Properties of an Intergenic Terminator and Start Site Switch That

MOLECULAR AND CELLULAR BIOLOGY, June 2008, p. 3883–3893 Vol. 28, No. 120270-7306/08/$08.00�0 doi:10.1128/MCB.00380-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Properties of an Intergenic Terminator and Start Site Switch ThatRegulate IMD2 Transcription in Yeast�

M. Harley Jenks,† Thomas W. O’Rourke,† and Daniel Reines*Department of Biochemistry, Emory University School of Medicine, Atlanta, Georgia 30322

Received 5 March 2008/Returned for modification 1 April 2008/Accepted 8 April 2008

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation isexerted through the choice of alternative transcription start sites that results in synthesis of either an unstableshort transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start siteselection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylationsites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of �200 nucleo-tides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymeraseII. The enzyme’s ability to locate the downstream initiation site decreased exponentially as the start was moveddownstream from the TATA box. This suggests that RNA polymerase II’s pincer grip is important as it slideson DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent uponthe distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1helicase when close to the promoter. These findings extend the emerging concept that distinct modes oftermination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well asits sequence, is important for the pathway chosen.

A large number of short RNAs that do not code for proteinshave been identified in eukaryotic cells. In Saccharomyces cer-evisiae, many of these are found between conventional mRNA-encoding transcription units; some of these play a regulatoryfunction in controlling adjacent gene activity (10, 29, 44). IMD2encodes IMP dehydrogenase, an enzyme important for denovo synthesis of guanine nucleotides. Its transcription isstrongly induced when intracellular guanine nucleotide poolsare depleted by drugs like mycophenolate and 6-azauracil (12,20, 38). This response enables cells to maintain adequate gua-nine nucleotide pools and survive drug exposure. A transcrip-tion unit upstream of IMD2 that generates a short, unstable,noncoding RNA was discovered following inactivation of anRNA degradation system known as the nuclear exosome (10).The presence of a transcriptional terminator between the up-stream transcription unit and the downstream unit encodingIMD2 mRNA was inferred in a genome-wide analysis of RNApolymerase II density on yeast chromosomes (44). Comparisonof wild-type and sen1 mutant strains revealed a downstreamshift in RNA polymerase II density toward the IMD2 openreading frame (ORF), suggestive of terminator readthrough(44), since SEN1 encodes an essential helicase known to beinvolved in transcription termination (21, 35, 40, 42, 43). Fur-thermore, there is a regulated shift from a set of upstreamtranscription start sites to a single downstream adenine startsite (see Fig. 1) when levels of intracellular guanine nucleo-tides become depleted (10, 44; J. N. Kuehner and D. A. Brow,submitted for publication). Under guanine-replete conditions,the upstream start predominates and transcription terminates

before the IMD2 ORF is reached, resulting in production of ashort, noncoding RNA. This “intergenic” transcript is rapidlydegraded in an exosome-dependent manner (10). Under gua-nine-depleted conditions, the start site downstream of the ter-mination region is used, resulting in full-length IMD2 mRNAencoding IMP dehydrogenase. Deletion or mutation of theterminator region (previously referred to at the repressive el-ement [see Fig. 1]) was shown to derepress IMD2 expression,enabling its transcription even when guanine is plentiful (12,39). In addition, the terminator region possesses autonomousterminator function when placed downstream of a promoterwhere it can generate polyadenylated transcripts (23). Thisterminator is unusual in that it overlaps the transcription startsite employed when IMD2 transcription is induced by low gua-nine nucleotide levels (see Fig. 1). This explains why it isrequired to maintain the repressed state of the IMD2 ORF,since when this DNA is deleted or mutated, transcription readsinto the IMD2 ORF from the upstream start events that arenormally aborted by termination when guanine levels are ad-equate. Here we will refer to this novel terminator as theintergenic IMD2 terminator (IT) because it is responsible forthe formation of a discrete intergenic transcript.

Termination by RNA polymerase II is poorly understood.For conventional terminators at the end of mRNA transcrip-tion units, RNA polymerase II ceases elongation and disen-gages from chromatin in a manner coupled to the processing ofthe 3� end of the RNA, i.e., cleavage of the primary transcriptand its polyadenylation (reviewed in references 3 and 36).Recent evidence suggests there is more than one mechanism oftranscription termination by RNA polymerase II, dependingupon the gene being transcribed. Small nuclear RNAs (snRNAs)and nucleolar RNAs (snoRNAs) that are relatively short and arenot polyadenylated in their mature form employ an alternativesystem that involves the Sen1 helicase and the Nrd1 and Nab3RNA binding proteins (21, 42, 43). An additional set of compo-

* Corresponding author. Mailing address: Department of Biochem-istry, Emory University School of Medicine, 1510 Clifton Road, At-lanta, GA 30322. Phone: (404) 727-3361. Fax: (404) 727-2538. E-mail:[email protected].

† These authors contributed equally to this work.� Published ahead of print on 21 April 2008.

3883

on April 11, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

nents appears to be shared by the two termination/processingsystems including Pcf11, Rna14, Rna15, and Ssu72 (1, 21, 28, 36,41). One determinant of the termination mechanism to be em-ployed is the distance between the termination region from thetranscription start site (23, 43).

Recent evidence indicates that termination of one group ofshort noncoding RNAs is coupled to their rapid degradation bythe exosome (1, 46, 47). The terminator at the end of thetranscription unit upstream of IMD2 appears to fall into thisclass (10, 23, 44). Previous results suggested that Nrd1-depen-dent termination is most active at a short distance from thetranscription start site, whereas conventional cleavage andpolyadenylation operate at more distal downstream sites, suchas those at the end of protein-encoding mRNAs (43).

Here we explore the requirements for termination at theintergenic IMD2 terminator and compare it with the canonicalterminator/polyadenylation site found at the end of the CYC1gene. The RNA generated by the intergenic IMD2 terminatoris rapidly degraded by the nuclear exosome, a phenomenonseen only when the sequence is placed close to a promoter. Incontrast, the CYC1 terminator yields a stable RNA even whenclose to the promoter. In addition, the intergenic IMD2 termi-nator is highly Sen1 dependent compared to the CYC1 termi-nator. Grafting a portion of the intergenic IMD2 terminatorcontaining a Nab3 consensus site onto the CYC1 terminatorenhanced its exosome sensitivity. Increasing the distance be-tween the upstream start sites and terminator resulted inlonger intergenic terminated transcripts and prevented use ofthe downstream start site, consistent with a model in whichRNA polymerase II scans along DNA for a start site. Further-more, the guanine-regulated shift from the upstream to down-stream start sites was highly dependent upon the Rpb9 subunitof RNA polymerase II, accounting for the extreme drug sen-sitivity of cells lacking this RNA polymerase II subunit andemphasizing the importance of RNA polymerase II’s “jaw” ingrasping DNA during translocation.

MATERIALS AND METHODS

Plasmid construction. The pGAlLuc, pREFXba-Luc, pRERXba-Luc, pREF-BstEII-Luc, and pRERBstEII-Luc plasmids have been previously described byour lab (23, 39). The lambda insertion family of plasmids were derived frompRS316-IMD2-BsiWImut which was made by mutagenesis using mismatch oli-gonucleotides 5�-GCTTATACATTTTACCTCGTACGCTGGGAACC-3� and5�-GGTTCCCAGCGTACGAGGTAAAATGTATAAGC-3� to introduce aBsiWI restriction site �180 bp upstream of the start codon in plasmidpRS316-IMD2 (20). pRS316-IMD2-24bp�, pRS316-IMD2-36bp�, pRS316-IMD2-45bp�, pRS316-IMD2-103bp�, pRS316-IMD2-153bp�, and pRS316-IMD2-218bp� were made by inserting HaeIII- or BstUI-digested lambda DNAof less than 250 bp into pRS316-IMD2-BsiWImut cut with BstWI and filled inwith DNA polymerase. A distribution of clones with increasing insert sizes wereselected for confirmation by sequencing.

A DNA duplex encoding the 5� end of the IT and the CYC1 transcriptionterminator was cut with XbaI and inserted into similarly cut pGalLuc to createpChimera1-F-XbaLuc. This chimeric piece of DNA was made by annealing5�-AGCTCATCTAGATTCCGTATTCTATTCTATTCCTTGCCTTACTTTTCTTATTATTTTCTATTTATTTTTT-3� and 5�-GATCGATCTAGAGTATAATGTTACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATAAAAAAATAAATA-3� and extending each primer via mutually primed synthesis with T4 DNApolymerase. The same product in the opposite orientation was also inserted intopGalLuc to form pChimera1-R-XbaLuc. The plasmid pCYC1TT-F-XbaLuc wasmade by inserting an XbaI-digested PCR product encoding the CYC1 transcrip-tion terminator region into XbaI-cut pGalLuc. The PCR product was generatedfrom pYES2 (Invitrogen) using primers 5�-AGCTCATCTAGAGACAACCTG

AAGTCTAGG-3� and 5�-GATCGATCTAGAGTATAATGTTACATGCGT-3�. A similar BsiWI-digested PCR product was generated from pCYC1TT-F-XbaLuc using oligonucleotides 5�-AGCTCACGTACGGACAACCTGAAGTCTAGG-3� and 5�-GATCGACGTACGGTATAATGTTACATGCGT-3� forinsertion of the CYC1 terminator into the BsiWI site of pGalLuc to formpCYC1TT-F-BsiLuc. The pChimera-F-BsiLuc plasmid was assembled by insert-ing a BsiWI-digested PCR product made off pChimera1-F-XbaLuc with primers5�-AGCTCACGTACGTTCCGTATTCTATTCTAT-3� and 5�-GATCGACGTACGGTATAATGTTACATGCGT-3�.

The pGalNabMutXba-F-Luc plasmid was made by inserting into XbaI-di-gested pGalLuc an XbaI-digested PCR product with the IT containing a site-directed mutation of the putative Nab3 site. This PCR product was generatedfrom plasmid pREFXbaLuc using 5�-AGCTCATCTAGATTCCGTATTCTATTCTATTCCTTGCCTTACTTTAGTTATTATTTTC-3�, which contains themutation, and 5�-GATCGATCTAGAAACAAAATGCGTTTATGACAG-3�.

Strains. Saccharomyces cerevisiae strains DY682 to DY689 were made bytransforming wild-type and sen1E1597K strains (46a and Sen1E1597K; D. A.Brow, University of Wisconsin, Madison) with the plasmids pREFXbaLuc,pRERXbaLuc, pREFBstLuc, and pRERBstLuc as indicated in Table 1. StrainDY695 was constructed by transforming Open Biosystems’ �RRP6 yeast strain(YSC1021-551682) with the IMD2 gene disruption cassette from pUC19-IMD2KO (20). Integration of the IMD2 knockout was confirmed by sequencingPCR products. Strains DY1701 to DY1708 were made by transformation ofstrain DY695 with the indicated plasmids (Table 1) using the lithium acetatemethod (16). Strains DY1562 and DY1563 were made by transforming theplasmid pGalNabMutXba-F-Luc into strains BY4741 and YSC1021-551682, re-spectively.

Poly(A) analysis. To identify the poly(A) addition sites, we used a derivativeof the rapid amplification of cDNA ends-poly(A) test (RACE-PAT) assay (37).Total RNA from the rrp6� strain YSC1021-551682 (Open Biosystems, Inc.) wasreverse transcribed with Moloney murine leukemia virus reverse transcriptaseand the oligo(dT) anchor oligonucleotide 5�-GGGAATTCGACCTCGTCTTGCACCTTGAAGTTTTCCTGTTTTTTTTTTTTTTT-3�. After heat inactivationof the enzyme, this cDNA was amplified by PCR using an anchor oligonucleotide(5�-GGGAATTCGACCTCGTCTTGCACC-3�) and an IT-specific oligonucleo-tide (5�-CGGGATCCTTCCGTATTCTATTCTATTCCTTGC-3�), digestedwith EcoRI and BamHI, ligated into similarly cut pBluescript KS (Stratagene,Inc.), and transformed into Escherichia coli. Plasmid was prepared from insert-containing transformants and sequenced.

RNA and Northern blots. Cells were grown in liquid media, collected in thelogarithmic growth phase, washed once with water, and frozen. Total RNA wasisolated from thawed cell pellets by hot acid phenol extraction and quantified bymeasuring absorbance at 260 nm. Total RNA (15 to 30 �g) was resolved on a 1%(wt/vol) agarose-formaldehyde gel and blotted onto Zeta-probe GT nylon (Bio-Rad) or Hybond XL (Amersham). Filters were baked at 85°C for 2 h and thenprehybridized for a minimum of 3 h at 42°C in 5� SSC (1� SSC is 0.15 M NaClplus 0.015 M sodium citrate), 5� Denhardt’s solution, 50% (vol/vol) formamide,1% (wt/vol) sodium dodecyl sulfate, and 100 �g/ml salmon sperm DNA. Filterswere hybridized under the same conditions with 50 �Ci of 32P-labeled DNAprobe for 4 h at 30°C. Filters were washed at least twice at 42°C in 2� SSC-0.1%sodium dodecyl sulfate for 15 min each time. Washed filters were exposed toKodak X-Omat or Pierce CL-Xposure film, or for quantification, a phosphor-imager screen was read by a Fujix BAS 1000. Probes were labeled with KlenowDNA polymerase (NEB), random hexamer primers, and [�-32P]dATP (Amer-sham Biosciences or Perkin-Elmer). For probing transcripts from the GAL1promoter-terminator plasmids, a promoter-proximal PCR probe was generatedfrom pGalLuc (39) using primers 5�-ATACTTTAACGTCAAGGAGAAAAAACC-3� and 5�-TGTTCACCTCGATATGTGCATCTGTAA-3�. The SED1 probewas prepared by PCR from yeast genomic DNA using 5�-CCGAATTCCACTGATTGCTCCACGTCAT-3� and 5�-CCGGATCCTTACACGCAACGCGTAAGAA-3�. To probe Northern blots for the transcripts from IMD2-containingplasmids and chromosomes (see Fig. 5 and 6), the “upstream” probe from theIMD2 locus was generated by PCR using 5�-GACTAGTGCGGCCGCATCGGTTGAGCGCGATATTA-3� and 5�-CTGATCAGGATCCGGCCATTGCTTTTGCTACTT-3� and yeast genomic DNA. The “downstream” probe was a PCRproduct made from yeast genomic DNA using 5�-GTGGTATGTTGGCCGGTACTACCG-3� and 5�-TCAGTTATGTAAACGCTTTTCGTA-3� as describedpreviously (23).

Primer extension. A 5�-32P-labeled, high-performance liquid chromatography-purified oligonucleotide (1.5 pmol; GCGTTTATGACAGTTAAAAAG) wasmixed with 20 �g of total RNA from the indicated yeast strains, dried, dissolvedin 10 �l of 2 mM Tris (pH 8.1), 0.2 mM EDTA, and 250 mM KCl, annealed at65°C for 5 min, and then incubated for 1 h at 45°C. Twenty-five microliters of 55

3884 JENKS ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

mM Tris-HCl (pH 8.1), 9 mM MgCl, 1 mM dithiothreitol, and 500 �M of eachdeoxynucleoside triphosphate were added to annealing reaction mixtures. Theprimers were extended with 200 units of Moloney murine leukemia virus reversetranscriptase (Invitrogen) at 37°C. Samples were ethanol precipitated, dissolvedin 5 �l of 90 mM Tris borate (pH 8), 2 mM EDTA, and 80% (vol/vol) formamide,heated to 95°C, and resolved on an 8% polyacrylamide-7 M urea gel.

RESULTS

Mapping the 3� ends of the upstream noncoding RNA. Tounderstand the complexity of the IMD2 promoter, we set outto define the beginning and end of the short intergenic tran-scripts resulting from transcription termination at the inter-genic IMD2 terminator. While initiation sites have beenmapped, the sites at which poly(A)� tails are added are un-known. Using reverse transcription from a poly(dT) primerand a primer specific for sequences upstream of IMD2, weobtained cDNAs from an RRP6 deletion strain of S. cerevisiae.Deletion of RRP6 stabilizes short, intergenic noncoding RNAsthat would otherwise be degraded by the exosome (10). Se-quencing of 11 clones identified sites at which the RNA waspolyadenylated (Fig. 1). Poly(A) tails varied from 11 to 50bases, and the set of poly(A) tail addition sites extended overa 78-base interval. All poly(A) tails were added at positionsdownstream of the “low-guanine” start site, and almost all

addition sites were at UA or CA dinucleotides as is common inyeast (17). The terminator region contains the four sequenceelements present in many yeast termination/poly(A) signalsand scored highly in a poly(A) site prediction algorithm (17;data not shown). These 3�-map positions, combined with thespectrum of upstream guanine initiation sites (44), mean thatunder guanine-replete conditions, short transcripts of 75 to 211bases [exclusive of poly(A)] can be synthesized dependingupon which pair of initiation and polyadenylation sites is used(Fig. 1). This range is consistent with the short transcriptsobserved earlier on Northern blots (10, 44).

Comparison of the IMD2 intergenic terminator and theCYC1 transcription terminator. We previously developed areporter assay for the termination activity of the intergenicIMD2 terminator (previously referred to as repressive element[RE], referred to here as IT) (Fig. 1) based on its ability togenerate short poly(A)� transcripts when it was placed down-stream of the GAL1 promoter (23). We used this assay tocompare the IT to a well-characterized conventional termina-tor derived from the end of the CYC1 gene (31, 49). As de-scribed before, when located 120 bp downstream of the GAL1start site, the IT efficiently stopped transcription and preventedfull-length transcript accumulation following galactose induc-

TABLE 1. Yeast strains used in this study

Strain Genotype

46aa.............................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2BY4741b.....................................................................MATa his3�1 leu2�0 met15�0 ura3�0BY4741-4437b ...........................................................MATa his3�1 leu2�0 met15�0 ura3�0 rpb9�07DY682........................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 [pREF-XbaLuc (URA3)]DY684........................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 [pREF-BstLuc (URA3)]DY686........................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pREF-XbaLuc (URA3)]DY688........................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pREF-BstLuc (URA3)]DY1035......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pGalLuc (URA3)]DY1038......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pGalREF-XbaLuc (URA3)]DY1400......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 [pGalLuc (URA3)]DY1403......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 [pGalREF-XbaLuc (URA3)]DY1532......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pCYC1TT-F-XbaLuc (URA3)]DY1534......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0 [pCYC1TT-F-XbaLuc (URA3)]DY1549......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rpb9�0 rrp6::URA3DY1550......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pChimera1-F-XbaLuc (URA3)]DY1551......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0 [pChimera1-F-XbaLuc (URA3)]DY1552......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pChimera1-R-XbaLuc (URA3)]DY1554......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pChimera-F-BsiLuc (URA3)]DY1555......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0 [pChimera-F-BsiLuc (URA3)]DY1558......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 [pCYC1TT-F-BsiLuc (URA3)]DY1559......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0 [pCYC1TT-F-BsiLuc (URA3)]DY1562......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 (pGalNabMutXba-F-Luc)DY1563......................................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0 (pGalNabMutXba-F-Luc)DY1700......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2 (URA3)]DY1701......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-BsiWImut (URA3)]DY1702......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-24bp� (URA3)]DY1703......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-36bp� (URA3)]DY1704......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-45bp� (URA3)]DY1706......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-103bp� (URA3)]DY1707......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-153bp� (URA3)]DY1708......................................................................MATa his3�1 leu2�0 met15�0 rrp6�0 ura3�0 imd2::LEU2 [pRS316-IMD2-218bp� (URA3)]DY2900......................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 [pCYC1TTF-XbaLuc (URA3)]DY2902......................................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K [pCYC1TTF-XbaLuc (URA3)]Sen1E1597Ka ............................................................MATa cup1� ura3 his3 trp1 lys2 ade2 leu2 sen1E1597K

YSC1021-551682c .....................................................MATa his3�1 leu2�0 met15�0 ura3�0 rrp6�0

a Strain provided by D. A. Brow (University of Wisconsin, Madison).b Strain from Research Genetics, Inc.c Strain from Open Biosystems, Inc.

VOL. 28, 2008 REGULATED START SITE SELECTION AND TERMINATION 3885


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

tion (23) (Fig. 2, lanes 1 to 3). The terminated transcriptbecame detectable only when RRP6 was deleted (Fig. 2, lanes4 to 6). In contrast, when transcription was driven into theCYC1 termination element, a prominent terminated RNA wasdetected regardless of RRP6 status (Fig. 2, compare lanes 7 to9 to lanes 10 to 12). Control full-length transcripts were alsounaffected by deletion of RRP6 (Fig. 2, compare lanes 13 to 15to lanes 16 to 18). A similar result was obtained when bothelements were inserted 15 bp closer to the promoter (data notshown). When the IT is moved 110 bp further downstream,however, the terminated transcript is stable even in the pres-ence of RRP6 (23). Thus, the distance from the promoter isimportant for stability of the terminated transcript generatedfrom the IT but not the CYC1 terminator. This suggests thatboth distance from the promoter and specific sequences at theterminator are determinants of transcript handling by the nu-clear exosome.

To test the sequence requirement, we grafted 49 bp of the IT(approximately the 5� half; Fig. 1) onto the minimal CYC1terminator and placed that under GAL1 control. This piece ofthe IT is known to be insufficient for termination (23). Thechimeric element efficiently terminated transcription (Fig. 3A,lanes 1 to 6). The RRP6 dependence of the RNAs generated bytermination due to the IT, CYC1, and chimeric terminatorswas quantified by phosphorimaging at the 90-min inductiontime point and normalizing to a constitutive reference tran-script (SED1). Transcripts terminated by the IT in wild-typestrains were 9% as abundant as when the Rrp6 exosome sub-unit was deleted (Fig. 3A, compare lanes 13 to 15 to lanes 16to 18). This is in striking contrast to the CYC1 terminator in

which almost all of the RNA was stable when the exosome wasintact (87% RRP6� versus �rrp6; Fig. 3A, compare lanes 7 to9 to lanes 10 to 12). The upstream portion of the IT endowedthe CYC1-terminated transcript with increased sensitivity tothe exosome (RRP6� 39% of rrp6�; Fig. 3A, lanes 1 to 3 versuslanes 4 to 6) when grafted onto its 5� end, rendering thetranscript more like that generated by the IT than the CYC1terminator. When the chimeric construct was moved down-stream an additional 110 bp, to a position in which even the ITis immune to exosome degradation (23), the chimera was alsorelatively Rrp6 independent (Fig. 3B, compare lanes 1 to 3 tolanes 4 to 6), as was the CYC1 terminator (Fig. 3B, comparelanes 7 to 9 to lanes 10 to 12).

The Nab3 RNA binding protein has been implicated intermination and degradation of small RNAs in yeast (1, 21, 42,46, 47). The IT has a consensus Nab3 binding site (UCUU).This site was contained in the portion of the IT grafted to theCYC1 (Fig. 1) and could be part of the signals for terminationand turnover of the noncoding small transcript. We mutatedthis site to AGUU in the reporter plasmid in which it is placeddownstream of the GAL1 promoter. The plasmid was intro-duced into RRP6� and �rrp6 strains, and transcription wasinduced with galactose. Mutation of this putative Nab3 sitestrongly stabilized (5.8-fold) the terminated short RNA in cellscontaining an intact exosome (RRP6; Fig. 3C). Interestingly,the mutation did not improve readthrough, i.e., it did notreduce termination efficiency of the IT. This contrasts with apoint mutation 10 bp downstream of UCUU that essentiallyabrogates termination, giving rise to a stable full-length RNA(23). Thus, separate sequences in the IT provide for the ter-

FIG. 1. Sequence of the IMD2 promoter region. Initiation sites in the presence of guanine are indicated by thin bent arrows. The initiation sitewhen guanine is limiting is depicted by the thick bent arrow (44). Map positions at which poly(A) is added to IT-terminated, intergenic RNAs arecircled. The TATA box (per Escobar-Henriques et al. [13]) and start codon are shown in large type. The IT is identified with a solid underline(single and double). The portion of the IT used to create a chimeric terminator is doubly underlined. The hexamer mutagenized to a BsiWI site(AGTATG 3 CGTACG, where the mutated nucleotides are underlined) is boxed. The consensus Nab3 binding site is in a shaded box.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

mination and RNA degradation functions. There is a slightincrease in abundance of the terminated transcript in a �rrp6strain (1.4-fold), suggesting that the transcript may be de-graded by residual activity of the Rrp6-depleted nuclear exo-some or another nuclease pathway (�rrp6; Fig. 3C). Theseresults are consistent with studies on a nab3 mutant strain thatalso suggests a role for this protein in IT function (Kuehnerand Brow, submitted).

Position dependence of Sen1-mediated termination. Sen1 isstrongly implicated in termination at the IT (44). We tested itsrole directly by transcribing the reporter construct in a strainbearing the temperature-sensitive sen1E1597K allele. In a strainwith the wild-type SEN1 gene, the IT promoted terminationand yielded trace levels of an unstable transcript (Fig. 4A,lanes 1 to 4). In contrast, the sen1 mutation rendered theterminator significantly less effective at both the permissiveand restrictive temperatures (Fig. 4A, lanes 5 to 8). Presum-ably these longer transcripts escape exosome attack, therebyexplaining their higher level of accumulation compared to ter-minated RNAs in lanes 1 to 4. If the Sen1 termination mech-anism operates preferentially on short transcripts in concertwith the exosome, then moving the IT downstream shouldabrogate the ability of the sen1E1597K mutation to causereadthrough of the terminator. Indeed, the IT shows strongtermination when positioned 680 bp downstream from thestart site regardless of the status of SEN1 (Fig. 4A, comparelanes 9 to 12 to lanes 13 to 16). The sen1E1597K mutation hadno effect on readthrough even at the restrictive temperaturewhen the IT was in this location (Fig. 4A, lanes 13 to 16).

Overall RNA abundance was also higher when the IT was thisfar downstream, since the transcripts were not diverted to theexosome degradation pathway (Fig. 4A, lanes 10, 12, 14, and16). This demonstrates a strong position dependence on Sen1’stermination function. The CYC1 terminator is also dependentupon the Sen1 pathway (44). It is a canonical poly(A) signal/termination site found at the end of the ORF. The CYC1terminator was 77% effective as a terminator in a SEN1� strainat either permissive or restrictive temperatures when locatedclose (120 bp) to the transcription start site (Fig. 4B, lanes 1 to6). The sen1E1597K mutation reduced termination efficiencies(short transcripts divided by total transcripts) to 43% and 28%at the permissive and restrictive temperatures, respectively(Fig. 4B, lanes 7 to 9 and lanes 10 to 12) in a manner similarto the mutation’s effect on the IT and as seen before in anotherreporter system (44). These results confirm that Sen1 influ-ences terminator function for both terminators but onlyIMD2’s IT renders terminated RNA sensitive to exosome deg-radation. Therefore, termination and degradation of shorttranscripts are not obligatorily coupled.

Effect of distance upon RNA polymerase II’s ability toswitch initiation sites. We next asked whether the distancebetween the two types of initiation sites (Fig. 1, the upstreamGs versus the downstream A) was important for their regu-lated selection, for example if RNA polymerase slides betweenthem when making its initiation decision. To test this, weintroduced a BsiWI restriction site (Fig. 1) between the initi-ation sites for high-guanine and the low-guanine start intowhich we inserted random pieces of DNA from lambda phage

FIG. 2. Exosome sensitivity of the IT- and CYC-terminated transcripts. RNA was prepared for Northern analysis from yeast strains with thewild-type RRP6 gene or deleted for RRP6 and bearing a plasmid containing the GAL1 promoter and either the CYC1 or IMD2 intergenicterminator (IT) inserted downstream of the promoter (indicated schematically at the bottom of the figure). The strains were DY1038 (RRP6)(lanes 1 to 3), DY1403 (�rrp6) (lanes 4 to 6), DY1532 (RRP6) (lanes 7 to 9), DY1534 (�rrp6) (lanes 10 to 12), DY1035 (RRP6) (lanes 13 to 15),and DY1400 (�rrp6) (lanes 16 to 18). Cells were induced with 2% galactose for 0, 30, or 90 min and probed with the GAL1 or SED1 (as a loadingcontrol) probe, as indicated.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

of various sizes (24, 36, 45, 103, 153, and 218 bp). Plasmids withthese “lengthened” versions of IMD2 were introduced into ayeast strain deleted for chromosomal IMD2, and the transcrip-tion start site patterns of the lengthened constructs were ana-lyzed. Start site mapping by primer extension revealed that thenormal high-guanine start sites were still used when cells weregrown in guanine (Fig. 5A, odd-numbered lanes) (althoughmore complex initiation patterns are apparent for the twolargest inserts). In contrast, when the cells were grown in my-cophenolic acid (MPA), RNA polymerase II’s ability to startfrom the normal downstream A residue was gradually compro-mised with increasing distance [Fig. 5A, low G (MPA) start ineven-numbered lanes, and graph]. These results suggest thateither RNA polymerase II abandons its search for a start siteor finds alternative start sites before the IT. In the latter case,transcripts started upstream of the IT would terminate, bedegraded, and fail to produce any protein-encoding IMD2mRNA. To examine this, we performed Northern analysis onthe transcripts produced from these constructs in RRP6 dele-tion strains using a probe that detects the upstream shorttranscript and full-length downstream transcripts (Fig. 5B, topgel) or just the downstream transcripts containing approxi-mately the 3� half of the IMD2 ORF (bottom gel). As expected,long transcripts were produced at the expense of short RNAsfrom wild-type IMD2, as well as from the IMD2 in which weengineered a new restriction site (Fig. 5B, top gel, comparelane 1 to lane 3 and lane 4 to lane 6). The addition of 24 bp oflambda DNA between the upstream and downstream initiationsites did not influence this pattern (Fig. 5B, lanes 7 to 9). Whenlarger pieces of DNA were inserted, MPA induction of full-length RNAs detected by either probe was reduced (36 bp; Fig.5B, lane 12) or virtually absent (45, 103, 153, and 218 bp; Fig.5B, lanes 15, 18, 21, and 24, respectively). Thus, RNA synthesisfrom any start site was curtailed when RNA polymerase II wasunable to find the favored downstream A start site in thepresence of MPA. The lack of short or long RNA productionin the presence of MPA (Fig. 5B, lanes 15, 18, 21, and 24) alsostrongly suggests that no other start sites are found as alterna-tives, either upstream or downstream of the natural initiationsite unless such aberrant RNAs are degraded by a nucleasesystem other than that requiring RRP6.

Since IMD2 expression is required for growth in the pres-ence of MPA, the absence of full-length IMD2-encodingmRNA in these strains should render them MPA sensitive.This was indeed the case, as growth was proportional to ex-pression of full-length IMD2 mRNA where the 36-bp insertallowed some growth but larger inserts did not support any

growth (Fig. 5C). Hence, the regulated switch from transcrip-tion of the upstream short RNA to the downstream biologi-cally active IMD2 mRNA can be disrupted by perturbing thechoice of transcription initiation site.

Role of the Rpb9 subunit of RNA polymerase II in IMD2start site selection. To further examine the start site shift, westudied initiation in a strain of yeast deleted for RPB9. Thissmall subunit of RNA polymerase II is not essential, but its lossshifts transcription start sites upstream and impairs elongationmore generally (2, 14, 18, 19, 45). It also renders cells ex-tremely MPA sensitive as well as defective in IMD2 induction(39). This suggested that RNA polymerase lacking this subunitmight have a start site switch problem on IMD2 during induc-tion. Primer extension (Fig. 6A) and Northern blotting (Fig.6B) showed no detectable IMD2 transcripts in an RPB9-nullstrain following MPA treatment (Fig. 6A, lanes 7 to 9; Fig. 6B,lanes 4 to 6). As seen before, when RRP6 was deleted in orderto stabilize the small intergenic transcripts, the upstream gua-nine initiation sites were detectable by primer extension in astrain with intact RPB9 (Fig. 6A, lane 4). When challengedwith MPA, the downstream “low-guanine” start was observed(Fig. 6A, lane 6). When RRP6 was deleted in order to stabilizethe intergenic transcripts in the RPB9 deletant, we found thatRNA polymerase II could employ the “high-guanine” starts(Fig. 6A, lanes 1 and 2), but they were shifted upstream rela-tive to RPB9. More importantly, the RPB9 deletants were notcapable of utilizing the downstream initiation site normallyinduced by MPA (Fig. 6A, compare lane 3 to lane 6). This is alikely explanation for why an RPB9 deletion strain is so sensi-tive to MPA. Northern blotting of the �rpb9 �rrp6 doubledeletant (Fig. 6B) confirmed this start site shift defect, sinceshort intergenic transcripts were synthesized normally, but full-length mRNA could not be induced (Fig. 6B, compare lane 1to lane 7 and lane 3 to lane 9).

DISCUSSION

Regulation of IMD2 employs an unusual mechanism involv-ing a noncoding transcript arising from upstream of the pro-ductive transcription start site. This noncoding RNA is de-graded, since its synthesis is not as important as the fact thatpolymerase molecules preferentially initiate at an upstreamsite when GTP is available and terminate at the IT, therebypreventing use of a downstream start that would otherwiseproduce IMD2-coding mRNA. Brow and coworkers haveshown that start site selection is governed by RNA poly-merase’s choice of GTP versus ATP as the initiating nucleo-

FIG. 3. Exosome sensitivity of terminated transcripts. RNA was prepared for Northern analysis from yeast strains with the wild-type RRP6 geneor deleted for RRP6 and bearing a plasmid containing the GAL1 promoter and either the CYC1 terminator, the IT, or a chimera between the CYC1and IMD2-IT. The chimera contained 49 bp of the IT (double underlined in Fig. 1) placed 5� to 102 bp of the CYC1 core terminator (there wasa 4-bp overlap of common sequence between them). Terminators were inserted at proximal (XbaI in panel A) or distal (BsiWI in panel B) positionsdownstream of the promoter (indicated schematically at the bottom of the figure). In panel A, the strains were DY1550 (RRP6) (lanes 1 to 3),DY1551 (�rrp6) (lanes 4 to 6), DY1532 (RRP6) (lanes 7 to 9), D1534 (�rrp6) (lanes 10 to 12), DY1038 (RRP6) (lanes 13 to 15), and DY1403(�rrp6) (lanes 16 to 18). In panel B, the strains were DY1554 (RRP6) (lanes 1 to 3), DY1555 (�rrp6) (lanes 4 to 6), DY1558(RRP6) (lanes 7 to9), and DY1559 (�rrp6) (lanes 10 to 12)]. Transcription was induced following galactose exposure for the indicated times. Filters were probed withthe GAL1 or SED1 probe as indicated. Full-length (IT in the reverse orientation in the XbaI site) marker RNA from galactose-induced strainDY1552 was loaded in the lane marked M in panels A and C. In panel C, transcription through an IT with a mutated consensus Nab3 binding site(AGUU) or an unaltered site (UCUU) was analyzed by Northern blotting as described above for panels A and B.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

tide, with the upstream G starts preferred when guanine nu-cleotide pools are adequate and the alternate downstream startsite employed when GTP is limiting (44; Kuehner and Brow,submitted) (Fig. 1). This preference probably explains why theregion has evolved an unusual sequence bias of only 13% Gbetween the TATA box and initiation codon, whereas theIMD2 ORF is 23% G and all ORFs average 21% G. The 97-bp

terminator element itself, in which the low-G adenine start sitelies, is a strikingly low 6% G. Under this scenario, the produc-tive downstream start site is not accessed unless GTP levels arelow enough that the upstream starts cannot be employed be-cause RNA polymerase II is essentially starved for that nucle-otide at those positions. Thus, the option of two start sitesappears to be largely a mutually exclusive choice.

Here we delineate the intergenic transcripts’ boundaries byidentifying their 3� ends. The short transcripts are a family ofpoly(A)� RNAs potentially ranging from 75 nucleotides toslightly over 200 nucleotides. The poly(A) addition sites all falldownstream of the adenine start site that generates IMD2mRNA and which is centrally located in the terminator (Fig.1). Hence, at the MPA-induced start site, RNA polymeraseinitiates inside the terminator and cannot transcribe the full setof sequences required for termination at the IT. By mappingRNA polymerase II density using a chromatin immunoprecipi-tation microarray (ChIP-chip) assay, readthrough of the IT ina sen1 mutant strain was observed (44). Here we show directlythat the IT’s activity is Sen1 dependent. As predicted fromwork on short transcript termination (1, 21, 42, 44, 46), we alsoobserved that the role of Sen1 in termination is strongly dis-tance dependent; it failed to affect termination when the ITwas 680 bp from the start site (Fig. 4A). Termination wasnevertheless efficient and therefore has been subsumed by analternative termination mechanism. The IT terminator func-tioned autonomously to yield a transcript that was very sensi-tive to degradation by the exosome but again only when it waspositioned close to an initiation site. This was unique to theIMD2 IT, since transcripts generated by the canonical CYC1terminator were not susceptible to degradation at that distancebut could be made so by transferring a piece of the IT up-stream of the CYC1 terminator. Therefore, a sequence deter-minant as well as distance influences the fate of the terminatedtranscript. A good candidate for the relevant sequence is aNab3 consensus site found in the region (Fig. 3C) (Kuehnerand Brow, submitted). These findings also fit with a model inwhich different classes of RNA polymerase II transcripts areterminated by different systems. One system employs the RNAbinding proteins Nab3 and Nrd1 along with the Sen1 helicase(5, 21, 41, 42, 44, 47). Short transcripts, such as noncodingregulatory RNAs and snRNA/snoRNAs use this system. Han-dling of the former set of transcripts is also coupled to rapiddegradation by the exosome, as observed here (1, 10, 46).

What could account for the strong distance dependence ofSen1 activity and exosome stimulating activity we observed forthis terminator? An obvious candidate is the phosphorylationstate of the carboxyl-terminal domain (CTD) of the large sub-unit of RNA polymerase II. Since the phosphorylation patternchanges as a function of where in the transcription cycle poly-merase is, it is attractive to consider that the transcribing en-zyme matures over the transcription unit with respect to phos-phorylation and loading of the Sen1 termination machineryonto the elongation complex. Serine 5 phosphorylation of theCTD repeat is enriched in the 5� end of transcription units,whereas serine 2 phosphorylation is enriched at the 3� end(32). It has been postulated that these markings are signals forthe different cotranscriptional events that process primarytranscripts into mature mRNA (22). Once a transition pointhas been reached, Sen1 can no longer gain access to the com-

FIG. 4. SEN1 dependence of termination. RNA was prepared forNorthern analysis from wild-type yeast and strains with the Sen1E1597K

mutation. Each strain contained plasmids with the GAL1 promoter andeither the CYC1 terminator or the IMD2 IT inserted downstream of thepromoter. Terminators were inserted at promoter-proximal (XbaI) orpromoter-distal (BstEII) positions. The strains used in panel A wereDY682 (SEN1) (lanes 1 to 4), DY686 (sen1E1597K) (lanes 5 to 8), DY684(SEN1) (lanes 9 to 12), and DY688 (sen1E1597K)(13 to 16). The strainsused in panel B were DY2900 (SEN1) and DY2902 (sen1E1597K). Thestrains were grown at the indicated temperatures (25°C or 37°C) after 0 or90 min of galactose induction, and the filters were probed with the GAL1or SED1 probe as indicated. Trace levels of an unstable transcript areindicated by the unlabeled black arrow to the left or right of the gel.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

plex, and the window of opportunity for that termination sys-tem to operate has passed. A role(s) for Nrd1 and Nab3 inengaging the complex early after initiation is attractive, asthese proteins are known to associate with each other andNrd1 binds the CTD (6, 8). In addition, the CTD kinase CTK1has been linked to the Sen1/Nrd1/Nab3 termination system (8).Recent work has shown that Nrd1 recognizes Ser-5 phosphor-ylated RNA polymerase II, and phosphorylation at serine 7that is specific for snRNA synthesis has recently been identi-fied (11, 48). Hence, there is enough variety in the modificationof an elongation complex to provide signals to distinct termi-nation machineries over the course of transcription.

Our results in modifying the spacing between the upstream

and downstream start sites reveal an exponential decay in theability of RNA polymerase II to recognize an initiation sitethat is progressively more distant from the TATA box (Fig.5A). These data are consistent with a scanning model for RNApolymerase II in which the enzyme enters chromatin throughrecognition of the preinitiation complex, melts DNA, andtracks on the template until it finds a satisfactory initiation site(15, 25, 26). Given the regulatory role of guanine nucleotideconcentration in this case and the unique nature of the high-guanine start sites (rare tandem GG dinucleotides [Kuehnerand Brow, submitted]), sliding between start sites would likelytake place without chain initiation. However, the possibilitythat small oligonucleotides, such as abortive transcripts, are

FIG. 5. Effect of spacing upon start site selection. (A) Start site mapping of IMD2 with increasing spacing between the “high-guanine” and“low-guanine”’ (MPA) starts. An rrp6� strain was transformed with a family of plasmids containing increasing amounts of lambda DNA insertedinto the engineered BsiWI site (boxed in Fig. 1) between the high-G and low-G start sites. Each derived strain was grown in the presence (�) of0.5 mM guanine for 30 min or 15 �g/ml MPA for 2 h before RNA was prepared and subjected to 5�-end mapping by primer extension. The strainsused were DY1701 (lanes 1 and 2), DY1702 (lanes 3 and 4), DY1703 (lanes 5 and 6), DY1704 (lanes 7 and 8), DY1706 (lanes 9 and 10), DY1707(lanes 11 and 12), and DY1708 (lanes 13 and 14). Extension products representing the low-guanine/downstream and high-guanine/upstream startsare indicated. Phosphorimaging was used to quantify the extension product corresponding to the MPA-induced start and plotted as a function ofthe length of DNA inserted between the two starts. Prism 4.0 (GraphPad Software, Inc.) was used for curve fitting. (B) Northern blot of IMD2transcripts with increasing spacing between the “high-guanine” and “low-guanine” starts. RNAs from strains described in panel A were analyzedby Northern blotting. Strains DY1700 (lanes 1 to 3), DY1701 (lanes 4 to 6), DY1702 (lanes 7 to 9), DY1703 (10 to 12), DY1704 (lanes 13 to 15),DY1706 (lanes 16 to 18), DY1707 (lanes 19 to 21), and DY1708 (lanes 22 to 24) were grown in synthetic complete medium lacking uracil (SCura)with 0.5 mM guanine and 15 �g/ml MPA for 2 h before RNA was prepared. Filters were probed with the “upstream” or “downstream” probesdescribed in Materials and Methods. wt, wild type; Bsi, BsiWI. (C) Cultures from the strains in panel B were grown to an optical density at 600nm of 0.01 and serially diluted in fourfold increments, and 5 �l of each dilution was spotted onto SC–ura and SC–ura containing 15 �g/ml MPAand grown at 30°C. WT, wild type.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

made and released during this search cannot be excluded. Thedistance effect may also represent the difficulty RNA polymer-ase has in making contact with proteins that reside upstream,such as TFIID. With respect to the start site decision at IMD2,it will be interesting to examine the role of TFIIB in thisprocess, since it is part of the measuring device that positionsstart sites at a fixed point downstream of the TATA box (4, 7,

26, 27, 33, 34). In the case of IMD2, start site selection is aregulated variable, so for this unusual promoter there is plas-ticity in this feature.

Our experiments with strains lacking the Rpb9 subunit helpelucidate why those cells are so sensitive to MPA and why theyfail to induce IMD2. RNA polymerase II without this subunitinitiates at the upstream site but cannot initiate from the Astart downstream. This makes sense, since Rpb9 is known toplay a role in start site positioning generally and is a significantcomponent of one of the pincers of the enzyme’s jaws thatcontacts downstream duplex DNA (9, 14, 18, 19). Absence ofthe subunit may result in a structural deficit, such as a loosegrip on DNA, that hampers controlled translocation of theenzyme. This could also explain the importance of Rpb9 in: (i)general elongation, (ii) the RNA cleavage activity of the en-zyme, which involves reverse translocation, and (iii) proofread-ing, which in turn relies on RNA cleavage and translocation (2,18, 24, 30). If RNA polymerase II deficient in Rpb9 slides onDNA between these two possible start sites, it will be interest-ing to know whether it is released from the upstream transcrip-tion unit following its failure to find the downstream start siteor remains bound to DNA.

ACKNOWLEDGMENTS

We thank D. A. Brow for materials and information prior to pub-lication, J. Boss for a critical reading of the manuscript, and KatrinaKopcewicz for contributing to early portions of this study.

This work was supported by NIH grant GM46331.

REFERENCES

1. Arigo, J. T., D. E. Eyler, K. L. Carroll, and J. L. Corden. 2006. Terminationof cryptic unstable transcripts is directed by yeast RNA-binding proteinsNrd1 and Nab3. Mol. Cell 23:841–851.

2. Awrey, D. E., R. G. Weilbaecher, S. A. Hemming, S. M. Orlicky, C. M. Kane,and A. M. Edwards. 1997. Transcription elongation through DNA arrestsites. A multistep process involving both RNA polymerase II subunit RPB9and TFIIS. J. Biol. Chem. 272:14747–14754.

3. Buratowski, S. 2005. Connections between mRNA 3� end processing andtranscription termination. Curr. Opin. Cell Biol. 17:257–261.

4. Bushnell, D. A., K. D. Westover, R. E. Davis, and R. D. Kornberg. 2004.Structural basis of transcription: an RNA polymerase II-TFIIB cocrystal at4.5 angstroms. Science 303:983–988.

5. Carroll, K. L., D. A. Pradhan, J. A. Granek, N. D. Clarke, and J. L. Corden.2004. Identification of cis elements directing termination of yeast nonpoly-adenylated snoRNA transcripts. Mol. Cell. Biol. 24:6241–6252.

6. Carroll, K. L., R. Ghirlando, J. M. Ames, and J. L. Corden. 2007. Interactionof yeast RNA-binding proteins Nrd1 and Nab3 with RNA polymerase IIterminator elements. RNA 13:361–373.

7. Chen, B. S., and M. Hampsey. 2004. Functional interaction between TFIIBand the Rpb2 subunit of RNA polymerase II: implications for the mecha-nism of transcription initiation. Mol. Cell. Biol. 24:3983–3991.

8. Conrad, N. K., S. M. Wilson, E. J. Steinmetz, M. Patturajan, D. A. Brow,M. S. Swanson, and J. L. Corden. 2000. A yeast heterogeneous nuclearribonucleoprotein complex associated with RNA polymerase II. Genetics154:557–571.

9. Cramer, P., D. A. Bushnell, and R. D. Kornberg. 2001. Structural basis oftranscription: RNA polymerase II at 2.8 angstrom resolution. Science 292:1863–1876.

10. Davis, C. A., and M. Ares, Jr. 2006. Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p inSaccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 103:3262–3267.

11. Egloff, S., D. O’Reilly, R. D. Chapman, A. Taylor, K. Tanzhaus, L. Pitts, D.Eick, and S. Murphy. 2007. Serine-7 of the RNA polymerase II CTD isspecifically required for snRNA gene expression. Science 318:1777–1779.

12. Escobar-Henriques, M., and B. Daignan-Fornier. 2001. Transcriptional reg-ulation of the yeast GMP synthesis pathway by its end products. J. Biol.Chem. 276:1523–1530.

13. Escobar-Henriques, M., B. Daignan-Fornier, and M. A. Collart. 2003. Thecritical cis-acting element required for IMD2 feedback regulation by GDP isa TATA box located 202 nucleotides upstream of the transcription start site.Mol. Cell. Biol. 23:6267–6278.

14. Furter-Graves, E. M., B. D. Hall, and R. Furter. 1994. Role of a small RNA

FIG. 6. Effect of Rpb9 subunit on initiation site selection. (A) Startsite mapping. RNA transcribed from the native chromosomal loci wasanalyzed by Northern blotting from strains deleted for RRP6, RPB9, orboth genes, as indicated in the figure. Strains DY1549 (lanes 1 to 3),YSC1021-551682 (lanes 4 to 6), and BY4741-4437 (lanes 7 to 9) weregrown in the presence of 0.5 mM guanine for 30 min or 15 �g/ml MPAfor 2 h before RNA was isolated for primer extension. Some cellsreceived neither treatment ( lanes). The fast moving band in all lanesis a nonspecific species in the probe preparation that serves as aninternal standard. (B) Northern analysis. RNAs from strains BY4741-4437 (lanes 1 to 3), YSC1021-551682 (lanes 4 to 6), and DY1549 (lanes7 to 9) were prepared as described above for panel A and subjected toNorthern blotting. The top panel of the Northern blot was probed withthe “upstream” probe described in Materials and Methods, and thelower panel was probed with the SED1 probe as a loading control.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

pol II subunit in TATA to transcription start site spacing. Nucleic Acids Res.22:4932–4936.

15. Giardina, C., and J. T. Lis. 1993. DNA melting on yeast RNA polymerase IIpromoters. Science 261:759–762.

16. Gietz, D., A. St. Jean, R. A. Woods, and R. H. Schiestl. 1992. Improvedmethod for high efficiency transformation of intact yeast cells. Nucleic AcidsRes. 20:1425.

17. Graber, J. H., G. D. McAllister, and T. F. Smith. 2002. Probabilistic predic-tion of Saccharomyces cerevisiae mRNA 3�-processing sites. Nucleic AcidsRes. 30:1851–1858.

18. Hemming, S. A., D. B. Jansma, P. F. Macgregor, A. Goryachev, J. D. Friesen,and A. M. Edwards. 2000. RNA polymerase II subunit Rpb9 regulatestranscription elongation in vivo. J. Biol. Chem. 275:35506–35511.

19. Hull, M. W., K. McKune, and N. A. Woychik. 1995. RNA polymerase IIsubunit RPB9 is required for accurate start site selection. Genes Dev. 9:481–490.

20. Hyle, J. W., R. J. Shaw, and D. Reines. 2003. Functional distinctions betweenIMP dehydrogenase genes in providing mycophenolate resistance and gua-nine prototrophy to yeast. J. Biol. Chem. 278:28470–28478.

21. Kim, M., L. Vasiljeva, O. J. Rando, A. Zhelkovsky, C. Moore, and S. Bura-towski. 2006. Distinct pathways for snoRNA and mRNA termination. Mol.Cell 24:723–734.

22. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphory-lated forms of RNA polymerase II and associated mRNA processing factorsduring transcription. Genes Dev. 14:2452–2460.

23. Kopcewicz, K. A., T. W. O’Rourke, and D. Reines. 2007. Metabolic regulationof IMD2 transcription and an unusual DNA element that generates shorttranscripts. Mol. Cell. Biol. 27:2821–2829.

24. Koyama, H., T. Ito, T. Nakanishi, and K. Sekimizu. 2007. Stimulation ofRNA polymerase II transcript cleavage activity contributes to maintain tran-scriptional fidelity in yeast. Genes Cells 12:547–559.

25. Kuehner, J. N., and D. A. Brow. 2006. Quantitative analysis of in vivoinitiator selection by yeast RNA polymerase II supports a scanning model.J. Biol. Chem. 281:14119–14128.

26. Leuther, K. K., D. A. Bushnell, and R. D. Kornberg. 1996. Two-dimensionalcrystallography of TFIIB- and IIE-RNA polymerase II complexes: implica-tions for start site selection and initiation complex formation. Cell 85:773–779.

27. Li, Y., P. M. Flanagan, H. Tschochner, and R. D. Kornberg. 1994. RNApolymerase II initiation factor interactions and transcription start site selec-tion. Science 263:805–807.

28. Lykke-Andersen, S., and T. H. Jensen. 2007. Overlapping pathways dictatetermination of RNA polymerase II transcription. Biochimie 89:1177–1182.

29. Martens, J. A., L. Laprade, and F. Winston. 2004. Intergenic transcription isrequired to repress the Saccharomyces cerevisiae SER3 gene. Nature 429:571–574.

30. Nesser, N. K., D. O. Peterson, and D. K. Hawley. 2006. RNA polymerase IIsubunit Rpb9 is important for transcriptional fidelity in vivo. Proc. Natl.Acad. Sci. USA 103:3268–3273.

31. Osborne, B. I., and L. Guarente. 1989. Mutational analysis of a yeast tran-scriptional terminator. Proc. Natl. Acad. Sci. USA 86:4097–4101.

32. Phatnani, H. P., and A. L. Greenleaf. 2006. phosphorylation and functions ofthe RNA polymerase II CTD. Genes Dev. 20:2922–2936.

33. Pinto, I., D. E. Ware, and M. Hampsey. 1992. The yeast SUA7 gene encodesa homolog of human transcription factor TFIIB and is required for normalstart site selection in vivo. Cell 68:977–988.

34. Pinto, I., W. H. Wu, J. G. Na, and M. Hampsey. 1994. Characterization ofsua7 mutations defines a domain of TFIIB involved in transcription start siteselection in yeast. J. Biol. Chem. 269:30569–30573.

35. Rasmussen, T. P., and M. R. Culbertson. 1998. The putative nucleic acidhelicase Sen1p is required for formation and stability of termini and formaximal rates of synthesis and levels of accumulation of small nucleolarRNAs in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:6885–6896.

36. Rosonina, E., S. Kaneko, and J. L. Manley. 2006. Terminating the transcript:breaking up is hard to do. Genes Dev. 20:1050–1056.

37. Salles, F. J., W. G. Richards, and S. Strickland. 1999. Assaying the poly-adenylation state of mRNAs. Methods 17:38–45.

38. Shaw, R. J., and D. Reines. 2000. Saccharomyces cerevisiae transcriptionelongation mutants are defective in PUR5 induction in response to nucleo-tide depletion. Mol. Cell. Biol. 20:7427–7437.

39. Shaw, R. J., J. L. Wilson, K. T. Smith, and D. Reines. 2001. Regulation of anIMP dehydrogenase gene and its overexpression in drug-sensitive transcrip-tion elongation mutants of yeast. J. Biol. Chem. 276:32905–32916.

40. Steinmetz, E. J., and D. A. Brow. 1996. Repression of gene expression by anexogenous sequence element acting in concert with a heterogeneous nuclearribonucleoprotein-like protein, Nrd1, and the putative helicase Sen1. Mol.Cell. Biol. 16:6993–7003.

41. Steinmetz, E. J., and D. A. Brow. 2003. Ssu72 protein mediates both poly(A)-coupled and poly(A)-independent termination of RNA polymerase II tran-scription. Mol. Cell. Biol. 23:6339–6349.

42. Steinmetz, E. J., N. K. Conrad, D. A. Brow, and J. L. Corden. 2001. RNA-binding protein Nrd1 directs poly(A)-independent 3�-end formation of RNApolymerase II transcripts. Nature 41:327–331.

43. Steinmetz, E. J., S. B. Ng, J. P. Cloute, and D. A. Brow. 2006. cis- andtrans-Acting determinants of transcription termination by yeast RNA poly-merase II. Mol. Cell. Biol. 26:2688–2696.

44. Steinmetz, E. J., C. L. Warren, J. N. Kuehner, B. Panbehi, A. Z. Ansari, andD. A. Brow. 2006. Genome-wide distribution of yeast RNA polymerase IIand its control by Sen1 helicase. Mol. Cell 24:735–746.

45. Sun, Z. W., A. Tessmer, and M. Hampsey. 1996. Functional interactionbetween TFIIB and the Rpb9 (Ssu73) subunit of RNA polymerase II inSaccharomyces cerevisiae. Nucleic Acids Res. 24:2560–2566.

46. Thiebaut, M., E. Kisseleva-Romanova, M. Rougemaille, J. Boulay, and D.Libri. 2006. Transcription termination and nuclear degradation of crypticunstable transcripts: a role for the nrd1-nab3 pathway in genome surveil-lance. Mol. Cell 23:853–864.

47. Vasiljeva L., and S. Buratowski. 2006. Nrd1 interacts with the nuclear exo-some for 3� processing of RNA polymerase II transcripts. Mol. Cell 21:239–248.

48. Vasiljeva, L., M. Kim, N. Terzi, L. M. Soares, and S. Buratowski. 2008.Transcription termination and RNA degradation contribute to silencing ofRNA polymerase II transcription within heterochromatin. Mol. Cell 29:313–323.

49. Zaret, K. S., and F. Sherman. 1982. DNA sequence required for efficienttranscription termination in yeast. Cell 28:563–573.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Documents

Properties of an Intergenic Terminator and Start Site Switch That