Proc. Natl. Acad. Sci. USAVol. 92, pp. 2582-2586, March 1995Biochemistry

Promoter architecture in the flagellar regulon of Bacillussubtilis: High-level expression of flagellin by the crD RNApolymerase requires an upstream promoter element

(transcription/a protein/upstream activation)

KURT FREDRICK*t, TIZLANA CARAMORItt, YA-FEN CHEN*t, ALESSANDRO GALIZZIt, AND JOHN D. HELMANN*§*Section of Microbiology, Wing Hall, Cornell University, Ithaca, NY 14853; and *Dipartimento di Genetica e Microbiologia, Universita di Pavia, Pavia, Italy

Communicated by Sankar Adhya, National Cancer Institute, Bethesda, MD, December 21, 1994 (received for review October 27, 1994)

ABSTRACT Flagellin is one of the most abundant pro-teins in motile bacteria, yet its expression requires a lowabundance cr factor (or28). We show that transcription fromthe Bacillus subtlis flagellin promoter is stimulated 20-fold byan upstream A+T-rich region [upstream promoter (UP)element] both in vivo and in vitro. This UP element is contactedby or28 holoenzyme bound at the flagellin promoter and bindsthe isolated a2 subassembly of RNA polymerase. The UPelement increases the affinity of RNA polymerase for theflagellin promoter and stimulates transcription when initia-tion is limited by the rate of RNA polymerase binding.Comparison with other promoters in the flagellar regulonreveals a bipartite architecture: the -35 and -10 elementsconfer specificity for or28, while promoter strength is deter-mined largely by upstream DNA sequences.

Promoter recognition by bacterial RNA polymerase (RNAP)is one of the simplest and best understood transcriptioninitiation reactions (1). RNAP recognizes promoters to forman initial closed complex (RP,), which undergoes one or morestructural transitions leading ultimately to a strand-separatedopen complex (RP.). RNAP then binds the appropriate NTPsubstrates and initiates RNA synthesis. Initial synthesis is notvery processive and abortive transcripts are released (2). Oncethe nascent RNA chain reaches a critical length, generally 8-10nucleotides, the or subunit is lost and a stable elongationcomplex is established. Promoter strength can be limited at anyone of these steps and activators must increase the rate of theslowest step to stimulate transcription (1, 3, 4).The relationship between promoter sequence and strength

is complex and has been studied in most detail for theEscherichia coli or70 holoenzyme (3, 5). o.70 promoters typicallyhave a core region comprising two conserved hexanucleotidemotifs centered 10 (-10 region) and 33 (-35 region) basesupstream of the transcription start point (designated + 1). Thesimilarity of this core region to the consensus is one predictorof in vivo promoter strength (5) and correlates closely with thein vitro binding affinity of RNAP (3). However, sequenceslocated upstream and downstream of the core elements alsoaffect strength (3, 6-8). Recent studies of rRNA transcriptionhave defined an upstream promoter element (UP element),which enhances RNAP binding, interacts directly with the asubunits of RNAP, and stimulates transcription both in vivoand in vitro (9-11).The o.28 subfamily of bacterial oa factors controls the expres-

sion of flagellar genes in a wide range of bacterial species (12).Binding of the Bacillus subtilis o28 (aD) protein to the coreRNAP confers a unique promoter specificity in the -35(TAAA) and -10 (GCCGATAT) regions (13, 14). oaD-dependent promoters match this consensus in at least 10 of 12

positions. However, there is no apparent correlation betweenpromoter sequence and in vivo strength. We demonstrate thatthe -35 and -10 elements confer a low basal level ofo'-dependent expression, which is enhanced between 3- and30-fold by upstream activation sequences (UASs).

MATERIALS AND METHODSGeneration of Promoter Variants. Deletion derivatives of

the Phag (15), PmotAB (16), and PfliDsT (17) promoters are listedin Table 1 and upstream deletion endpoints are diagrammedin Fig. 1. Both strands of promoters Phag-43 and Pmot-4S weresynthesized with a Cyclon Plus DNA synthesizer (Milligen),heated at 90°C, and annealed. After digestion with EcoRI andBamHI, the promoter fragments were purified by PAGE andligated into pHAG-458 as described below. Other promoterfragments were obtained by the PCR (30 cycles at 93°C,47-50°C, and 72°C) and are flanked by EcoRI and BamHIsites.

All promoters were analyzed as lacZ fusions after integra-tion into the pks locus using pHAG-458 and its derivatives. A513-bp EcoRI/BamHI PCR fragment (containing Phag4A5Table 1) was cloned into pDH32 (18) and removed as anEcoRI/Cla I fragment that was cloned into pJF751 (19) togenerate a transcriptional fusion between Phag and lacZ (con-taining the spoVG ribosome-binding site from pDH32). Then,a 602-bp Pst I/EcoRI fragment of DNA from the pks locus(155°C) was incorporated, resulting in pHAG-458. Otherplasmids listed in Table 1 were derived from pHAG-458 bysubstitution of different EcoRI/BamHI promoter cassettes.

8-Galactosidase Assays. Plasmids were transformed into B.subtilis PB168 (20) with selection for chloramphenicol resis-tance (CmR; 5 ,ug/ml). Transformants could arise by integra-tion either at hag or atlpks, where disruptions show no obviousphenotype (21). To identify integrants at thepks locus (155°),phage PBS-1 transduction was used to verify linkage betweenthe integrated CmR marker and DNA able to complement atemperature-sensitive mutation in polC (dnaP39) at 1490.Strains were grown in Schaeffer sporulation medium andsamples were removed at 30-min intervals for A525 readingsand duplicate f-galactosidase assays (22). Since oD-dependenttranscription is highest at late-logarithmic phase (12, 23),measurements were made throughout the growth cycle in atleast two independent experiments to determine the peak levelof expression.

Overproduction and Purification of B. subtilis a Protein.Plasmid pKF38 was constructed in a three-way ligation withtwo partial rpoA clones (24). A 238-bp Nde I/EcoRI fragmentfrom pSA136 and a 903-bp EcoRI/Bcl I fragment from

Abbreviations: RNAP, RNA polymerase; UAS, upstream activationsequence; UP element, upstream promoter element.tK.F., T.C., and Y.-F.C. contributed equally to this work.§To whom reprint requests should be addressed.

2582

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 7

, 202

1

Proc. NatL Acad Sci USA 92 (1995) 2583

Table 1. In vivo expression from deletion variants ofcD-dependent promoters

Extent of Galactosidase Relativepromoter activity, Miller activity,

Promoter Plasmid DNA units* %

Phag-458 pHAG-458 -458 to +55 2549 ± 234 100Phag-96a pHAG-96a -96 to +55 2125 ± 97 83Phag-6b pHAG-96b -96 to +4 1949 ± 14 76Phag-74 pHAG-74 -74 to +4 1703 ± 131 67Phag65t pHAG-65t -65 to +4 1910 ± 28 75Phag-58 pHAG-58 -58 to +4 572 ± 94 22Phag-43 pHAG-43 -43 to +4 114 ± 25 4Phag-41 pHAG-41 -41 to +55 85 ± 8 3Pf1D-224 pFLI-224 -224 to +6 109 ± 12 100PfI1D-68 pFLI-68 -68 to +6 83 ± 13 76PfI1D-39 pFLI-39 -39 to +6 24 ± 7 22Pmot-171 pMOT-171 -171 to +2 193 ± 43 100Pmot-89 pMOT-89 -89 to +2 145 ± 17 75Pmot-45 pMOT-45 -45 to +2 53 ± 25 27

*Mean ± SEM. SEM equals /1n-1/2.tPhag-65 also contains a point mutation: A at -61 to C.

pSW102 were ligated into the Nde I and BamHI sites ofpETllc to generate pKF38. E. coli BL21/DE3(pKF38) was

grown in 2XYT medium (16 q of bactotryptone, 10 g of bactoyeast extract, and 5 g of NaCl per liter) (4 liters containing 200,ug of ampicillin per ml) to midlogarithmic phase, isopropyl,B-D-thiogalactopyranoside was added to 1 mM, and cells wereharvested after 2 hr. Cells (15 g) were resuspended in 20 ml oflysis buffer [50 mM Tris HCl, pH 8.0/2 mM EDTA/100 mMNaCl/0.1 mM dithiothreitol (DTT)/1 mM 2-mercaptoetha-nol/10% (vol/vol) glycerol/i mM phenylmethylsulfonyl fluo-ride] and lysed using a French Pressure cell. After centrifu-gation at 10,000 x g, the supernatant fraction was loaded ontoan 1 1-ml Q-Sepharose column and washed with TGED buffer(10 mM Tris HCl, pH 8.0/0.1 mM EDTA/10% glycerol/0.1mM DTT) containing 100mM NaCl. a protein was eluted withTGED/400 mM NaCl, concentrated by ammonium sulfate(65% saturation) precipitation, and loaded on a SephacrylS-200 column in TGED/400 mM NaCl. Final purification wasachieved with an FPLC Mono Q column. About 6 mg of a2

(>95% pure) per liter was obtained.Purification of B. subtilis RNAP, aD, and S. For in vitro

transcription, RNAP was purified from B. subtilis RP3, whichcontains a disruption of rpoE and therefore lacks 8 (25). Keysteps included chromatography on heparin-Sepharose,Sephacryl S-300, and FPLC Mono Q. BioRex-70 chromatog-raphy was used to purify core enzyme as described (26). wasoverproduced and purified from E. coli. Details of theseprocedures will be published elsewhere (F. Lopez de Saro andJ.D.H., unpublished data). For DNase I footprinting, RNAPcore (containing substoichiometric amounts of 8) was purifiedfrom CB100 (27) (sigD::cat) and aD was purified from an E.coli overproducing strain (Y.-F.C. and J.D.H., unpublished

-70 -60 -50 -40 -30 -10* * * * * ~~~~~~~~//

CATTATCCTCACAAAAAAGTGAGGATTTTTTTATTTTTGTAITA&C-N14-CCGIAA A* A AA hagTACAAGAAATCTAAAACAGAAGATTTTTTTCCAAAAATATGTGTAAT-N14---GTCGATAT

A A fl DGCCTCTTCCTTGAATATTTCATGAACAAATTCACAATGTCCCIAAAG-N14-AQCCA=A

A A motA

FIG. 1. aD promoters used in this study. The promoter regions ofthe oD-dependent hag (flagellin) (15), fliDST (17), and motAB (16)transcription units are shown. The -35 and -10 elements for aDRNAP are underlined. The last base of each 5' deletion is indicatedabove each A. The Phag -65 deletion, indicated with the asterisk, alsocontains a point mutation of A to C at position -61.

data). Protein concentrations were determined by absorbanceat 280 nm.In Vitro Transcription. Transcription was initiated by addi-

tion of RNAP (core, oD, and 8 in the molar ratio 1:9:5) totranscription buffer (18 mM Tris-HCl, pH 8.0/10 mM MgCl2/10% glycerol/8 mM 2-mercaptoethanol/100,M [a-32P]UTP/800 ,uM CTP/800 ,uM GTP/800 ,uM ATP) containing tem-plate DNA. Concentrations of EaD RNAP and NaCl were asindicated for each experiment. After 6 min at 37°C (unlessindicated otherwise) reactions were terminated with stopsolution (2.5 M NH4OAc/20 mM EDTA/100 ,ug of plasmidDNA per ml), extracted with phenol/chloroform, and ethanolprecipitated before analysis by 6% acrylamide/urea PAGE.The molar ratios of transcripts were determined with a Mo-lecular Dynamics PhosphorImaging system, ImageQuant dataanalysis software, and subsequent correction for the number ofUMP residues in each transcript.The Phag(+UP) template was a 413-bp Pvu II/BamHI

fragment containing promoter Phag-96a(-96 to +55) and262-bp pBKSII+ vector DNA upstream. The Phag(-UP)template was a 370-bp Pvu II/Xba I fragment carrying Phag41(-41 to +55), the same 262-bp vector DNA upstream, and12-bp pBKSII+ polylinker DNA downstream. RNA runoffproducts are 55 (+UP) and 67 (-UP) nucleotides long.DNase I Footprinting and Gel Mobility-Shift Assays. For

DNase I footprinting, the Phag(+UP) fragment (extendingfrom -85 to + 108) was obtained from pYFC-16 (Y.-F.C. andJ.D.H., unpublished data) and the Phag(-UP) fragment (ex-tending from -41 to +55) was obtained from pHAG-41 andsubcloned into pBSK+. DNA fragments were end-labeled onthe top strand using [y-32P]ATP and T4 polynucleotide kinaseat the pBSK+ polylinker Eag I site (+UP) or Bspl20i site(-UP). DNase I footprinting reaction mixtures containedDNA and proteins as indicated in the legend to Fig. 3 and willbe described in detail elsewhere (Y.-F.C. and J.D.H., unpub-lished data).For gel-shift analysis, 5'-end-labeled Phag(+UP) or

Phag(-UP) transcription templates (<1.5 nM) and aD RNAPwere incubated at 37°C for 7 min in binding buffer (18 mMTris-HCl, pH 8.0/10 mM MgCl2/150 mM NaCl/50 ,ug ofbovine serum albumin per ml/10 ,ug of cold plasmid DNA perml/8 mM 2-mercaptoethanol) before analysis by 4% PAGE at180 V for 2 hr in lx TAE buffer (28). For determination ofthe RNAP binding constants as a function of NaCl concen-tration, MgCl2 was omitted from the binding buffer. Quanti-tation of the fraction bound was determined with a MolecularDynamics PhosphorImager as described above.

RESULTS AND DISCUSSIONFlagellin is one of the most abundant proteins in motile B.subtilis cells and transcription of the flagellin gene (hag) iscompletely dependent on o.D (15, 29). The maximal level of aDis estimated as 220 molecules per cell in late-logarithmic phase(30). Despite this low abundance, aD appears to be present inexcess as measured by flagellin synthesis since a 14-foldreduction in oD levels leads to a <2-fold decrease in flagellin(27). In this study, we demonstrate that efficient initiationfrom the hag promoter (Phag) is due to a UAS analogous to theE. coli rrnB UP element.The e'-Dependent hag Promoter Is Activated >20-Fold by

a UAS. To define the minimal sequences required for tran-scription by E0D, deletion variants of the hag, fliDST, andmotAB promoters were used to drive expression of lacZ (Fig.1). In each case, the minimal promoter gave relatively lowexpression of ,B-galactosidase (between 24 and 85 Miller units;Table 1). The low activity observed for Phag,2 was unexpectedsince hag-lacZ fusions typically express >2000 Miller units(20). This suggested that the core promoter elements (thosedownstream of -43) were insufficient for high-level expres-

Biochemistry: Fredrick et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 7

, 202

1

2584 Biochemistry: Fredrick et al.

sion by EPD. In contrast, wild-type levels of expression (2500Miller units) were obtained with a longer hag-lacZ fusion(Phag-458) (Table 1). Deletion analysis revealed that sequencesbetween -65 and -42 stimulated transcription 20-fold, rela-tive to vector DNA, with an additional 1.5-fold contributed bysequences further upstream (Fig. 2; Table 1). The upstreamregions of the fliDST and motAB promoters also stimulatedtranscription from their core elements but the effect wasrelatively modest (3- to 5-fold). The operon encoding themajor B. subtilis autolysin (cwiB) is also under o-D control. Inthis case the region between -42 and -98 appears to stimulatetranscription by 4- or 5-fold (31).There has not been a systematic analysis of sequence

recognition by EaD but alignments indicate that most oD-dependent promoters have at least 10 of 12 identities with the-35 and -10 consensus elements. In vivo activity is eliminatedby deletion of the -35 region for both the hag (32) and cwlBpromoters (31), thereby supporting the importance of thiselement. Despite their apparent sequence homogeneity, cD-dependent promoters differ at least 100-fold in strength. Ourobservations suggest that the -35 and -10 elements conferspecificity for Eoa but that upstream sequences confer highpromoter activity.We considered the possibility that the hagUAS might define

a protein binding site. SinR is a DNA-binding protein thatpositively regulates motility and competence (33). To testwhether the Phag UAS is a target for SinR, we measuredexpression ofhag-lacZ fusions in a sinR background. Althougha sinR null mutation led to a 5-fold decrease in hag-lacZexpression, consistent with earlier studies (17), the residualexpression was decreased an additional 23-fold by removal ofthe UAS. Therefore, the stimulatory activity of the UAS doesnot require SinR.The Phag UAS Binds Ea& RNAP and the a2 Core Subas-

sembly. The region of Phag between -74 and -42 is A+T-rich(Fig. 1), a characteristic of the rRNA UP element (9, 10).Therefore, we hypothesized that the Phag UAS was an UPelement. UP elements bind RNAP to form an extendedupstream footprint (34), bind directly to the isolated a dimer(a2) subassembly ofRNAP (10), and stimulate transcription invitro (11). Therefore, we tested these properties of the pro-posed hag UP element.

Reconstituted Eo( bound tightly to Phag and, as expected,binding was dependent on o-D (Fig. 3A). EoD formed anextended DNase I footprint with approximate boundaries of-70 and +20. Two prominent DNase I hypersensitive sites areapparent at -31 and -8. Addition of excess 8, a factor knownto affect RNAP complexes at other promoters (26), did notnoticeably alter the DNase I footprint (Fig. 3A, compare lanes1 and 2). When the EaD holoenzyme was bound to Phag-42(-UAS) the protected region was reduced in extent (-45 to+20) and the hypersensitive sites were greatly reduced (Fig.

;> 2000

- 1500~a)E

; 1000

co _,

OK 500

0

-100 -80 -60 -40 -20Deletion endpoint

FIG. 2. In vivo activity of promoter variants. The peak level off3-galactosidase (assayed in single copy at pks) from each promotervariant is plotted vs. the 5' deletion endpoint (see Fig. 1) for Phag (-),PfliDsT (0), and PmotAB (A) (see Table 1).

A1 234

-8 >15

-31 >* .

*4i,

5 6B1 I I 4 5

+10

-10

-30

-40

-50

-60

-70

* +10

* -10

* -30

* -40

-50

Cl 2 3 4 5

-10

I t '' -l -30

E , -40

iz a .-50

* -60

* -70

FIG. 3. DNase I footprinting of Phag promoter DNA. (A) Protec-tion of Phag(+UP) against DNase I cleavage in the presence of EOSD(top strand). Lanes: 1, EOD plus 8; 2, EorD (subsaturating 8); 3, coreRNAP; 4, no protein control; 5, A and G chemical sequencing ladder;6, T ladder. (B) Protection of Phag(-UP) (Ph -41; see Fig. 1) againstDNase I cleavage in the presence of the EoP (top strand). Lanes: 1,T ladder; 2, A and G ladder; 3, no protein control; 4, core RNAP; 5,EoD holoenzyme. (C) Protection of Phag(+UP) against DNase Icleavage in the presence of a. Lanes: 1, T ladder; 2, A and G ladder;3, no protein control; 4 and 5, purified a (1.3 and 2.6 ,uM dimer,respectively).

3B). Thus, the DNA region required for high-level expressionin vivo interacts with purified RNAP in vitro.The purified B. subtilis a protein is a dimer in solution (data

not shown) and also binds Phag as judged by DNase I foot-printing (Fig. 3 C). The region protected by a2 (-70 to -32)is upstream of the core promoter and overlaps the regionprotected by EaD on the +UAS but not on the -UASpromoter (Fig. 4). These data suggest that a contacts the UASin the active EUD-Phag complex. Therefore, we refer to thisUAS as the Phag UP element.The Phag UP Element Stimulates Transcription in Vitro. The

stimulatory activity of the Phag UP element was tested with B.subtilis EoD and Phag templates containing (-96) or lacking(-41) the UP element. As observed with the rRNA UPelement (10), stimulation was greatest when the concentrationof RNAP was limiting for promoter activity. Experimentally,this was accomplished by using low concentrations of EoD,high salt concentration, or by promoter competition. The UPelement increased the rate of RNA synthesis 19-fold at 160mM NaCl (Fig. 5). For both the +UP and -UP templates,increasing the DNA and RNAP concentrations increased therate of transcription, which demonstrates that the bimolecularbinding step is rate-limiting.When the NaCl concentration was decreased to 110 mM, the

magnitude of-the UP-dependent stimulation decreased from19-fold to <3-fold (Fig. 6A, lanes 1 and 2), presumably due to

-35 N -10-70 - - TGATAT - -+20

.4 RNAPon Phag(+uP)* RNAP on Phag(-UP)

a2 __0

FIG. 4. Summary of footprinting data for Phag promoter region.Boundaries of DNase I protection by EorD and a on Phag(+UP) andPhag(-UP) are illustrated.

Proc. Natl. Acad Sci. USA 92 (1995)

Dow

nloa

ded

by g

uest

on

Aug

ust 7

, 202

1

Proc. Natt Acad Sci USA 92 (1995) 2585

1 2 3 4 5 6DNA, nM 1.7 1.7 3.4 3.4 6.7 6.7RNAP, nM 9 9 19 19 37 37

-UPo->

40 U.

FIG. 5. In vitro transcription of Phag promoter region. E&iD RNAPwas used to transcribe either Phag(+UP) or Phag(-UP) template intranscription buffer with 160 mM NaCl. Concentrations ofRNAP andtemplate DNA are listed above each lane. RNA was isolated from 120,ul (lanes 1 and 2), 60 ,ul (lanes 3 and 4), or 30 jlI (lanes 5 and 6) ofreaction mixture so that the RNA in each lane is that produced by thesame total amount of RNAP and DNA template.

more rapid binding of RNAP to the promoter. However, theeffect of the UP element was still substantial in promotercompetition assays. When the +UP and -UP templatescompete for RNAP (at 110 mM NaCl), synthesis from the-UP template decreases >10-fold, while synthesis from the+UP template is unaffected (Fig. 6A, compare lanes 1, 2, and4). This indicates that the +UP template can sequester limitingRNAP from the -UP template. The Phag(+UP) template alsooutcompetes another oD-dependent promoter, that for cheV.In competition assays, the Phag(+UP) template is 80-fold moreactive than Pchev, whereas Phag(-UP) is only 2.8-fold moreactive. The cheV promoter is known to be relatively weak invivo since a cheV-lacZ fusion expresses only 30 Miller units of13-galactosidase (35).

A 1RNAP, nM 37

2 3 4 5 637 19 37 73 146

.' -.

_609.0.. w w

B 30-, 25-

n D 20-m; 15-Z 10-

5 -

50 100RNAP, nM

C 1 2 3 4NaCl,mM 20 110 160 210

-UP- * o ES

The promoter competition experiments indicate that the UPelement increases the overall rate constant, k0n, for formationof the first stably bound (irreversible) RNAP-promoter com-plex (7). We do not yet know whether this kinetically definedstable intermediate is a closed, an open, or an initiatedcomplex (cf. ref. 36). However, the preferential transcriptionof the Phag(+UP) template is reduced at higher concentrationsof RNAP (Fig. 6B) and at lower concentrations of NaCl(19-fold effect at 160 mM NaCl reduced to 2.4-fold at 20 mMNaCl; Fig. 6C). These effects are consistent with the hypothesisthat the UP element increases the initial binding of RNAP tothe promoter. However, since the UP element also alters theDNase I footprint in the -10 region, other steps may beaffected as well.The Phag UP Element Increases the Affinity of EaD RNAP

for Ph,. We have used a gel mobility-shift assay to test thehypothesis that the Phag UP element increases the affinity ofRNAP for Phag. Eo'- was incubated with the +UP and -UPPhag fragments and the amount of promoter complex wasdetermined (Fig. 7). At each NaCl concentration tested (10,50, 100, and 150 mM), RNAP bound more tightly to the +UPDNA. The overall equilibrium dissociation constant (Kd) forthe formation of stable complexes was 20 nM (+UP) com-pared to 200 nM (-UP) at 100 mM NaCl (data not shown).The measured affinities increase at low salt, as expected, butRNAP binds Phag(+UP) at least 3-fold tighter than Phag(-UP)under all conditions tested.The Ph1g UP Element Is Not Associated with Bent DNA.

IntrinsicDNA bends, often determined by phased polyadeninetracts, can stimulate transcription severalfold (8, 37-39). BentDNA can enhance RNAP binding and thereby strengthenpromoters, which are binding limited. However, this enhancedbinding can impede promoter clearance and thereby decreasethe strength of promoters limited in the clearance step (8).Although rrnB P1 is sometimes cited as an example of acti-vation by bent DNA, the rrnB bend is located 50 bp upstreamof the UP element (40). Therefore, an UP element does notrequire an intrinsic DNA bend for function and, conversely, itis unclear whether DNA bends are mechanistically similar toUP elements. In circular permutation assays, we failed todetect DNA bending in Phag and we estimate that any bend, ifpresent, must be <300 (data not shown). Therefore, a staticDNA bend does not appear to be essential for the function ofeither the hag or the rrnB UP elements.Summary. Overall there is a remarkable correspondence

between the biochemical effects of the flagellin and rRNA UPelements. One obvious difference is that the hag UP elementfunctions with an alternative holoenzyme. Our studies supportthe hypothesis that UP elements are a widespread componentof prokaryotic promoters. Indeed, A+T-rich sequences arefrequently found upstream of Gram-positive promoters (41,42) and in several cases have been shown to activate transcrip-

RNAP, nM 0 7 14 1 28 56 110

+UP-> * *

FIG. 6. Effect of UP element in promoter competition experi-ments. (A) Runoff transcripts produced from Phag(+UP) andPhag(-UP) templates (6.7 nM each) at the indicated concentrations ofE&aD RNAP. Lanes: 1, Phag(+UP) template alone, 37 nM RNAP; 2,Phag(-UP) template alone, 37 nM RNAP; 3-6, Phag(+UP) andPhag(-UP) together with 19, 37, 73, or 146 nM RNAP, respectively.(B) Graph of UP effect vs. [RNAP] in competition reactions. Datafrom reactions inA (lanes 3-6) were quantitated by phosphorimagingthe transcript intensity at 6 min (U) and 12 min (-) of incubation. (C)Salt dependence of the UP effect in competition reactions. Reactionmixtures similar to those inA (lane 4; 37 nM RNAP) were incubatedfor 10 min at the indicated concentration of NaCl (mM).

Complexes

+UP ->-UP ->

FIG. 7. Effect of UP element on RNAP binding affinity. E5aD (atthe indicated concentrations) was allowed to equilibrate for 7 min withlabeled Phag(+UP) and Phag(-UP) fragments prior to separation ofbinary complexes from unbound DNA by PAGE.

Biochemistry: Fredrick et aL

Dow

nloa

ded

by g

uest

on

Aug

ust 7

, 202

1

2586 Biochemistry: Fredrick et al.

tion (43, 44). We propose that promoters of the B. subtilisflagellar regulon have evolved a bipartite architecture: thehighly conserved core elements confer specificity for the lowabundance oD factor, while the adjacent upstream regionsmodulate promoter strength.

We thank Justin Lee for performing the DNA-bending assays andS. Winans for comments on the manuscript. This research was

supported by National Institutes of Health Grant GM47446 (J.D.H.),by P. F. Ingegneria Genetica CNR (A.G.), and by Ministero dell'Universita e Ricerca Scientifica e Tecnologica (MURST) (A.G.). K.F.was partially supported by National Institutes of Health BiotechnologyTraining Grant GM08384 and T.C. was partially supported by a

fellowship from Fondazione A. Buzzati-Traverso.

1. Leirmo, S. & Record, M. T., Jr. (1990) in Nucleic Acids and

Molecular Biology, eds. Eckstein, F. & Lilley, D. M. J. (Springer,Berlin), Vol. 4, pp. 123-151.

2. Krummel, B. & Chamberlin, M. J. (1989) Biochemistry 28,7829-7842.

3. Knaus, R. & Bujard, H. (1990) in Nucleic Acids and MolecularBiology, eds. Eckstein, F. & Lilley, D. M. J. (Springer, Heidel-berg), Vol. 4, pp. 110-122.

4. Adhya, S., Gottesman, M., Garges, S. & Oppenheim, A. (1993)Gene 132, 1-6.

5. Mulligan, M. E., Hawley, D. KI, Entriken, R. & McClure, W. R.(1984) Nucleic Acids Res. 12, 789-800.

6. Knaus, R. & Bujard, H. (1988) EMBO J. 7, 2919-2923.7. Brunner, M. & Bujard, H. (1987) EMBO J. 6, 3139-3144.8. Ellinger, T., Behnke, D., Knaus, R., Bujard, H. & Gralla, J. D.

(1994) J. Mol. Biol. 239, 466-475.9. Rao, L., Ross, W., Appleman, J. A., Gaal, T., Leirmo, S., Schlax,

P. J., Record, M. T., Jr., & Gourse, R. L. (1994)J. Mol. Biol. 235,1421-1435.

10. Ross, W., Gosink, K. K., Salomon, J., Igarishi, K, Zou, C.,Ishihama, A., Severinov, K. & Gourse, R. L. (1993) Science 262,1407-1413.

11. Leirmo, S. & Gourse, R. L. (1991) J. Mol. Biol. 220, 555-568.12. Helmann, J. D. (1991) Mol. Microbiol. 5, 2875-2882.13. Wiggs, J. L., Gilman, M. Z. & Chamberlin, M. J. (1981) Proc.

Natl. Acad. Sci. USA 78, 2762-2766.14. Gilman, M. Z. & Chamberlin, M. J. (1983) Cell 35, 285-293.15. Mirel, D. B. & Chamberlin, M. J. (1989) J. Bacteriol. 171, 3095-

3101.16. Mirel, D. B., Lustre, V. M. & Chamberlin, M. J. (1992) J. Bac-

terioL 174, 4197-4204.17. Chen, L. & Helmann, J. D. (1994) J. Bacteriol. 176, 3093-3101.18. Shimotsu, H. & Henner, D. J. (1986) Gene 43, 85-94.19. Ferrari, F. A., Trach, K. & Hoch, J. A. (1985) J. Bacteriol. 161,

556-562.20. Barilla, D., Caramori, T. & Galizzi, A. (1994) J. Bacteriol. 176,

4558-4564.

21. Scotti, C., Piatti, M., Cuzzoni, A., Perani, P., Tognoni, A.,Grandi, G., Galizzi, A. & Albertini, A. (1993) Gene 130, 65-71.

22. Miller, J. H. (1972) in Experiments in Molecular Genetics (ColdSpring Harbor Lab. Press, Plainview, NY), pp. 352-355.

23. Ordal, G. W., Mairquez-Magania, L. & Chamberlin, M. J. (1993)in Bacillus subtilis and Other Gram-Positive Bacteria: Biochemis-try, Physiology, and Molecular Genetics, eds. Sonenshein, A. L.,Hoch, J. & Losick, R. (Am. Soc. Microbiol., Washington, DC),pp. 765-784.

24. Boylan, S. A., Suh, J.-W., Thomas, S. M. & Price, C. W. (1989) J.Bacteriol. 171, 2553-2562.

25. Lampe, M., Binnie, C., Schmidt, R. & Losick, R. (1988) Gene 67,13-20.

26. Juang, Y. L. & Helmann, J. D. (1994) J. Mol. Biol. 239, 1-14.27. Marquez, L. M., Helmann, J. D., Ferrari, E., Parker, H. M.,

Ordal, G. W. & Chamberlin, M. J. (1990) J. Bacteriol. i72,3435-3443.

28. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1990) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Lab. Press,Plainview, NY).

29. Helmann, J. D., Marquez, L. M. & Chamberlin, M. J. (1988) J.Bacteriol. 170, 1568-1574.

30. Helmann, J. D., Masiarz, F. R. & Chamberlin, M. J. (1988) J.Bacteriol. 170, 1560-1567.

31. Kuroda, A. & Sekiguchi, J. (1993) J. Bacteriol. 175, 795-801.32. LaVallie, E. R. & Stahl, M. L. (1989)J. Bacteriol. 171,3085-3094.33. Smith, I. (1993) in Bacillus subtilis and Other Gram-Positive

Bacteria: Biochemistry, Physiology, and Molecular Genetics, eds.Sonenshein, A. L., Hoch, J. & Losick, R. (Am. Soc. Microbiol.,Washington, DC) Vol. pp. 785-800.

34. Newlands, J. T., Ross, W., Gosink, K. K. & Gourse, R. L. (1991)J. Mol. Biol. 220, 569-583.

35. Fredrick, K. & Helmann, J. D. (1994) J. Bacteriol. 176, 2727-2735.

36. Whipple, F. W. & Sonenshein, A. L. (1992) J. Mol. Biol. 223,399-414.

37. Perez-Martin, J., Rojo, F. & DeLorenzo, V. (1994) Microbiol.Rev. 58, 268-290.

38. Bracco, L., Kotlarz, D., Kolb, A., Diekmann, S. & Buc, H. (1989)EMBO J. 8, 4289-4296.

39. McAllister, C. F. & Achberger, E. C. (1989) J. Biol. Chem. 264,10451-10456.

40. Gaal, T., Rao, L., Estrem, S. T., Yang, J., Wartell, R. W. &Gourse, R. L. (1994) Nucleic Acids Res. 22, 2344-2350.

41. Graves, M. C. & Rabinowitz, J. C. (1986) J. Biol. Chem. 261,11409-11415.

42. Moran, C. P., Lang, N., LeGrice, S. F. J., Lee, G., Stephens, M.,Sonenshein, A. L., Pero, J. & Losick, R. (1982) Mol. Gen. Genet.186, 339-346.

43. Banner, C. D. B., Moran, C. P. & Losick, R. (1983) J. Mol. Biol.168, 351-365.

44. McAllister, C. F. & Achberger, E. C. (1988) J. Biol. Chem. 263,11743-11749.

Proc. NatL Acad ScL USA 92 (1995)

Dow

nloa

ded

by g

uest

on

Aug

ust 7

, 202

1