Product Provides Keratinocyte Growth Factor-dependent ...of Education, Science, and Culture of Japan; by the Uehara Memorial Foundation; and by the Bristol-Myers Squibb Foundation

[CANCER RESEARCH 54, 518-522, January 15, 1994]

Preferential Expression of the Third Immunoglobulin-like Domain of K-sam

Product Provides Keratinocyte Growth Factor-dependent Growth in

Carcinoma Cell Lines 1

H i d e s h i I sh i i , Y u t a k a H a t t o r i , H i r o s h i I t o h , T a t s u y a K i s h i , T e r u h i k o Y o s h i d a , H i r o m i S a k a m o t o , H a k u m e i O h ,

S h o Y o s h i d a , T a k a s h i S u g i m u r a , a n d M a s a a k i T e r a d a 2

Genetics Division, National Cancer Center Research Institute, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104 [H. Is., Y H., H. It., T. K., Z Y, H. S., T. S., M. T.], and the Second Department of Internal Medicine, Chiba University School of Medicine, 8-1, lnohana 1-chome, Chuo-ku, Chiba 260 [H. Is., H. 0., S. Y], Japan

A B S T R A C T

Previously, we identified an amplified gene in a stomach cancer cell line, KATO-III, and designated it K-sam. This gene was later found to be identical with a gene for a receptor tyrosine kinase, bek/FGFR2. One of the characteristics of the K.sam gene is structural diversity of its transcripts; K-sam complementary DNA (cDNA) cloned from human brain (K-sam-I) has a completely different sequence at the third extracelinlar immunoglobulin-like domain as compared to that of the K-sam cDNA derived from KATO-III cells (K-sam-II). Recent study has revealed that this dif- ference signifies a differential ligand affinity; the receptor encoded by the K.sam-I cDNA has a high affinity for basic fibroblast growth factor (bFGF), while the K-sam-II cDNA corresponds to a receptor with the high affinity for keratinocyte growth factor (KGF). Reverse transcription-po. iymerase chain reaction and RNA blot analysis showed that the K-sam- II-type transcript was present in carcinoma call lines but not in any of the sarcoma cell lines examined. The K-sam-I-type transcript was expressed in both carcinoma and sarcoma cell lines. Furthermore, KGF enhanced the DNA synthesis of the esophageal cancer cells, TE-1, in a dose-dependent manner, while the effect of bFGF was not substantial. In contrast, the glioblastoma cell line, A-172, that expressed the bFGF receptor showed a mitogenic response to bFGF but not to KGF. These data suggest that KGF is a growth factor used preferentially in cancer cells, and this preference is based on the presence of the K-sam.II.type receptor in carcinoma cells but not in sarcoma cells due to alternative splicing.

from normal human brain cDNA library, and K-sam-II cDNA was

from the KATO-III cDNA library (11). Comparison of the K-sam-I and K-sam-II cDNAs revealed completely different nucleotide se-

quences in the second half of the third extracellular Ig-like domain; this region of the K-sam-II cDNA was identical to that of the KGF

receptor, which showed high-affinity binding to KGF but not to bFGF, whereas the corresponding region of the K-sam-I cDNA was identical

to that of human bek, which is the high-affinity receptor for bFGF but not for KGF (8, 12-16). A genomic analysis around the third Ig-like domain of K-sam/bek suggests that the K-sam-II-type and K-sam-I- type messages are transcribed from the same gene by an alternative splicing mechanism (14, 15, 17). We and others have also noted that there are several other splicing variations for the K-sam-I-type and K-sam-II-type transcripts, including those with and without the first Ig-like domain.

Here we report that the K-sam-II-type transcript was expressed only in human cancer cells of epithelial origin, or carcinoma cells, while none of five cancer cells of nonepithelial origin, or sarcoma cells, expressed the K-sam-II transcript. We further showed the stimulation of [3H]thymidine uptake by KGF, but not by bFGF, in a carcinoma cell line containing the K-sam-II-type transcript. In contrast, [3H]thymidine uptake of a sarcoma cell line expressing the K-sam-I-type transcript was stimulated by bFGF but not by KGE

I N T R O D U C T I O N

We previously reported a receptor tyrosine kinase gene, K-sam, which was isolated as an amplified gene in a human stomach cancer cell line, KATO-III, by the in-gel DNA renaturation method (1-3).

The K-sam-related genes, N-sam and sam3, have been identified (4, 5). An analysis of the nucleotide sequences of the K-sam, N-sam, and sam3 cDNAs 3 revealed that they are members of the FGFR gene

family (4--6). At least four distinct FGFRs, that is, FGFR1, FGFR2, FGFR3, and FGFR4, have been isolated to date (7-10); K-sam is identical to the human bek/FGFR2 gene (6), N-sam is identical to human FLG/FGFR1 (4), and sam3 is presumably the rodent counter- part of human FGFR3 (5).

We have identified at least four types of K-sam cDNA from various

sources (11). K-sam-I and K-sam-II cDNAs encode membrane-bound receptors, whereas K-sam-Ill and K-sam-IV appear to represent se- cretory forms of the K-sam receptors. K-sam-I cDNA was cloned

Received 7/16/93; accepted 11/8/93. The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

a Supported in part by a Grant-in-Aid for the Comprehensive 10-year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan; by Grants-in-Aid for Cancer Research from the Ministry of Health and Welfare of Japan and from the Ministry of Education, Science, and Culture of Japan; by the Uehara Memorial Foundation; and by the Bristol-Myers Squibb Foundation. H. Is., Y. H., H. It., T. K., and T. Y. were awardees of Research Resident Fellowships from the Foundation for Promotion of Cancer Research.

2 To whom requests for reprints should be addressed. 3 The abbreviations used are: cDNA, complementary DNA; FGFR, fibroblast growth

factor receptor; Ig, immunoglobulin; KGF, keratinocyte growth factor; bFGF, basic FGF; FCS, fetal calf serum; PCR, polymerase chain reaction; RT-PCR, reverse transcription- polymerase chain reaction; Tin, melting temperature; MTI', 3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyl tetrazolium bromide.

M A T E R I A L S A N D M E T H O D S

Cells, Culture Conditions, and RNA Preparation. Thirteen cancer cell lines, five sarcoma cell lines, an immature teratoma cell line, and a TE-10 esophageal cancer cell line were used in the present studies (Table 1). KATO- III, HSC-39, MKN45, Lu-143, Lu-140, Lu-135, PC-13, PC-10, PC-3, PC-l, A549, and NCC-IT cells were maintained in RPMI 1640 supplemented with 10% FCS, while TE-1, TE-10, A-172, HT-1080, RD, G-361, and G-402 cells were cultured in RPMI 1640 with 7% FCS, RPMI 1640 with 7% FCS, Dul- becco's modified Eagle's medium with 10% FCS, Eagle's minimum essential medium with 10% fetal bovine serum, Eagle's minimum essential medium with 10% FCS, McCoy's medium with 10% fetal bovine serum, and McCoy's medium with 10% FCS, respectively. Extraction of total RNA from these cultured cells was performed as described elsewhere (18). Polyadenylated RNAs from the human fetal brain and the adult brain were purchased from Clontech (Palo Alto, CA).

RT-PCR. cDNA was synthesized from 1 /xg of total RNAs or 0.2 /xg of polyadenylated RNAs using M-MLV reverse transcriptase (GIBCO BRL, Gaithersburg, MD). We designed the following three pairs of primers (Fig. 1): upstream primer K7-7, 5'-CACTCGGGGATAAATAG'Iq'CCAATGC-3', and downstream primer K7-11, 5'-TCCAGGCGCTTGCTGTITFGG-3', for the K-sam-II-type second half of the third Ig-like domain; upstream primer PK-9, 5'-AGATTGAGGTrCTCTATATI'C-3', and downstream primer PK-12, 5'- TATCCTCACCAGCGGGGTGTF-3', for the K-sam-I-type transcript; upstream primer NS-10, 5'-CAGATCITGAAGACTGCTGGA-3', and downstream primer NS-13, 5'-GCTAGCATGGGAGTCCCACTG-3', for the N-sam-type transcript. PCR was carried out for 30 cycles. The thermal cycle conditions were: denaturation at 94~ for 30 s; annealing at 65~ for the K-sam-II-type transcript (Tm= 71~ 58~ for the K-sam-I-type transcript (Tin = 61~ or 62~ for the N-sam-type transcript (Tm= 65~ for every 30 s; and extension at 72~ for 1 min. The products were separated by electro- phoresis in a 3% agarose gel. The nucleotide sequence of the K-sam-II,

518

Research. on February 21, 2020. © 1994 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

K-sam EXPRESSION IN CANCER CELL LINES

Table 1 Tumor cell lines used for analysis for presence of K-sam and N-sam transcripts

Cell Origin K - s a m - I I a K - s a m - I N - s a m

Stomach cancer KATO-III Signet ring cell ca. b + + - HSC-39 Signet ring cell ca. + + + MKN45 Poorly differentiated adenoca. + + +

Esophageal cancer T E - 1 Well-differentiated squamous + + +

cell ca.

Lung cancer Lu-143 Small cell ca. + - + Lu-140 Small cell ca. + - + Lu-135 Small cell ca. + + - PC-13 Large cell ca. - + + PC-10 Moderately differentiated _ + +

squamous cell ca. P C - 3 Well-differentiated adenoca. + - - PC-1 Poorly differentiated - + +

squamous cell ca. A 5 4 9 Bronchioalveolar adenoca. - + +

Sarcoma A - 1 7 2 Glioblastoma - - + HT-1080 Fibrosarcoma - + + RD Rhabdomyosarcoma - +_ + G-361 Malignant melanoma - - + G - 4 0 2 Leiomyoblastoma - - +

Other NCC-IT Immature teratoma + + +

a The presence of K-sam and N-sam transcripts were analysed by RT-PCR; +, presence of the transcripts; _+, presence of small amounts of the transcripts; -, absence of the transcripts.

b Ca., carcinoma, adenoca., adenocarcinoma.

K-sam-I, and N-sam cDNAs predict that the three products of RT-PCR are 156, 374, and 449 base pairs in size, respectively.

RNA Blot Analysis. Samples of 20/xg of total RNA were fractionated on a 1% agarose/formaldehyde gel and transferred onto the NitroPlus membrane (Micron Separations, Inc., Westboro, MA) as described (18). Hybridization was performed under a high-stringency condition at 42~ for 16-24 h in 50% formamide containing 0.65 M NaC1 and was followed by washing in a buffer consisting of 0.1 • standard saline citrate and 0.1% sodium dodecyl sulfate at 65~ for 1 h. Probes were K7-3Ig and PK-3Ig that were made by RT-PCR using the following primers: upstream primer, 5'-CACTCGGG- GATAAATAGTI'CC-3', and downstream primer, 5'-'I'TGCTGTIqTGGCAG- GACAG-3', for K7-3Ig probe; upstream primer, 5'-ACGGACAAAGAGAT- TGAGG'IT-3', and downstream primer, 5'-CCATGCAGAGTGAAAGGATA- 3', for PK-3Ig probe (Fig. 1). These probes hybridized specifically to the second half of the third Ig-like domain of the K-sam-II and the K-sam-I cDNAs, respectively.

Mitogenic Assays. 2 • 104 cells/well of TE-1 cells and A-172 cells were seeded in a 24-well plate (Nunc, Roskilde, Denmark) in RPMI 1640 with 7% FCS and Dulbecco's modified Eagle's medium with 10% FCS, respectively. After incubation for 24 h, the serum concentration in the medium was reduced to 0.01% for 48 h and 36 h, respectively. Increasing concentrations of a ligand protein, KGF or bFGF, were added to the culture medium in the presence of 50 /tg/ml of heparin (Sigma Chemical Co., St. Louis, MO). Transferrin was added to TE-1 cells in the concentration of 5/xg/ml. After incubation of TE-1 cells for 36 h or incubation of A-172 cells for 48 h, the cells were pulse-labeled with 0.5 /~Ci/ml [3H]thymidine (925 GBq/mmol; Amersham, Tokyo, Japan) for 6 h for TE-1 cells or for 4 h for A-172 cells. The cells were subsequently washed with phosphate-buffered saline, and 10% trichloroacetic acid-insoluble radioactivity was determined as described (19). Under the conditions used, the cells stayed alive during the [3H]thymidine incorporation assay as shown by trypan blue exclusion. We also examined the [3H]thymidine incorporation of esophageal cancer TE-10 cells in the same condition as in the TE-1 cells. MTT assay was performed to assess the growth stimulation of the cells by KGE Briefly, 1 • 103 TE-10 esophageal carcinoma cells were seeded in each well of a 96-well plate and cultured for 4 days in RPMI 1640 containing 0.7% FCS and various amounts ranging from 100 pg/ml to 100 ng/ml of KGE MTI" assay was performed using a kit available from Chemicon (Temecula, CA) according to the manufacturer's instructions.

R E S U L T S

RT-PCR Analysis of the Expression of the Second Hal f o f the Third Ig-like Domain of the K-sam Transc r ip t . Using the RT-PCR

technique, we examined the expression pattern of the second half of

the third Ig-like domain of the K-sam-II-type and K-sam-I-type tran-

scripts in human cancer cell lines. The second half of the third Ig-like

domain of the K-sam-I eDNA is 80% homologous to the N-sam~ FGFR1 eDNA at the nucleotide level (4, 11). In order to avoid a

cross-reaction between the K-sam-I and the N-sam sequences in PCR

analysis, we designed the downstream primers in the juxtamembrane

region and determined the respective annealing temperatures by de-

ducing Tins (Fig. 1). We ascertained by PCR analysis that the three

pairs of primers for the K-sam-II, K-sam-I, and N-sam cDNAs am-

plify only the corresponding sequences (Fig. 2A, Lanes 13-15).

In RNA samples from the three gastric cancer cell lines examined,

KATO-III, HSC-39, and MKN45 cells, a 156-base pair PCR product

corresponding to the K-sam-II-type transcript and a 374-base pair

product corresponding to the K-sam-I-type transcript were observed

(Fig. 2A; Table 1). A 449-base pair product corresponding to the

N-sam-type message was found in the two cell lines except for KATO-

III. In RNA from the esophageal cancer cell line TE-1, all the three

PCR products were detected, each corresponding to the K-sam-II- type, K-sam-I-type, and N-sam-type transcripts. In the five lung can-

cer cell lines, Lu-143, Lu-140, Lu-135, PC-10, and PC-3 cells, the

K-sam-II-type transcript was found; in Lu-135 and PC-10 cells, the

K-sam-I transcript was also detected. In the three lung cancer cell

lines, PC-13, PC- l , and A549 cells, the K-sam-II-type message was

not detected, whereas the K-sam-I-type message was observed. The

N-sam-type transcript was detected in six of eight lung cancer cell

lines; Lu-135 and PC-3 cells did not have the N-sam-type transcript.

In the analysis of the three sarcoma cell lines, A-172, G-361, and

G-402 cells, neither K-sam-II-type nor K-sam-I-type transcript was

identified. In RNAs from the two sarcoma cell lines, HT-1080 and RD

cells, the K-sam-I-type PCR band was observed very weakly, but the

band corresponding to the K-sam-II-type transcript was not detected

(Fig. 2B). The N-sam-type transcript was present in all these sarcoma

cell lines. In the immature teratoma cell line, NCC-IT, three bands

corresponding to the K-sam-II-type, K-sam-I-type, and N-sam-type transcripts were observed. On the other hand, both the fetal brain and

the adult brain expressed the K-sam-I-type and N-sam-type transcripts

but not the K-sam-II-type transcript.

R N A Blot Analysis of the Third Ig-like Domain of the K-sam Transc r ip t . To compare quantitatively the amount of the K-sam-II- type transcript with that of the K-sam-I type in carcinoma and sarcoma

cell lines, RNA blot hybridization was performed using the specific

probes, K7-3Ig and PK-3Ig (Fig. 1). We ascertained by the hybrid-

ization of these probes to the K-sam-II and K-sam-I cDNAs that these

probes did not cross-hybridize to each other or to the N-sam sequence

under high-stringency conditions (data not shown). In RNA blot

analysis, the signal of the K-sam-II-type third Ig-like domain in

KATO-III and HSC-39 cells was detected with higher intensity than

that of TE-1 and MKN45 cells (Fig. 3), as expected from more than

50-fold amplification of the K-sam gene in the former two cell lines

(6). 4 The amount of the K-sam-II-type transcript was much more than

that of the K-sam-I-type transcript in these four tumors. Two K-sam- II-type messages, 3.5 kilobases and 4.0 kilobases, were detected in

RNA from KATO-III cells. They may correspond to subclasses of the

K-sam-II-type transcripts, including those with and without the first

Ig-like domain (Fig. 1). Similar multiple transcripts were also oh-

4 yo Hattori, unpublished data.

519




Fig. 1. Primers and probes used for analysis of the third Ig-like domain of the K-sam and N-sam transcripts. NH2-terminal portions of the K-sam and N-sam cDNAs were schematically shown. Several variations for the K-sam and N-sam messages are known. For instance, those with and without the first Ig-like domain were identified, which are shown here for the K-sam-II cDNAs. Ig 1, first Ig-like domain; Ig 2, second Ig-like domain; lg 3, third Ig-like domain; TM, transmembrane domain; JM, juxtamembrane domain; TK, tyrosine kinase domain.

served in other cell lines, and they are considered to be generated by alternative splicing, the pattern of which could vary among different cells (15). 5

Biological Response to Ligands. To examine the responsiveness to KGF and bFGF of the cancer cells containing the K-sam or N-sam transcript, mitogenic assay was performed. TE-1 esophageal cancer cells, which contain predominantly larger amounts of the K-sam-II-

type transcript over the K-sam-I-type message, showed increased thymidine uptake in response to KGF in a dose-dependent manner but did not show an apparent increase in thymidine uptake when the cells

were cultured with bFGE The experiment was repeated four times, and one typical result is presented (Fig. 4A). The KGF protein was clearly a potent mitogen for TE-1 cells with a half-maximal stimula-

5 H. Itoh, Y. Hattori, H. Sakamoto, H. Ishii, T. Kishi, H. Sasaki, T. Yoshida, M. Koono, T. Sugimura, and M. Terada. Preferential alternative splicing in cancer generates a K-sam mRNA with higher transforming activity, submitted for publication.

tion of the DNA synthesis at about 2 ng/ml. We also observed a similar increase in the [3H]thymidine incorporation for another esophageal cancer cell line, TE-10, and the cells showed growth stimulation assessed by Mq"r assay after culture with KGF (data not shown). On the other hand, the culture with bFGF enhanced thymidine uptake of A-172 glioblastoma cells expressing N-sam in a dose-dependent manner. The K-sam gene was not expressed in A-172 cells, and the cells did not show a response to KGF under the experimental conditions used (Fig. 4B).

DISCUSSION

Recently, it has been demonstrated that the K-sam-II-type transcript is present specifically in noncancerous epithelial cells (13, 15, 20). Here we showed that all cell lines that contained the K-sam-II-type

transcript belonged to those derived from carcinomas. So far, there have been no sarcoma cells that express the K-sam-II-type transcript,

520




Fig. 2. RT-PCR analysis of K-sam and N-sam transcripts. K~ band with the size of 156 base pairs using primers K7-7 and K7-11 showing the presence of the K-sam-II transcript; P, band size of 374 base pairs using primers PK-9 and PK-12 showing the presence of the K-sam-I transcript; N, band size of 449 base pairs using primers NS-10 and NS-13 showing the presence of N-sam. A, carcinoma cell lines. Lanes 1-3, KATO-III, HSC-39, and MKN45 gastric cancer cells, respectively; Lane 4, TE-1 esophageal cancer cells; Lanes 5-12, Lu-143, Lu- 140, Lu-135, PC-13, PC-10, PC-3, PC-l, and A549 lung cancer cells, respectively; Lane 13, K-sam-II cDNA; Lane 14, K-sam-I cDNA; Lane 15, N-sam cDNA. B, Lane 1, A-172 glioblastoma cells; Lane 2, HT-1080 fibrosarcoma cells; Lane 3, RD rhabdomyosarcoma ceils; Lane 4, G-361 malignant melanoma cells; Lane 5, G-402 leiomyoblastoma cells; Lane 6, NCC-IT immature teratoma cells; Lane 7, human fetal brain; Lane 8, human adult brain.

B

even when searched for by the RT-PCR method using specific primers. Moreover, in some carcinoma cells containing the K-sam transcript, the amount of the K-sam-II-type transcript was much more abundant than that of the K-sam-l-type transcript, revealed by RNA blot analysis. The various amounts of the K-sam-I-type transcript were detected widely in both carcinoma and sarcoma cells. Recent studies revealed that the K-sam-II-type and K-sam-I-type messages are generated by an alternative splicing of the same K-sam gene (14, 15, 17). The molecular mechanism determining the carcinoma cell-specific splicing pattern remains to be elucidated.

Analysis of the DNA synthesis showed that TE-1 cells, in which the K-sam-II-type transcript was preferentially expressed, responded to KGF but not substantially to bFGF. KGF is produced from normal stromal fibroblast and, among the few known growth factors with mitogenic activity on the epithelial cells, KGF is specific to epithelial cells and has properties consistent with those of a major paracrine

effector in epithelial cell proliferation (21). It is likely that stromal cells that produce and secrete the KGF protein interact with carcinoma cells containing the K-sam-II-type transcript to promote their proliferation. It should also be noted that many carcinoma cells produce bFGF (22-24), which presumably stimulates proliferation of stromal cells in paracrine manner.

Those tumor cells which respond to KGF may have a higher po- tential to proliferate and metastasize; an immunohistochemical study using the anti-K-sam antibody indicated that K-sam staining was positive only in the scattered population of cells in the primary region but diffusely positive in the metastasized sites. 6 It is likely that K-sam- II-expressing carcinoma cells are selected positively during the pro- cess of the KGF-dependent cell growth.

All the sarcoma cell lines examined here did not contain the K-sam- II-type transcript, whereas the K-sam-I-type and/or N-sam-type transcript was detected. The major ligand for both the K-sam-I-type and N-sam proteins has been reported to be bFGE The A-172 cells that express only N-sam but not K-sam-I or K-sam-II showed the increased DNA synthesis in response to bFGF but not to KGF, suggest- ing that sarcoma cells showed bFGF-dependent growth but not KGF- dependent growth. The NCC-IT cells express the K-sam-I-type, K-sam-II-type, and N-sam messages simultaneously; this observation is congruous with the pleuripotent teratocarcinoma nature of this cell line (25), presumably with a mixed carcinoma and sarcoma pheno- type.

It remains to be clarified why the TE-1 cells did not show signifi- cant mitogenic response to bFGF, although the cells expressed not only the K-sam-II-type but also the K-sam-I-type and N-sam transcripts. Because TE-1 cells express mRNA of bFGF but not KGF 7, one possibility is that their high-affinity receptors for bFGF, K-sam-I and N-sam, are already saturated with endogenous bFGF, whereas the autocrine stimulation is not likely for the KGF signal transduction

6 y. Hattori, H. Itoh, S. Uchino, A. Ochiai, Y. Ino, H. Ishii, H. Sakamoto, N. Yamagu- Fig. 3. RNA blot analysis of K-sam transcripts. Twenty/xg of total RNA in each lane chi, K. Yanagihara, S. Hirohashi, T. Sugimura, and M. Terada. Immunohistochemical

were hybridized with the 32p-labeled probes K7-Ig and PK-Ig specific to the third Ig-like detection of K-sam protein in stomach cancer and the significance for prognosis, submit- domain of K-sam-II and K-sam-I transcripts, respectively. Lane 1, KATO-III; Lane 2, ted for publication. HSC-39; Lane 3, MKN45; Lane 4, TE-1. 7 S. Iida, unpublished data.

521




:3000

2500

2 0 0 0

1500

1000

500

A

' " ' " ' " ' " 1'0 " 0 1 0 10 2 1 0 3 4

p g / m l

lO 5

1700

1600

1500

1400

1300

1200

1100

1000

0 10 10 2

pg/ml

!

1'0 3 1 0 4 1 0 5

Fig. 4. Response of TE-1 and A-172 to KGF or bFGE The incorporation of [3H]- thymidine to an acid-insoluble fraction was measured in TE-1 cells and A-172 cells after culture with the increasing concentration of KGF or bFGE Each data count is the mean of two independent experiments. A, the response of TE-1 to KGF (O) or to bFGF (O); B, the response of A-172 to bFGF (O) or to KGF (O). The experiments were repeated four times, which gave reproducible results.

s y s t e m in these cells. T h e resu l t ing au toc r ine l oop migh t lead to the

r e d u c e d r e s p o n s i v e n e s s o f the TE-1 cel ls to the e x o g e n o u s b F G E

T h e p resen t s tud ies ind ica ted that c a r c i n o m a ce l l s r e s p o n d e d to

KGF, wh i l e s a r c o m a cel ls r e s p o n d e d to b F G F for the i r g rowth . It is

poss ib le that a spec i f i c b l o c k a d e o f l i g a n d - r e c e p t o r in t e rac t ion by

t a rge t ing to the s e c o n d ha l f o f the third Ig- l ike d o m a i n m a y lead to

d e v e l o p m e n t o f a n e w a p p r o a c h to the g rowth supp re s s ion o f c a n c e r

cells.

ACKNOWLEDGMENTS

We thank Dr. Stuart A. Aaronson for providing KGF; Takeda Chemical

Industry for the recombinant human bFGF; Dr. Kazuyoshi Yanagihara for

HSC-39; Dr. Tetsuro Nishihira for TE-1 and TE-10; Dr. Yukio Shimosato for

Lu-143, Lu-140, Lu-135, PC-13, PC-10, PC-3, and PC-l ; American Type

Culture Collection for A549; and Japanese Cancer Research Resources Bank

for A-172, HT-1080, RD, G-361, and G-402.

R E F E R E N C E S

1. Roninson, I. B. Detection and mapping of homologous, repeated and amplified DNA sequences by DNA renaturation in agarose gels. Nucleic Acid Res., 11: 5413--5431, 1983.

2. Nakatani, H., Tahara, E., Yoshida, T., Sakamoto, H., Suzuki, T., Watanabe, H., Sekiguchi, M., Kaneko, Y., Sakurai, M., Terada, M., and Sugimura, T. Detection of amplified DNA sequences in gastric cancers by a DNA renaturation method in gel. Jpn. J. Cancer Res., 77." 849-853, 1986.

3. Nakatani, H., Sakamoto, H., Yoshida, T., Yokota, J., Tahara, E., Sugimura, T., and Terada, M. Isolation of an amplified DNA sequence in stomach cancer. Jpn. J. Cancer Res., 81: 707-710, 1990.

4. Hattori, Y., Odagiri, H., Katoh, O., Sakamoto, H., Morita, T., Shimotohno, K., Tobi- nai, K., Sugimura, T., and Terada, M. K-sam-related gene, N-sam, encodes fibroblast growth factor receptor and is expressed in T-lymphocytic tumors. Cancer Res., 52: 3367-3371, 1992.

5. Katoh, O., Hattori, Y., Sasaki, H., Sakamoto, H., Fujimoto, K., Fujii, T., Sugimura, T., and Terada, M. Isolation of the complementary DNA encoding a mouse heparin; binding growth factor receptor with the use of a unique kinase insert sequence. Cancer Res., 53: 1136--1141, 1993.

6. Hattori, Y., Odagiri, H., Nakatani, H., Miyagawa, K., Naito, K., Sakamoto, H., Katoh, O., Yoshida, T., Sugimura, T., and Terada, M. K-sam, an amplified gene in stomach cancer, is a member of the heparin-binding growth factor receptor genes. Proc. Natl. Acad. Sci. USA, 87: 5983-5987, 1990.

7. Reid, H. H., Wilks, A. E, and Bernard, O. Two forms of the basic fibroblast growth factor receptor-like mRNA are expressed in the developing mouse brain. Proc. Natl. Acad. Sci. USA, 87: 1596-1600, 1990.

8. Dionne, C. A., Crumley, G., Bellot, E, Kaplow, J. M., Searfoss, G., Ruta, M., Burgess, W. H., Jaye, M., and Schlessinger, J. Cloning and expression of two distinct high- affinity receptors cross-reacting with acidic and basic fibroblast growth factors. EMBO J., 9: 2685-2692, 1990.

9. Keegan, K., Johnson, D. E., Williams, L. T., and Hayman, M. J. Isolation of an additional member of the fibroblast growth factor receptor family, FGFR-3. Proc. Natl. Acad. Sci. USA, 88: 1095-1099, 1991.

10. Partanen, J., M/ikel/i, T. P., Eerola, E., Korhonen, J., Hirvonen, H., Claesson-Welsh, L., and Alitalo, K. FGFR-4, a novel acidic fibroblast growth factor receptor with a distinct expression pattern. EMBO J., 10: 1347-1354, 1991.

11. Katoh, M., Hattori, Y., Sasaki, H., Tanaka, M., Sugano, K., Yazaki, Y., Sugimura, T., and Terada, M. K-sam gene encodes secreted as well as transmembrane receptor tyrosine kinase. Proc. Natl. Acad. Sci. USA, 89: 2960-2964, 1992.

12. Johnson, D. E., Lee, P. L., Lu, J., and Williams, L. T. Diverse forms of a receptor for acidic and basic fibroblast growth factors. Mol. Cell. Biol., 10: 4728-4736, 1990.

13. Champion-Arnaud, P., Ronsin, C., Gilbert, E., Gesnel, M. C., Houssaint, E., and Breathnach, R. Multiple mRNAs code for proteins related to the BEK fibroblast growth factor receptor. Oncogene, 6: 979-987, 1991.

14. Johnson, D. E., Lu, J., Chen, H., Werner, S., and Williams, L. T. The human fibroblast growth factor receptor genes: a common structural arrangement underlies the mecha- nisms for generating receptor forms that differ in their third immunoglobulin domain. Mol. Cell. Biol., 11: 4627-4634, 1991.

15. Miki, T., Bottaro, D. P., Fleming, T. P., Swith, C. L., Burgess, W. H., Chan, A. M-L., and Aaronson, S. A. Determination of ligand-binding specificity by alternative splicing: two distinct growth factor receptors encoded by a single gene. Proc. Natl. Acad. Sci. USA, 89: 246-250, 1992

16. Crumley, G., Bellot, E, Kaplow, J. M., Schlessinger, J., Jaye, M., and Dionne, C. A. High-affinity binding and activation of a truncated FGF receptor by both aFGF and bFGE Oncogene, 6: 2255-2262, 1991.

17. Yayon, A., Zimmer, Y., Guo-Hong, S., Avivi, A., Yarden, Y., and Givol, D. A con- fined variable region confers ligand specificity on fibroblast growth factor receptors: implications for the origin of the immunoglobulin fold. EMBO J., 11: 1885-1890, 1992.

18. Maniatis, T., Fritsch, E. E, and Sambrook, J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982.

19. Miyagawa, K., Sakamoto, H., Yoshida, T., Yamashita, Y., Mitsui, Y., Furusawa, M., Maeda, S., Takaku, F., Sugimura, T., Terada, M. hst-1 transforming protein: expression in silkworm cells and characterization as a novel heparin-binding growth factor. Oncogene, 3: 383-389, 1988.

20. Rubin, J. S., Osada, H., Finch, P. W., Taylor, W. G., Rudikoff, S., and Aaronson, S. A. Purification and characterization of a newly identified growth factor specific for epithelial cells. Proc. Natl. Acad. Sci. USA, 86: 802--806, 1989.

21. Finch, P. W., Rubin, J. S., Miki, T., Ron, D., and Aaronson, S. A. Human KGF is FGF-related with properties of a paracrine effector of epithelial cell growth. Science (Washington DC), 245: 752-755, 1989.

22. Tanimoto, H., Yoshida, K., Yokozaki, H., Yasui, W., Nakayama, H., Ito, H., Ohama, K., and Tahara, E. Expression of basic fibroblast growth factor in human gastric carcinomas. Virchows Arch. B Cell Pathol., 61: 263-267, 1991.

23. Nakamoto, T., Chang, C., Li, A., and Chodak, G. W. Basic fibroblast growth factor in human prostate cancer ceils. Cancer Res., 52: 571-577, 1992.

24. Eguchi, J., Nomata, K., Kanda, S., Igawa, T., Taide, M., Koga, S., Matsuya, E, Kanetake, H., and Saito, Y. Gene expression and immunohistochemical localization of basic fibroblast growth factor in renal cell carcinoma. Biochem. Biophys. Res. Com- mun., 183: 937-944, 1992.

25. Teshima, S., Shimosato, Y., Hirohashi, S., Tome, Y., Hayashi, I., Kanazawa, H., and Kakizoe, T. Four new germ cell tumor cell lines. Lab. Invest., 59: 328-336, 1988.

522



1994;54:518-522. Cancer Res Hideshi Ishii, Yutaka Hattori, Hiroshi Itoh, et al. Factor-dependent Growth in Carcinoma Cell Lines

Product Provides Keratinocyte GrowthsamDomain of K-Preferential Expression of the Third Immunoglobulin-like

Updated version

http://cancerres.aacrjournals.org/content/54/2/518

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/54/2/518To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Documents

Product Provides Keratinocyte Growth Factor-dependent ...of Education, Science, and Culture of Japan; by the Uehara Memorial Foundation; and by the Bristol-Myers Squibb Foundation