Promoter-targeted Phage Display Selections with

Promoter-targeted Phage Display Selections withPreassembled Synthetic Zinc Finger Libraries forEndogenous Gene Regulation

Caren V. Lund, Pilar Blancafort, Mikhail Popkov andCarlos F. Barbas III*

The Skaggs Institute forChemical Biology andDepartment of MolecularBiology, The Scripps ResearchInstitute, 10550 North TorreyPines Road, La Jolla, CA 92037USA

Regulation of endogenous gene expression has been achieved usingsynthetic zinc finger proteins fused to activation or repression domains,zinc finger transcription factors (TFZFs). Two key aspects of selective generegulation using TFZFs are the accessibility of a zinc finger protein to itstarget DNA sequence and the interaction of the fused activation or repres-sion domain with endogenous proteins. Previous work has shown thatpredicting a biologically active binding site at which a TFZF can controlgene expression is not always straightforward. Here, we used a library ofpreassembled three-finger zinc finger proteins (ZFPs) displayed on fila-mentous phage, and selected for ZFPs that bound along a 1.4 kb promoterfragment of the human ErbB-2 gene. Following affinity selection by phagedisplay, 13 ZFPs were isolated and sequenced. Transcription factors wereprepared by fusion of the zinc finger proteins with a VP64 activationdomain or a KRAB repression domain and the transcriptional controlimposed by these TFZFs was evaluated using luciferase reporter assays.Endogenous gene regulation activity was studied following retroviraldelivery into A431 cells. Additional ZFP characterization includedDNase I footprinting to evaluate the integrity of each predicted pro-tein:DNA interaction. The most promising TFZFs able to both up-regulateand down-regulate ErbB-2 expression were extended to six-finger pro-teins. The increased affinity and refined specificity demonstrated by thesix-finger proteins provided reliable transcriptional control. As a result ofstudies with the six-finger proteins, the specific region of the promotermost accessible to transcriptional control by VP64-ZFP and KRAB-ZFPfusion proteins was elucidated and confirmed by DNase I footprinting,flow cytometric analysis and immunofluorescence. The ZFP phage displaylibrary strategy disclosed here, coupled with the growing availability ofgenome sequencing information, provides a route to identifying gene-regu-lating TFZFs without the prerequisite of well-defined promoter elements.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: phage display selection; zinc finger; gene regulation; ErbB-2;immunofluorescence*Corresponding author

Introduction

Transcription factors (TFs), mediator proteins,

and chromatin remodeling proteins associate withthe promoter regions of genes.1,2 The presence orabsence of these proteins determines the timing

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

Supplementary data associated with this article can be found at doi: 10.1016/j.jmb.2004.04.057

E-mail address of the corresponding author: [email protected]

Abbreviations used: TF, transcription factor; ZFP, zinc finger protein; TFZF, zinc finger transcription factor;UTR, untranslated region; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting;KRAB, Kruppel-associated box; HA, hema-glutinin; DAPI, 40,6-diamidino-2-phenylindole dihydro-chloride; P/PMR,polypurine/polypyrimidine mirror repeat; GFP, green fluorescent protein; VP64, tetrameric repeat of herpes simplexVP16’s minimal activation domain.

doi:10.1016/j.jmb.2004.04.057 J. Mol. Biol. (2004) 340, 599–613

and duration of gene transcription. One of themost common classes of TFs contains the DNA-binding zinc finger transcription factors.3,4 Inorder to impart artificial control on gene transcrip-tion, synthetic zinc finger proteins (ZFPs) havebeen engineered to bind specific DNA sequences.A subset of these engineered proteins (TFZFs) hasbeen shown to control endogenous geneexpression selectively when fused to activation orrepression domains.5 – 17 The prediction of success-ful target sites for TFZFs in endogenous promotershas been based on ZFP affinity, position within the50 untranslated region (UTR), and their locationwithin DNase I-hypersensitive regions.6 – 8,10 Appli-cation of these criteria, however, has not resultedconsistently in specific gene regulation. With theroles of endogenous TFs, mediator proteins, andchromatin remodeling proteins largely uncharac-terized for any given promoter, a more empiricalmethod of sampling binding sites across a pro-moter is required to achieve robust, imposed generegulation.

Synthetic ZFPs have been derived from theframework of naturally occurring zinc finger TFs,including Sp1 and the murine Zif268, which havethree zinc finger domains.5 The C2H2 zinc fingerdomain consists of an a helix packed against twoantiparallel b sheets and stabilized via coordinationof a zinc ion. The side-chains of amino acid resi-dues at the terminus of the b-sheet and continuinginto the a helix, constitute the DNA reading-headof the domain that is responsible for sequence-specific interaction with the DNA. A single zincfinger domain typically recognizes 3 bp of DNA,primarily through major groove interactions.Synthetic ZFPs typically consist of a repeat ofthree to six zinc finger domains, allowing theresulting polydactyl proteins to recognize DNAsequences of 9–18 bp. Transcription factors havebeen constructed by fusion of an activation orrepression domain to the ZFP, creating TFZFs.Naturally occurring activators and repressors, orvariants thereof, are commonly used with ZFPs,particularly the VP16 activation domain and theKruppel associated box (KRAB).5,18 – 20

The target of imposed gene regulation is notsimply DNA, but rather the three-dimensionallandscape of chromatin structure constructed fromDNA:protein interactions and protein:proteininteractions along a promoter. The linear sequenceof DNA provides little indication of a promoter’sdynamic topology. Eukaryotic gene promotersequences often stretch over many thousands ofbases, and include both positive and negativeregulatory elements. Genome-wide characteri-zation of promoters employing deletion constructs,linker scanning, computational TF binding siteanalyses, and TF isolation, is ongoing.21 – 25 Inaddition, experiments have begun to addressthe chromatin state of promoters, the locationof nucleosomes, and the nature of histonemodifications.26,27 In spite of this information, theunderstanding of the precise mechanism of tran-

scriptional control is far from complete for anypromoter.

Here, we have studied the application of phagedisplay to provide ZFP-based TFs that bindthroughout a given promoter sequence with theaim of applying these proteins to endogenousgene regulation. This strategy resulted in theidentification of a site at which a three-finger or asix-finger TFZF could provide regulation of ErbB-2expression in human epidermoid carcinoma A431cells. The site identified would not have been pre-dicted from the linear sequence of the promoter,known TF binding sites, or chromatin characteri-zation, suggesting that this approach can be usedto synthesize gene regulators without prior charac-terization of a target gene’s promoter.

Results

Phage display optimization and selectionagainst an ErbB-2 promoter fragment

Previous studies of zinc finger proteins usingphage display have focused on the selection ofzinc finger variants of altered specificity. Thesestudies have utilized short pieces of DNA as thetarget for selection, typically oligonucleotides thatpresent the 9 bp binding site for a three-fingerprotein.9,28 – 30 Our goal was to select zinc fingersthat bound optimally within a 1.4 kb promoterfragment. The phage display library used in thisstudy contained 9177 three-finger ZFPs, eachcapable of recognizing 9 bp of DNA. The construc-tion of the library was based on a combinatorialassembly of a subset of defined zinc-finger DNAsequences recognizing GNN, ANN and TNNtriplets.9,14,30,31 There were only a few TNNdomains available at the time of the library’sconstruction, so the library is biased towardsrecognition of RNN triplets, where R ¼ G orA. Theoretically, the double-stranded humangenome contains 750 million (RNN)3 sites.14 Inaddition, many promoters contain GNN-richregions of DNA, which makes the library particu-larly applicable to the isolation of promoter bind-ing proteins.32

As the length of the DNA target was far in excessof any used previously, we first evaluated theability of the previously established phage displayprotocol to recover ZFPs. A six-finger protein,E2C, with a dissociation constant of 0.75 nM foran 18 bp site in the ErbB-2 promoter (see Figure2), was used as a positive control.5 Using phageexpressing the six-finger protein E2C on its surface,test selections were done to compare the recoveryof E2C phage by a biotinylated 1.4 kb promoter ora biotinylated 18 bp hairpin oligonucleotide. Bothselections had the E2C phage diluted into controlphage bearing a different selective marker at aratio of 1:10,000. The 1.4 kb promoter DNA yielded90% fewer phage compared to the number ofphage recovered using the 18 bp oligonucleotide.

600 Phage Display Selection of Zinc Finger Transcription Factors

Panning conditions were subsequently optimized,and phage selection using E2C phage wasimproved to 85% relative to the phage recoveredwith the 18 bp oligonucleotide.

The library of preassembled three-finger proteinswas then selected over four rounds of panningusing the 1.4 kb ErbB-2 promoter fragment. Thefirst and second rounds of panning contained125 nM promoter DNA per binding reaction. Thethird and fourth rounds contained 62 nM and31 nM promoter DNA per binding reactionrespectively, to increase the stringency of selectionand to favor recovery of higher-affinity ZFPs. Theeffectiveness of each round of panning to selectZFPs specific for the target was initially evaluatedusing a phage enzyme-linked immunosorbentassay (ELISA) (Figure 1B). As a functional evalua-tion of the ZFPs recovered, DNA from each round

of panning was subcloned into a retroviral vectorand expressed as fusions with the activationdomain, VP64, which is a tetrameric repeat of theminimal activation domain of herpes simplexvirus VP16 activator protein.5,33 The ability of eachpool of proteins to activate ErbB-2 expression inA431 cells was evaluated using fluorescence-activated cell sorting (FACS) analysis (Figure 1C).The unselected library did show some activationof ErbB-2 expression. However, proteins selectedin subsequent rounds of phage display, particu-larly round 4, were more efficient activators ofendogenous gene expression.

Characterization of selected zinc finger proteins

ZFP clones from round 4 of panning wereselected for characterization. Five clones were

Figure 1. Phage display strategy with in vitro and in vivo characterization of the rounds. A, Using a 50-biotinylatedprimer, the promoter of interest was PCR-amplified and conjugated to streptavidin-coated magnetic beads. Incubationof the phage displaying a preassembled synthetic zinc finger protein library with target-coated beads providedrecovery of zinc finger proteins with binding sites in the promoter. Multiple rounds of selection were conducted withdecreasing amounts of promoter target to select for a narrowed pool of proteins with high binding affinities. B, PhageELISA analysis was used to determine the relative binding affinities of the unselected library (US) phage comparedto phage selected from four subsequent rounds of panning. Phage were amplified from each round of panning andincubated with biotinylated ErbB-2 promoter fragment immobilized on ELISA plates. Bound phage were detectedwith an anti-M13/horseradish peroxidase antibody conjugate. Fluorescence of activated ABTS (2,20-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) was detected at 405 nm and quantified by a microplate reader. The maximal signal ofround 2 was normalized to 1. C, Each round of panning was subcloned into a retroviral vector for expression as fusionproteins with VP64 in A431 cells. The ability of the zinc finger fusion proteins from each round to activate endogenousErbB-2 expression in A431 cells was monitored by FACS analysis. The tallest, dotted peak is A431 cells infected withstuffer DNA fused to VP64. The unselected library peak is the second tallest peak and is in bold. The third tallestpeak is round 1 represented with a thin line. The peaks for rounds 2, 3, and 4 overlap, and are shown with a singlebold line that is shifted furthest to the right.

Phage Display Selection of Zinc Finger Transcription Factors 601

initially sequenced and labeled 1A, 2A, 3A, 8A,and 9A. Subsequently, 25 more clones werescreened for binding to the biotinylated 1.4 kbErbB-2 promoter using an ELISA assay (data notshown). The clones with the best binding signalswere designated 2, 4, 5, 6, 8, 11, 13, and 16, andwere sequenced. On the basis of previous studies,the DNA sequence that each ZFP is predicted tobind is based on the amino acid sequence of eachdomain’s reading head.9,30 Table 1 lists the pre-dicted DNA-binding sequence for each ZFP andthe corresponding sites within the ErbB-2 promo-ter. Six of the ZFP proteins sequenced encodedpairs of identical sequence: 3A and 8, 4 and 11,and 5 and 13. Most of the proteins were predictedto bind with eight out of nine matches to sites inthe ErbB-2 promoter, while 8A, 9A, 6, and 8 haveperfect 9 bp matching sites in the promoterfragment.

Footprinting analysis of the zinc fingerproteins along the promoter

DNase I footprinting analysis was used to con-firm the binding of the selected ZFPs at their pre-dicted sites within the promoter DNA. ZFP1A and2A could not be purified in sufficient quantity forthese studies. The other zinc finger proteins werefootprinted on the fragment of DNA that containedthe predicted sites (only data for ZFP16 are shownin Figure 3). Each protein was titrated over a 100-

fold concentration range to confirm binding to thepredicted sites. The proteins bound their predictedsites within the promoter DNA with affinities thatranged from 1.0 nM to 88 nM (Table 1). Seven outof nine clones showed additional, lower-affinitybinding sites. None of the footprints observed forthe predicted sites extended outside the expected9 bp region by more than 3 bp, indicating themaltose-binding protein fused to each ZFP for pro-tein purification did not interfere with the bindingsite analyses. For each footprint, the predictedbinding site of each ZFP is marked with a lower-case letter. Proximal to site 2285 is the poly-purine/polypyridmidine repeat region (P/PMR)of the ErbB-2 promoter. The P/PMR region is aGNN-rich region of DNA that is located within aDNase I-hypersensitive region of the ErbB-2 pro-moter between the CCAAT and TATAA boxes.34,35

Transfection and retroviral infection of zincfinger transcription factors

In order to study the potential of each ofthe selected ZFPs for gene regulation, the genesencoding them were transferred into mammalianexpression vectors and expressed as fusions withthe VP64 activation domain. The ability of theresulting transcription factors to activate a lucifer-ase reporter gene driven by the 1.4 kb ErbB-2 pro-moter was studied in A431 cells (Table 2). TFZFs1A and 11 showed the highest level of activation,

Figure 2. A representation of the ErbB-2 promoter fragment, 21440 to þ1. The ErbB-2 promoter fragment is sepa-rated into three 480 bp regions. Two sections of region 3 (sub-regions 3A and 3B) are magnified to show the bindingsites of the proximal ZFPs. Binding sites of the 3Fn-ZFPs listed in Table 1 are indicated along with the associated pro-moter sequence (50-30). Open arrowheads designate binding sites of transcription factors, AP-2, p300, Sp1, adenovirus5 E1A and Ets binding site (EBS), that have been characterized in ErbB-2 gene regulation.35,45,46,55,56 The CCAAT andTATAA sites are marked with hatched rectangles to represent the boundaries of the DNase I hypersensitive region ofthe ErbB-2 promoter.34


with 52.6-fold and 47.4-fold increases in luciferaseexpression over expression of luciferase in theabsence of a transiently expressed transcriptionfactor. TFZFs 2, 6, and 8 displayed less than twofoldactivation, while the level of activation derivedfrom TFZFs 2A, 8A, 9A, 13, and 16 ranged from3.2-fold to 15.2-fold. Initially, the various affinitiesderived from footprinting analysis (Table 1) werecompared with activation of a luciferase reporterconstruct (Table 2). The TFZFs with affinities stron-ger than 52 nM generated at least fivefold acti-

vation of luciferase expression. Considering TFZFs11 and 13, whose affinities were determined to besimilar for the same region of DNA, their acti-vation of luciferase expression was 47-fold versus5.8-fold, respectively. Therefore, there was no strictcorrelation between stronger affinity and greateractivation. This may be due, in part, to the multi-plicity of binding sites available to a three-fingerprotein in the 1.4 kb target region and elsewherein the cell. However, the inability of transient trans-fection reporter assays to correlate activation with

Figure 3. DNase I footprinting analysis of ZFP16 and three six-finger proteins –642, –369 and –285. Storage phos-phor autoradiograms of DNase I footprint titrations analyzed on 8 M urea/6% (w/v) polyacrylamide gels. For eachgel: lane 1 (–) is the DNA fragment without digestion; lane 2 is the G þ A ladder (L); lane 3, DNase I digestion of thelabeled fragment without protein (D); lanes 4–10 contain 100 nM, 50 nM, 20 nM, 10 nM, 5 nM, 2 nM, 1 nM purifiedZFP incubated with the DNA fragment. The location of the predicted binding sites are indicated to the right of eachgel with lower-case letters. All reactions contained 15,000 cpm of 32P end-labeled PCR fragment. Kd values are calcu-lated as described.54


affinity or, more importantly, predict endogenousregulation, has been observed with other three-finger TFZFs.7 Therefore, the activity of thetranscription factors on the endogenous gene wasstudied.

The ability of the TFZFs to activate or repressendogenous ErbB-2 expression was studied usingretroviral delivery of the transcription factors intocells. The retroviral vector pMX, which contains atranscription factor expression cassette linked toan internal ribosome entry sequence (IRES) fusedto the coding sequence of green fluorescent protein(GFP), was used for these studies. 53GFP expressionfrom this construct is then correlated with tran-scription factor activity. Immunofluorescencestudies were used to confirm the nuclearexpression of zinc finger proteins and the cyto-plasmic expression of GFP in retrovirally infectedA431 cells.

Table 2 lists the values for activation and repres-sion levels obtained with each TFZF. Transcriptionalactivation was studied using VP64, and repressionwas studied using the Kox-1 Kruppel-associatedbox (KRAB) domain.5,6,19 Six TFZFs had greaterthan twofold activation of endogenous ErbB-2expression in A431 cells. TFZFs 1A and 16 enhancedexpression 5.2-fold and 4.8-fold, respectively,relative to cells transduced with control virus. Incontrast, only two of the ten TFZFs were able torepress ErbB-2 expression greater than twofold:2A with 2.2-fold repression, and 16 with 7.1-foldrepression. Figure 4(a–d) presents the FACS pro-files of the two best activating (1A and 16) andrepressing (2A and 16) TFZFs. Only 16 was able toboth up and down-regulate ErbB-2 expression.The six proteins that showed activation or repres-sion of ErbB-2 expression had predicted binding

sites within a GNN-rich region of DNA charac-terized previously as a P/PMR mirror repeat.35

The P/PMR region can form a triple helix andprevent binding of endogenous TFs adjacent tothe neighboring TATAA box.35,36 The P/PMRregion has been characterized to have an increasedlevel of chromatin-relaxing proteins associatedwith it in cell-lines expressing high levels ofErbB-2, compared to cells with low-level ErbB-2expression.37 Considering the substantial level ofErbB-2 expression in A431 cells, the P/PMR regionwould be expected to be an accessible region ofbinding. The inability of the same ZFP to provideboth up and down-regulation, depending on thefused effector domain, in spite of being in a pre-sumably accessible region of DNA, supportsthe hypothesis that the topology of a promotervaries from position to position, depending onendogenous factors.

With the predicted binding sites and functionaldata collected, we were surprised to find thatTFZF9A and TFZF16 did not share the same tran-scriptional control profiles. Both ZFP9A andZFP16 are predicted to bind at site 2369, with 9Abeing a perfect match. While TFZF16 is able to bothup-regulate and down-regulate ErbB-2 expressionrobustly, TFZF9A up-regulates ErbB-2 expressiononly moderately. Studies are ongoing to determineif subtle differences in binding between these twoproteins explains their differences in regulation.

Affinity of ZFP16 for its three potentialbinding sites

Since TFZF16 was differentiated by its ability toboth up-regulate and down-regulate, we sought todetermine which of its three potential binding

Table 1. Selected sequences and their position in the ErbB-2 promoter used

Zinc finger protein Predicted DNA recognition Times selected Binding sites in promoter Affinity (nM)

3Fn 1A TAG GAG GTG 1 237 ND3Fn-2A GAG GCG GTG 1 237 ND3Fn-8A GAG AAG GAG 1 341 ND

243 8.9 ^ 3.8237a 4.6 ^ 1.4228 3.6 ^ 1.2

3Fn-9A TAG GAG GGA 1 369 ND3Fn-2 GGA GCG GAT 1 – ND3Fn-6 GGG GCA GAG 1 454 88.0 ^ 583Fn-8 GAG GCG GGA 2 1014 ND

878 ND3Fn-11 GAG GAG AAG 2 416 ND

246 3.9 ^ 1.6237a 1.0 ^ 0.3228 1.2 ^ 0.3

3Fn-13 GCG GAG GAG 2 231 5.1 ^ 1.8228 4.3 ^ 2.0

3Fn-16 TAG GAG GGG 1 642 2.9 ^ 0.6369 51.6 ^ 29284 5.9 ^ 1.8

The three finger (3Fn) ZFP proteins used in this work are listed with their predicted binding sites, the recognition sequencespredicted for each ZFP (50-30), the number of times each binding motif was identified, the location of each predicted binding site inthe promoter target, and the corresponding affinity of the ZFPs at the predicted sites.

a Sites that were observed in DNase I footprinting experiments and for which associated affinities are included.


sites within the ErbB-2 promoter sequences (Table1) was responsible for the biological phenotype.The prediction of the biologically relevant site wasfirst addressed by determining the affinity ofZFP16 for each of the three sites. Figure 3 shows

the DNase I footprinting for each DNA:ZFP inter-action site. Three independent binding reactionswere used to calculate Kd values. DNase I footprintanalysis of ZFP16 bound on the fragment con-taining site 2642 (Figure 3 panel a) shows one

Figure 4. FACS analysis and immunofluorescence of A431 cells transduced with zinc finger fusion proteins.a–d, FACS profiles are shown for cells transduced with the fusion proteins that displayed activation and repression ofendogenous ErbB-2 expression. Black indicates the staining of A431 cells with IgG1 isotype control antibody, blue isthe level of ErbB-2 expression in cells transduced with a stuffer fragment, and red is the level of ErbB-2 expression asa result of transduction with the fusion protein expression construct indicated in each panel. e–l, Maximal projectionsof 3D datasets show the total cellular distribution of TFZF (g and k). A431 cells were transduced with TFZF 16K (i–l) andcontrol StufferK (e–h). The top panels show A431 nuclei in blue; the upper middle panels show GFP in green; thelower middle panels show TFZF in red; and the bottom panels show merge signals of TFZF (red), GFP (green), andnuclei (blue). TFZF localization in nuclei was observed in TFZF 16K-transduced cells (l). No TFZF was detected incontrol, StufferK-tranduced A431 (h).


binding site that extends over the sequence50-GGGGAGGAA-30. The affinity of ZFP16 for thissite was determined to be 2.9 (^0.6) nM. ZFP16was also predicted to bind a site at 2369. Footprintanalysis of ZFP16 on a 189 bp fragment containingthe 2369 binding site showed binding of ZFP16 attwo regions. The predicted binding site on thisfragment at 2369 was 50-TAGGAGGGA-30 andthe associated affinity was determined to be 51.6(^29) nM. ZFP16 also bound a second site withseven out of nine matches to the promotersequence: 50-GGGGAGGGG-30. The affinity ofZFP16 for this site was not determined. The thirdpredicted binding site for ZFP16 was site 2285.The binding site extended over the predictedbinding sequence, 50-TTGGAGGGG-30, with anassociated affinity of 5.9 (^1.8) nM. Additionalbinding sites were found between positions 2243and 2218 that included three adjacent sites, eachwith seven out of nine matches with ZFP16’spredicted DNA recognition:

50-GAGAAGGAGGAGGTGGAGGAGGAGGGCT-30.

In vitro and in vivo characterization of threesix-finger proteins for specific regulation ofErbB-2

In order to determine the biologically relevantsite for TFZF16, three six-finger proteins were con-structed; 6Fn-642, 6Fn-369 and 6Fn-285. Six-fingerproteins recognize 18 bp of DNA and weredesigned to bind each of ZFP16’s three predictedsites independently. The six-finger proteins werecharacterized by sequencing, by evaluation ofbinding to oligonucleotides displaying the targetsequence, and by DNase I footprinting. Figure 3d

shows the DNase I footprinting analysis of6Fn-642 on a 180 bp fragment containing the pre-dicted site. The site bound is 50-CACATCCCCCTCCTTGA-30. Figure 3e is the DNase I footprintof 6Fn-369 on a 189 bp fragment at the site 50-GGCGCTAGGAGGGACG-30. Figure 3f is theDNase I footprint of 6Fn-285 on a 165 bp fragmentat the site 50-CGTCAACCTCCCCCGCTC-30. Theaffinities of 6Fn-642, 6Fn-369 and 6Fn-285 for theirrespective sites were 4.8 (^1.1) nM, 4.8 (^1.3) nM,and 9.5 (^4.8) nM. It was interesting to findthat two of the three six-finger proteins had loweraffinities for the same target sites as their three-finger counterpart, ZFP16. Typically, six-fingerproteins are associated with higher affinity.5,20,38

To evaluate the biological effect of retroviralexpression of each of the six-finger proteins fusedto activation or repression domains, cell-surfaceexpression of ErbB-2 was monitored by FACSanalysis. Each of the constructs was infected intoA431 cells in two independent experiments andthe resulting up-regulation and down-regulationprofiles of each are illustrated in Figure 5. 6Fn-285showed no ability to up-regulate or down-regulateErbB-2 expression in A431 cells, 6Fn-642 couldslightly down-regulate ErbB-2 expression, and6Fn-369 was able to up-regulate and down-regulateErbB-2 expression approximately tenfold frombasal expression levels. DNase I footprint analysisshowed that 6Fn-369, with an affinity of 4.8 nMfor site 2369, does not bind at sites 2285 or 2642with equal or better affinity (data not shown).

Immunofluorescence studies included A431 cellstransduced to express the three-finger proteinZFP16 fused to KRAB (ZFP16K), the six-finger pro-tein 6Fn-369 fused to KRAB (6F3K), and cells

Figure 5. FACS analysis of six finger proteins 2642, 2369 and 2285. Flow cytometric analyses of ErbB-2 expressionin cells retrovirally transduced with the six different fusion proteins are indicated. Two days after transduction, cellswere stained with the ErbB-2 specific antibody TA-1 in combination with Cy5-labeled secondary antibody. The brokenline represents transduced cells stained with IgG1 isotype control antibody, the thin line represents ErbB-2 expressionof cells transduced with stuffer DNA, and the bold line is ErbB-2 expression as a result of TFZF transduction.


Figure 6. TFZF and ErbB-2 visualization on A431. Maximal projections of 3D datasets show the total cellular distri-bution of ErbB-2 (d and f) and TFZF (g–i). A431 cells were transduced with the following fusion proteins: ZFP16K(a, d, g, and j), 6Fn-369K (b, e, h, and k), and control StufferK (c, f, i, and l). The top panels show nuclei in blue; theupper middle panels show ErbB-2 receptor in green; the lower middle panels show ZFP in red; and the bottompanels show merge signals of TFZF (red), ErbB-2 (green), and nuclei (blue). TFZF localization in nuclei was observedin ZFP16K-transduced and 6Fn3K-transduced cells, and correlated with ErbB-2 down-regulation (j and k). No ZFPwas detected in control Stuffer-transduced A431 (l).


transduced with a negative control DNA fragmentfused to KRAB (StufferK) (Figure 6). Immunofluor-escence studies confirmed the down-regulation ofcell surface ErbB-2 expression shown by FACSanalysis of ZFP16-KRAB and 6Fn369-KRAB(Figure 6d and e versus f). Immunofluorescencestudies also showed a correlation of TFZFexpression of ErbB-2 (Figure 6j and k versus l). Thebottom three panels of Figure 6 have correspond-ing movies in Supplementary Material.

Discussion

Previous guidelines for the selection of TFZFs forcontrol of endogenous gene expression haveincluded affinity, proximity to transcription startsites, and proximity to DNase I hypersensitiveregions in cellular chromatin.5 – 8,10 None of theseparameters have proven to be absolute rules forsuccessful, specific gene regulation. With the rolesof endogenous TFs, mediator proteins, and chro-matin remodeling proteins largely uncharacterizedfor any given promoter, an empirical method ofsampling different binding sites is needed. Theavailability of the phage display library used inthis work, coupled with the growing availabilityof genome sequencing information, allowed us toidentify gene-regulating TFZFs without the needfor a well-characterized promoter, or a detailedzinc finger assembly strategy. Here, we describeisolation of ZFPs that bind along the ErbB-2 pro-moter, and characterize the ability of the selectedzinc finger fusion proteins to up-regulate ordown-regulate endogenous ErbB-2 expression inhuman epidermoid carcinoma A431 cells.

Phage display provided means for selectingZFPs with high affinity for the binding sites pro-vided by a 1.4 kb ErbB-2 promoter fragment.In previous work, protein:DNA affinity was con-sidered a key requirement for achieving generegulation with a synthetic transcription factorsuch as a TFZF. With more examples of endogenousgene regulation by TFZFs available, the data indi-cate that the position of targeting is as importantas affinity. For example, six-finger proteins pE2X,pE3Y and pE3Z were designed to regulate ErbB-2and ErbB-3 expression.9 Only pE3Y both up-regu-lated and down-regulated ErbB-3 expression, andyet all three proteins had DNA-binding affinitiesof ,10 nM. Similarly, only one of three TFZFstargeted to the erythropoietin (EPO) promoter up-regulated EPO transcription, and only three of tenTFZFs were able to up-regulate VEGF-A secretion,despite all these ZFPs having dissociationconstants of ,10 nM.7,8 The minimum affinityrequired for a ZFP to function as an effective TFZF

amongst endogenous factors is not known. Theo-retically, this value would vary depending on theaccessibility of a binding site(s), the number ofbinding sites, and the position of the bindingsite(s) amongst promoter-associated proteins. Theadvantage of using the phage display method is

that ZFPs can be isolated that bind various regionsof the promoter and with a range of affinities. Theresulting pool of proteins is screened to identifythe combination of position and affinity that pro-vides transcriptional control of the target gene.Here, the most successful TFZF had a dissociationconstant of 52 nM for the biologically relevant tar-get site, an affinity much lower than would beexpected. However, the affinity of a ZFP for thissite was improved to 4.8 nM with assembly of asix-finger protein. Therefore, even if the affinitythat the phage display screen provides is notoptimal, if function is demonstrated, an extendedZFP can typically improve the affinity.5,6,20,39

The lack of a strict correlation between affinityand transcriptional regulation using TFZFs hasbeen acknowledged in the field. Investigation ofthe role of chromatin structure as it effects TFZF tar-geting is ongoing.40,41 One method of determiningthe accessible regions of chromatin-associatedDNA, is DNase I-hypersensitive site mapping. Theidentification of a hypersensitive region was avaluable approach in the targeting of VEGF-A.42

However, the same approach in the design ofTFZFs selective for PPARg2 regulation provideddiffering levels and extents of regulation of bothof the PPARg isoforms, g1 and g2.10 In the targetingof the EPO gene, there was no hypersensitive siteassociated with site 2862, although additionalcharacterization indicated proximity of the site toa positioned nucleosome.7 In this study, 6Fn-369was able to up-regulate and down-regulate ErbB-2expression, and did not map within the DNase I-hypersensitive region of the ErbB-2 promoter. Ofthe six TFZFs that showed binding in the hyper-sensitive region by DNase I footprinting analysis,three showed activation of ErbB-2 expression, oneshowed repression of ErbB-2 expression, and onewas unable to modulate the transcription of ErbB-2 in either direction. The inconsistency of targetingbased on hypersensitive regions and the incom-plete characterization of chromatin structure formany promoters, supports the use of an empiricalmethod, without biases, to target TFZFs as providedby phage display and a given linear DNA sequence.

Retroviral expression of each selected ZFP as afusion protein with an activation or repressiondomain was assessed by FACS analysis of ErbB-2.The most significant finding from the FACS datawas that activation and repression of ErbB-2expression were not usually accessible from thesame DNA-binding domain. For example, TFZF11was able to up-regulate, but not down-regulateErbB-2 expression. Considering that both fusionproteins had the same DNA-binding domain, theup-regulation data suggests that the DNA-bindingdomain was able to bind the DNA of the promoterin the context of cellular chromatin. Therefore, theinability of TFZFs 1A, 2A, 8A, 9A or 11 to effecttranscriptional control of ErbB-2 is hypothesized tobe associated with the proteins recruited by KRABor VP64 that were unable to form a functional unitor, if the functional unit was assembled, was


unable to modify the promoter’s transcriptionalprogram.18,43 By sampling different sites along apromoter, sites amenable to VP64 and KRABassembly and function can be elucidated to pro-vide gene regulation. Site 2369 was a site fromwhich activation and repression could be coordi-nated. In the context of the ErbB-2 promoter, site2369 lies 20 bp from an upstream AP-2 bindingsite and 20 bp from a downstream p300 bindingsite. The AP-2 site acts in coordination with anupstream AP-2 site to activate ErbB-2 expressionin breast cancer cells.44 AP-2 activation can becountered by an estrogen-suppressible enhancer inthe first intron of the ErbB-2 gene.45 Binding ofp300 in the ErbB-2 promoter provides a target forthe adenovirus 5 E1A mediated repression ofErbB-2, which is in clinical trials for breast cancertreatment.46,47 Considering the characterization ofendogenous factors for the ErbB-2 promoter, site2369 is in proximity to regions accessible for therecruitment of activation and repression mediatorproteins.

Once a successful three-finger TFZF was iden-tified, it was unclear which of ZFP16’s three poten-tial binding sites was biologically relevant, or ifbinding at all three sites contributed to the tran-scriptional regulation observed. Six-finger fusionproteins, which have extended recognition of18 bp of DNA, were designed to bind inde-pendently at each of TFZF16’s best match sites toevaluate transcriptional regulation derived fromeach site. Even before ZFPs were described, von-Hippel’s study of transcription factors and nucleo-tide sequence recognized that binding of extendedsequences would increase the information contentof a DNA-binding protein and reduce binding toother DNA sites.48 This theory is supported by theDNase I footprint analysis of the six-finger proteinsassembled for this study. Figure 3d–f shows thatonly one 18 bp site was bound by each of thesix-finger proteins on the fragments footprinted.This is in contrast to the upper panels of Figure 3that show cross-reactive binding of the three-fingerprotein, ZFP16, outside of the region labeled as thebest match site on each DNA fragment. Cross-reac-tivity of the three-finger ZFPs was most extensivein the P/PMR region that contains nine consecu-tive GNN triplets. Although the footprinting datawere used to confirm the ability of the phage dis-play selection method to isolate ZFPs that couldbe associated with sites in the promoter fragment,the footprinting analysis provided valuable insightinto the type of recognition provided by three-finger proteins versus six-finger proteins. Thesubtlety of amino acid interactions within the ZFPprotein structure as well as in proximity to DNA,continues to be an area of study for the zinc fingerfield.49 DNase I footprinting presents a ZFP with abiologically relevant diversity of binding sites notrepresented by specificity ELISAs, gel mobility-shift assays, CAST assays, or available microarraychips.38,50,51 While statistics predict a 9 bp perfectmatch site for a given ZFP should be once every

2.6 £ 105 bp,50 this is an underestimate of the poten-tial binding sites given the binding of eight out of9 bp, or seven out of 9 bp match sites with affinities,100 nM as observed here. Taking into consider-ation this degeneracy, by increasing the number ofcontacts needed to provide a minimum thresholdof binding affinity, the importance of using six-finger proteins for specific gene regulation isemphasized.

Phage display for the selection of TFZFs hasmany advantages. First, the investigation is notlimited to sites that fit the guidelines previouslyused for the selection of TFZF binding sites. Second,the method provides TFZFs more rapidly than byindividual construction and testing. Finally, thisempirical approach requires only the preassembledlibrary of ZFPs and a linear sequence of DNA toallow selection. Our application of this approachhas resulted in the successful regulation of thehuman ErbB-2 promoter. An advantage of usingphage display is that each round of panning canbe tested in various cell lines to determine whichpool of TFZFs is amenable to transcriptional regu-lation in a particular cell type. We suggest thatthis strategy holds potential for the rapid prepa-ration of transcription factors for the characteri-zation of genes and for therapeutic application viagene therapy.

Materials and Methods

Selection by phage display

Construction of zinc finger libraries has been

Table 2. Luciferase reporter activation by TFZFs and retro-viral transduction mediated activation and repression ofendogenous ErbB-2 expression by ZFPs

Zinc fingerprotein(ZFP)

Luciferasereporter assay

Retroviral transductionFoldactivation

Foldrepression

1A 52.6 ^ 4.4 5.2 ^ 2.5 –2A 5.6 ^ 3.1 – 2.2 ^ 0.238A 15.2 ^ 10.2 2.9 ^ 2.1 –9A 3.2 ^ 0.7 3.2 ^ 1.2 –2 0.55 ^ 0.2 – –6 1.85 ^ 0.13 – –8 1.63 ^ 0.21 – –11 47.4 ^ 15.2 3.1 ^ 2.0 –13 5.8 ^ 1.0 – –16 10.9 ^ 2.1 4.8 ^ 0.84 10.7 ^ 3.6

A431 cells were cotransfected with each TFZF listed and anErbB-2 promoter-luciferase reporter construct.5 Luciferaseactivity in total cell extracts was measured 48 hours after trans-fection. Fold activation and standard deviation are derivedfrom triplicate measurements. Fold activation and repression ofthe endogenous ErbB-2 promoter were evaluated in A431 cellsusing FACS analysis following retroviral expression of eachTFZF listed. Two independent transductions were used to deter-mine the fold activation and repression from basal ErbB-2expression levels and the corresponding standard deviationvalues.


described.14 PCR-generated libraries were subcloned inpComb3H and amplified. Growth and precipitation ofphage were as described.30 Streptavidin-coated magneticbeads (Dynal) were optimized to bind the 1.4 kb target(0.05 mg target/ml beads). The beads were washed fourtimes with zinc buffer A (ZBA) (10 mM Tris, 90 mMKCl, 1 mM MgCl2, 90 mM ZnCl2), 5 mM DTT and oncewith ZBA, 5 mM DTT, 5% (w/v) non-fat dry milk. Targetwas prepared in ZBA, 5 mM DTT, 5% non-fat dry milk,1 M NaCl, added to the washed beads, and incubatedfor one hour at 37 8C on a rotating wheel. After incu-bation, beads were washed once with ZBA, 5 mM DTT,5% non-fat dry milk. Then 100 ml of filtered phage (1013

colony-forming units), 100 ml of ZBA, 5 mM DTT, 5%Blotto, 4 mg of sheared herring sperm DNA (Sigma),294 ml of ZBA and 2.5 ml of 1 M DTT were added to thebeads and the samples were incubated for three hoursat room temperature on a rotating wheel.

Phage ELISA

Phage ELISA was performed as described.52

Luciferase assays

Luciferase assays were performed as described,5

except that A431 cells were used.

Antibodies

ErbB-2 expression was detected using TA-1 antibody(Calbiochem). Control staining was done using mouseF(ab0)2 IgG1-UNLB (SouthernBiotech). The secondaryantibody for both was Cy5-labeled, affinity-purified don-key F(ab0)2 anti-mouse IgG (Jackson ImmunoResearch).

Retroviral gene targeting

For retroviral expression of the three-finger and six-finger proteins, the zinc finger-KRAB and zinc finger-VP64 coding regions were cloned into a modifiedpMX-IRES-GFP53 using SfiI restriction sites (IRES,internal ribosome-entry site; GFP, green fluorescent pro-tein). As a control for the retroviral infection, a constructcontaining a stuffer fragment of DNA inserted at the Sfisites was prepared. The stuffer sequence coded for asingle-chain Fab modified with stop codons that preventexpression. The retroviral pMX-IRES-GFP/zinc fingerconstructs were transiently transfected into the packa-ging cell line 293 gag/pols6 by using LipofectaminePlus (GIBCO/BRL). Three hours after transfection themedium was changed to 6 ml of fresh DMEM with 10%(v/v) fetal calf serum (FCS) and penicillin/strepto-mycin/anti-mycotic antibiotics. Approximately 42 hourslater, culture supernatants were used for infection oftarget cells in the presence of 8 mg/ml of Polybrene.Four infections were performed, the first after 42 hoursof transfection, then 50, 66 and 74 hours following trans-fection. At 90 hours post-transfection, the mediumwaschanged to 10 ml of fresh DMEM, 10% FCS, antibiotics.One week from the start of the transfection the cellswere harvested for analysis.

Flow cytometric analysis

Cells were trypsinized and washed in FACS buffer(PBS, 1 mM EDTA, 25 mM Hepes (pH 7.0), 1% (w/v)

BSA) prior to staining. Two wells for each sample wereprepared with 105 cells; one received 5 mg/ml of TA-1antibody and the other 5 mg/ml of IgG1 control antibodyin 100 ml of FACS buffer. After incubation on ice for onehour, cells were washed twice in FACS buffer. Boundantibodies were stained with Cy5-labeled donkey anti-mouse secondary antibody in 100 ml of a 1:100 (v/v)dilution in FACS buffer. Finally, the cells were washedtwice in FACS buffer, resuspended in 500 ml of FACSbuffer, and analyzed for their fluorescence with a BectonDickinson FACSort.

Fold activation and repression were calculated based ongating the GFP-positive population (examples shown inFigure 4a–d). From the GFP-gated profiles, the geometricmean value for the center of the peak derived from the pro-tein expression as a result of TFZF infection (in Figure 4a–dthis peak is red) and the geometric mean value forthe center of the peak derived from cells transducedwith a stuffer DNA fragment fused to VP64 or KRAB(Figure 4a–d, the blue peak) were calculated using Cell-Quest software. To calculate fold activation, the TFZF

derived peak value (red) was divided by the basalexpression peak (blue). For fold repression, the basalexpression peak (blue) was divided by the TFZF-derivedpeak (red).

Construction and characterization of thesix-finger proteins

For the construction of the six-finger proteins, twothree-finger proteins binding each of the 9 bp half-sitesof each of the three 18 bp target sequences were con-structed by grafting the appropriate DNA recognitionhelices into the framework of the three-finger proteinSp1C. DNA fragments encoding the two three-fingerproteins were assembled from six overlapping oligonu-cleotides as described.5 The oligonucleotides used werebased on DNA recognition helices characterized fromfinger 2 variants of Zif268.9,30 6Fn-654 was designed to bind50-GTCAAGGAGGGGGATGTG-30 and was assembledfrom domains pGTC, pAAG, pmGAG, pmGGG, pGATand GTG. 6Fn-369 was designed to bind 50-GGCGCTAGGAGGGACGAC-30 and was assembled from domainspmGGC, pmGCT, pAGG (t), pAGG (j), pmGAC andpmGAC. 6Fn-275 was designed to bind 50-GCAGTTGGAGGGGGCGAG-30 and was assembled from domainspGCA, pmGTT, GGA, pmGGG, pmGGC, pmGAG.

Purification and footprinting

Zinc finger-coding DNA was subcloned into a modi-fied pMAL-c2 (New England Biolabs) bacterialexpression vector and transformed into XL-1 Blue(Stratagene). Protein was purified using the ProteinFusion and Purification System (New England Biolabs)following the manufacturer’s protocol, except thatZBA/5 mM DTT was used as the column buffer. Proteinpurity was determined by staining 4%–12% Novex gelswith Coomassie brilliant blue. The protein concentrationwas determined by Bradford assay with bovine serumalbumin (BSA) standards. The radiolabeled DNA frag-ments were generated by PCR using the human ErbB-2promoter cloned into pGL35 with High Fidelity PCRMaster (Roche) with 60 pmol of the following (50-32P)-labeled primers (designated with an F) and 30 primers(designated with a B):

342F (GCATTTTGAAGAATTGAGATAGAAGTCTTTTTGGG)


(GGATTACAGGCATGTGCCACCATGACC)450F (GGAGTTCAAGACCAGCCTCACCAACGTGG

AGAACC)(GCTCTTGTTGCCCAGGCTGGAGAGC)(CCAAATTTGTAGACCCTCTTAAGATCATGC)(CCAAGCCTATTTGTTTTAATATCAAATAATGG)(CCTGAGACTTAAAAGGGTGTTAAGAGTGGCAGC)1110B (GCTTCACTTTCTCCCTCTCTTCGC)(CCTAGGGAATTTATCCCGGACTCC)1150B (CGAAGTCTGGGAGTCGGCAACTCC)1090F (GCGAAGAGAGGGAGAAAGTGAAGC)1270B (GCTTCACAACTTCATTCTTATACTTCC)Buffer for PCR with all primers except 1270 and 1150

included 10% (v/v) DMSO The PCR program was twominutes at 94 8C, (30 seconds at 94 8C, 30 s at 55 8C, 30seconds at 72 8C) for 30 cycles, seven minutes at 72 8C,then 4 8C. The footprinting assay was carried out intriplicate as described.54 The 5 £ TKMC buffer (50 mMTris–HCl (pH 7.0), 50 mM KCl, 50 mM MgCl2, 25 mMCaCl2,) was supplemented with 50 mM ZnCl2 and5 mM DTT was added fresh to the binding reactionsEquilibrations were incubated for 12–18 hours at 4 8Cor for one hour at 37 8C and were subsequentlydigested with 13 ml of a 0.00012 unit/ml solution ofDNase I, 1 mM DTT (Roche Diagnostics) Samples wereelectrophoresed through an 8 M urea/6% poly-acrylamidegel The gels were exposed on phosphorimagerplates, recorded by a PhosphorImager SI (MolecularDynamics), and subsequently analyzed using Image-Quant (Molecular Dynamics) and KaleidaGraphsoftware (Synergy, Reading, PA) to give Kd values asdescribed.54

Immunocytochemical analysis of TFZF localization

For analysis of TFZF expression in transduced A431cells (TFZFs ZFP16K and 6Fn3K), cells were seeded onpoly(L-lysine)-coated Lab-Tek coverglasses and incu-bated for 30 minutes. Cells were washed with copiousamounts of PBS, incubated with 4% (v/v) paraformalde-hyde for 20 minutes, washed again, and incubated in ahumidifying chamber at room temperature for one hourwith a mixture of biotinylated rat anti-HA mAb (2 mg/ml, Roche Diagnostics, Indianapolis, IN) and rabbit anti-human ErbB-2 polyclonal antibody (5 mg/ml, Calbio-chem, La Jolla, CA) in FACS buffer, 0.1% (w/v) saponin.The cells were then stained for one hour at room tem-perature with the mixture of Cy5-conjugated donkeyanti-rabbit IgG polyclonal antibodies and Streptavidin/rhodamine Red-X (both from Jackson Immunoresearch,West Grove, PA) diluted 1:100 (v/v) in FACS buffer,0.1% (w/v) saponin. Finally, the cells were incubatedwith 40,6-diamidino-2-phenylindole dihydrochloride(DAPI) solution for five minutes, washed with PBS, andcovered with SlowFade Antifade reagent. Four-color(DAPI, GFP, rhodamine Red-X, and Cy5) three-dimen-sional datasets were collected with a DeltaVision system(Applied Precision, Issaquah, WA). Exposure timeswere 0.2–0.5 s (2-binning), and images were obtainedwith either 60 £ or 100 £ magnification oil objectives.Three-dimensional reconstruction was generated bycapturing 150 nm serial sections along the z-axis.Images were deconvolved (based on the Agard-Sadatinverse matrix algorithm) and analyzed with softWorXVersion 2.5.

Acknowledgements

The authors thank Joel Gottesfeld, ChristianMelander and David Segal for their invaluableassistance. This work was supported by theUS National Institutes of Health CA86258 andDK61803. C.V.L. is a Skaggs Predoctoral Fellow.

References

1. Levine, M. & Tjian, R. (2003). Transcription regu-lation and animal diversity. Nature, 424, 147–151.

2. Wray, G. A., Hahn, M. W., Abouheif, E., Balhoff, J. P.,Pizer, M., Rockman, M. V. & Romano, L. A. (2003).The evolution of transcriptional regulation ineukaryotes. Mol. Biol. Evol. 20, 1377–1419.

3. Tupler, R., Perini, G. & Green, M. R. (2001). Expres-sing the human genome. Nature, 409, 832–833.

4. Iuchi, S. (2001). Three classes of C2H2 zinc fingerproteins. Cell. Mol. Life Sci. 58, 625–635.

5. Beerli, R. R., Segal, D. J., Dreier, B. & Barbas, C. F.,3rd (1998). Toward controlling gene expression atwill: specific regulation of the erbB-2/HER-2 pro-moter by using polydactyl zinc finger proteins con-structed from modular building blocks. Proc. NatlAcad. Sci. USA, 95, 14628–14633.

6. Beerli, R. R., Dreier, B. & Barbas, C. F., 3rd (2000).Positive and negative regulation of endogenousgenes by designed transcription factors. Proc. NatlAcad. Sci. USA, 97, 1495–1500.

7. Zhang, L., Spratt, S. K., Liu, Q., Johnstone, B., Qi, H.,Raschke, E. E. et al. (2000). Synthetic zinc finger tran-scription factor action at an endogenous chromo-somal site. Activation of the human erythropoietingene. J. Biol. Chem. 275, 33850–33860.

8. Liu, P. Q., Rebar, E. J., Zhang, L., Liu, Q., Jamieson,A. C., Liang, Y. et al. (2001). Regulation of anendogenous locus using a panel of designed zinc fin-ger proteins targeted to accessible chromatin regions.Activation of vascular endothelial growth factor A.J. Biol. Chem. 276, 11323–11334.

9. Dreier, B., Beerli, R. R., Segal, D. J., Flippin, J. D. &Barbas, C. F., 3rd (2001). Development of zinc fingerdomains for recognition of the 50-ANN-30 family ofDNA sequences and their use in the constructionof artificial transcription factors. J. Biol. Chem. 276,29466–29478.

10. Ren, D., Collingwood, T. N., Rebar, E. J., Wolffe, A. P.& Camp, H. S. (2002). PPARgamma knockdown byengineered transcription factors: exogenous PPAR-gamma2 but not PPARgamma1 reactivates adipo-genesis. Genes Dev. 16, 27–32.

11. Xu, D., Ye, D., Fisher, M. & Juliano, R. L. (2002).Selective inhibition of P-glycoprotein expression inmultidrug-resistant tumor cells by a designed tran-scriptional regulator. J. Pharmacol. Expt. Ther. 302,963–971.

12. Guan, X., Stege, J., Kim, M., Dahmani, Z., Fan, N.,Heifetz, P. et al. (2002). Heritable endogenous generegulation in plants with designed polydactyl zincfinger transcription factors. Proc. Natl Acad. Sci.USA, 99, 13296–13301.

13. Jouvenot, Y., Ginjala, V., Zhang, L., Liu, P. Q.,Oshimura, M., Feinberg, A. P. et al. (2003). Targetedregulation of imprinted genes by synthetic zinc-finger transcription factors. Gene Ther. 10, 513–522.

14. Blancafort, P., Magnenat, L. & Barbas, C. F. (2003).


Scanning the human genome with combinatorialtranscription factor libraries. Nature Biotechnol. 21,269–274.

15. Falke, D., Fisher, M., Ye, D. & Juliano, R. L. (2003).Design of artificial transcription factors to selectivelyregulate the pro-apoptotic bax gene. Nucl. Acids Res.31, e10.

16. Reynolds, L., Ullman, C., Moore, M., Isalan, M.,West, M. J., Clapham, P. et al. (2003). Repression ofthe HIV-1 50 LTR promoter and inhibition of HIV-1replication by using engineered zinc-finger transcrip-tion factors. Proc. Natl Acad. Sci. USA, 100,1615–1620.

17. Segal, D. J., Gonclaves, J., Eberhardy, S., Swan, C. H.,Torbett, B. E. & Barbas, C. F., 3rd (2004). Attenuationof HIV-1 replication in primary human cells with adesigned zinc finger transcription factor. J. Biol.Chem. 279, 14509–14519.

18. Wysocka, J. & Herr, W. (2003). The herpes simplexvirus VP16-induced complex: the makings of a regu-latory switch. Trends Biochem. Sci. 28, 294–304.

19. Margolin, J. F., Friedman, J. R., Meyer, W. K., Vissing,H., Thiesen, H. J. & Rauscher, F. J., 3rd (1994).Kruppel-associated boxes are potent transcriptionalrepression domains. Proc. Natl Acad. Sci. USA, 91,4509–4513.

20. Liu, Q., Segal, D. J., Ghiara, J. B. & Barbas, C. F., 3rd(1997). Design of polydactyl zinc-finger proteins forunique addressing within complex genomes. Proc.Natl Acad. Sci. USA, 94, 5525–5530.

21. Ronicke, V., Risau, W. & Breier, G. (1996). Characteri-zation of the endothelium-specific murine vascularendothelial growth factor receptor-2 (Flk-1) promo-ter. Circ. Res. 79, 277–285.

22. Kappel, A., Schlaeger, T. M., Flamme, I., Orkin, S. H.,Risau, W. & Breier, G. (2000). Role of SCL/Tal-1,GATA, and ets transcription factor binding sitesfor the regulation of flk-1 expression during murinevascular development. Blood, 96, 3078–3085.

23. Perier, R. C., Praz, V., Junier, T., Bonnard, C. &Bucher, P. (2000). The eukaryotic promoter database(EPD). Nucl. Acids Res. 28, 302–333.

24. Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob,H., Kel, A. E., Kel, O. V. et al. (1998). Databases ontranscriptional regulation: TRANSFAC, TRRD andCOMPEL. Nucl. Acids Res. 26, 362–367.

25. Vityaev, E. E., Orlov, Y. L., Vishnevsky, O. V.,Pozdnyakov, M. A. & Kolchanov, N. A. (2002). Com-puter system “gene discovery” for promoter struc-ture analysis. In Silico Biol. 2, 257–262.

26. Turner, B. M. (2002). Cellular memory and thehistone code. Cell, 111, 285–291.

27. Georgel, P. T. (2002). Chromatin structure of eukary-otic promoters: a changing perspective. Biochem.Cell. Biol. 80, 295–300.

28. Choo, Y. & Klug, A. (1994). Selection of DNA bindingsites for zinc fingers using rationally randomizedDNA reveals coded interactions. Proc. Natl Acad. Sci.USA, 91, 11168–11172.

29. Wu, H., Yang, W. P. H. & Barbas, C. F., 3rd (1995).Building zinc fingers by selection: toward a thera-peutic application. Proc. Natl Acad. Sci. USA, 92,344–348.

30. Segal, D. J., Dreier, B., Beerli, R. R. & Barbas, C. F.,3rd (1999). Toward controlling gene expression atwill: selection and design of zinc finger domainsrecognizing each of the 50-GNN-30 DNA targetsequences. Proc. Natl Acad. Sci. USA, 96, 2758–2763.

31. Dreier, B., Segal, D. J. & Barbas, C. F., 3rd (2000).

Insights into the molecular recognition of the50-GNN-30( family of DNA sequences by zinc fingerdomains. J. Mol. Biol. 303, 489–502.

32. Hapgood, J. P., Riedemann, J. & Scherer, S. D. (2001).Regulation of gene expression by GC-rich DNA cis-elements. Cell. Biol. Intl, 25, 17–31.

33. Seipel, K., Georgiev, O. & Schaffner, W. (1992). Dif-ferent activation domains stimulate transcriptionfrom remote (“enhancer”) and proximal (“promo-ter”) positions. EMBO J. 11, 4961–4968.

34. Scott, G. K., Daniel, J. C., Xiong, X., Maki, R. A.,Kabat, D. & Benz, C. C. (1994). Binding of an ETS-related protein within the DNase I hypersensitivesite of the HER2/neu promoter in human breastcancer cells. J. Biol. Chem. 269, 19848–19858.

35. Scott, G. K., Chang, C. H., Erny, K. M., Xu, F.,Fredericks, W. J., Rauscher, F. J., 3rd et al. (2000). Etsregulation of the erbB2 promoter. Oncogene, 19,6490–6502.

36. Noonberg, S. B., Scott, G. K., Hunt, C. A., Hogan,M. E. & Benz, C. C. (1994). Inhibition of transcriptionfactor binding to the HER2 promoter by triplex-forming oligodeoxyribonucleotides. Gene, 149,123–126.

37. Mishra, S. K., Mandal, M., Mazumdar, A. & Kumar,R. (2001). Dynamic chromatin remodeling on theHER2 promoter in human breast cancer cells. FEBSLetters, 507, 88–94.

38. Tan, S., Guschin, D., Davalos, A., Lee, Y. L.,Snowden, A. W., Jouvenot, Y. et al. (2003). Zinc-fingerprotein-targeted gene regulation: genomewidesingle-gene specificity. Proc. Natl Acad. Sci. USA, 100,11997–12002.

39. Kim, J. S. & Pabo, C. O. (1998). Getting a handholdon DNA: design of poly-zinc finger proteins withfemtomolar dissociation constants. Proc. Natl Acad.Sci. USA, 95, 2812–2817.

40. Urnov, F. D. (2002). A feel for the template: zincfinger protein transcription factors and chromatin.Biochem. Cell. Biol. 80, 321–333.

41. Urnov, F. D., Rebar, E. J., Reik, A. & Pandolfi, P. P.(2002). Designed transcription factors as structural,functional and therapeutic probes of chromatin invivo. Fourth in review series on chromatin dynamics.EMBO Rep. 3, 610–615.

42. Liang, Y., Li, X. Y., Rebar, E. J., Li, P., Zhou, Y., Chen,B. et al. (2002). Activation of vascular endothelialgrowth factor A transcription in tumorigenic glio-blastoma cell lines by an enhancer with cell type-specific DNase I accessibility. J. Biol. Chem. 277,20087–20094.

43. Peng, H., Begg, G. E., Schultz, D. C., Friedman, J. R.,Jensen, D. E., Speicher, D. W. & Rauscher, F. J., 3rd(2000). Reconstitution of the KRAB-KAP-1 repressorcomplex: a model system for defining the molecularanatomy of RING-B box-coiled-coil domain-mediated protein–protein interactions. J. Mol. Biol.295, 1139–1162.

44. Vernimmen, D., Begon, D., Salvador, C., Gofflot, S.,Grooteclaes, M. & Winkler, R. (2003). Identificationof HTF (HER2 transcription factor) as an AP-2(activator protein-2) transcription factor and contri-bution of the HTF binding site to ERBB2 gene over-expression. Biochem. J. 370, 323–329.

45. Perissi, V., Menini, N., Cottone, E., Capello, D., Sacco,M., Montaldo, F. & De Bortoli, M. (2000). AP-2 tran-scription factors in the regulation of ERBB2 genetranscription by oestrogen. Oncogene, 19, 280–288.

46. Chen, H., Yu, D., Chinnadurai, G., Karunagaran, D.


& Hung, M. C. (1997). Mapping of adenovirus 5 E1Adomains responsible for suppression of neu-mediated transformation via transcriptional repres-sion of neu. Oncogene, 14, 1965–1971.

47. Wang, S. C., Zhang, L., Hortobagyi, G. N. & Hung,M. C. (2001). Targeting HER2: recent developmentsand future directions for breast cancer patients.Semin. Oncol. 28, 21–29.

48. von Hippel, P. (1979). On the molecular bases of thespecificity of interaction of transcriptional proteinswith genomic DNA. Biological Regulationand Development (Goldberger, R., ed.), vol. 1, pp.279–347, Plenum Press, New York.

49. Miller, J. C. & Pabo, C. O. (2001). Rearrangement ofside-chains in a Zif268 mutant highlights the com-plexities of zinc finger-DNA recognition. J. Mol. Biol.313, 309–315.

50. Segal, D. J., Beerli, R. R., Blancafort, P., Dreier, B.,Effertz, K., Huber, A. et al. (2003). Evaluation ofa modular strategy for the construction of novelpolydactyl zinc finger DNA-binding proteins. Bio-chemistry, 42, 2137–2148.

51. Bulyk, M. L., Huang, X., Choo, Y. & Church, G. M.(2001). Exploring the DNA-binding specificities ofzinc fingers with DNA microarrays. Proc. Natl Acad.Sci. USA, 98, 7158–7163.

52. Barbas, C. I., Burton, D. R., Scott, J. K. & Silverman,G. J. (2001). Phage Display: A Laboratory Manual, ColdSpring Harbor Laboratory Press, Cold SpringHarbor, NY.

53. Liu, X., Sun, Y., Constantinescu, S. N., Karam, E.,Weinberg, R. A. & Lodish, H. F. (1997). Transforming

growth factor beta-induced phosphorylation ofSmad3 is required for growth inhibition and tran-scriptional induction in epithelial cells. Proc. NatlAcad. Sci. USA, 94, 10669–10674.

54. Trauger, J. W. & Dervan, P. B. (2001). Footprintingmethods for analysis of pyrrole–imidazole poly-amide/DNA complexes. Methods Enzymol. 340,450–466.

55. Chen, H. & Hung, M. C. (1997). Involvement ofco-activator p300 in the transcriptional regulationof the HER-2/neu gene. J. Biol. Chem. 272, 6101–6104.

56. Chen, Y. & Gill, G. N. (1994). Positive and negativeregulatory elements in the human erbB-2 genepromoter. Oncogene, 9, 2269–2276.

Edited by F. Schmid

(Received 14 January 2004; received in revised form21 April 2004; accepted 22 April 2004)

Supplementary Material for this paper compris-ing one movie is available on Science Direct


Documents

Promoter-targeted Phage Display Selections with