]. The ChBD is a tunnel-like structure

which facilitates chitinase binding, thus, allowing the

efficient degradation of chitin [13, 30].

We have constructed a chimeric chitinase by adding a

chitin-binding domain from T. atroviride chitinase 18–10

to the N-terminal of Chit42 from T. atroviride to improve

its enzyme activity. The antifungal activity of the con-

structed chimeric was evaluated to study the effect of

ChBD in the antifungal activity of the chimeric chitinase.

Materials and Methods

Microorganisms and Plasmids

Trichoderma harzianum (ABRIICC T8-7MK), Rhizoctonia

solani (ABRIICC Rs46), Fusarium graminearum (ABRIICC

Fg21), Fusarium oxysporum (ABRIICC Fo11), Sclerotinia

M. Kowsari � M. Motallebi (&) � M. Zamani

National Institute of Genetic Engineering and Biotechnology

(NIGEB), Shahrak-e Pajoohesh, km 15, Tehran - Karaj

Highway, P.O. Box 14965-161, Tehran, Iran

e-mail: [email protected]

M. Zamani


M. Kowsari

Agricultural Biotechnology Research Institute of Iran, Seed

and Plant Improvement, Institutes Campus, Mahdasht Road,

P. O. Box 31535-1897, Karaj, Iran


123

Curr Microbiol (2014) 68:495–502

DOI 10.1007/s00284-013-0494-3

sclerotiorum (ABRIICC Ss8), Verticillium dahlia (ABRIICC

Vd5), Alternaria brassicola (ABRIICC Ab3) and Botrytis

cinerea (ABRIICC Bc2) were provided by the Agricultural

Biotechnology Research Institute of Iran (ABRII), type col-

lection culture. The amdS plasmid p3SR2 was kindly pro-

vided by Prof. Dr. M. J. Hynes from Melbourne University,

Australia. The pLMRS3 plasmid which carried the constitu-

tive promoter pki1 from T. reesei and the cbh2 terminator

from T. reesei cellobiohydrolaseII was kindly donated by

Prof. Dr. R. L. Mach, Vienna University, Austria. Total

genomic DNA was isolated from freeze-dried mycelia

according to the method of Lee and Taylor [16]. The RNA

from powdered mycelia was isolated using the RNeasy Plant

Mini Kit (Qiagen) according to the manufacturer’s recom-

mendations. Molecular biology procedures were performed

following the standard protocols of Sambrook and Russell

[28].

Growth Media

Fungal strains were maintained on PDA (Potato Dextrose

Agar). Colloidal Chitin Agar (CCA) selective medium

contained (g/l): colloidal chitin, 5.0; sucrose, 1.0; NaNO3,

2.0; K2HPO4, 1.0; KCl, 0.5; MgSO4, 0.5; FeSO4, 0.01; agar

15 at pH 6.5. Salt minimal medium, MM [23] supple-

mented with 20 g/l glucose were used for spore inocula-

tion. The MM medium was buffered using 0.2 M MES

(2-Nmorpholino-ethanesulfonic acid)-KOH pH 6.0, or

0.2 M Tris pH 8.0. The selective medium for amdS

expression was MM containing 10 mM acetamide as the

sole nitrogen source and 12.5 mM CsCl (MMA). The

Escherichia coli strain was grown in a Luria–Bertani (LB)

medium at 37 �C, and media were supplemented with

ampicillin (SIGMA, 100 g/ml). All chemicals and antibi-

otics were purchased from Merck (Germany). DNA mod-

ifying enzymes were obtained from Fermentase and Roche

Biochemical.

Construction of Hybrid Chitinase

Chit42 cDNA from T. atroviride (DQ022674) was ampli-

fied using Pf1/Prx primers (Table 1) with XbaI site by Pfu

DNA polymerase. The PCR mixture contained the standard

concentration of DNA, dNTPs, primers and DNA poly-

merases. The PCR reaction was carried out as follows: one

cycle for 50 s at 94 �C, 35 cycles of amplification: 1 min at

94 �C, 1 min at 60 �C and 1.5 min at 72 �C, followed by

an additional cycle of 5 min at 72 �C. The blunt-ended

fragment was ligated to vector pJET (pJEchit42) and

pLMRS3 (pLMRS3-chit42). To create a chimeric gene

containing ChBD?linker at the N-terminal end of chit42-

cDNA, the fragment containing chit42 cDNA (F1 fragment

in Fig. 1) was amplified using F3/Prx primers (Table 1).

This fragment contained the coding sequence of the mature

protein of Chit42 without its signal peptide and prepro

region (1,170 bp). The signal peptide and prepro sequences

of chit42 (105 bp) were amplified (F2 fragment in Fig. 1)

from plasmid pJEchit42 using Pf1/R1 primers (Table 1).

The fragment (237 bp) containing a chitin-binding domain

(from amino acid 414 to 480) and a linker (from amino acid

481 to 492) in chitinase 18–10 (AAZ23945.1) was ampli-

fied (F3 fragment in Fig. 1) using the genomic DNA of T.

atrovridea as template and F01/R2 as primers (Table 1).

Amplified fragments (F2 and F3) were purified using a

PCR product purification kit (Roche) and fused together in

a second PCR step. R1/F01primers (Table 1) contained

respectively a 14- and 15-nucleotides long 50 extension

complementary to the ChBD?linker and signal pep-

tide?prepro fragments that were necessary to fuse different

fragments together. The chimeric chitinase was constructed

using Splicing by Overlap Extension (SOEing) PCR. For

overlap extension of PCR, equimolar amounts of each

fragment (F2 and F3) were mixed in the absence of addi-

tional primers. The PCR programme consisted of seven

repetitive cycles and was carried out with a denaturation

step (94 �C, 1 min), an annealing step (54 �C, 1 min) and

an elongation step (72 �C, 1.2 min). The fusion product

was subsequently amplified using F1 and R2 primers in

PCR reaction as described above.

For the second SOEing PCR, the product of the first

SOEing PCR and F1 fragment was purified and fused

together in a second PCR reaction. R2 and F3 primers

contained 17- and 15-nucleotides 50 extensions comple-

mentary to the F1 and linker fragments for fusion. For

overlap extension PCR, equimolar amounts of each frag-

ment were mixed without additional primers. The PCR

programme consisting of seven repetitive cycles was car-

ried out. Then the fused product was amplified using Pf1/

Prx primers. The chimeric gene was purified and cloned

into XbaI site of pJET1.2. The nucleotide sequence of the

chimeric gene was verified by DNA sequencing. The

Table 1 Primers used in this study

Primer Sequences (50–30)

Pf1 GC TCTAGAATGTTGGGCTTCCTCGGAAAG

Prx GCTCTAGACTAGTTGAGACCGCTTCGGAT

F3 GCTCCCGCCCACTTCGCCAGCGGATACGCAAACG

R1 TGAGGACCGCATTTTCTCTTCTCAACTGAGACG

F01 TCAGTTGAGAAGAGAAAATGCGGTCCTCAGGTTCC

R2 TTTGCGTATCCGCTGGCGAAGTGGGCGGGAGCCG

ChiF TGCCTACGCCGATTATCAGAAGCA

ChiR CTTCAAGTTGCGGTTGGCCTTCTT

btubuF TTCTTGCATTGGTACACTAGCG

btubuR ATCGTTCATGTTGGACTCAGCC

496 M. Kowsari et al.: Protein Engineering of Chit42

123

fragment was ligated to the pLMRS3 vector to create

pLMRS3-chit42ChBD for expression of the chimeric gene

in Trichoderma.

Transformation Procedures

Protoplast preparation and transformation were carried out

according to the method of Penttilaet al. [25]. T. harzianum

T8-7 MK wild type was cotransformed with chitinase-

containing plasmids pLMRS3-ChBD and pLMRS3-chit42

with the plasmid p3SR2. Plasmid p3SR2 carries the amdS

gene from as Aspergillus nidulans, which codes for ace-

tamidase as a selectable marker. Cotransformation was

conducted with a 1:10 (p3SR2/pLMRS3-chit42 & pLMRS3-

chit42ChBD) plasmid ratio, and 200–1,000 ll aliquots of

the transformed protoplasts were plated in 0.75 % selective

top Agar containing 1 M sorbitol as the osmotic stabilizer.

The selective medium for amdS expression was MM glu-

cose containing 10 mM acetamide as the sole nitrogen

source instead of (NH4)2 SO4 and 12.5 mM CsCl. Indi-

vidual colonies were randomly chosen for amds in the

selective medium and incubated at 28 �C after five days.

Protoplasts were placed on a 2 % CCA selective medium.

The protoplast regeneration and the development of colo-

nies were observed on plates that were incubated at room

temperature. Regenerated transformants were selected

based on their growth rate on selective medium. One

mycelial disc (5 mm) of each transformant was inoculated

on 0.5 % CCA and PDA media and incubated at 28 �C for

four days.

Transcriptomic Analysis by Quantitative Real-time

RT-PCR

Chit42 transcripts were quantified by real-time quantitative

RT-PCR in transformants and control strains under

repressive conditions with glucose. RNA was isolated from

mycelia grown for 48 h at 28 �C in MM with 20 g/l glu-

cose. Total RNA was isolated from 100 mg of freeze-dried

mycelia powder derived from single spore of selected

transformants and wild type using the RNeasy Plant Mini

Kit (Qiagen). The cDNA were synthesized from 1 lg of

total RNA using a cDNA synthesis kit with an oligo (dT)

primer. One ll of the cDNA was used in the PCR reaction

with the (chiF/chiR) and (btubuF/btubuR) as specific

primers. Real-time PCR was performed using an ABI

system with a SYBR green master mix. All PCRs were

performed in triplicate in a total volume of 10 ll for 40

cycles under the following conditions: denaturation, 95 �C,

45 s; annealing, 58 �C, 1 min; extension, 72 �C, 1 min.

The number of cDNA transcripts was normalized against

the expression of the housekeeping b-tubulin gene [11].

Data were expressed as 2-DDCT [20].

Chitinase Activity

Chitinase activity was assayed according to the method of

Boller and Mauch [4]. To test the effect of a ChBD on

chitinase activity, insoluble chitin was used as a substrate.

Strains were grown for 60 h in pH 6-buffered MM with

20 g/l glucose; 250 ll concentrated supernatant or cell-free

Fig. 1 Scheme of gene constructions. Vectors pLMRS3-chit42 and

pLMRS3-chit42ChBD were constructed amplifying the signal pep-

tide, preproregion, ChBD, linker region and mature chit42with

specific primers containing strategies for cleavage. pki prom,

Pyruvate kinase promoter from T. reesei; sp, signal peptide; prepro,

preproregion; ChBD-Linker, Chitin-binding domain and linker of

chitinase 18–10 T. atroviride; Chit42 cDNA encoding mature protein;

cbh2 term, terminator of cellobiohydrolases II from T. reesei.

Numbers inside shapes show fragment sizes; Arrows indicate primers

for PCR and SOEing PCR amplification

M. Kowsari et al.: Protein Engineering of Chit42 497

123

extract of each strain was incubated with insoluble chitin.

Chitin (10 g/l) was resuspended in a 70 mM potassium

phosphate buffer pH 6.0. Activity was assayed in contin-

uous shaking at 30 �C for 1 h. The released N-acetyl-glu-

cosamine (GlcNAc) was measured according to the

procedures set out by Reissig et al. [25]. A unit was defined

as the amount of enzyme that released 1 lmol GlcNAc per

60 min. Chitinase activity data are the average of three

experiments. Specific activity was expressed in units per

microgram protein. The protein content in the culture fil-

trates was estimated using Bradford’s method [5].

Test for Antagonism

In vitro tests were conducted to evaluate the antagonistic

effect of chit42 and chit42-ChBD transformants against

fungal pathogens on a PDA medium using the dual culture

technique [9]. One mycelial disc (5 mm) of transformants

and one disc (5 mm) of test pathogen were simultaneously

placed on opposite sides of a PDA Petri dish and incubated

at 26 �C. Three plates (replications) were used for each

transformant and test pathogen based on a completely

randomized design. The plates that received only the

mycelial disc of pathogens served as control. The colony

interaction was assayed as the percentage of inhibition on

the PDA plate after four days of incubation following the

formula suggested by Sundar et al. [29]. Inhibition of

growth (%) = X – Y/X 9 100 where, X = mycelial

growth of pathogen in the absence of Trichoderma (con-

trol), Y = mycelial growth of pathogen in the presence of

transformants. The fungal strains included R. solani, F.

graminearum, F. oxysporum, S. sclerotiorum, V. dahlia, A.

brassicales and B. cinerea.

Results

Transformation of Trichoderma harzianum

by Chitinase Genes

Trichoderma harzianum was cotransformed with the plas-

mid p3SR2 and the pLMRS3 derivatives (pLMRS3-chit42

and pLMRS3-chit42-ChBD) as shown in Fig. 1. The chi-

meric chitinase was constructed by the fusion of a

Chit18–10 ChBD from T. atroviride to Chit42. The pre-

diction of the ChBD glycozylation site by NetOGlyc 3.1

server showed four glycozylation sites in the ser-rich linker

which separated the catalytic domain from the binding

domain. The glycozylation of linker prevented the chimeric

enzyme from proteolysis which occurs mainly in this

region [29]. The ChBD was added to the N-terminal of

chit42 employing SOEing PCR (Fig. 1).

Stable transformants were initially selected using a

selective medium containing acetamide. From among 500

transformants for each construct, 100 were selected on the

basis of their ability to grow on the selective medium

containing 2 % colloidal chitin (2 %CCA). The selected

stable amdS transformants were found to have chitinase

activity. Among these transformants, 16 fast growing col-

onies for each construct, designated Chit42-ChBD1 to 16

and Chit42-1 to 16, were selected for further study. The

growth rate of the selected colonies was examined on a

0.5 % CCA medium for 48 h. Based on the mycelial

growth, eight fast growing transformants from each group

were selected for subsequent study (Table 2).

Expression Analysis

To test the expression of chit42 and chit42-ChBD in the

selected transformants, quantitative RT-PCR was per-

formed using real-time PCR. The cDNA was prepared

from the RNA of transformants and nontransformants (as

negative control) grown in MM containing 20 g/l glucose

as repressive conditions for endogenous chitinase repres-

sion. Based on calculations using the 2-DDCT method and

b-tubulin as an internal reference gene, differential

expression folds of chit42 (ranging from 8 to 32) and

chimeric chitinase (ranging from 9.2 to 45.25) were

detected in transformants with the highest level of

expression for Chit42-ChBD15 (Fig. 2).

Table 2 Growth rate and chitinase activity of the Chit42 and Chit42-

ChBD transformants

Isolate Diameter

(mm/48 h)

Chitinase

activity

(U/ml)

Specific

activity

(U/mg)

Control (nontransformed) 17.5 ± 0.5 0.048 ± 0.001 20 ± 0.5

Chit42-2 26.0 ± 0.6 1.59 ± 0.01 130 ± 1.2

Chit42-4 25.0 ± 0.3 1.28 ± 0.02 110 ± 0.8

Chit42-6 30.0 ± 1.0 2.41 ± 0.09 180 ± 1.2

Chti42-8 26.5 ± 0.5 1.16 ± 0.01 100 ± 0.4

Chit42-9 32.0 ± 0.4 2.60 ± 0.01 190 ± 1.4

Chit42-11 27.5 ± 0.7 1.58 ± 0.02 140 ± 0.5

Chit42-12 33.0 ± 1.2 3.15 ± 0.07 210 ± 1.3

Chit42-14 28.5 ± 0.8 2.16 ± 0.05 160 ± 0.9

Chit42-ChBD3 30.0 ± 1.0 2.95 ± 0.09 220 ± 1.8

Chit42-ChBD4 26.0 ± 0.3 2.80 ± 0.05 230 ± 1.0

Chit42-ChBD6 31.0 ± 0.6 3.82 ± 0.09 260 ± 2.6

Chit42-ChBD7 27.0 ± 0.7 3.08 ± 0.07 220 ± 0.7

Chit42-ChBD11 31.5 ± 0.5 3.57 ± 0.09 250 ± 1.4

Chti42-ChBD13 32.0 ± 1.1 4.82 ± 0.06 330 ± 2.7

Chit42-ChBD14 25.8 ± 0.7 1.86 ± 0.02 140 ± 1.6

Chit42-ChBD15 32.0 ± 0.5 6.20 ± 0.09 390 ± 2.9

Results and standard deviations are the average of three replicates


123

Chitinase Activity

The effect of the ChBD on the chitinase activity of Chit42

was investigated with insoluble chitin under repressive

conditions in a buffered glucose medium. While the

enzyme activity in the Chit42 transformants ranged from

1.16 to 3.15 U/ml, the Chit42ChBD transformants showed

improved chitinase activity of 1.86–6.2 U/ml (Table 2).

Overall, specific chitinase activity was highest in trans-

formants for the chimeric chitinases. The minimum and

maximum specific activity of Chit42 and Chit42ChBD was

100–210 and 140–390 U/mg, respectively (Table 2). These

results indicate that the presence of a ChBD can increase

specific activity. The specific chitinase activity of

Chit42ChBD-15 showed the highest activity of 390 U/mg

when compared to Chit42-12 (210 U/mg) (Table 2).

Antifungal Activity

To determine whether an increase in the transformants’

chitinase activity correlates with their antifungal activity,

dual culture tests were carried out. When phytopathogenic

fungi and T. harzianum (wild type or transformants) were

grown in the same plates, they produced a zone of lysis in the

pathogenic fungal mycelia. Seven phytopathogenic fungi

were inoculated individually on plates against the different

chimeric transformants (Table 3). All the transformants

showed varied reductions in the growth rate of these seven

fungi, ranging from 11 to 100 % (Table 3). The highest rate

of inhibition based on overgrow and sporulation on pathogen

was observed for R. solani. The growth inhibition of R. solani

by Chit42-ChBD3, 6, 11, 13 and 15 transformants was

similar and 100 % compared to the nontransformant as the

control (Fig. 3). No growth was detected when pieces of the

overgrown area of lysed and killed R. solani mycelia were

transferred to fresh medium (data not shown). Among these

transformants, Chit42-ChBD15 was the best at inhibiting the

growth of the seven pathogens tested (Table 3). The mini-

mum and maximum values of mean Inhibition by Chit42-

ChBD transformants against the seven phytopathogenic

fungi were 31.6 and 88.6 %, respectively, which were sig-

nificantly different compared with those of the wild type

(10–49.5 %) and Chit42 transformants (24.7–63.4 %)

(Table 4). At the same time, the mean inhibition by Chit42

Fig. 2 Quantitative RT-PCR

analysis of chitinase gene in the

Chit42 and Chit42-ChBD

transformants. Values (2-DDCT)

corresponds to relative

measurement against the chit42

transcript in the control (2-

DDCT = 1.002). Trichoderma b-

tubulin was used as an internal

reference gene

Table 3 Antifungal inhibition (%) of selected Chit42-ChBD transformants against different phytopathogenic fungi

Pathogen Control Chit42-

BD3

Chit42-

ChBD4

Chit42-

ChBD6

Chit42-

ChBD7

Chit42-

ChBD11

Chit42-

ChBD13

Chit42-

ChBD14

Chit42-

ChBD15

R. solani 34 100 35 100 55.5 100 100 37.8 100

F. graminearum 32.5 66.6 30 66.6 33.3 66 46.6 66.6 83.3

F. oxysporum 21 80 16 76 40 80 60 25 88

S. sclerotiorum 18.5 68 16 100 52 68 78.6 27.3 100

V. dahlia 48 86.6 52 86.6 77.7 95.5 86.6 77.5 100

A. brassicola 49.5 100 65 100 76 88 100 80 100

B. cinerea 10 50 11 50 12.5 30 25 12 62.5


123

transformants was 24.7–63.4 % (Table 4). Transformants

that overexpressed the hybrid chitinases inhibited growth of

all pathogens more than both the wild type and Chit42

transformants expressing the native chitinases. Transfor-

mation of T. harzianum by chit42 increased its inhibition

from 1.29-fold (for V. dahliae) to 2.47-fold (for S. sclero-

tiorum) when compared with the nontransformant (Table 4),

while transformation by Chit42-ChBD increased the inhi-

bition from 1.72-fold (for V. dahliae) to 3.44-fold (for S.

sclerotiorum), indicating the positive effect of the ChBD on

biocontrol activity.

Discussion

Chitinases of T. harzianum are believed to play an

important role in antifungal activity. Among these enzymes

chit42 has been shown to be responsible for most of the

chitinase activity [7, 10, 18]. This enzyme does not contain

a chitin-binding domain (ChBD) to bind to insoluble chitin

such as fungal cell walls. Therefore, in this study, trans-

formants of T. harzianum that overexpressed chimeric

chitinases with a ChBD were obtained, and to improve

fungal strains, the overexpression of hydrolases has usually

been achieved using strong, but regulated promoters that

need an inducer for expression. This is not the optimal

situation for controlling plant disease [10, 17, 22, 32]. In

this research, a constitutive promoter was used for chitinase

overexpression, without using any specific inducer.

Many over-produced hydrolases underwent proteolysis

when they were overexpressed in Trichoderma. The Chit42

and Chit42RChBD transformants were grown in buffered

media to prevent the proteolysis of overexpressed chitin-

ases by acidic proteases [8]. Furthermore, the predicted

glycozylation at the linker region of the binding domain

could protect the chimeric chitinase against proteolysis.

Fig. 3 Growth inhibition of R. solani by Chit42-ChBD transformants

and the control. Each plate has T. harzianum at the top and R. solani

at the bottom. Transformants: E3, Chit42-ChBD3; E4, Chit42-

ChBD4; E6, Chit42-ChBD6; E7, Chit42-ChBD7; E11, Chit42-

ChBD11; E13, Chit42-ChBD13; E14, Chit42-ChBD14 and E15,

Chit42-ChBD15

Table 4 Comparison of antifungal (%) activity of improved Chit42-ChBD and Chit42 transformants and wild type as control

Pathogen Control

(inhibition mean)

Overexpressed

(inhibition mean)

Chit42control

(fold) Chimer

(inhibition mean)

Chit42 - ChBDcontrol

(fold) Chimerover (fold)

R. solani 34 ± 0.4 61.5 1.8 78.5 2.3 1.28

F. graminearum 32.5 ± 0.5 45.4 1.4 57.4 1.76 1.26

F. oxysporum 21 ± 0.6 46.5 2.21 58.1 2.76 1.25

S. sclerotiorum 18.5 ± 0.5 45.5 2.46 63.7 3.44 1.40

V. dahlia 48 ± 0.8 62 1.29 82.8 1.72 1.33

A. brassicola 49.5 ± 0.5 63.4 1.28 88.6 1.79 1.39

B. cinerea 10 ± 0.3 24.7 2.47 31.6 3.16 1.28

Results and standard deviations are the average of three replicates


123

Protection of the linker region by glycozylation has been

demonstrated by Alfthan et al. [1] and Limon et al. [18].

Significant differences were observed between the chi-

tinase activity of Chit42 and chimer transformants against

insoluble chitin. The variations in observed enzyme

activity among the Chit42 or ChBD-Chit42 transformants

(Table 2) might be related to the copy number of the

transgene and/or their position in the genome. The effect of

these two parameters could mainly be normalized when the

means of data from two kinds of transformants were

compared. The means of extracellular chitinase activity

produced by the Chit42 and Chit42-ChBD transformants

were 1.99 and 3.64 U/ml, respectively (Table 5). The

improved chitinase containing a chitin-binding domain

showed higher chitinase activity than Chit42 (about 1.83-

fold) when grown in a glucose medium for repressing

endogenous chitinases. This result showed an increase of

about 83 % in chimer chitinase activity over expressed

Chit42 (Table 5). Moreover, the mean of the specific

activities of Chit42 was 150 U/mg, whereas that of Chit42-

ChBD was 260 U/mg, which shows a 1.7-fold increase.

This increase (70 %) suggests that the ChBD may be

helping the enzyme to bind better to the insoluble chitin,

therefore, increasing enzyme activity (Table 5), while the

difference between the transcript levels demonstrates a

33 % increase of ChBD-Chit42 mRNA over that of Chit42

when analysed by real-time PCR which emphasizes the

role of the ChBD (Table 5). Limon et al. added a ChBD

from Nicotiana tabacum to Chit42 and observed an

approximately 36 % increase in the chitinase activity of the

chimeric enzyme in the presence of insoluble chitin [18].

Fan et al. constructed a chimeric chitinase using the silk-

worm ChBD and Beauveria bassiana chitinase which

showed a 5.5-fold increase in enzymatic activity in the

presence of powdered chitin [9]. The effect of a ChBD on

chitin binding was also described by Hashimoto et al. [14].

They showed that deletion of the ChBD from chitinase A1

greatly decreased the efficiency of chitin degradation.

In this study, the transformants expressing chimeric

chitinase, which is more active towards crystalline chitin,

also showed higher antifungal activity than the Chit42

transformants. This seems to result from the subsite

structure in the binding cleft (ChBD) of this enzyme. This

finding was also reported by Hashimoto et al. [14] who

suggested that the ChBD recognizes an insoluble or crys-

talline chitin structure.

The variation among the antifungal activity of these

chitinases was observed when seven phytopathogenic fungi

were tested (Table 3). This may be due to the intrinsic

variability of chitin and cell wall composition which nat-

urally exists in polymorphic forms. [3, 24, 31].

Looking at the results, we can introduce the Chit42-

ChBD15 as the best transformant with the highest chitinase

activity (6.201 U/ml), specific activity (390 U/mg) and

also an antagonistic effect.

In conclusion, our data demonstrate that enzyme engi-

neering can produce a chitinase with an improved activity

capacity, which will lead to higher enzyme and antifungal

activities; thus the transformants generated in this study

might result in better biocontrol agents in the field.

Acknowledgments We thank Prof. Dr. R. L. Mach and Prof. Dr.

M. J. Hynes for kindly providing plasmids. We wish to thank Dr.

M. C. Limon for her advises. This project was supported by the

National Institute of Genetic Engineering and Biotechnology.

References

1. Alfthan K, Takkinen K, Sizmann D et al (1995) Properties of a

single-chain antibody containing different linker peptides. Protein

Eng 8:725–731

2. Arakane Y, Zhu Q, Matsumiya M, Muthukrishnan S et al (2003)

Properties of catalytic, linker and chitin-binding domains of

insect chitinase. Insect Biochem Mol Biol 33:631–648

3. Aranaz I, Mengı0bar M, Harris R, Panos I, Miralles B et al (2009)

Functional characterization of chitin and chitosan. Curr Chem

Biol 3:203–230

4. BollerT Mauch F (1988) Colorimetric assay for chitinase.

Methods Enzymol 161:430–435

5. Bradford M (1976) A rapid and sensitive method for the quan-

tification of microgram quantities of protein utilizing the princi-

ple of protein–dye binding. Anal Biochem 72:249–254

6. Chern JT, Chao YP (2005) Chitin-binding domain based immo-

bilization of D-hydantoinase. J Biotechnol 117:267–275

7. De la Cruz J, Hidalgo-Gallego A, Lora JM, Benıtez T et al (1992)

Isolation and characterization of three chitinases from Tricho-

derma harzianum. Eur J Biochem 206:859–867

8. Delgado-Jarana J, Rincon AM, Benitez T (2002) Aspartyl pro-

tease from Trichoderma harzianum CECT 2413: cloning and

characterization. Microbiology 148:1305–1315

9. Fan Y, Fang W, Guo S, Pei X et al (2007) Increased insect

virulence in Beauveria bassiana strains overexpressing an engi-

neered chitinase. Appl Environ Microbiol 73:295–302

10. Garcıa I, Lora JM, De la Cruz J, Benıtez T et al (1994) Cloning

and characterization of a chitinase (CHIT42) cDNA from the

mycoparasitic fungus Trichoderma harzianum. Curr Genet

27:83–89

11. Glass NL, Donaldson G (1995) Development of primer sets

designed for use with the PCR to amplify conserved genes from

filamentous ascomycetes. Appl Environ Microbiol 61:1323–1330

Table 5 Comparison of overexpressed and chimer transformants

based on 2-DDCT and chitinase activities

Control Overexpressed Chimer Chimerover

(fold)

2-DDCT (mean) 1.00 17.53 23.35 1.33

Chitinase activity

(U/ml) (mean)

0.048 1.99 3.64 1.83

Specific activity

(U/mg) (mean)

20 150 260 1.7


123

12. Guthrie JL, Khalif S, Castle AJ (2005) An improved method for

detection and quantification of chitinase activities. Can J

Microbiol 51:491–495

13. Hardt M, Laine RA (2004) Mutation of active site residues in the

chitin-binding domain ChBDChiA1 from chitinase A1 of Bacil-

lus circulans alters substrate specificity: use of a green fluorescent

protein binding assay. Arch Biochem Biophys 426:286–297

14. Hashimoto M, Ikegami T, Seino S, Ohuchi N et al (2000)

Expression and characterization of the chitin-binding domain of

chitinase A1 from Bacillus circulans WL-12. J Bacteriol

182:3045–3054

15. Kubicek CP, Herrera-Estrella A, Seidl-Seiboth V, Martinez DA,

Druzhinina IS, Thon M, Zeilinger S et al (2011) Comparative

genome sequence analysis underscores mycoparasitism as the

ancestral life style of Trichoderma. Genome Biol 12:R40

16. Lee SB, Taylor JW (1990) Isolation of DNA from fungal mycelia

and single spores. In: Innis DGM, Sninsky J, White T (eds) In:

PCR protocols: a guide to methods and applications, vol 34.

Academic Press, Orlando

17. Limon MC, Lora JM, Garcıa I, De la Cruz J, Llobell A et al

(1995) Primary structure and expression pattern of the 33 kDa

chitinase gene from the mycoparasitic fungus Trichoderma har-

zianum. Curr Genet 28:478–483

18. Limon MC, Margolles-Clark E, Benitez T, Penttila M (2001)

Addition of substrate-binding domains increases substrate-bind-

ing capacity and specific activity of a chitinase from Trichoderma

harzianum. FEMS Microbiol Lett 198:57–63

19. Limon MC, Chacon MR, Mejias R, Delgado-Jarana J et al (2004)

Increased antifungal and chitinase specific activities of Tricho-

derma harzianum CECT 2413 by addition of a cellulose binding

domain. Appl Microbiol Biotechnol 64:675–685

20. Livak KJ, Schmittgen T (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2-DDCT

method. Methods 25:402–408

21. Matarese F, Sarrocco S, Gruber S, Seidl SV, Vannacci G (2012)

Biocontrol of Fusarium head blight: interactions between Tricho-

derma and mycotoxigenic Fusarium. Microbiology 158:98–106

22. Migheli Q, Gonzalez-Candelas L, Dealessi L et al (1998)

Transformants of Trichoderma longibrachiatum overexpressing

the b-1,4-endoglucanase gene egl1 show enhanced biocontrol of

Pythium ultimun on cucumber. Phytopathology 88:673–677

23. Penttila M, Nevalainen H, Ratto M, Salminen E, Knowles J

(1987) A versatile transformation system for the cellulolytic fil-

amentous fungus Trichoderma reesei. Gene 61:155–164

24. Pillai CKS, Paul W, Chandra PS (2009) Chitin and chitosan

polymers: chemistry, solubility and fiber formation. Prog Polym

Sci 34:641–678

25. Reissig JL, Strominger JL, Leloir L (1955) A modified colori-

metric method for the estimation of N-acetylamino sugars. J Biol

Chem 217:959–966

26. Reithner B, Ibarra-Laclette E, Mach RL, Estrella H (2011) A

identification of mycoparasitism-related genes in Trichoderma

atroviride. Appl Environ Microbiol 77:4361–4370

27. Ryder LS, Harris BD, Soanes DM, Kershaw MJ et al (2012)

Saprotrophic competitiveness and biocontrol fitness of a geneti-

cally modified strain of the plant-growth-promoting fungus

Trichoderma hamatum GD12. Microbiology 158:84–97

28. Sambrook J, Russell D (2001) Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, Woodburry

29. Sundar AR, Das ND, Krishnaveni D (1995) In-vitro antagonism

of Trichoderma spp. against two fungal pathogens of castor.

Indian J Plant Protec 23:152–155

30. Van Aalten DMF, Komander D, Synstad B, Gaseidnes S et al

(2001) Structural insights into the catalytic mechanism of a

family 18 exo-chitinase. PNAS 98:8979–8984

31. Van de Velde K, Kiekens P (2004) Structure analysis and degree

of substitution of chitin, chitosan and dibutyrylchitin by FT-IR

spectroscopy and solid state 13C NMR. Carbohydr Polym

58:409–416

32. Yanai K, Takaya N, Kojima N, Horiuchi H et al (1992) Purification

of two chitinases from Rhizopus oligosporus and isolation and

sequencing of the encoding genes. J Bacteriol 174:7398–7406


123

Documents

Protein Engineering of Chit42 Towards Improvement of Chitinase and Antifungal Activities