Protein Engineering Lab Book · 2016. 11. 10. · 19/10/2016 Protein Engineering Lab Book | Evernote Web 1e66d649fa604939a93418d7b2eaf336&ses=4&sh=2&sds=5& 3/17

19/10/2016 Protein Engineering Lab Book | Evernote Web

https://www.evernote.com/Home.action#n=1e66d649fa604939a93418d7b2eaf336&ses=4&sh=2&sds=5& 1/17

Protein Engineering Lab Book

Amplification of Plasmid Vectors Transformation:

1. Put 5alpha cells and vectors in ice box2. Add 1uL of pETDUET1 or pACYCDUET1 vector into 25uL of cells3. Leave on ice for 30mins4. Heat shock at 42 degrees celsius for 45 seconds5. Spread on LB plates with antibiotics

30ug/mL Chloramphenicol for pACYCDUET1100ug/mL Ampicilin for pETDUET1

6. Incubate at 37 degees celsius overnight

Growing Plasmid Vectors in LB Broth:

1. Add 10mL of LB broth to 50mL falcon tubes with appropriate antibiotics30ug/mL Chloramphenicol for pACYCDUET1100ug/mL Ampicilin for pETDUET1

2. Add one colony from LB plates into broth3. Incubate overnight at 37 degrees celsius and shake at 240rpm

Perform miniprep using QIAprep ® Spin Miniprep Kit (Following adapted from QIAprep Miniprep Handbook):

1. Pellet 10 ml bacterial overnight culture by centrifugation at >8000 rpm (6800 x g) for 3 min at room temperature(15–25°C).

2. Resuspend pelleted bacterial cells in 250 μl Buffer P1 and transfer to a microcentrifuge tube.3. Add 250 μl Buffer P2 and mix thoroughly by inverting the tube 4–6 times until the solution becomes clear. Do notallow the lysis reaction to proceed for more than 5 min. If using LyseBlue reagent, the solution will turn blue.

4. Add 350 μl Buffer N3 and mix immediately and thoroughly by inverting the tube 4–6 times. If using LyseBluereagent, the solution will turn colorless.

5. Centrifuge for 10 min at 13,000 rpm (~17,900 x g) in a tabletop microcentrifuge. 6. Apply 800 μl supernatant from step 5 to the QIAprep 2.0 spin column by pipetting. Centrifuge for 30–60 s anddiscard the flowthrough.

7. Wash the QIAprep 2.0 spin column by adding 0.75 ml Buffer PE. Centrifuge for 30–60 s and discard the flowthrough. Transfer the QIAprep 2.0 spin column to the collection tube.

8. Centrifuge for 1 min to remove residual wash buffer. 9. Place the QIAprep 2.0 column in a clean 1.5 ml microcentrifuge tube. To elute DNA, add 50 μl Buffer EB (10 mMTrisCl, pH 8.5) or water to the center of the QIAprep 2.0 spin column, let stand for 1 min, and centrifuge for 1 min.

Miniprep nanodrop results:

Plasmid Concentration (ng/uL)

SLIC A (pACYCDUET1) 82.9



SLIC B (pACYCDUET1) 55.2

SLIC C (pACYCDUET1) 89.5

SLIC D (pACYCDUET1) 64.5

SLIC E (pACYCDUET1) 82.0

SLIC F (pACYCDUET1) 67.8

SLIC G (pACYCDUET1) 73.7

pETDUET1 55.4

Samples stored at 20 degrees celsius.

Resuspension of gBlocks and primers ordered from IDT Australia:

SpycatcherEcoRI, SpycatcherXbaI, SpycatcherSpeI, M.EcoRI, M.XbaI and M.SpeI all diluted to 100fmol/uL

All primers diluted to 100uM

PCR amplification of GBlocks:

For 50uL Reaction:

10uL 5x Phusion HF buffer

1uL 10mM dNTP

2.5uL 10uM Forward Primer

2.5uL 10uM Reverse Primer

1uL of 100fmol/uL template

0.5uL Phusion DNA Polymerase

Add H20 to top up to 50uL

Cycles:

Temperature (degrees celsius) Time (sec)

Initial 98 30



Amplification (x35 cycles) 98 30

67 30

72 60

Final 72 10 mins

EcoRI Digestion

For 50uL reaction

1uL of FastDigest EcoRI

1ug of Plasmid

5uL of FastDigest Buffer

Incubate at:

37 degrees celsius for 60mins80 degrees celsius for 15mins

Agarose Gel Electrophoresis

Gel Composition:

1% agarose gel

1xTAE buffer

1uL RedSafe dye

Sample:

6x Purple Gel loading dye

Load 10uL of DNA sample with 2uL of dye in each well

Setting:

120V for 30mins

Image with Chemiluminescence Gel Imaging System



28: cutSLIC vectorsAG 9: 2 Log Ladder 10: XbaISpycatcher 11: SpeISpyCatcher

Lane 10 shows successful amplification of SpycatcherXbaI GBlocks

Run agarose gel electrophoresis for linearised vectors:



1: 2 Log Ladder 2,4,6,8,10,12,14: Circular SLIC AG vectors 3,5,7,9,11,13,15: Digested SLIC AG Vectors

All linearisation of plasmids confirmed. Pattern: Circular Plasmid then linear plasmid etc along the wells



1: 2 Log Ladder 2: SpycatcherEcoRI 3: SpycatcherSpeI

Successful amplification of SpyCatcherEcoRI and SpyCatcherSpeI shown in lanes 2 and 3 respectively

SLIC Cloning protocol (adapted from sources provided by Dr Lawrence Lee)

Primer design

1. Vector cloning site: ctg gag gtt ctg ttc caa ggt cca GAA TTC gag aat ctg tat ttt cag ggc (conservedPreScission/EcoRI/TEV site)

2. Primer 1: 5'CTGTTCCAAGGTCCAGAATTC(add your gene sequence)3' NB: Make sure you have removed thestarting ATG codon...

3. Primer 2: 5'GAAAATACAGATTCTCGAATTC(add the reverse complement for the end of your gene of interest)3’(make sure you DO NOT include stop codons TAA, TGA or or TAG)

Preparation of insert and plasmid involves EcoRI Digestion (refer to EcoRI Digestion of Plasmids)

InFusion reaction for spin column purified inserts

1insert, 1vector



1. Mix your purifiedPCR insert and vector together at a 2:1 molar ratio in 10 μl of deionized H2O. Use 100–300 ng ofvector.

2. Set up the InFusion Cloning reactions:

Add 10 μl of vector + insert DNA + H2O (from Step 1) to each InFusion DryDown pellet. Mix well by pipetting upand down.Each InFusion DryDown pellet used for 4 reactions

3. Incubate the reaction(s) for 15 min at 37°C followed by 15 min at 50°C and then transfer the tubes to ice.4. Dilute the InFusion reaction mixture with 40 μl TE buffer (pH 8), and mix well.5. Proceed with transformation. If you cannot transform cells immediately, store cloning reactions at –20°C until youare ready.

Transformation and plating

1. Refer to Amplification of Plasmid Vector Transformation2. Use 2.5uL of reaction mix rather than 1uL of plasmid

Colony screening.

1. Colonies (23 per reaction) are picked from the transformation plate and dispersed into 50ul water (in 300 ul 96well plates). 1μl of this is added to the cPCR reaction mix.

2. Reaction mix for cPCR for vectors A,B,C,D,E,H:

DNA 1.0ul

10x Taq pol 2.5 ul

dNTP 0.5 ul

FOR (Duet1Up) 0.5 ul

REV (Duet1Down) 0.5 ul

MQW x

Taq pol 0.125

Total 25ul

3. PCR Cycles same as PCR amplification of GBlocks but annealing temperature is at 55 degrees celsius



1: 2 Log Ladder 2: SLIC A 38: AEcoRI 9: SLIC E 1015: EEcoRI 16: SLIC C 1722: CSpeI 23: ladder

Successful cloning of EEcoRI plasmids verified

1: 2 Log Ladder 23: SLIC D 4: DEcoRI 511: DXbaI 1219: DSpeI 20: pETDuet1 2124: M.EcoRI

Successful cloning of DEcoRI, DXbaI and DSpeI plasmids verified



Restriction Enzyme Cloning of Methylases

1. PCR amplify methylase GBlocks using conditions in PCR amplification of GBlocks 2. Perform double digest of both plasmid (pETDuet1) and insert (EcoRI and SpeI Methylases) using NEB NcoIHFand EcoRIHF

Refer to EcoRI DigestionUse an additional 1uL of NcoIHFSubstitute with NEB CutSmart Buffer

3. Perform ligation (Protocol adapted from NEB)

Reaction mix (20uL)2uL NEB T4 Ligase Buffer (10x)50ng of pETDuet137.5ng of Insert1uL NEB T4 LigaseTop to 20uL with H20

Incubate at 16°C overnightHeat inactivate at 65 degrees celsius for 10mins

4. Transform into cells using Amplification of Plasmid Vector Transformation protocol5. Perform cPCR using SLIC Cloning protocol Colony Screening

1: 2 Log Ladder 23: pETDuet1 47: MEcoRI 815: MSpeI

Confirmation of successful EcoRI and SpeI methylase cloning

Amplification of Recombinant Plasmids:



1. Inoculate 20mL of LB broth (in 50mL Falcon tubes) with successfully cloned colonies

add appropriate antibiotic:30ug/mL Chloramphenicol for pACYCDUET1100ug/mL Ampicilin for pETDUET1

2. Incubate overnight in shaking incubator at 37 degrees Celsius3. Perform miniprep to harvest plasmids c.f. Perform miniprep using QIAprep ® Spin Miniprep Kit

Expression and purification of proteins (Adapted from Sophie Hertel's Protocols)

Day 1: Transformation into T7 High Expression cells

1. Thaw T7 cells on ice (~2030 minutes)2. Allow LB agar + 30ug/mL chloramphenicol plates, LB agar + 100ug/mL ampicilin plates and LB agar + 100ug/mLampicilin + 30ug/mL chloramphenicol plates to warm to room temperature

3. Mix 1 or 2 uL of plasmid DNA to 25 uL of T7 cells gently mix by flicking the bottom of the tube4. Place competent cell/DNA mix on ice for 30 minutes5. Heat shock cells by placing tube into a 42 oC water bath for 45 seconds, then quickly place tubes on ice for 2minutes

Transformed cells with:1uL of EcoRI Methylase (Control)1uL of SpyCatcherEcoRI (Control)1uL of EcoRI Methylase + 1uL of SpyCatcherEcoRI

6. Plate all cells and incubate at 37 oC overnight

Day 2: Starter culture

1. Inoculate 20 mL LB media with appropriate antibiotics in 50 mL Falcon tube with a single colonyEcoRI Methylase in pETDuet1 vectors require 30ug/mL chloramphenicolSpyCatcherEcoRI in SLIC vectors require 100ug/mL ampicilinDouble transformations require both antibiotics

2. Grow cultures overnight at 37 oC, shaking

Day 3: Expression1. Inoculate 500 mL LB media + appropriate antibiotics (see above) with 8 mL of the starter culture and grow at37 oC, shaking, until OD600 ~ 0.5

2. Take a sample immediately before induction, take OD600 (preIPTG sample)Collect 1 mL and spin at maximum speed to collect the pellet remove the supernatantStore at 20 oC until SDSPAGE analysis

3. Induce expression by adding 0.4 mM IPTG4. Incubate the cultures at 18 degrees for an additional 1618 hours5. Take another 1 mL sample postinduction(1:10 dilution with LB) and process as in Step 2 (postIPTG sample)6. Harvest the cells by centrifugation at 5000rpm for 15 minutes, remove supernatant and keep 1mL sample (supernatant sample)

7. Store pelleted cells at 80 degrees Celsius

Day 4: Harvest

1. Resuspend cells in 10mL of Lysis Buffer



2. Lyse cells by sonication (keep tube on ice water at all times, 2mins on, 2mins off, 15% intensity, repeat 3 times) keep 10 uL of sample (lysed cell sample)

3. Collect soluble fraction by spinning at 20 000 x g for 30 minutes at 4 oC4. Wash 100 uL of 50% of NiNTA resin with 3 x 3 CV of MQW, then wash Buffer, using spin columns5. Keep membrane pellet and resuspend with amount of SDSPAGE sample buffer (plus DTT) that would giveOD600 ~1=same amount of lysate which will be around 500ul (membrane fraction sample)

6. Keep 10 uL of soluble fraction (soluble fraction sample)7. Combine soluble fraction with preequilibrated NiNTA resin and incubate for 2 hours at 4 oC, mixing8. Using filtration column, filter out flowthrough and keep 1mL of SDSPAGE analysis (flow through sample)9. Wash resin 3 times with Wash Buffer

Keep 1mL of first wash for SDSPAGE analysis (wash sample) 10. Elute with 3mL of elution buffer (elution sample)11. Run all samples (lysed cells, soluble fraction, membrane fraction, flowthrough, wash and beads) on a SDSPAGE

gel (if successful, protein should bind onto NiNTA resin at the expected size)

SDSPAGE gel preparation

1. Immerse Novex NuPAGE SDSPAGE gel (Thermofisher) in 1xMES buffer2. Mix 10uL of samples with 5uL of SDS loading dye + DTT3. Load 5uL of SeaBlue Plus2 Prestained protein standard4. Load 10uL of mixed samples to gel5. Run at 180V for 25 mins6. Remove gel from and rinse with water7. Add 15mL of Coomassie Stain to gel8. Microwave twice for 10 sec 9. Put on rocking table for 15mins10. Repeat steps 8 and 911. Rinse with water and put on rocking table to destain12. Image with Gel Imaging System with Coomassie settings



1. SeaBlue Protein ladder 2. M.EcoRI + EEcoRI6 PreInduction 3. M.EcoRI + EEcoRI6 PostInduction 4. M.EcoRI +Supernatant 5. M.EcoRI + EEcoRI6 Flowthrough 6. M.EcoRI + EEcoRI6 Wash 7. M.EcoRI + EEcoRI6 Elution #1 8.M.EcoRI + EEcoRI6 Elution #2 9. M.EcoRI + EEcoRI6 Elution #3 10. M.EcoRI PreInduction 11. M.EcoRI PostInduction 12. M.EcoRI Supernatant 13. M.EcoRI Flowthrough 14. M.EcoRI Wash 15. M.EcoRI Elution #1 16. M.EcoRIElution #2 17. M.EcoRI Elution #3

No obvious band appeared to suggest that the recombinant SpyCatcherEcoRI was purified. Western blotting wasperformed to confirm results

Western Blotting (Protocol adapted from Invitrogen iBlot Manual)

1. Insert anode stack on the the iBlot system (Invitrogen) 2. Apply water on surface3. Place SDSPAGE gel and cover with filter paper4. Apply water and cover with cathode stack5. Gently roll out air bubbles6. Run 7 min blot 7. Prepare 30mL of 5% milk powder solution



8. Insert nitrocellulose paper in milk powder solution9. Block for 1 hour at 4 degrees Celsius10. Prepare TBSTriton11. Prepare 15mL of milk powder solution with TBSTriton 12. Add 1:1000 antihistag antibodies and incubate with nitrocellulose paper at 4 degrees Celsius overnight13. Wash membrane 3 times at 15min intervals with TBSTriton 14. Wash membrane with 1uL of Western Lightning Enhanced Luminol Reagent + 1uL of Western Lightning Oxidising

Reagent 15. Acquire image using Gel Imaging System with chemiluminescent settings

Binding of histagged proteins (double transformation elution) shown in western blot results

Concentrating Elution Samples

1. Use 10mL concentratorWash with waterWash with elution bufferWash by centrifuging for 5min, 4000rpm

2. Spin 5mL of ME EE6 elution must nanodrop first5min, 3000rpmCheck for precipitateIf precipitate appears put in eppi and spin for 15 min at highest rpm at 4 degrees

3. Take out supernatant and spin for 3 min at 2000 rpm in a new concentrator4. Repeat step 3 after checking for precipitates 5. Add 3mL of EcoRI buffer and spin at 3000rpm for 5 min6. Repeat step 5 twice

SpyCatcherEcoRI assay

1. Prepare 20uL reactions with:10uL SpyCatcherEcoRI and 10uL of DNA

20nM dsDNA without EcoRI recognition site as control



20nM braces with opening angle of 135 degrees2. For control, use 1uL FastDigest EcoRI, 2uL buffer, 10uL DNA and top with water 3. Incubate for 40mins at 37 degrees4. Heat inactivate for 8mins at 80 degrees 5. Run 10% polyacridimide gel

Running PAGE Gels

10% PAGE gel composition:

5mL1xTAE

2.5mL 30% acrylamide

37.5uL APS

7uL TEMED

1. Immerse gel in TAE2. Load 100bp ladder with gel loading dye into first well3. Load 9uL sample mixed with 3uL gel loading dye, 4x to wells4. Run at 100V for 60mins5. Post stain with SYBRgold dye (5uL in 50mL of H2O)6. Image gel using Gel Document System

Enzyme assay for SpyCatcherEcoRI with peptide conjugate

1. Incubate 5uL of 100uM of SpyTag peptide with 100uL of SpyCatcherEcoRI for 2 hours at room temperature2. Perform incubation with braces with opening angle of 135 (cf SpyCatcherEcoRI Assay) for conjugated and nonconjugated SpyCatcherEcoRI and FastDigest EcoRI

3. Run on 10% polyacridimide gel



Interaction between SpyCatcherEcoRI and DNA Origami Constructs

1. Refer to SpyCatcherEcoRI Assay2. Substitute DNA samples with Origami constructs (purified and unpurified female M13 barrels and purified springloaded boxes)

3. Incubate for 40mins, 90mins and 180mins4. Run on TBE agarose gel

1.5% agarose0.5xTBE11mM MgCl2Redsafe5ul sample with 1ul of purple loading dyeGel on ice70V for 2 hours

5. Image gel



Buffers and Solutions

Lysis Buffer20 mM TrisHCl, pH 7.5 1000mM x V = 20mM x 50ml V = 1ml100 mM NaCl 5000mM xV = 100mM x 50ml V=1ml1X complete EDTAfree protease inhibitor tablet per 50 mL buffer

Pinch of DNase I

Wash Buffer20 mM TrisHCl, pH 7.5 1000mM x V = 20mM x 50ml V = 1ml300 mM NaCl 5000mM xV = 300mM x 50ml V=3ml10 mM imidazole 8000mM x V = 10mM x 50ml V = 62.5ulMix Buffer A with 8 M stock of imidazole pH 8.0**Prepare ~500 mL in a Falcon tube and filtersterilise before use

Elution Buffer50mM NaH2Po4, pH 8.00.5M NaCl250mM imidazole

Chloramphenicol stock (33mg/ml for a 1/1000 dilution) dissolve in ethanol1) Dissolve 0.0495 g of chloramphenicol into 1.5 ml 100% ethanol.2) Filter through a 0.22 µm filter to sterilize.3) Aliquot and store at 20°C.



4) Use at 1:1000 dilution in LB or LBAgar.

Making IPTGMW=238.30 gr ( We need to make the stock of 0.4M (volume of 15ml)and we need the final cons of 0.4mM later)238.30gr 1M x 0.4M x=95.32gr 1000ml x 1.5 x= 0.1429

top it up with water, filter sterilise it and keep it in 20 freezer

DTT (100mM)MW=154.25g 1Mx=15.42 gr 100mM 1000ml top it up with water allocate into 50ul in each eppendorf and keep it in 20 freezer

* Also make 1/100 dilution and make DTT 1mM

TBSTriton

20mM Tris, pH7.5

150mM NaCl

0.1% Tween 20

0.025% Triton X100

Documents

Protein Engineering Lab Book · 2016. 11. 10. · 19/10/2016 Protein Engineering Lab Book | Evernote Web 1e66d649fa604939a93418d7b2eaf336&ses=4&sh=2&sds=5& 3/17