Principles of Molecular Biology - Assiut University€¦ · Principles of Molecular Biology Chromosomes The 3 billion bp in the human genome are organized into 23 distinct, physically

Principles of Molecular Biology

1


Training course on the

Principles of Molecular

Biology

Course Coordinator

Prof.Dr. Mohamed M.H. El-Defrawy

Assiut University, Faculty of Agriculture Genetics Department, Biotechnology Lab., Assiut 71516, Egypt.

Office: +2088-2412743 Fax: +2088-2412743 Cellular phone (mobile): +20164016202

email: [email protected], [email protected]@gmail.com

This wiki-booklet is available for anyone who needs such

information. Anyone can contribute to it by sending an

email to the course coordinator including the proposed

modification that he/she sees that they are adding valuable

information or update(s)

2010

2

mailto:[email protected]

mailto:[email protected]

http://us.f313.mail.yahoo.com/ym/[email protected]


Gontributors

-Prof. Dr. Fathy M. Saleh⊗, Professor of Microbial Genetics

-Prof. Dr. Mohamed M.H. El-Defrawy⊗, Professor of

Population and Quantitative Genetics⊗Assiut University, Faculty of Agriculture, Department of

Genetics, Assiut, Egypt.

-Dr. Péter Poczai♣∇ (who revised the manuscript also)∇Present address:

CIMO Research FellowPlant Biology (Biocenter 3), PO Box 65, FIN-00014 UNIV. HELSINKI, FINLANDPhone: +358-(0)-9-19167790Facsimle +358-(0)-9-19157788

♣Former address:Doctor of Plant HealthDept. of Plant Science and Biotechnology, University of Pannonia, H-8360, Festetics 7, Keszthely, Hungary

-Mr. Mohamed A. Khirshy Yousef⊗♥

♥Present address;Ph.D Student (CICY)Centro de investigacion cientifica de Yucatanwww.cicy.mxMexico - Yucatan - Meridamobile:+5219992630144

3

http://www.cicy.mx/


Table of contents

DNA structure and replication

4

Genome fine structure12

Polymerase Chain Reaction (PCR) 21

Types of PCRs 36

Quantitation of DNA and RNA with Absorption and Fluorescence

spectroscopy 60

Monitoring and interpreting separations of DNA through agarose gels 76

Genotyping 81

DNA Isolation protocoles 89

Gel reading and troubleshooting 99

Statistical analysis 107

4


DNA structure

Introduction

The complete set of instructions for making an organism is called its genome.

It contains the master blueprint for all cellular structures and activities for the lifetime

of the cell or organism. Found in every nucleus of a person's many trillions of cells.

The human genome consists of tightly coiled threads of deoxyribonucleic acid

(DNA) and associated protein molecules, organized into structures called

chromosomes.

If unwound and tied together, the strands of DNA would stretch more than 5

feet but would be only 50 trillionths of an inch wide. For each organism, the

components of these slender threads encode all the information necessary for

building and maintaining life, from simple bacteria to remarkably complex human

beings. Understanding how DNA performs this function requires some knowledge of

its structure and organization.

DNA:

It's what makes you unique. It's the stuff that tells each and every one of your

body's 10 trillion cells what it's supposed to be and what it's supposed to do and

5


where. And although your DNA is different from that of every other person in the

world -unless you have an identical twin- it's the same in every cell that makes up

your body.

That DNA is unique from person to person but the same from cell to cell in one

person can be a handy thing, especially when it comes to DNA fingerprinting. DNA

fingerprints can be used for anything from determining a biological mother or father

to identifying the suspect of a crime. And, as may someday prove to be the case with

Sam Sheppard, it can be used to clear someone's name.

But what exactly is a DNA fingerprint? Well, it certainly isn't an inky impression of a

DNA strand. Compared to unimaginably small DNA, a fingerprint is HUGE. So what

is it that we're looking at, and how is one of these fingerprints made? Here's your

chance to find out. You'll find out by solving a mystery a crime of sorts. Solving the

mystery involves creating a DNA fingerprint (we'll supply the lab and all necessary

materials) and comparing this fingerprint to those of the suspects.

In humans, as in other higher organisms, a DNA molecule consists of two strands that

wrap around each other to resemble a twisted ladder whose sides, made of sugar and

phosphate molecules are connected by rungs of nitrogen-containing chemicals called

bases. Each strand is a linear arrangement of repeating similar units called

nucleotides, which are each composed of one sugar, one phosphate, and a nitrogenous

base. Four different bases are present in DNA: adenine (A), thymine (T), cytosine (C),

and guanine (G). The particular order of the bases arranged along the sugar-

phosphate backbone is called the DNA sequence; the sequence specifies the

6


exact genetic instructions required to create a particular organism with its own unique

traits.

DNA Structure.

The four nitrogenous bases of DNA are arranged

along the sugar-phosphate backbone in a particular order (the

DNA sequence), encoding all genetic instructions for an

organism. Adenine (A) pairs with thymine (T), while

cytosine (C) pairs with guanine (G). The two DNA strands

are held together by weak hydrogen bonds between the bases.

A gene is a segment of a DNA molecule (ranging from fewer

than 1 thousand bases to several million), located in a

particular position on a specific chromosome, whose base

sequence contains the information necessary for protein

synthesis.

The two DNA strands are held together by weak hydrogen bonds between the bases on

each strand, forming base pairs (bp). Genome size is usually stated as the total number

of base pairs; the human genome contains roughly 3 billion bp.

7


Comparative Sequence Sizes (Bases)

(yeast chromosome 3) 350 Thousand

Escherichia coli (bacterium) genome 4.6 Million

Largest yeast chromosome now mapped 5.8 Million

Entire yeast genome 15 Million

Smallest human chromosome (Y) 50 Million

Largest human chromosome (1) 250 Million

Entire human genome 3 Billion

Comparison of Largest Known DNA Sequence with Approximate Chromosome and Genome Sizes of Model Organisms and Humans.

Each time a cell divides into two daughter cells, its full genome is duplicated; for

humans and other complex organisms, this duplication occurs in the nucleus. During

cell division the DNA molecule unwinds and the weak bonds between the base pairs

break, allowing the strands to separate. Each strand directs the synthesis of a

complementary new strand, with free nucleotides matching up with their

complementary bases on each of the separated strands. Strict base-pairing rules are

adhered to adenine will pair only with thymine (an A-T pair, with 2 hydrogen bonds)

and cytosine with guanine (a C- G pair, with 3 hydrogen bonds). Each daughter cell

receives one old and one new DNA strand. The cells adherence to these base-pairing

rules ensures that the new strand is an exact copy of the old one.

8


DNA Replication

During replication the DNA molecule unwinds,

with each single strand becoming a template for

synthesis of a new, complementary strand. Each

daughter molecule, consisting of one old and

one new DNA strand, is an exact copy of the

parent molecule.

This minimizes the incidence of errors (mutations) that may greatly affect the

resulting organism or its offspring.

Genes:Each DNA molecule contains many genes the basic physical and functional units of

heredity. A gene is a specific sequence of nucleotide bases, whose sequences carry the

information required for constructing proteins, which provide the structural

components of cells and tissues as well as enzymes for essential biochemical

reactions.

Human genes vary widely in length, often extending over thousands of bases, but only

about 10% of the genome is known to include the protein-coding sequences (exons)

of genes. Interspersed within many genes are intron sequences, which have no known

coding function. The balance of the genome is thought to consist of other noncoding

regions (such as control sequences and intergenic regions), whose functions are

obscure. All living organisms are composed largely of proteins; humans can

synthesize at least 100,000 different kinds. Proteins are large, complex molecules

made up of long chains of subunits called amino acids. Twenty different kinds of

amino acids are usually found in proteins. Within the gene, each specific sequence of

three DNA bases (codons) directs the cells protein-synthesizing machinery to add

specific amino acids. For example, the base sequence ATG codes for the amino acid

methionine. Since 3 bases code for 1 amino acid, the protein coded by an average-

9


sized gene (3000 bp) will contain 1000 amino acids. The genetic code is thus a series

of codons that specify which amino acids are required to make up specific proteins.

The protein-coding instructions from the genes are transmitted indirectly through

messenger ribonucleic acid (mRNA), a transient intermediary molecule similar to a

single strand of DNA. For the information within a gene to be expressed, a

complementary RNA strand is produced (a process called transcription) from the

DNA template in the nucleus. This mRNA is moved from the nucleus to the cellular

cytoplasm, where it serves as the template for protein synthesis. The cells protein-

synthesizing machinery then translates the codons into a string of amino acids that

will constitute the protein molecule for which it codes. In the laboratory, the mRNA

molecule can be isolated and used as a template to synthesize a complementary DNA

(cDNA) strand, which can then be used to locate the corresponding genes on a

chromosome map. The utility of this strategy is described in the section on physical

mapping.

10


Gene Expression. When genes are expressed, the genetic information (base sequence) on

DNA is first transcribed (copied) to a molecule of messenger RNA (mRNA) in a process

similar to DNA replication. The mRNA molecules then leave the cell nucleus and enter the

cytoplasm, where triplets of bases (codons) forming the genetic code specify the particular

amino acids that make up an individual protein. This process, called translation, is

accomplished by ribosomes (cellular components composed of proteins and another class of

ribosomal RNA, rRNA) that read the genetic code from the mRNA, and the transfer RNAs

(tRNAs) transports amino acids to the ribosome(s) for attachment to the growing protein.

11


Chromosomes

The 3 billion bp in the human genome are organized into 23 distinct,

physically separate microscopic units called chromosomes. All genes are arranged

linearly along the chromosomes. The nucleus of most human cells contains 2 sets of

chromosomes, 1 set given by each parent. Each set has 23 single chromosomes 22

autosomes and an X or Y sex chromosome. (A normal female will have a pair of X

chromosomes; a male will have an X and Y pair.) Chromosomes contain roughly

equal parts of protein and DNA; chromosomal DNA contains an average of 150

million bases. DNA molecules are among the largest molecules now known.

Chromosomes can be seen under a light microscope and, when stained with certain

dyes, reveal a pattern of light and dark bands. Differences in size and banding pattern

allow the 23 chromosomes to be distinguished from each other, an analysis called a

karyotype. A few types of major chromosomal abnormalities, including missing or

extra copies of a chromosome or gross breaks and re-joinings (translocations), can be

detected by microscopic examination; Downs syndrome, in which an individual's cells

contain a third copy of chromosome 21, is diagnosed by karyotype analysis. Most

changes in DNA, however, are too subtle to be detected by this technique and require

molecular analysis. These subtle DNA abnormalities (mutations) are responsible for

many inherited diseases such as cystic fibrosis and sickle cell anemia or may

predispose an individual to cancer, major psychiatric illnesses, and other complex

diseases.

12


Human Karyoptype

Genome fine structure

Repeat sequence length: Varies from 1 nucleotide to whole gene

Repeated sequences are of two basic types: unique sequences that are repeated in one

area; and repeated sequences that are interspersed throughout the genomes. Satellites

are unique sequences that are repeated in tandem in one area. Depending on the length

of the repeat, they are classified as either:

Minisatellite: Short repeats of nucleotides.

Simple sequence repeats (SSRs, or microsatellites) are a class of DNA sequences

consisting of simple motifs or monomers of 1–6 nucleotides that are exact in identity,

repetition and are tandemly repeated from two or three up to a few dozen times at a

locus. SSRs have long been known to be distributed throughout the genomes of

eukaryotes and to be highly polymorphic. There is accumulating evidence that SSRs

serve a functional role, affecting gene expression, and that polymorphism of SSR tracts

may be important in the evolution of gene regulation.

Microsatellite: Very short repeats of nucleotides. Some trinucleotide repeats are

found in coding regions (see, Trinucleotide repeat disorder). Most are found in

noncoding regions. Their function is unknown, if they have any specific function. They

are used as molecular markers which might be used in Maker Assisted Selection MAS

and in DNA fingerprinting.

13


Interspersed sequences are tandem repeats interspersed across the genome. They can

be classified based on their length as:

Short interspersed sequences (SINE):

The repeats are normally a few hundred base pairs in length. These sequences

constitute about 13% of the human genome with the specific Alu sequence accounting

for 5%. The Alu family is a family of repetitive elements in the Human genome. Alu

sequences are about 300 base pairs long. There are over one million Alu sequences

interspersed throughout the human genome however less than 0.5% is polymorphic.

Alu:

GC rich Length: ~ 280 base pairs Location: Untranslated intronic regions Species: Primate-specific Methylation: Maternal Function: mostly unknown. Do not encode protein; LINE dependent replication; associated with some diseases (e.g. breast cancer, hemophilia, diabetes mellitus type II). Polymorphism in: Myotonic dystrophy CTG repeats Mutations involving Alu elements: Occasional patient

o CCFDN: Only mutation identifiedo LGMD 2Ao Mental retardation with epilepsy, rostral ventricular enlargemento ACE polymorphismo Dystrophin-related cardiomyopathyo Mariner (Mariner-like) elements

Flanked sides by TA dinucleotide Length: ~80 bp Sequence structure

o 2 perfect inverted repeat sequences of 37 base pairso Separated by six unique base pairs (GAAAGT)

related to production of mutations in CMT 1A

Long interspersed sequences (LINE): The repeats are normally several thousand

base pairs in length. These sequences constitute about 21% of the human genome.

14


Both of these types are classified as retrotransposons. LINEs and SINEs are examples

where the sequences are repeats, but there are non-repeated sequences that can also be

retrotransposons.

Retrotransposons are sequences in the DNA that are the result of retrotransposition of

RNA. They are also called transposons via RNA intermediates. They

are genetic elements that can amplify themselves in a genome and are ubiquitous

components of the DNA of many eukaryotic organisms. They are a subclass

of transposons. They are particularly abundant in plants, where they are often a

principal component of nuclear DNA. In maize, 49-78% of the genome is made up of

retrotransposons. In wheat, about 90% of the genome consists of repeated sequences

and 68% of transposable elements. In mammals, almost half the genome (45% to 48%)

comprises transposons or remnants of transposons. Around 42% of the human genome

is made up of retrotransposons while DNA transposons account for about 2-3%.

Typical eukaryotic chromosomes contain much more DNA than is classified in the

categories above. The DNA may be used as spacing, or have other as-yet-unknown

function. Or, they may simply be random sequences of no consequence.

o Highly repetitive DNA is found in some untranslated regionso 6 to 10 base pair sequences may be repeated 100,000 to 1,000,000 timeso Whole genes may exist as tandem clusters of multiple copies (50 to 10,000)

o Multiple copy genes include histones, ribosomal RNA, tRNA, SMNo Allow more gene product to accumulate per unit timeo Meet high biosynthetic requirements during early developmento Repeat induced gene silencing: Via methylation and chromatin compaction

1 gene copy at locus expressed more effectively thanmultiple copies in arrays More repression when multiple copies of gene on 1 chromosome than with dispersion over several chromosomes

• Some DNA repeats present in numerous places and genes in genome• Some DNA repeats are mutation "hot spots"

o Cause mismatching during DNA replication, e.g. Aluo Form fragile chromosomal break points, e.g. CCG repeatso Number of repeats may be unstable during DNA replication, e.g. CAG repeats

o Repeat induced gene silencing: Via methylation and chromatin compaction 1 gene copy at locus expressed more effectively than multiple copies in arrays

15

http://en.wikipedia.org/wiki/Maize

http://en.wikipedia.org/wiki/DNA

http://en.wikipedia.org/wiki/Transposon

http://en.wikipedia.org/wiki/Eukaryote

http://en.wikipedia.org/wiki/Genome

http://en.wikipedia.org/wiki/Genetics


More repression when multiple copies of gene on 1 chromosome thanwith dispersion over several chromosomes

o Some DNA repeats present in numerous places & genes in genomeo Some DNA repeats are mutation "hot spots"

Cause mismatching during DNA replication, e.g. Alu Form fragile chromosomal break points, e.g. CCG repeats Number of repeats may be unstable during DNA replication, e.g. CAG repeats

• DNA Repeat types: Tandemly repeated DNA and Interspersed repetitive DNA

o Tandemly repeated DNA Repeats often associated with disease syndromes Telomeres

o Contain long arrays of TTAGGG repeatso Repeats form nucleoprotein complex: Associate with TERF proteins.

o Repeat function Protection of chromosome ends Replication of chromosome ends Control of telomere length

o Interspersed repetitive DNA Long Interspersed Nuclear Elements (LINEs)

o L1 element (Kpn repeat)o AT rich regionso Length: 6-8 kbo LINEs contain internal promotors for RNA polymerase IIIo Methylation: Paternalo Species: Mammals

Transposable elements with Long Terminal Repeatso Length: 1.5 - 10 kbpo Encode reverse transcriptaseo Flanked by 300 - 1000 bps terminal repeatso Regulation

Methylation: Paternal Repressive chromatin structures

o Include non-functional human endogenous retroviruses (hERV) DNA Transposons

o Single intron-less open reading frameo Encode transposaseo Two short inverted repeat sequences flanking the reading frame

o Transposable repeat elements: Possible adverse effects Direct insertional mutagenesis

o ~1 in 500 new germ line mutations 2" transposable elements Recombination between non-allelic repeats

o Can cause translocations and other re-arrangementso See CMT 1A

Presence of strong promotor regions

16


o Can cause inappropriate protein production Anti-sense production Demethylation in tumors

o Dysfunctional transposon activityo Inappropriate gene expressiono Increased Oncogene function

Inserted within geneso Effect: Reduced functiono See Fukuyama congenital muscular dystrophy

• Trinucleotide repeatso 10 possible sequence motifso Further functional variation depending on reading frameo Nomenclature:

Same nucleotide repeats can be written in different ways

o CCG, CGG, GCC are identicalo AGC, CAG are identical

AGC repeat in exon reading frame: Translated from CAG to polyglutamine

Repeat sequences are sometimes disease associated.

• p(CCG)n repeatso Frequency: Not uncommon in human genomeo Location: Usually in 5' untranslated regions of geneso Repeat sizes

Normal: Polymorphic range (25 to 55) Large: Full mutation (> ~230)

o Large mutation: Mechanisms of disease Chromosome susceptible to breakage near site May inactivate gene: Inhibits transcription of gene

o Expanded repeato Cytosine methylation of mutation & adjacent CpG residueso Interaction of CGG binding protein with expanded repeat sequence

• p(CAG)n repeatso Location

In exons of genes throughout genome Exception for SCA12

o Amino acid coding: Glutamineo Repeat sizes

Normal: Upper limit 32 to 40 Large: Lower limit 32 to 62 Exception is SCA6: Normal 4 to 18; Large 21 to 30 Reduced disease penetrance: HD 36 to 41 repeats; SCA2 32 to 34 repeats Intermediate alleles: CAG size

o From which new mutations arise

17

http://neuromuscular.wustl.edu/ataxia/domatax.html#sca12

http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=603363


o > than usual in general population, < than in patients with diseaseo Found clinically in some normal personso Huntington's: 29 to 35 repeats

Size range: Normal vs. diseaseo Mutually exclusive disease & normal range: SBMA; SCA 3, 6 & 7; DRPLAo No gap between normal & disease ranges: Huntington's; SCA1 & 2

o CAG repeat related diseases and Interruptions in CAG sequences

• p(CTG)n repeatso Location: 3' untranslated regiono Repeat sizes

Normal: 5 to 35 copies Intermediate range: 35 to 50 Mildly affected: 50 to 80 Severely affected: Up to 4,000 copies

o Diseases: Myotonic Dystrophy; SCA8o Inheritance: Dominanto Postulated disease mechanisms

Effect on RNA stability or processing Protein binding to large trinucleotide repeats Altered expression of flanking DNA into protein (DMAHP)

• p(GCG)n repeatso Nucleotide composition of repeats

Imperfect GCN triplets: Over-representation by GCG triplet

o Location: Exono Amino acid coding: Alanineo Stable during meiosis and mitosiso Normal proteins: Poly-Alanine repeats

Frequent in eucaryotic cells: Especially common in transcription factors Poorly conserved in vertebrates Commonly located

o Outside of other functional domainso N-terminal end of proteins

o Diseases: Poly-alanine repeat disorders General

o Disease types: Congenital malformations Especially skeletal & nervous system disorders

o Protein Functions: All transcription factor genes, except OPMD Mutant: Present; Stable

o Onset age: Young, except OPMD

18


o Comparison with other mutation types in same gene

Tend to produce milder disorders May not produce same disease manifestations

o Longer repeat sequences: Some disorders more severeo Inheritance

Dominant: Usual Recessive: Infantile spasm syndrome Dosage effect: Homozygous more severe than heterozygous

o Mutation mechanism: Unequal allelic homologous recombinationo Disease mechanism

Toxic gain of function Protein aggregation: Cytosol or Nucleus

Oculopharyngeal Muscular Dystrophy (OPMD)o Repeat sizes (OPMD)

Normal: 6 repeats Recessive OPMD: Homozygous 7 repeats Dominant OPMD: 8 to 13 repeats

Neural disorderso Congenital hypoventilation syndrome (CCHS): Paired mesoderm homeo box 2B (PHOX2B)

Normal 20 repeats; Disease 25 to 29 repeats

o Congenital hypoventilation syndrome : Hash-1 Normal 13 repeats; Disease 5 to 8 repeats

o Holoprosencephaly: ZIC2o Infantile spasm syndrome : Aristaless-related homeobox, X-linked (ARX)

Normal 10 to 12 repeats; Disease 17 to 20 repeats Other features: Mental retardation; Lissencephaly; Abnormal genitalia

o Mental retardation, X-linked, with isolated Growth hormone deficiency: SOX3

Normal 9 repeats; Disease 20 to 31 repeats

Skeletal disorderso Cleidocranial dysplasia (CCD)(Dominant): α1 core-binding factor (RUNX2)

Normal 11 to 17 repeats; Disease 27 repeats

o Synpolydactyly: HOXD13o Hand-Foot-Genital syndrome HOXA13

Normal 18 repeats; Disease 26 repeats

19

http://neuromuscular.wustl.edu/spinal/fsp.html#isxfsp

http://neuromuscular.wustl.edu/autonomic.html#rf

http://neuromuscular.wustl.edu/autonomic.html#rf

http://neuromuscular.wustl.edu/musdist/peeom.html#opd

http://neuromuscular.wustl.edu/musdist/peeom.html#opd


o Blepharophimosis/Ptosis/Epicanthus inversus syndrome (BPEIS): FOXL2

• p(AAG)n repeatso Location: Introno Repeat sizes

Normal: Polymorphic range (7 to 22) Large: Full mutation (200 to 900)

o Disease: Friedreich Ataxiao Inheritance: Recessiveo Disease mechanism: Reduced protein production

Nuclear Ribosomal Spacer regions:

Pe´ter Poczai (2009) Department of Plant Sciences and Biotechnology, Georgikon Faculty, University of Pannonia, Festetics 7, 8360 Keszthely, Hungary

The ribosomal RNA (rRNA) genes and their spacer regions have become widely used

as a source of phylogenetic information across the entire breadth of life. The popularity

of the rDNA locus for phylogenetics might be attributed to the phenomena that they

serve the same function in all free-living organisms. They have the same or almost the

same structure within a wide range of taxa. The coding regions, like the small- and

large subunit gene, represent some of the most conservative sequences in eukaryotes

which is a result of a strong selection against any loss-of-function mutation in

components of the ribosome subunits. The most conservative part appears to be the 30

end of the 26S rDNA representing the a-sarcin/ricin (S/R) loop. The information

provided by the rDNA locus in phylogenetic research is significant, and it can be used

at different taxonomic levels, since the specific regions of the rDNA loci are conserved

differentially. The spacer regions of the rDNA locus possess information useful for

plant systematics from species to generic level. They have also been used on studies of

speciation and biogeography, due to the high sequence variability and divergence.

There are three notable spacer regions: the external- and internal transcribed spacers

(ETS, ITS) and the intergenic spacer (IGS).

The internal transcribed spacer ITS as a phylogenetic marker:

The internal transcribed spacer (ITS) is intercalated in the 16S-5.8S-26S region

separating the elements of the rDNA locus (Fig. 1). The ITS region consists of three

parts: the ITS1 and ITS2 and the highly conserved 5.8S rDNA exon located in

between. The total length of this region varies between 500 and 750 bp in angiosperms

while in other seed plants it can be much longer, up to 1,500–3,500 bp. Both spacers

are incorporated into the mature ribosome, but undergo a specific cleavage during the

maturation of the ribosomal RNAs. It is now certain that ITS2 is sufficient for the

20

http://neuromuscular.wustl.edu/ataxia/recatax.html#FA


formation of the large subunit (LSU) rRNA during the ribosome biogenesis. The

correct higher order structure of both spacers is important to direct endonucleolytic

enzymes to proper cut sites. Although, the sequence length of the ITS2 is highly

variable between different organisms, Hadjiolova et al. (1994) identified structurally

homologous domains within mammals and Saccharomyces cerevisiae. In contrast to

the coding regions, spacers evolve more quickly, like the internal transcribed spacer

(ITS) region, which is extensively used as a marker for phylogenetic reconstruction at

different levels.

Fig. 1 Schematic presentation of the universal structure of the rDNA region in plants. (a) The chromosomal location of the rDNA regions. (b) Tandem arrays of the consecutive gene blocks (18S-5.8S-26S). In the tandem arrays each gene block is separated by an intergenic spacer (IGS) consisting of a 50 end and 30end external transcribed spacer (ETS). The two ETS regions are separated by a nontranscribed region (NTS). The transcription start site (TIS) labels the start position of the 50ETS. The small subunit (18S) and large subunit genes (5.8S and 26S) are separated by the internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2).

Since its first application by Porter and Collins (1991) it has become widely used for

phylogeny reconstruction. As a part of the transcriptional unit of rDNA, the ITS is

present in virtually all organisms. The advantages of this region are: (1) biparental

inheritance, in comparison to the maternally inherited chloroplast and mitochondrial

markers; (2) easy PCR amplification, with several universal primers available for a

various kind of organisms; (3) multicopy structure; (4) moderate size allowing easy

21


sequencing; and (5) based on published studies it shows variation at the level that

makes it suitable for evolutionary studies at the species or generic level. this variability

is due to frequently occurring nucleotide polymorphisms or to common

insertions/deletions in the sequence. This high rate of divergence is also an important

source to study population differentiation or phylogeography. It has been widely

utilized across the whole tree of life, including fungi, animals, different groups of

‘algae’ lichens, and bryophytes. In addition it is often used in the other two major

domains of the tree of life Archaea and Bacteria, where RISSC, a novel database for

ribosomal 16S–23S RNA genes and spacer regions is developed to provide easy access

to information. The high copy numbers allow for highly reproducible amplification and

sequencing results. The number of studies utilizing ITS in phylogenetic studies is

increasing, publicly available ITS sequences has tripled since 2003.The plant families

most intensively studied are Asteraceae, Fabaceae, Orchideaceae, Poaceae,

Brassicaceae, and Apiaceae. At the genus level there are for example more than 1,000

sequences available for different species of Carex (NCBI GenBank, nucleotide search

preformed in 15.02.2009). Besides several advantages there are many drawbacks for

use of rDNA ITS data in evolutionary studies. There are hundreds or thousands of ITS

copies in a typical plant genome. Inferring phylogeny from multigene families like ITS

can lead to erroneous results, because there is variation among the different repeats

present in a single eukaryote genome. Evidence now suggests that this variation among

ITS sequences of an organism is found only within organisms that are hybrids or

polyploids.

Poczai, P. and, J. Hyvönen (2009). Nuclear ribosomal spacer regions in plant phylogenetics: problems and prospects. Mol Biol Rep DOI 10.1007/s11033-009-9630-3.

Hadjiolova KV, Normann A, Cavaille´ J, Soupe´ne E, Mazan S, Hadjiolov AA, Bachellerie JP (1994). Processing of truncated mouse or human rRNA transcribed from ribosomal minigenes transfected into mouse cells. Mol Cell Biol 14:4044–4056.

Porter CH, Collins FH (1991). Species-diagnostic differences in the ribosomal DNA internal transcribed spacer from the sibling species Anopheles freeborni and Anopheles hermsi (Diptera: Culicidae). Am J Trop Med Hyg 45:271–279.

22


Polymerase Chain Reaction (PCR)

INTRODUCTION

In molecular biology, the polymerase chain reaction (PCR) is a technique to amplify a

single or few copies of a piece of DNA across several orders of magnitude, generating

thousands to billions of copies (amplicons) of a particular DNA sequence. The

technique was invented by Dr. Kary Mullins, 1983, for which he received the Nobel

Prize in Chemistry in 1993. The method relies on thermal cycling, consisting of

cycles of repeated heating and cooling of the reaction for DNA

melting and enzymatic replication of the DNA. Primers (short DNA fragments)

containing sequences complementary to the target region along with a DNA

polymerase (after which the method is named) are key components to enable selective

and repeated amplification. As PCR progresses, the DNA generated is itself used as a

template for replication, setting in motion a chain reaction in which the DNA template

is exponentially amplified. PCR can be extensively modified to perform a wide array

of genetic manipulations.

23

http://en.wikipedia.org/wiki/Exponential_growth

http://en.wikipedia.org/wiki/Chain_reaction

http://en.wikipedia.org/wiki/Taq_polymerase


http://en.wikipedia.org/wiki/Primer_(molecular_biology)

http://en.wikipedia.org/wiki/DNA_replication

http://en.wikipedia.org/wiki/Enzyme

http://en.wikipedia.org/wiki/DNA_melting


http://en.wikipedia.org/wiki/Thermal_cycler


http://en.wikipedia.org/wiki/DNA_replication

http://en.wikipedia.org/wiki/Molecular_biology


What do we need for PCR?

• DNA template that contains the DNA region (target) to be amplified.

• Two forward and reverse primers, which determine the beginning and end of the

region to be amplified. But sometimes one may use just one primer that plays

the role of forward and reverse primers.

• Nucleotides: the four dNTPs (Adenine, Thymine, Cytosine, Guanine) the building

blocks from which the DNA polymerases synthesizes a new DNA strand.

• Heat-stable DNA polymerase (like Taq Polymerase)

• Reaction Buffer providing a suitable chemical environment for optimum activity

and stability of the DNA polymerase.

• Divalent cations, magnesium or manganese ions; generally Mg2+ as a cofactor

(MgCl2) is used, but Mn2+ can be utilized for PCR-mediated DNA mutagenesis,

as higher Mn2+ concentration increases the error rate during DNA synthesis.

• Monovalent cation potassium ions.

Thermal cycler:

A thermal cycler (a machine that automatically changes the temperature at the correct

time for each of the stages and can be programmed to carry out a set number of

cycles) is used for a PCR reaction.

All components are placed in a thin-walled Eppendorf tube (0.2-0.5 ml) then All components are placed in a thin-walled Eppendorf tube (0.2-0.5 ml) then these tubes

are placed in the PCR thermal cycler.

2.5µl DNA stock (25ng/µl)2.5µl 1X Taq polymerase buffer

1.25µl 2.5mM MgCl2 (2.5mM)

1µl primer stock (25pmol)

4µl dNTP's (400µM)

1µl Taq polymerase (0.5-1U)Sterile water to make 25 µl

Steps of PCR reactions:

24

http://en.wikipedia.org/wiki/Potassium

http://en.wikipedia.org/wiki/Manganese

http://en.wikipedia.org/wiki/Magnesium

http://en.wikipedia.org/wiki/Cations

http://en.wikipedia.org/wiki/Divalent


The PCR reaction usually consists of a series of 30-40 cycles repeated temperature

changes called cycles; each cycle typically consists of 2-3 discrete temperature steps.

Most commonly PCR is carried out with cycles that have three temperature steps (see

figure below). The cycling is often preceded by a single temperature step

(called hold) at a high temperature (90-95°C), and followed by one hold at the end for

final product extension or brief storage. The temperatures used and the length of time

they are applied in each cycle depend on a variety of parameters. These include the

enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the

reaction, and the melting temperature (Tm) of the primers.

Initialization step: This step consists of heating the reaction to a temperature of 86-

95°C (or 98°C if extremely thermostable polymerases are used), which is held for 1-9

minutes. It is only required for DNA polymerases that require heat activation by hot-

start PCR .

Denaturation step: This step is the first regular cycling event and consists of heating

the reaction to 86-95°C for 20-60 seconds. It causes melting of DNA template and

primers by disrupting the hydrogen bonds between complementary bases of the DNA

strands, yielding single strands of DNA.

Annealing step: The reaction temperature is lowered to 33-65°C for 20-60 seconds

allowing annealing of the primers to the single-stranded DNA template. Typically the

annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used.

(depending upon the primers' melting temperature Tm used, its length and its GC

content). Stable DNA-DNA hydrogen bonds are only formed when the primer

sequence very closely matches the template sequence. The polymerase binds to the

primer-template hybrid and begins DNA synthesis.

Extension/elongation step: The temperature at this step depends on the DNA

polymerase used; Taq polymerase has its optimum activity temperature at 75-

80°C, and commonly a temperature of 72°C is used with this enzyme. At this step the

DNA polymerase synthesizes a new DNA strand complementary to the DNA

template strand by adding dNTPs that are complementary to the template in 5' to 3'

direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl

group at the end of the nascent (extending) DNA strand. The extension time depends

both on the DNA polymerase used and on the length of the DNA fragment to be

amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will

25

http://en.wikipedia.org/wiki/Hydroxyl_group





http://en.wikipedia.org/wiki/Phosphate_group

http://en.wikipedia.org/wiki/Enzyme


http://en.wikipedia.org/wiki/Annealing_(biology)

http://en.wikipedia.org/wiki/Denaturation_(biochemistry)#Nucleic_acid_denaturation

http://en.wikipedia.org/wiki/Denaturation_(biochemistry)#Nucleic_acid_denaturation

http://en.wikipedia.org/wiki/Polymerase_chain_reaction#Variations_on_the_basic_PCR_technique

http://en.wikipedia.org/wiki/Polymerase_chain_reaction#Variations_on_the_basic_PCR_technique



polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are

no limitations due to limiting substrates or reagents, at each extension step, the

Schematic drawing of the PCR cycle. (1) Denaturing at 94-96°C. (2) Annealing at ~65°C (3) Elongation at 72°C. Four cycles are shown here. The blue lines represent the DNA template to which primers (red arrows) anneal that are extended by the DNA polymerase (light green circles), to give shorter DNA products (green lines), which themselves are used as templates as PCR progresses.

amount of DNA target is doubled, leading to exponential (geometric) amplificationamount of DNA target is doubled, leading to exponential (geometric) amplification

of the specific DNA fragment.of the specific DNA fragment. The DNA of interest is amplified by a power of 2 for

26


each PCR cycle: For example, if one subjects the DNA of interest to 5 cycles of PCR,

he will end up with 32 copies of DNA. Similarly, if one subjects the DNA of interest

to 35 cycles of PCR, he will end up with 1073741824 copies of DNA. Amplification

(replication) proceeds at an exponential (logarithmic) rate (amount of DNA produced

doubles at each cycle).

Final elongation: This single step is occasionally performed at a temperature of 70-

74°C , and commonly a temperature of 72°C is used for 5-15 minutes after the last

PCR cycle to ensure that any remaining single-stranded DNA is fully extended.

Final hold: This step at 4-15°C for an indefinite time may be employed for short-

term storage of the reaction.

Primer features:

• PCR primers are short (10-40 bp), single stranded DNA molecules.

• DNA amplification in PCR required on two primer(s) (forward and reverse

primers),which determine the beginning and end of the region to be amplified.

• The Forward and Reverse primers should have similar Tm (melting temperature).

• Sometimes primers are sequence specific, they will bind to a particular sequence in a

genome.

• Primers anneal to the flanking regions by complementary-base pairing (G=C and

A=T) using hydrogen bonding.

• The G+C content of the primers should be ~ 50%, and having G or C at 3’ end.

• Avoid sequences leading to hairpin formation.

• Avoid complementarities between oligo-primers (primer dimmer).

• They are manufactured commercially and can be ordered to match any DNA

sequence.

• As the size of the primer is increased, the likelihood of, for example, a primer

sequence of 35 bases repeatedly encountering a perfect complementary section on

the target DNA become remote

So it become increasing unlikely that one will get 16 bases in this particular sequence

(1 chance in 4.3 billion). In this same way, one can see that as the primer increases in

size, the chances of a match other than the one intended for is highly unlikely.

1) Conventional PCR DNA Polymerase features:

27


• Given that PCR involves very high temperatures, it is imperative that a heat-

stable DNA polymerase be used in the reaction.

• Most DNA polymerases would denature, and thus not function properly at the high

temperatures of PCR.

• Heat stable Taq DNA polymerase was purified from the hot springs bacterium

Thermus aquaticus in 1976

• Taq has maximal enzymatic activity at 72 °C to 80 °C, and substantially reduced

activities at lower temperatures.

• The DNA polymerase recognizes the primer and makes a complementary copy of

the template which is now single stranded.

• Taq DNA Polymerase extends the DNA chain by adding approx. 150 nucleotides

per second to the 3’ ends of the primers.

• All thermophilic DNA polymerases used in PCR show a small but measurable

activity at room temperature where researchers assemble the reaction components.

The enzymes' DNA polymerase activity will catalyze the extension of any annealed

3' end. Upon amplification, the resulting product contains a mixture of specific and

non-specific bands. Furthermore, the 5'-3' exonuclease activity of these enzymes

will degrade any free 5' end of partially annealed nucleic acid destroying the primer

and template substrates of the polymerase reaction. Less substrate means an

inhibited reaction and a lower yield of desired product. A number of non-specific

priming events occur under the low stringency conditions of ambient temperature.

Template hybridizes to itself, primer dimers form, and individual primers form

hairpin structures or partially anneal to non-specific sites on the template.

Therefore, preparing PCR at room temperature can generate secondary products in

the first PCR cycle that are amplified in subsequent cycles. Even when assembled

on ice, the reactions briefly pass through low stringency temperatures on the way to

the first melting step. The amplification of secondary products and the non-specific

exonuclease activity also unnecessarily consumes PCR reagents inhibiting the

amplification of the specific desired product. Normally, using template amounts in

excess of 100 to 500 copies avoids some of these difficulties. However, with lower

amounts of PCR target (especially in the presence of excess non-specific and

complex genomic DNA), these low rates of room temperature extension and

28


nuclease activities affect the specificity and efficiency of the polymerase chain

reaction. Skewed threshold cycle values and false amplicon melting temperatures in

real-time PCR as well as false end points in conventional PCR can all occur as a

result.

2) Hot-start technology overcomes the previous phenomena to generate cleaner

PCR products. The methodology prevents non-specific extension or degradation of

nucleic acid substrates at ambient temperatures by either excluding or reversibly

inhibiting the polymerase enzyme. Upon assembly, pre-heating the other reaction

components melts all priming events, both specific and non-specific. Addition of

the polymerase, if missing, then initiates PCR. Alternatively, the heat also reverses

the inhibition of the enzyme thus activating it. The first annealing step, due to its

properly defined temperature, allows specific annealing reactions to occur and

prevents non-specific annealing events. With a lack of non-specific hybridization

of primers to template or to one another, the resulting amplified DNA bands are

cleaner.

I. Manual Techniques:

Manual hot-start, the simplest hot-start method, requires the researcher to

withhold a critical component, usually the polymerase, until the reaction has been

heated briefly at the melting temperature. Addition of the enzyme then initiates

the reaction. This method proves difficult and inconvenient to perform, especially

when processing many reactions at the same time, because the tubes must be kept

at 100 °C in the PCR hot block, which serves as the working surface. This method

also increases the risk of inadvertently contaminating the reactions.

II. Use of Physical Barriers:

This relatively simple hot-start method separates the critical polymerase

component from the template, primers, and other reaction components with a

physical barrier that the high melting temperature removes. The most commonly

and easily used barrier is wax and requires the following steps. A PCR tube

containing most of the reaction components receives a molten bead of wax. Upon

cooling, the wax forms a solid barrier over the aqueous phase and a receptacle for

the addition of an aliquot of the polymerase. Upon reheating during the thermal

cycles, the wax barrier melts, allowing the polymerase to mix with the other

components in the aqueous phase.

29


III.Reversible Polymerase Inactivation and Specially Formulated Hot-Start

Polymerases:

a. Non-Covalently Bound Inhibitor:

A polypeptide, antibody, or oligonucleotide aptamer mixed with the

polymerase binds to the active or nucleotide-binding site of the

polymerase, rendering the enzyme inactive. Upon heating, the compound

denatures and dissociates from the polymerase, restoring enzyme activity.

The non-covalent protein-protein or oligonucleotide-protein interactions

between the inhibitor and the enzyme require only relatively low activation

energy, normally one to five minutes at 95 °C, to remove the inhibitor

from the active site. However, the ability of the inhibitors to re-associate

with the enzyme active site during thermal cycles may still disrupt or slow

the reaction affecting the yield of product.

b. Chemical Modification:

Covalent modifications of amino acid residues in the polymerase,

particularly those in the active site, also inhibit the enzyme's activities.

Typical protein modification reagents each react with a specific type of

amino acid. For some of these reagents, a combination of heat, water and a

change in pH hydrolyzes their covalent modifications to regenerate the

active amino acid, release a more inert compound, and restore enzyme

activity. Unlike the dissociation of inhibitors from the enzyme, this

chemical reactivation of the polymerase is irreversible because the

activation process breaks molecular bonds. This process requires higher

activation energy, ten to even fifteen minutes at 95 °C, than the

dissociation of inhibitors further insuring the complete melting of non-

specific annealing events.

3. Examples of HotStart enzymes:

The reversible inactivation of the polymerase, whether by use of an inhibitor or

chemical modification, remains the most effective hot-start method. However,

individual researchers lack the time or expertise to generate such enzymes routinely

30


and consistently. Fortunately, several manufacturers offer at very reasonable prices

specially formulated polymerase enzymes carefully prepared with lot-to-lot

consistency. A few examples are listed below:

Antibody: Invitrogen™ Platinum™ TaqPolypeptide: Eppendorf HotMaster™ TaqChemical Modification: Roche FastStart Taq

ABgene THERMO-START® DNA PolymeraseStratagene SureStart™ TaqSABiosciences ReactionReady™ HotStart "Sweet" PCR master mix

4. Performance of Specially Formulated Hot-Start Polymerases:

Effective hot-start polymerases should have minimal to no polymerase activity at

ambient temperature and should only yield product when properly activated. Figure 1

compares a hot-start enzyme with a conventional one. Indeed, the hot-start enzyme

only generates product when activated, while the conventional enzyme generates

product whether pre-incubated at high temperature or not. Furthermore, the activated

hot-start enzyme amplifies DNA equally as well as the treated or untreated

conventional enzyme indicating that the pre-modification of the enzyme and its

reversal do not affect the enzyme's proficiency. The small amount of product

observed from the inactivated hot-start enzyme results from partial activation by the

brief melting step in each cycle of the PCR program.

Figure 1: Activation of ReactionReady™ HotStart "Sweet" PCR master mix. The

"Sweet" and HotStart "Sweet" master mixes were used to amplify a gene-specific

fragment in replicate reactions that were either not activated or activated at 95 °C for

15 min. The master mixes only differ in their source of polymerase: The "Sweet"

contains a standard enzyme, while the HotStart "Sweet" contains a specially

formulated hot-start enzyme. Products were characterized by agarose gel

electrophoresis.

31


Before the polymerase amplifies or degrades any nucleic acid substrate, the same heat

activation process must also successfully melt the non-specific annealing and priming

events. For example, primer dimers, one of the most commonly observed non-specific

PCR products, occur when primer pairs complementary at their 3'-ends anneal to each

other allowing primer extension from the 3'-ends to generate a small double-stranded

product. The amplification of primer dimers unnecessarily consumes primers and

nucleotides, frequently reducing the yield of the desired amplification product. Primer

dimer formation during PCR could occur due to poor primer design or failure to use

or activate a hot start enzyme. As shown in Figure 2, a conventional enzyme primarily

amplifies a primer dimer at the expense of the actual gene-specific fragment. In

contrast, the hot-start enzyme produces only the expected fragment of the correct size,

without any primer dimer, and generates a greater amount of the product.

Figure 2: The ReactionReady™ HotStart "Sweet" PCR master mix eliminates

problematic primer dimers. XpressRef™ Human Universal Reference Total RNA

(GA-004, 3 µg) was converted to PCR template using the ReactionReady™ First

Strand cDNA Synthesis Kit. Equal amounts of template were added to separate

reactions to amplify a gene-specific fragment of human BCL10 using either

SABiosciences' HotStart "Sweet" master mix or a standard non-hot start PCR enzyme.

Products were characterized by agarose gel electrophoresis.

Interestingly, the length of time required for activation significantly contributes to the

effectiveness of the hot-start enzyme, and the activation time of each commercially

available enzyme varies. The longer the incubation time, the more likely non-specific

annealing events melt and the more likely cleaner and specific products result. Figure

3 compares the ability of three different hot-start enzymes to amplify three different

human genes. One enzyme relies on an antibody inhibitor and a short activation time.

The other two both use chemical modification with one needing a longer activation

time than the other. The results demonstrate that the hot-start enzymes with short

activation times generate a population of products of various sizes for all three genes,

most likely resulting from non-specific annealing of the primers to the template.

However, the enzyme with the longer activation time yields predominately one band

of the predicted size for the BAX and ITGA5 genes and correctly fails to yield a band

in the case of the poorly expressed IL11 gene. Therefore, longer activation times

32


allow more than enough time for non-specific annealing events to dissociate

preventing the formation of secondary products.

Figure 3: The ReactionReady™ HotStart "Sweet" PCR master mix outperforms other

competing hot start enzymes. XpressRef™ Human Universal Reference Total RNA

(GA-004, 3 µg) was converted to PCR template using the ReactionReady™ First

Strand cDNA Synthesis Kit. Gene-specific fragments of three different human genes

(BAX, ITGA5, IL11) were amplified by PCR from equal amounts of template using

the same primers and using either SABiosciences' HotStart "Sweet" master mix or one

of two hot start enzymes from other manufacturers, according to their respective

specifications. The enzyme in the HotStart "Sweet" master mix requires a longer

activation time than the other two enzymes. The products were characterized by

agarose gel electrophoresis.

0

1

capillary_electrophoresis

33


The PCR products are exposed to electrophoresis to distinguish the different amplicons using gel electrophoresis then analyzed using gel documentation system.

gel_documentation_system

Analysis of primer sequences

When designing primers for PCR, sequencing or mutagenesis it is often necessary to

make predictions about these primers, for example melting temperature (Tm) and

propensity to form dimers with itself or other primers in the reaction. The following

program will perform these calculations on any primer sequence or pair.

IDT DNA (Select Oligo Analyzer)

http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/

34




The programs will calculate both the Tm of the primers, as well as any undesireable

pairings of primers. When primers form hairpin loops or dimers less primer is

available for the desired reaction. For example...

Some thoughts on designing primers.

1. primers should be 17-28 bases in length

2. base composition should be 50-60% (G+C)

3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming

4. Tms between 55-80oC are preferred

35


5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product

6. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided

7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.

Also keep in mind that most oligonucleotide synthesis reactions are only 98%

efficient. This means that each time a base is added, only 98% of the oligos will

receive the base. This is not often critical with shorter oligos, but as length increases,

so does the probability that a primer will be missing a base. This is very important in

mutagenesis or cloning reactions. Purification by HPLC or PAGE is recommended

in some cases.

Oligonucleotide length Percent with correct sequence

10 bases (0.98)10 = 81.7%

20 bases (0.98)20 = 66.7%

30 bases (0.98)30 = 54.6%

40 bases (0.98)40 = 44.6%

Designing Degenerate Oligonucleotides.

A group of degenerate oligonucleotides contain related sequences with differences at

specific locations. These are used simultaneously in the hope that one of the

sequences of the oligonucleotides will be perfectly complementary to a target DNA

sequence.

One common use of degenerate oligonucleotides is when the amino acid sequence of

a protein is known. One can reverse translate this sequence to determine all of the

possible nucleotide sequences that could encode that amino acid sequence. A set of

degenerate oligonucleotides would then be produced matching those DNA

sequences. The following link will take you to a program that will perform a reverse

translation. http://arbl.cvmbs.colostate.edu/molkit/rtranslate/

36

http://arbl.cvmbs.colostate.edu/molkit/rtranslate/


For example, the amino acid sequence shown in purple below could be encoded by

the following codons.

AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln

GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA

C G C CT CAGC C C T C C C G

A A A A A

G G G G G

One could then select the 14 base sequence (in blue) to generate a smaller set of

degenerate oligonucleotides. Each oligonucleotide in the set would have one base

changed at a time (shown in purple below). A total of 32 unique oligonucleotides

would be generated.

TATTGTTGGCTTCC

TACTGTTGGCTTCC

TATTGCTGGCTTCC

TACTGCTGGCTTCC

etc.

When ordering degenerate oligonucleotides, you just let the company know that you

want a mixture of nucleotides added at a specific position using the code below. By

adding the mixture, oligos will incorporate one of the bases, leading to a mixture of

oligonucleotides.

Standard MixBase DefinitionsA, GC, TA, CG, TC, GA, TA, C, TC, G, TA, C, G

37


A, G, TA, C, G, T

Types of PCR:

1) Touchdown polymerase chain reaction

Touchdown polymerase chain reaction or touchdown style polymerase chain

reaction is a method of polymerase chain reaction by which primers will avoid

amplifying nonspecific sequence. The temperature at which primers anneal during a

cycle of polymerase chain reaction determines the specificity of annealing.

The melting point of the primer sets the upper limit on annealing temperature. At

temperatures just below this point, only very specific base pairing between the primer

and the template will occur. At lower temperatures, the primers bind less specifically.

Nonspecific primer binding obscures polymerase chain reaction results, as the

nonspecific sequences to which primers anneal in early steps of amplification will

"swamp out" any specific sequences because of the exponential nature of polymerase

amplification.

The earliest steps of a touchdown polymerase chain reaction cycle have high

annealing temperatures. The annealing temperature is decreased in increments for

every subsequent set of cycles (the number of individual cycles and increments of

temperature decrease is chosen by the experimenter). The primer will anneal at the

highest temperature which is least-permissive of nonspecific binding that it is able to

tolerate. Thus, the first sequence amplified is the one between the regions of greatest

primer specificity; it is most likely that this is the sequence of interest. These

fragments will be further amplified during subsequent rounds at lower temperatures,

and will out compete the nonspecific sequences to which the primers may bind at

those lower temperatures. If the primer initially (during the higher-temperature

phases) binds to the sequence of interest, subsequent rounds of polymerase chain

reaction can be performed upon the product to further amplify those fragments.

2) Quantitative PCR (Q-PCR or qPCR)

Q-PCR is a PCR technique used to quantify starting amounts of DNA template.

Amounts can be measured either at the end of the PCR (end-point assay) or during the

PCR steps (real-time PCR). Today real-time PCR is more commonly used because it

can be more precise. Cells in all organisms regulate gene expression and turnover of

gene transcripts (messenger RNA, abbreviated to mRNA), and the number of copies

of an mRNA transcript of a gene in a cell or tissue is determined by the rates of its

expression and degradation.

38

http://en.wikipedia.org/wiki/MRNA

http://en.wikipedia.org/wiki/Gene_expression

http://openwetware.org/wiki/PCR_techniques

http://en.wikipedia.org/wiki/Exponential_growth

http://en.wikipedia.org/wiki/Denaturation_(biochemistry)


http://en.wikipedia.org/wiki/Temperature


http://en.wikipedia.org/wiki/Polymerase_chain_reaction


Northern blotting is often used to estimate the expression level of a gene by

visualizing the abundance of its mRNA transcript in a sample. In this method, purified

RNA is separated by agarose gel electrophoresis, transferred to a solid matrix (such as

a nylon membrane), and probed with a specific DNA or RNA probe that

iscomplementary to the gene of interest. Although this technique is still used to assess

gene expression, it requires relatively large amounts of RNA and provides only

qualitative or semiquantitative information of mRNA levels.

In order to robustly detect and quantify gene expression from small amounts of RNA,

amplification of the gene transcript is necessary. The polymerase chain reaction is a

common method for amplifying DNA; for mRNA-based PCR the RNA sample is first

reverse transcribed to cDNA with reverse transcriptase.

Development of PCR technologies based on reverse transcription

and fluorophores permits measurement of DNA amplification during PCR in real

time, i.e., the amplified product is measured at each PCR cycle. The data thus

generated can be analysed by computer software to calculate relative gene

expression in several samples, or mRNA copy number. Real-time PCR can also be

applied to the detection and quantification of DNA in samples to determine the

presence and abundance of a particular DNA sequence in these samples.

A DNA-binding dye binds to all double-stranded (ds)DNA in PCR, causing

fluorescence of the dye. An increase in DNA product during PCR therefore leads to

an increase in fluorescence intensity and is measured at each cycle, thus allowing

DNA concentrations to be quantified. However, dsDNA dyes such as SYBR

Green will bind to all dsDNA PCR products, including nonspecific PCR products

(such as "primerdimers"). This can potentially interfere with or prevent accurate

quantification of the intended target sequence.

1. The reaction is prepared as usual, with the addition of fluorescent

dsDNA dye.

2. The reaction is run in a thermocycler, and after each cycle, the levels

of fluorescence are measured with a detector; the dye only fluoresces when

bound to the dsDNA (i.e., the PCR product). With reference to a standard

dilution, the dsDNA concentration in the PCR can be determined.

Like other real-time PCR methods, the values obtained do not have absolute units

associated with it (i.e. mRNA copies/cell). As described above, a comparison of a

measured DNA/RNA sample to a standard dilution will only give a fraction or ratio of

the sample relative to the standard, allowing only relative comparisons between

different tissues or experimental conditions. To ensure accuracy in the quantification,

39

http://en.wikipedia.org/wiki/Thermocycler


http://en.wikipedia.org/wiki/SYBR_Green

http://en.wikipedia.org/wiki/SYBR_Green


http://en.wikipedia.org/wiki/Fluorophore

http://en.wikipedia.org/wiki/Reverse_transcriptase

http://en.wikipedia.org/wiki/Complementary_DNA


http://en.wikipedia.org/wiki/Complementarity_(molecular_biology)

http://en.wikipedia.org/wiki/Hybridization_probe

http://en.wikipedia.org/wiki/Agarose_gel_electrophoresis

http://en.wikipedia.org/wiki/Northern_Blot


it is usually necessary to normalize expression of a target gene to a stably expressed

gene (see below). This can correct possible differences in RNA quantity or quality

across experimental samples.

Fluorescent reporter probes detect only the DNA containing the probe sequence;

therefore, use of the reporter probe significantly increases specificity, and enables

quantification even in the presence of non-specific DNA amplification. Fluorescent

probes can be used in multiplex assays—for detection of several genes in the same

reaction—based on specific probes with different-coloured labels, provided that all

targeted genes are amplified with similar efficiency. The specificity of fluorescent

reporter probes also prevents interference of measurements caused byprimer dimers,

which are undesirable potential by-products in PCR. However, fluorescent reporter

probes do not prevent the inhibitory effect of the primer dimers, which may depress

accumulation of the desired products in the reaction.

The method relies on a DNA-based probe with a fluorescent reporter at one end and

a quencher of fluorescence at the opposite end of the probe. The close proximity of

the reporter to the quencher prevents detection of its fluorescence; breakdown of the

probe by the 5' to 3'exonuclease activity of the Taq polymerase breaks the reporter-

quencher proximity and thus allows unquenched emission of fluorescence, which can

be detected after excitation with a laser. An increase in the product targeted by the

reporter probe at each PCR cycle therefore causes a proportional increase in

fluorescence due to the breakdown of the probe and release of the reporter.

1. The PCR is prepared as usual (see PCR), and the reporter probe is

added.

2. As the reaction commences, during the annealing stage of the PCR

both probe and primers anneal to the DNA target.

3. Polymerisation of a new DNA strand is initiated from the primers, and

once the polymerase reaches the probe, its 5'-3-exonuclease degrades the

probe, physically separating the fluorescent reporter from the quencher,

resulting in an increase in fluorescence.

4. Fluorescence is detected and measured in the real-time PCR

thermocycler, and its geometric increase corresponding to exponential

increase of the product is used to determine the threshold cycle (CT) in each

reaction.

40




http://en.wikipedia.org/wiki/PCR

http://en.wikipedia.org/wiki/Excited_state


http://en.wikipedia.org/wiki/Exonuclease

http://en.wikipedia.org/wiki/Quenching_(fluorescence)

http://en.wikipedia.org/wiki/Primer_Dimer

http://en.wikipedia.org/wiki/Fluorescence

http://en.wikipedia.org/wiki/Normalize


(1) In intact probes, reporter fluorescence is quenched. (2) Probes and the

complementary DNA strand are hybridized and reporter fluorescence is still

quenched. (3) During PCR, the probe is degraded by the Taq polymerase and the

fluorescent reporter released.

Quantifying gene expression by traditional methods presents several problems.

Firstly, detection of mRNA on a Northern blot or PCR products on a gel or Southern

blot is time-consuming and does not allow precise quantification. Also, over the 20-40

cycles of a typical PCR, the amount of product reaches a plateau determined more by

the amount of primers in the reaction mix than by the input template/sample.

Relative concentrations of DNA present during the exponential phase of the reaction

are determined by plotting fluorescence against cycle number on a logarithmic

scale (so an exponentially increasing quantity will give a straight line). A threshold

for detection of fluorescence above background is determined. The cycle at which the

fluorescence from a sample crosses the threshold is called the cycle threshold, Ct. The

quantity of DNA theoretically doubles every cycle during the exponential phase and

relative amounts of DNA can be calculated, e.g. a sample whose Ct is 3 cycles earlier

than another's has 23 = 8 times more template. Since all sets of primers don't work

equally well, one has to calculate the reaction efficiency first. Thus, by using this as

the base and the cycle difference C(t) as the exponent, the precise difference in

starting template can be calculated (in previous example, if efficiency was 1.96, then

the sample would have 7.53 times more template).

Amounts of RNA or DNA are then determined by comparing the results to a standard

curve produced by real-time PCR of serial dilutions (e.g. undiluted, 1:4, 1:16, 1:64) of

a known amount of RNA or DNA. As mentioned above, to accurately quantify gene

expression, the measured amount of RNA from the gene of interest is divided by the

amount of RNA from a housekeeping gene measured in the same sample to normalize

for possible variation in the amount and quality of RNA between different samples.

This normalization permits accurate comparison of expression of the gene of interest

between different samples, provided that the expression of the reference

(housekeeping) gene used in the normalization is very similar across all the samples.

Choosing a reference gene fulfilling this criterion is therefore of high importance, and

41

http://en.wikipedia.org/wiki/Standard_curve

http://en.wikipedia.org/wiki/Standard_curve

http://en.wikipedia.org/wiki/Logarithmic_scale

http://en.wikipedia.org/wiki/Logarithmic_scale


http://en.wikipedia.org/wiki/Plateau_(mathematics)

http://en.wikipedia.org/wiki/Southern_blot

http://en.wikipedia.org/wiki/Southern_blot


http://en.wikipedia.org/wiki/Northern_blot

http://en.wikipedia.org/wiki/MRNA


often challenging, because only very few genes show equal levels of expression

across a range of different conditions or tissues. There are numerous applications for

real-time polymerase chain reaction in the laboratory. It is commonly used for both

diagnostic and basic research.

Diagnostic real-time PCR is applied to rapidly detect nucleic acids that are diagnostic

of, for example, infectious diseases, cancer and genetic abnormalities. The

introduction of real-time PCR assays to the clinical microbiology laboratory has

significantly improved the diagnosis of infectious diseases, and is deployed as a tool

to detect newly emerging diseases, such as flu, in diagnostic tests. In research settings,

real-time PCR is mainly used to provide quantitative measurements of gene

transcription. The technology may be used in determining how the genetic expression

of a particular gene changes over time, such as in the response of tissue and cell

cultures to an administration of a pharmacological agent, progression of cell

differentiation, or in response to changes in environmental conditions.

In a real time PCR protocol, a fluorescent reporter molecule is used to monitor the

PCR as it progresses. The fluorescence emitted by the reporter molecule manifolds as

the PCR product accumulates with each cycle of amplification. Based on the molecule

used for the detection, the real time PCR techniques can be categorically placed under

two heads:

1. Non-specific detection using DNA binding dyes

In real time PCR, DNA binding dyes are used as fluorescent reporters to monitor the

real time PCR reaction. The fluorescence of the reporter dye increases as the product

accumulates with each successive cycle of amplification. By recording the amount of

fluorescence emission at each cycle, it is possible to monitor the PCR reaction during

exponential phase. If a graph is drawn between the log of the starting amount of

template and the corresponding increase the fluorescence of the reporter dye

fluorescence during real time PCR, a linear relationship is observed.

SYBR® Green is the most widely used double-strand DNA-specific dye reported

for real time PCR. SYBR® Green binds to the minor groove of the DNA double helix.

In the solution, the unbound dye exhibits very little fluorescence. This fluorescence is

substantially enhanced when the dye is bound to double stranded DNA. SYBR®

Green remains stable under PCR conditions and the optical filter of the thermocycler

can be affixed to harmonize the excitation and emission wavelengths. Ethidium

42

http://en.wikipedia.org/wiki/Pharmacology

http://en.wikipedia.org/wiki/In_vitro_diagnostics

http://en.wikipedia.org/wiki/Influenza

http://en.wikipedia.org/wiki/Cancer

http://en.wikipedia.org/wiki/Infectious_diseases


bromide can also be used for detection but its carcinogenic nature renders its use

restrictive.

Principles of RQ-PCR techniques. (a) SYBR Green I technique. SYBR Green I

fluorescence is enormously increased upon binding to double-stranded DNA. During

the extension phase, more and more SYBR Green I will bind to the PCR product,

resulting in an increased fluorescence. Consequently, during each subsequent PCR

cycle more fluorescence signal will be detected. (b) Hydrolysis probe technique. The

hydrolysis probe is conjugated with a quencher fluorochrome, which absorbs the

43


fluorescence of the reporter fluorochrome as long as the probe is intact. However,

upon amplification of the target sequence, the hydrolysis probe is displaced and

subsequently hydrolyzed by the Taqpolymerase. This results in the separation of the

reporter and quencher fluorochrome and consequently the fluorescence of the reporter

fluorochrome becomes detectable. During each consecutive PCR cycle this

fluorescence will further increase because of the progressive and exponential

accumulation of free reporter fluorochromes. (c) Hybridization probes technique. In

this technique one probe is labeled with a donor fluorochrome at the 3' end and a

second probe is labeled with an acceptor fluorochrome. When the two fluorochromes

are in close vicinity (ie within 1–5 nucleotides), the emitted light of the donor

fluorochrome will excite the acceptor fluorochrome. This results in the emission of

fluorescence, which subsequently can be detected during the annealing phase and first

part of the extension phase of the PCR reaction. After each subsequent PCR cycle

more hybridization probes can anneal, resulting in higher fluorescence signals.

Although these double-stranded DNA-binding dyes provide the simplest and cheapest

option for real time PCR, the principal drawback to intercalation based detection of

PCR product accumulation is that both specific and nonspecific products generate

signal.

2. Specific detection target specific probes

Specific detection of real time

PCR is done with some

oligonucleotide probes labeled

with both a reporter fluorescent

dye and a quencher dye. Probes

based on different chemistries are

available for real time detection,

these include: Molecular Beacons

(Molecular beacons are short segments of ssDNA)

a.This beacon is 33 nucleotides long with a reporter dye attached to the 5' end and a

quencher attached to the 3' end. The nine 5' bases are able to form base pairs with the

44


nine 3' bases which brings the reporter and quencher in very close proximity.

Therefore, when the reporter is excited by the appropriate light, its emission is

absorbed by the quencher and no fluorescence is detected. The pink lines represent

nucleotides that can form base pairs with the PCR product under investigation.

The PCR portion of real-time PCR is standard. Two PCR primers are used to amplify

a segment of DNA .

PCR product of interest. The two primers are show as purple arrows and the base

pairing between the two strands are shown in pink.

As the PCR continues, the newly synthesized PCR products are denatured by high

temperatures. As each strand of the product are separated, the molecular beacon also

is denatured so the hairpin structure is disrupted. As the temperatures cool for the next

round of primer annealing, the molecular beacon is capable of forming base pairs with

the appropriate strand of the PCR product (Figure 3). Any molecular beacons that do

not bind to PCR product reform the hairpin structures and thus are unable to fluoresce.

However, molecular beacons that bind to PCR product remove the ability for the

quencher to block fluorescence from the reporter dye. Therefore, as PCR product

accumulates, there is a linear increase in fluorescence.

Detection of PCR product by molecular beacon. When the beacon binds to the PCR

product, it is able to fluoresce when excited by the appropriate wavelength of light.

45


The amount of fluorescence is directly proportional to the amount of PCR product

amplified.

Real-time PCR can be performed in a "multiplex" format which means that more than

one PCR product can be detected in a single reaction tube. For each sequence, there is

a unique color of fluorescent dye and therefore, each PCR product is associated with

its own color which is detected by the real-time PCR machine.

b. TaqMan® Probes

TaqMan probes (also known as Fluorogenic 5’ nuclease assay) contain two dyes, a

reporter dye (e.g. 6-FAM) at the 5’ end and a 3’ acceptor dye, usually TAMRA.

Recent designs substitute the 3’ TAMRA fluorescent acceptor quencher dye with non-

fluorescent quencher, e.g. Black Hole Quencher. The proximity of the quencher to the

reporter in an intact Taqman probe allows the quencher to suppress, or “quench” the

fluorescence signal of the reporter dye through FRET. If the target of interest is

present, these Taqman probes specifically anneal between the forward and reverse

primer sites. During the reaction, the 5’ to 3’ nucleolytic activity of Taq polymerase

cleaves the probe between the reporter and the quencher only if the probe hybridizes

to the target. The probe fragments are displaced from the target, separating the

reporter dye from the quencher dye and thus resulting in increased fluorescence of the

reporter. Accumulation of PCR products is detected directly by monitoring the

increase in fluorescence of the reporter dye. Because increase in fluorescence signal is

detected only if the target sequence is complementary to the probe, nonspecific

amplification is not detected.

46


c. FRET HybridizationProbes

Förster resonance energy transfer (FRET), wherein an excited dye molecule transfers

it’s energy to a different, lower energy dye. This results in quenching of the

fluorescence from the first (donor) dye and stimulation of fluorescence from the

second (acceptor) dye, observed at longer wavelength. FRET is typically observed if

the donor and acceptor are separated by less than 10 nm and thus, it can be used to

monitor processes that result in changes in the donor-acceptor separation distance.

An interesting application of FRET is to monitor the process of RNA splicing, which

occurs in the nucleus of the cell. In humans (and many other organisms), the sequence

of a gene usually codes for a protein that would be much longer than what is actually

found when the protein is sequenced. The loss of information between DNA and

protein occurs at the RNA level by a process known as splicing. During this process,

RNA introns are excised out of the initially transcribed RNA and the

remainingexons are stitched together to form the mature mRNA, which is

subsequently translated into protein by the ribosome (Figure 1). Splicing is catalyzed

by a large RNA-protein complex known as the spliceosome and, while much is known

about the composition of the spliceosome, far less is known about the individual steps

that occur during splicing. These steps include binding, conformational changes,

dissociation and chemical reactions. We can begin to understand the overall

mechanism of splicing by mapping out the structural changes that take place during

47


the splicing process.

In principle, FRET can be used to follow structural changes since the distance

between appropriately placed donor and acceptor dyes should change in response to a

conformational or chemical reaction step. However, RNA is not inherently

fluorescent, so donor and acceptor dyes need to be introduced into the RNA structure.

We use PNA to accomplish this by designing the PNA to be complementary to a

specific site in the RNA. In addition, we synthesize the PNA bearing a fluorescent

donor or acceptor dye. Mixing the PNA with the RNA allows the PNA to bind to its

target site in the RNA, delivering the fluorescent dye to that specific location. Figure 1

illustrates how this strategy is used to follow splicing. Before splicing occurs, the

donor and acceptor fluorophores are far apart due to the presence of the intron.

However, after splicing, the donor-acceptor distance is much smaller and FRET can

occur. We detect this as a decrease in donor fluorescence and an increase in acceptor

fluorescence.

Schematic of RNA splicing reaction as followed by fluorescent PNA hybridization probes.

48


d. Scorpion Primers

Allele-specific mutation detection by Scorpion Amplified Refractory Mutation

System. Allele-specific Scorpion primers are composed of a specific

fluorophore (green circleor red circle), a stem (purple), a gene-specific probe

region (orange), a quencher (gray circle), a blocker molecule (gray square),

and a primer (black) with a 3 -terminal nucleotide complementary to either the′

wild-type or the mutant base in the DNA template (green line or red line).

Genomic DNA extracted from plasma is amplified by PCR in a reaction

containing Scorpion primers specific for wild-type or mutant alleles. Primers

anneal to template DNA, and the fluorophore remains quenched. Extension

occurs in an allele-specific manner. On denaturation, the probe mediates self-

association of the Scorpion primer and, consequently, dissociation of the

fluorophore/quencher to generate allele-specific fluorescence. Fluorescence is

detected and quantitated by real-time PCR permitting a determination of the

genotype of input plasma DNA.

Real time PCR applications include

1 . Quantitative mRNA expression studies.

2 . DNA copy number measurements in genomic or viral DNAs.

3 . Allelic discrimination assays or SNP genotyping.

49


4 . Verification of microarray results.

5 . Drug therapy efficacy.

6 . DNA damage measurement.

Real Time PCR VS Traditional PCR

Real time PCR allows for the detection of PCR product during the early phases of the

reaction. This ability of measuring the reaction kinetics in the early phases of PCR

provide a distinct advantage over traditional PCR detection. Traditional methods use

gel electrophoresis for the detection of PCR amplification in the final phase or at end-

point of the PCR reaction.

3) Reverse transcription polymerase chain reaction (RT-PCR)

RT-PCR is a variant of polymerase chain reaction (PCR), a laboratory technique

commonly used in molecular biology to generate many copies of a DNA sequence, a

process termed "amplification". In RT-PCR, however, RNA strand is first reverse

transcribed into its DNA complement (complementary DNA, or cDNA) using the

enzyme reverse transcriptase, and the resulting cDNA is amplified using traditional

or real-time PCR. Reverse transcription PCR is not to be confused with real-time

polymerase chain reaction (Q-PCR/qRT-PCR), which is also sometimes (incorrectly)

abbreviated as RT-PCR.

RT-PCR utilizes a pair of primers, which are complementary to a defined sequence on

each of the two strands of the cDNA. These primers are then extended by a DNA

polymerase and a copy of the strand is made after each cycle, leading to logarithmic

amplification.

RT-PCR includes three major steps. The first step is the reverse transcription (RT)

where RNA is reverse transcribed to cDNA using a reverse transcriptase and primers.

This step is very important in order to allow the performance of PCR since DNA

polymerase can act only on DNAtemplates. The RT step can be performed either in

the same tube with PCR (one-step PCR) or in a separate one (two-step PCR) using a

temperature between 40°C and 50°C, depending on the properties of the reverse

transcriptase used.

The next step involves the denaturation of the dsDNA at 95°C, so that the two strands

separate and the primers can bind again at lower temperatures and begin a new chain

reaction. Then, the temperature is decreased until it reaches the annealing temperature

which can vary depending on the set of primers used, their concentration,

50



http://en.wikipedia.org/wiki/Reverse_transcription

http://en.wikipedia.org/wiki/DNA_polymerase

http://en.wikipedia.org/wiki/DNA_polymerase


http://en.wikipedia.org/wiki/Real-time_polymerase_chain_reaction







http://en.wikipedia.org/wiki/Laboratory_technique


the probe and its concentration (if used), and the cations concentration. The main

consideration, of course, when choosing the optimal annealing temperature is the

melting temperature (Tm) of the primers and probes (if used). The annealing

temperature chosen for a PCR depends directly on length and composition of the

primers. This is the result of the difference ofhydrogen bonds between A-T (2 bonds)

and G-C (3 bonds). An annealing temperature about 5 degrees below the lowest Tm

of the pair of primers is usually used.

The final step of PCR amplification is the DNA extension from the primers which is

done by the thermostable Taq DNA polymerase usually at 72°C, which is the optimal

temperature for the polymerase to work. The length of the incubation at each

temperature, the temperature alterations and the number of cycles are controlled by a

programmable thermal cycler. The analysis of the PCR products depends on the type

of PCR applied. If a conventional PCR is used, the PCR product is detected

using agarose gel electrophoresis and ethidium bromide (or other nucleic acid

staining).

Conventional RT-PCR is a time-consuming technique with important limitations

when compared to real time PCR techniques. This, combined with the fact

that ethidium bromide has low sensitivity, yields results that are not always reliable.

Moreover, there is an increased cross-contamination risk of the samples since

detection of the PCR product requires the post-amplification processing of the

samples. Furthermore, the specificity of the assay is mainly determined by the

primers, which can give false-positive results. However, the most important issue

concerning conventional RT-PCR is the fact that it is a semi or even a low

quantitative technique, where the amplicon can be visualised only after the

amplification ends.

Real time RT-PCR provides a method where the amplicons can be visualised as the

amplification progresses using a fluorescent reporter molecule. There are three major

kinds of fluorescent reporters used in real time RT-PCR, general non specific DNA

Binding Dyes such as SYBR Green I, TaqMan Probes and Molecular

Beacons (including Scorpions).

The real time PCR thermal cycler has a fluorescence detection threshold, below which

it cannot discriminate the difference between amplification generated signal and

background noise. On the other hand, the fluorescence increases as the amplification

progresses and the instrument performs data acquisition during the annealing step of

each cycle. The number of amplicons will reach the detection baseline after a specific

cycle, which depends on the initial concentration of the target DNA sequence. The

cycle at which the instrument can discriminate the amplification

51

http://en.wikipedia.org/wiki/Amplicons


http://en.wikipedia.org/wiki/Thermal_cycler

http://en.wikipedia.org/wiki/Molecular_beacon

http://en.wikipedia.org/wiki/Molecular_beacon

http://en.wikipedia.org/wiki/TaqMan


http://en.wikipedia.org/wiki/Ethidium_bromide

http://en.wikipedia.org/wiki/Ethidium_bromide



http://en.wikipedia.org/wiki/Hydrogen_bond

http://en.wikipedia.org/wiki/Ion

http://en.wikipedia.org/wiki/Hybridization_probe


generated fluorescence from the background noise is called the threshold cycle (Ct).

The higher the initial DNA concentration, the lower its Ct will be.

Uses of reverse transcription polymerase chain reaction

The exponential amplification via reverse transcription polymerase chain reaction

provides for a highly sensitive technique, where a very low copy number of RNA

molecules can be detected. Reverse transcription polymerase chain reaction is widely

used in the diagnosis of genetic diseases and, semiquantitatively, in the determination

of the abundance of specific different RNA molecules within a cell or tissue as a

measure of gene expression. Northern blot is used to study the RNA's gene expression

further. RT-PCR can also be very useful in the cloning of eukaryotic genes in

prokaryotes. Due to the fact that most eukaryotic genes contain introns which are

present in the genome but not in the mature mRNA, the cDNA generated from a RT-

PCR reaction is the exact (without regard to the error prone nature of reverse

transcriptases) DNA sequence which would be directly translated into protein after

transcription. When these genes are expressed in prokaryotic cells for the sake of

protein production/purification, the RNA produced directly from transcription need

not undergo splicing as the transcript contains only exons (prokaryotes, such as E.coli,

lack the mRNA splicing mechanism of eukaryotes).

RT-PCR is commonly used in studying the genomes of viruses whose genomes are

composed of RNA, such as Influenzavirus A andretroviruses like HIV.

The Quantitative PCR Primer Database (QPPD) provides information about primers

and probes that can be used to quantitate human and mouse mRNA by reverse

transcription polymerase chain reaction (RT–PCR) assays. All data has been gathered

from published articles, cited in PubMed.

4) Multiplex PCR

Multiplex PCR is a variant of PCR which enabling simultaneous amplification of

many targets of interest in one reaction by using more than one pair of primers. Since

its first description in 1988 by Chamberlain et al, this method has been applied in

many areas of DNA testing, including analyses of deletions, mutations, and

polymorphisms, or quantitative assays and reverse transcription PCR. Typically, it is

used for genotyping applications where simultaneous analysis of multiple markers is

required, detection of pathogens or genetically modified organisms (GMOs), or for

microsatellite analyses. Multiplex assays can be tedious and time-consuming to

establish, requiring lengthy optimization procedures. Since the turn of the century

seven new respiratory viruses have infected man and two of these have resulted in

52

http://en.wikipedia.org/wiki/HIV

http://en.wikipedia.org/wiki/Retrovirus

http://en.wikipedia.org/wiki/Influenzavirus_A

http://en.wikipedia.org/wiki/Virus

http://en.wikipedia.org/wiki/Northern_blot

http://en.wikipedia.org/wiki/Gene_expression#Techniques_and_tools



worldwide epidemics. Both SARS Coronavirus which quickly spread to 29 countries

in February 2003 and H1N1 swine influenza that recently spread from Mexico to 30

countries in three weeks represent major pandemic threats for mankind. Diagnostic

assays are required to detect novel influenza strains with pandemic potential.

Multiplex PCR have the ability to detect new, "non-seasonal" influenza viruses

including the H1N1 swine influenza.

5) Nested PCR

Nested polymerase chain reaction is a modification of polymerase chain

reaction intended to reduce the contamination in products due to the amplification of

unexpected primer binding sites. One of the methods currently employed to increase

sensitivity and specificity is the nested PCR (nPCR). Nested Primers for PCR is a

powerful method to amplify specific sequences of DNA from a large complex mixture

of DNA. For example, you can design PCR primers to amplify a single locus from an

entire genome. From a single template molecule, you can produce over 1 billion

copies of the PCR product very quickly. However, the capacity to amplify over one

billion fold also increases the possibility of amplifying the wrong DNA sequence over

one billion times. The specificity of PCR is determined by the specificity of the PCR

primers. For example, if your primers bind to more than one locus (e.g. paralog or

common domain), then more than one segment of DNA will be amplified. To control

for these possibilities, investigators often employ nested primers to ensure specificity.

Nested PCR means that two pairs of PCR primers were used for a single locus (figure

1). The first pair amplified the locus as seen in any PCR experiment. The second pair

of primers (nested primers) bind within the first PCR product (figure 4) and produce a

second PCR product that will be shorter than the first one (figure 5). The logic behind

this strategy is that if the wrong locus were amplified by mistake, the probability is

very low that it would also be amplified a second time by a second pair of primers.

Figure 1. Nested PCR strategy. Segment of DNA with dots representing nondiscript DNA sequence of unspecified length. The double lines represent a large distance between the portion of DNA illustrated in this figure. The portions of DNA shown

53




with four bases in a row represent PCR primer binding sites, though real primers would be longer.

Figure 2. The first pair of PCR primers (blue with arrows) bind to the outer pair of primer binding sites and amplify all the DNA in between these two sites.

Figure 3. PCR product after the first round of amiplificaiton. Notice that the bases outside the PCR primer pair are not present in the product.

Figure 4. Second pair of nested primers (red with arrows) bind to the first PCR product. The binding sites for the second pair of primers are a few bases "internal" to the first primer binding sites.

Figure 5. Final PCR product after second round of PCR. The length of the product is defined by the location of the internal primer binding sites.

When a complete genome sequence is known, it is easier to be sure you will not

amplify the wrong locus but since very few of the world's genomes have been

sequenced completely, nested primers will continue to be an important control for

many experiments.

54


6) Random Amplification of Polymorphic DNA (RAPD-PCR)

In 1990, two teams simultaneously reported the development of PCR-based,

novel, genetic screening techniques random amplified polymorphic DNA (RAPD)

and arbitrarily-primed PCR (AP-PCR) (Williams et al., 1990 and Welsh and

McClelland, 1990). The use of the polymerase chain reaction (PCR) in generating

random amplified polymorphic DNA (RAPD) has already proven valuable in

genetic analyses. Generation of molecular markers by RAPD PCR have provided

an efficient means to screen large populations in comparison with probe

construction and restriction fragment-length polymorphism (RFLP) linkage

analysis. RAPD markers have been used for generating genetic linkage maps

(Martin et al., 1991; Williams et al., 1990), genotype fingerprinting (Welsh and

McClelland, 1990), analyzing populations and pedigree (Dweikat et al., 1993),

predicting phylogenies (Halward et al., 1992), studying population dynamics

(Fritsch and Rieseberg, 1992), and identifying clones (Smith et al., 1992).

RAPD markers are decamer (10 nucleotide length) DNA fragments from PCR

amplification of random segments of genomic DNA with single or double

primer(s) of arbitrary nucleotide sequence and which are able to differentiate

between genetically distinct individuals, although not necessarily in a reproducible

way. The resulting amplified DNA markers are random polymorphic segments

with band sizes from 100 to 3000 bp depending upon the genomic DNA and the

primer. No fragment is produced if primers annealed too far apart or 3' ends of

the primers are not facing each other. Polymorphism of amplified fragments are

caused by: (1) base substitutions or deletions in the priming sites, (2) Insertions

that render priming sites too distant to support amplification, or (3) insertions or

deletions that change the size of the amplified fragment. If a mutation has

occurred in the template DNA at the site that was previously complementary to

the primer, a PCR product will not be produced, resulting in a different pattern of

amplified DNA segments on the gel. Selecting the right sequence for the primer is

very important because different sequences will produce different band patterns

and possibly allow for a more specific recognition of individual strains.

55

http://wheat.pw.usda.gov/~lazo/docs/cotton/image/pcr.jpg

http://avery.rutgers.edu/WSSP/StudentScholars/project/archives/onions/poly.html


Limitations of RAPD

Nearly all RAPD markers are dominant, i.e. it is not possible to distinguish

whether a DNA segment is amplified from a locus that is heterozygous (1

copy) or homozygous (2 copies). Co-dominant RAPD markers, observed as

different-sized DNA segments amplified from the same locus, are detected

only rarely.

PCR is an enzymatic reaction, therefore the quality and concentration of

template DNA, concentrations of PCR components, and the PCR cycling

conditions may greatly influence the outcome. Thus, the RAPD technique is

notoriously laboratory dependent and needs carefully developed laboratory

protocols to be reproducible.

Mismatches between the primer and the template may result in the total

absence of PCR product as well as in a merely decreased amount of the

product. Thus, the RAPD results can be difficult to interpret.

Developing Locus-specific, Co-Dominant Markers from RAPDs

The polymorphic RAPD marker band is isolated from the gel.

It is amplified in the PCR reaction.

The PCR product is cloned and sequenced.

New longer and specific primers are designed for the DNA sequence, which is

called the Sequenced Characterized Amplified Region Marker (SCAR).

RAPD Protocol

• Deoxynucleoside triphosphates (dNTP'S): 2.5 mM each of

dCTP,dATP,dTTP,dGTP. Store at –20 ºC

• Magnesium chloride: 25mM stock and store at –20 º C

56


• Genomic DNA 5-25 ng/ml stocks.

1. Assemble RAPD reactions as follows for each sample:

2.5µl DNA stock (25ng/µl) 2.5µl 1X Taq polymerase buffer

1.25µl 2.5mM MgCl2 (2.5mM)

1µl primer stock (25pmol)

4µl dNTP's (400µM)

1µl Taq polymerase (0.5-1U)

Sterile water to make 25 µl Mix by inversion and spin for 2 seconds to collect solution. You may make a

mixture for the total number of samples +1 (as a spare) before adding the Taq

polymerase.

• Wear gloves throughout RAPD reaction preparation procedure. Assay

buffer, dNTPs, MgCl2 and primer solution are thawed from frozen

stock. Keep the assembled reaction in themocycler for amplification.

Stock and final concentrations per 25 µl of reaction mixture:

Components Stock Concentration Final Concentration Vol/Rxn

dNTPs 100 mM 0.8 mM 0.2 µl

1X Taq polym. buffer 10x 1x 2.5 µl

MgCl2 50 mM 2.5 mM 1.25 µlTaq 5 u/µl 1 u/rxn 0.2 µl

Primer 10 µM 0.4 µM 1.0 µl

dH2O - - 17.35 µl

DNA 2 ng/µl 5 ng/µl 25 µl

Agarose gel electrophoresis• Reagents for agarose gel electrophoresis• Agarose, TBE (or TAE) buffer, Ethidium Bromide, gel loading dye,

• To prepare 100ml of a 0.7-2% agarose solution, measure 0.7-2g agarose

into a glass beaker or flask and add 100ml 0.5X TBE buffer (or TAE).

• Microwave (or stir on a hot plate) until agarose is dissolved and solution is

clear.

57


• Allow solution to cool to about 55º C before pouring. ( ethidium bromide

can be added at this point to concentration of 0.5µg/ml).

• Place the comb in the gel tray onto a leveled platform.

• Pour 50º C gel solution into tray to a depth of about 5mm. Allow the gel to

solidify for about 20 min at room temperature.

• To run, gently remove the comb, place the tray in electrophoresis

chamber, and cover (just until wells are submerged) with electrophoresis buffer

(the same buffer used to prepare the agarose: TBE (or TAE) buffer). Fill the

electrode tank also with 0.5X TBE buffer.

• To the RAPD sample from refrigerator, add 1µl of 6% gel loading dye for

every 5 µl of DNA solution. Mix well. Load 15-20µl of DNA per well. Load also

the DNA size standards 10 µl of 1 Kb DNA Ladder (marker) alongside RAPD

reactions.

• Connect the electrodes to the power supply and electrophorese at 50-

150Volts (depending on the distance between electrodes: 5volts/1cm) until the

bromophenol blue dye reaches 1cm of the gel edge.

Stain the gel with ethidium bromide (0.5-1 µl of the stack solution: 10 mg/ml, if not

already included in the gel). Note: Ethidium bromide is a mutagen and a probable

carcinogen. Wear gloves when working with ethidium bromide solutions. Also use care

not to contaminate the work area with the solution. UV light is damaging and must be

used with caution. UV light causes burns and can damage the eyes.

• Examine the gel under UV light (transilluminator).

Depending on the objective of the experiment make a note of polymorphism, segregating

bands, and appearance of overall pattern within fingerprint. Bands may be sized by

comparison to molecular weight standards. The standards should be used to generate a

standard curve for interpolation.

After you have run the gel, obtain a photograph, and label and measure the migration of

the DNA bands. Make a standard curve plot of the known size markers, and determine

the size of the marker bands. Analyze the data using computer software NTSYS /

RAPDistance. Such steps are automated using a Gel documentation system.

58


DNA amplification

Place PCR tubes in a thermal cycler. Amplify using the following temperature profile:

Temperature (°C)Time Steps

94 2-5 min 194 60-30sec

2 for 41 cycles33-37 20-30 min72 0.5-2 min72 5 min Final Extension4 ∞ Final hold

59


Capillary electrophoresis

PCR conditions must be optimized and this is normally achieved by titrating the

magnesium-, template-, primer-, dNTP- and Taq polymerase concentration, “Hot Start

PCR”, “Touch-down PCR”, adding detergents, reducing the PCR cycles or by

gradually increasing the annealing temperature. The selection of the annealing

temperature is possibly the most critical component for optimizing the specificity of a

PCR reaction. In most cases, this temperature must be empirically tested. The PCR is

normally started at 5°C below the calculated temperature of the primer melting point

(Tm). However, the possible formation of unspecific secondary bands shows that the

optimum temperature is often much higher than the calculated temperature (>12°C).

Further PCR reactions with gradually increasing temperatures are required until the

most stringent conditions have been found. When a standard PCR cycler is used, this

method is the most time-intensive optimization strategy. The gradient PCR now

enables rapid testing of the optimum temperature conditions on one block and in one

experiment. During the PCR, a temperature gradient, which can be programmed

between 1°C and 20°C, is built up across the thermoblock. This allows the most

stringent parameters for every primer set to be calculated with the aid of only one

single PCR reaction.

60

http://www.biocompare.com/Brinkmann_ThermalCycles_7programmingtouchdownpcr_art.html

http://www.biocompare.com/Brinkmann_ThermalCycles_7programming_hotstartpcr_art.html

http://www.biocompare.com/Brinkmann_ThermalCycles_7programming_hotstartpcr_art.html


gel documentation_system

61


Specifications: Multiplexing of up to 5 fluorophores in each reaction vessel. Reliable thermal cycling performance and real-time PCR thermal gradient for rapid assay development Embedded tool for end-point fluorescence analysis that simplifies qualitative assessment of sample abundance in single or multicolor assays.

62


Dweikat, I., S. Mackenzie, M. Levy, and O. Herbert. 1993. Pedigree assessment using RAPD-DGGE in cereal crop species. Theor. Appl. Genet. 85:497-505. Fritsch, P., and L. H. Rieseberg. 1992. Outcrossing rates are high in androdioecious populations of the flowering plant Datisca glomerata. Nature 359-633-636.

Halward, T. T. Stalker, E. LaRue, and G. Kochert. 1992. Use of single-primer DNA amplification in genetic studies of peanut (Arachis hypogaea L). Plant Mol. Biol. 18:315-325. Martin, G. B., J. G. K. Williams, and S. D. Tanksley. 1991. Rapid identification of markers linked to a Pseudomonas resistance gene in tomato by using random primers and near-isogenic lines. Proc. Natl. Acad. Sci. USA. 88:2336-2340. Smith, M. L., J. N. Bruhn, and J. B. Anderson. 1992. The fungus Armillaria bulbosa is among the largest and oldest living organisms. Nature 356:428-431. Welsh, J., and M. McClelland. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 189:7213-7218. Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and

Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are

useful as genetic markers. Nucl. Acids Res. 18:6531-6535.

Quantitation of DNA and RNA with Absorption and Fluorescence

spectroscopy

Reliable quantitation of nanogram and microgram amounts of DNA and RNA in

solution is essential to researchers in molecular biology. In addition to the traditional

absorbance measurements at 260 nm three more sensitive fluorescence techniques are

presented below. These four procedures cover a range from 5 to 10 ng/ml DNA to 25

pg/ml DNA. Absorbance measurements are straightforward as long as any

contribution from contaminants and the buffer components are taken into account.

Fluorescence assays are less prone to interference than A260 measurements and are

also simple to perform. As with absorbance measurement, a reading from the reagent

blank is taken prior to adding the DNA. In instruments where the readout can be set to

indicate concentration, a known concentration is used for calibration and subsequent

readings are taken in µg/ml, ng/ml, or pg/ml DNA.

63


BASIC PROTOCOL DETECTION OF NUCLEIC ACIDS

USING ABSORPTION SPECTROSCOPY:

Absorption of the sample is measured at several different wavelengths to

assess purity and concentration of nucleic acids. A260 measurements are quantitative

for relatively pure nucleic acid preparations in microgram quantities. Absorbance

readings cannot discriminate between DNA and RNA; however, the ratio of A at 260

and 280 nm can be used as an indicator of nucleic acid purity. Proteins, for example,

have a peak absorption at 280 nm that will reduce the A260/A280 ratio. Absorbance

at 325 nm indicates particulates in the solution or dirty cuvettes; contaminants

containing peptide bonds or aromatic moieties such as protein and phenol absorb at

230 nm. This protocol is designed for a single-beam ultraviolet to visible range (UV-

VIS) spectrophotometer. If available, a double-beam spectrophotometer will simplify

the measurements, as it will automatically compare the cuvette holding the sample

solution to a reference cuvette that contains the blank. In addition, more sophisticated

double-beam instruments will scan various wavelengths and report the results

automatically.

Materials

1X TNE buffer (see recipe), DNA sample to be quantitated, Calf thymus DNA standard

solutions (see recipe). Matched quartz semi-micro spectrophotometer cuvettes (1-cm

pathlength). Single- or dual-beam spectrophotometer (ultraviolet to visible)

1. Pipet 1.0 ml of 1X TNE buffer into a quartz cuvette. Place the cuvette in a single- or

dual-beam spectrophotometer, read at 325 nm (note contribution of the blank relative to

distilled water if necessary), and zero the instrument. Use this blank solution as the

reference in double-beam instruments. For single-beam spectrophotometers, remove

blank cuvette and insert cuvette containing DNA sample or standard suspended in the

same solution as the blank. Take reading. Repeat this process at 280, 260, and 230 nm. It

is important that the DNA be suspended in the same solution as the blank.

2. To determine the concentration (C) of DNA present, use the A260 reading in

conjunction with one of the following equations:

Single-stranded DNA: C (pmol /μl) = A260/10*S, C (μg/ml)= A260/0.027

Double-stranded DNA: C (pmol/μl) = A260/13.2*S, C (μg/ml)= A260/0.020

Single-stranded RNA: C (μg/ml)= A260/0.025

Oligonucleotide: C (pmol/μl) = (A260) * [(100)/(1.5 NA + 0.71 NC + 1.20 NG + 0.84 NT)]

64


where S represents the size of the DNA in kilobases and N is the number or residues of

base A, G, C, or T.

For double-or single-stranded DNA and single-stranded RNA: These equations assume a

1cm-pathlength spectrophotometer cuvette and neutral pH. The calculations are based on

the Lambert-Beer law, A = ECl, where A is the absorbance at a particular wavelength, C

is the concentration of DNA, l is the pathlength of the spectrophotometer cuvette

(typically 1 cm), and E is the extinction coefficient. For solution concentrations given in

mol/liter and a cuvette of 1-cm pathlength, E is the molar extinction coefficient and has

units of M−1cm−1. If concentration units of μg/ml are used, then E is the specific

absorption coefficient and has units of (μg/ml)−1cm−1. The values of E used here are as

follows: ssDNA, 0.027 (μg/ml)−1cm−1; dsDNA, 0.020 (μg/ml)−1cm−1; ssRNA, 0.025

(μg/ml) −1cm−1. Using these calculations, an A260 of 1.0 indicates 50 μg/ml double-

stranded DNA, ~37 μg/ml single-stranded DNA, or ~40 μg/ml single-stranded RNA

(adapted from Applied Biosystems, 1987).

For oligonucleotides: Concentrations are calculated in the more convenient units of

pmol/μl. The base composition of the oligonucleotide has significant effects on

absorbance,

because the total absorbance is the sum of the individual contributions of each base

(Table A.3D.1).

3. Use the A260/A280 ratio and readings at A230 and A325 to estimate the purity of the

nucleic acid sample.

Table A.3D.1 Molar Extinction Coefficients of DNA Basesa

Base ε 1M260 nm

Adenine 15,200Cytosine 7,050

Guanosine 12,010Thymine 8,400

aMeasured at 260 nm; see Wallace and Miyada, 1987

Ratios of 1.8 to 1.9 and 1.9 to 2.0 indicate highly purified preparations of DNA

and RNA, respectively. Contaminants that absorb at 280 nm (e.g., protein) will lower this

ratio.

Absorbance at 230 nm reflects contamination of the sample by phenol or urea, whereas

absorbance at 325 nm suggests contamination by particulates and dirty cuvettes. Light

65


scatter at 325 nm can be magnified 5-fold at 260 nm. Typical values at the four

wavelengths for a highly purified preparation are shown in Table A.3D.2.

Table A.3D.2 Spectrophotometric Measurements of Purified DNAa

Wavelength (nm) Absorbance A260/A280 Conc. (μg/ml)325 0.01 — —

280 0.28 — —

260 0.56 2.0 28

230 0.30 — —aTypical absorbancy readings of highly purified calf thymus DNA suspended in 1X TNE buffer. The concentration of DNA was

nominally 25 μg/ml.

DNA DETECTION USING THE DNA-BINDING FLUOROCHROME

HOECHST 33258

Use of fluorometry to measure DNA concentration has gained popularity because it is

simple and much more sensitive than spectrophotometric measurements. Specific for

nanogram amounts of DNA, the Hoechst 33258 fluorochrome has little affinity for RNA

and works equally well with either whole-cell homogenates or purified preparations of

DNA. The fluorochrome is, however, sensitive to changes in DNA composition, with

preferential binding to AT-rich regions. A fluorometer capable of an excitation

wavelength of 365 nm and an emission wavelength of 460 nm is required for this assay.

Additional Materials (also see Basic Protocol). Hoechst 33258 assay solution (working

solution; see recipe). Dedicated filter fluorometer (Hoefer TKO100) or scanning

fluorescence spectrophotometer (Shimadzu model RF-5000 or Perkin-Elmer model LS-

5B or LS-3B). Fluorometric square glass cuvettes or disposable acrylic cuvettes

(Sarstedt) Teflon stir rod:

1. Prepare the scanning fluorescence spectrophotometer by setting the excitation

wavelength to 365 nm and the emission wavelength to 460 nm. The dedicated filter

fluorometer has fixed wavelengths at 365 and 460 nm and does not need adjustment.

2. Pipet 2.0 ml Hoechst 33258 assay solution into cuvette and place in sample chamber.

Take a reading without DNA and use as background. If the fluorometer has a

concentration readout mode or is capable of creating a standard curve, set instrument to

read 0 with the blank solution. Otherwise note the readings in relative fluorescence units.

Be sure to take a blank reading for each cuvette used, as slight variations can cause

changes in the background reading.

66


3. With the cuvette still in the sample chamber, add 2 μl DNA standard to the blank

Hoechst 33258 assay solution. Mix in the cuvette with a Teflon stir rod or by capping and

inverting the cuvette. Read emission in relative fluorescence units or set the concentration

readout equal to the final DNA concentration. Repeat measurements with remaining

DNA standards using fresh assay solution (take background zero reading and zero

instrument if needed). If necessary, the DNA standards should be quantitated by A260

measurement (Basic Protocol) before being used here. Small-bore tips designed for

loading sequencing gels minimize errors of pipetting small volumes. Prerinse tips with

sample and make sure no liquid remains outside the tip after drawing up the sample. Read

samples in duplicate or triplicate, with a blank reading taken each time. Unusual or

unstable blank readings indicate a dirty cuvette or particulate material in the solution,

respectively.

4. Repeat step 3 with unknown samples.

A dye concentration of 0.1 μg/ml is adequate for final DNA concentrations up to ~500

ng/ml. Increasing the working dye concentration to 1 μg/ml Hoechst 33258 will extend

the assay’s range to 15 μg/ml DNA, but will limit sensitivity at low concentrations (5 to

10 ng/ml). Sample volumes of ≤10 μl can be added to the 2.0-ml aliquot of Hoechst

33258 assay solution.

In contrast to the fluorochrome Hoechst 33258, ethidium bromide is relatively

unaffected by differences in the base composition of DNA. Ethidium bromide is not as

sensitive as Hoechst 33258 and, although capable of detecting nanogram levels of DNA,

will also bind to RNA. In preparations of DNA with minimal RNA contamination or with

DNA samples having an unusually high guanine and cytosine (GC) content where the

Hoechst 33258 signal can be quite low, ethidium bromide offers a relatively sensitive

alternative to the more popular Hoechst 33258 DNA assay. A fluorometer capable of an

excitation wavelength of 302 or 546 nm and an emission wavelength of 590 nm is

required for this assay.

Additional Materials (also see Basic Protocol)

Ethidium bromide assay solution (see recipe)

1. Pipet 2.0 ml ethidium bromide assay solution into cuvette and place in sample

chamber. Set excitation wavelength to 302 nm or 546 nm and emission wavelength to

590 nm. Take an emission reading without DNA and use as background. If the instrument

has a concentration readout mode or is capable of creating a standard curve, set

instrument to read 0 with the blank solution. Otherwise note the readings in relative

67


fluorescence units. The excitation wavelength of this assay can be either in the UV range

(~302 nm) using a quartz cuvette or in the visible range (546 nm) using a glass cuvette. In

both cases the emission wavelength is 590 nm.

2. Read and calibrate these samples as described in step 3 of the Hoechst 33258 assay.

3. Read emissions of the unknown samples as in step 4 of the Hoechst 33258 assay. A

dye concentration of 5 µg/ml in the ethidium bromide assay solution is appropriate for

final DNA concentrations up to 1000 ng/ml. 10 μg/ml ethidium bromide in the ethidium

bromide assay solution will extend the assay’s range to 10 μg/ml DNA, but is only used

for DNA concentrations >1 μg/ml. Sample volumes of up to 10 μl can be added to the

2.0-ml aliquot of ethidium bromide assay solution.

DNA DETECTION USING PICOGREEN dsDNA QUANTITATION REAGENT

PicoGreen dsDNA quantitation reagent enables researchers to quantitate as little

as 25 pg/ml of dsDNA (50 pg dsDNA in a 2-ml assay volume) with a standard

spectrofluorometer and fluorescein excitation and emission wavelengths. This sensitivity

exceeds that achieved with the Hoechst 33258–based assay (Alternate Protocol 1) by

400-fold. Using a fluorescence microplate reader, it is possible to detect as little as 250

pg/ml dsDNA (50 pg in a 200-μl assay volume). The standard PicoGreen assay protocol

is also simpler than that for Hoechst 33258 because a single concentration of the

PicoGreen reagent allows detection over the full dynamic range of the assay. In order to

achieve more than two orders of magnitude in dynamic range with Hoechst-based assays,

two different dye concentrations are recommended. In contrast, the linear detection range

of the PicoGreen assay in a standard fluorometer extends over more than four orders of

magnitude in DNA concentration—from 25 pg/ml to 1000 ng/ml—with a single dye

concentration (Fig.A.3D.1).

68


Linearity is maintained in the presence of several compounds that commonly contaminate

nucleic acid preparations, including salts, urea, ethanol, chloroform, detergents, proteins,

and agarose.

CAUTION: No data are available addressing the mutagenicity or toxicity of PicoGreen

dsDNA quantitation reagent. Because this reagent binds to nucleic acids, it should be

treated as a potential mutagen and handled with appropriate care. The DMSO stock

solution should be handled with particular caution, as DMSO is known to facilitate the

entry of organic molecules into tissues. It is strongly recommended that double gloves be

used when handling the DMSO stock solution. As with all nucleic acid reagents,

solutions of PicoGreen reagent should be poured through activated charcoal before

disposal. The charcoal must then be incinerated to destroy the dye.

Additional Materials (also see Basic Protocol)

PicoGreen dsDNA quantitation kit containing: PicoGreen dsDNA quantitation reagent

(Component A), 1 ml solution in DMSO (store frozen up to 6 months at −20°C, protected

from light) 20X TE (Component B), 25 ml of 200 mM Tris.Cl/20 mM EDTA, pH 7.5

(store up to 6 months at 4°C; may be frozen for long-term storage) Lambda DNA

standard (Component C), 1 ml of 100 μg/ml in TE (store up to 6 months at 4°C; may be

frozen for long-term storage) Spectrofluorometer or fluorescence microplate reader.

NOTE: For either the kits or the stand-alone reagent, sufficient reagent is supplied for

200 assays using an assay volume of 2 ml according to the protocol below. Note that the

assay volume is dependent on the instrument used to measure fluorescence; with a

microplate reader and a 96-well microplate, the assay volume is reduced to 200 μl and

2000 assays are possible. The PicoGreen reagent supplied in the kits is exactly the same

as the reagent sold separately. The DMSO stock solution should be stored frozen at

−20°C and protected from light. The 20X assay buffer and lambda DNA standard in the

kits are best stored at 4°C; however, either may be frozen for long-term storage. When

properly stored, components should be stable for at least 6 months.

Prepare the reagent

1. On day of experiment, prepare an aqueous working solution of the PicoGreen reagent

by making a 200-fold dilution of the concentrated DMSO solution in 1X TE. Allow the

PicoGreen reagent to warm to room temperature before opening the vial. Because the

PicoGreen dye is an extremely sensitive detection reagent for dsDNA, it is imperative

that the TE solution be free of contaminating nucleic acids. The 20X TE buffer included

in the PicoGreen dsDNA Quantitation Kits is certified to be nucleic acid–free and

69


DNase-free. Prepare a 1X TE working solution by diluting the concentrated buffer 20-

fold with sterile, distilled, DNase-free water. To prepare enough working solution to

assay 20 samples in a 2-ml final volume, add 100µl PicoGreen dsDNA quantitation

reagent to 19.9 ml TE. The author recommends preparing this solution in a plastic

container rather than glass, as the reagent may adsorb to glass surfaces. Protect the

working solution from light by covering it with foil or placing it in the dark, as the

PicoGreen reagent is susceptible to photodegradation. For best results, this solution

should be used within a few hours of its preparation. Establish the DNA standard curve

2. Prepare a 2 μg/ml stock solution of dsDNA in 1X TE. Determine the DNA

concentration on the basis of absorbance at 260 nm (A260) in a cuvette with a 1-cm

pathlength (see Basic Protocol); an A260 of 0.04 corresponds to 2 μg/ml dsDNA

solution.

For a standard curve, the author commonly uses bacteriophage lambda DNA (provided

with kit) or calf thymus DNA, although any purified dsDNA preparation may be used.

The lambda DNA standard, provided at 100 _g/ml in the PicoGreen Kits, can simply be

diluted 50-fold in 1X TE to make the 2 μg/ml working solution. For example, 30 μl of the

DNA standard mixed with 1.47 ml of TE will be sufficient for the standard curve

described below. It is sometimes preferable to prepare the standard curve with DNA

similar to the type being assayed; e.g., long or short linear DNA fragments when

quantitating similar-sized restriction fragments or plasmid when quantitating plasmid

DNA. However, most linear dsDNA molecules yield approximately equivalent signals,

regardless of fragment length. Results have shown that the PicoGreen assay remains

linear in the presence of several compounds that commonly contaminate nucleic acid

preparations, although the signal intensity may be affected (Table A.3D.3). Thus, to serve

as an effective control, the dsDNA solution used to prepare the standard curve should be

treated the same way as the experimental samples and should contain similar levels of

such compounds.

3a. For high-range standard curve: Create a five-point standard curve from 1 ng/ml to 1

μg/ml by combining the 2 μg/ml stock prepared in step 2 with 1X TE, in disposable

cuvettes (or plastic test tubes for transfer to quartz cuvettes), according to Table A.3D.4.

3b. For low-range standard curve: Prepare a 40-fold dilution of the 2 μg/ml DNA solution

to yield a 50 ng/ml DNA stock solution. Create a five-point standard curve from 25

pg/ml to 25 ng/ml by combining this 50 ng/ml stock with 1X TE in disposable cuvettes

(or plastic test tubes for transfer to quartz cuvettes), according to Table A.3D.4.

70


To create the low-range standard curve, adjust the fluorometer gain to accommodate the

lower fluorescence signals.

4. Add 1.0 ml of the aqueous working solution of PicoGreen reagent (prepared in step1)

to each cuvette. Mix well and incubate for 2 to 5 min at room temperature, protected from

light.

5. After incubation, measure sample fluorescence using a spectrofluorometer or

fluorescence microplate reader and standard fluorescein wavelengths (excitation ~480

nm, emission ~520 nm). To ensure that the sample readings remain in the detection

range of the fluorometer, set the instrument’s gain so that the sample containing the

highest DNA concentration yields a fluorescence intensity near the fluorometer’s

maximum. To minimize photobleaching effects, keep the time for fluorescence

measurement constant for all samples.

6. Subtract the fluorescence value of the reagent blank from that of each of the samples.

Use corrected data to generate a standard curve of fluorescence versus DNA

concentration (see Fig. A.3D.1). Analyze samples

71


7. Add 1.0 ml of the aqueous working solution of the PicoGreen reagent (prepared in step

1) to each sample. Incubate 2 to 5 min at room temperature, protected from light.

72


8. Measure fluorescence of sample using instrument parameters that correspond to those

used when generating standard curve (see steps 2 to 6). To minimize photobleaching

effects, keep time for fluorescence measurement constant for all samples.

9. Subtract fluorescence value of reagent blank from that of each sample. Determine

DNA concentration of the sample from standard curve.

10. If desired, repeat assay using a different dilution of the sample to confirm results.

REAGENTS AND SOLUTIONS

Use deionized, distilled water in all recipes and protocol steps.

Calf thymus DNA standard solutions Kits containing calf thymus DNA standard for

fluorometry are available (Fluorometry Reference Standard Kits, Hoefer). Premeasured,

CsCl-gradient-purified DNA of defined GC content, for use in absorption and

fluorometric spectroscopy, is available from Sigma (e.g., calf thymus DNA, 42% GC;

Clostridium perfringen DNA, 26.5% GC).

Ethidium bromide assay solution

Add 10 ml of 10X TNE buffer (see recipe) to 89.5 ml H2O. Filter through a 0.45-μm

filter, then add 0.5 ml of 1 mg/ml ethidium bromide. Add the dye after filtering, as

ethidium bromide will bind to most filtration membranes.

CAUTION: Ethidium bromide is hazardous; wear gloves and use appropriate care in

handling, storage, and disposal.

Hoechst 33258 assay solutions

Stock solution: Dissolve in H2O at 1 mg/ml. Stable for ~ 6 months at 4°C.

Working solution: Add 10 ml of 10X TNE buffer (see recipe) to 90 ml H2O. Filter

through a 0.45-μm filter, then add 10 μl of 1 mg/ml Hoechst 33258.

Hoechst 33258 is a fluorochrome dye with a molecular weight of 624 and a molar

extinction coefficient of 4.2*104 M−1cm−1 at 338 nm. The dye is added after filtering

because it will bind to most filtration membranes. Hoechst 33258 is hazardous; use

appropriate care in handling, storage, and disposal.

TNE buffer, 10SX, 100 mM Tris base, 10 mM EDTA, 2.0 M NaCl, Adjust pH to 7.4

with concentrated HCl. As needed, dilute with H2O to desired concentration.

COMMENTARY

Background Information

In deciding what method of nucleic acid measurement is appropriate, three issues are

critical: specificity, sensitivity, and interfering substances. Properties of the four assays

described in this section are listed in Table A.3D.5.

73


The traditional method for determining the amount of DNA in solution is by measuring

absorbance at 260 nm. Because many potential contaminants of DNA and RNA

preparations also absorb in the UV range, absorption spectroscopy is a reliable method to

assess both the purity of a preparation and the quantity of DNA or RNA present.

Absorption spectroscopy does have serious limitations. Relatively large amounts of DNA

are required to get accurate readings—for example, 500 ng/ml DNA is equivalent to only

0.01 A260 units. Furthermore, the method cannot discriminate between RNA and DNA,

and UV-absorbing contaminants such as protein will cause discrepancies. The assay

using Hoechst 33258 dye (Alternate Protocol 1) is the only procedure in common use that

is specific for DNA (i.e., it does not measure RNA). This assay is the method of choice

for rapid measurement of low quantities of DNA, with a detection limit of ~1 ng DNA.

Concentrations of DNA in both crude cell lysates and purified preparations can be

quantified (Labarca and Paigen, 1980). Because the assay quantifies a broad range of

DNA concentrations— from 10 ng/ml to 15 μg/ml—it is useful for the measurement of

both small and large amounts of DNA (e.g., in verifying DNA concentrations prior to

performing electrophoretic separations and Southern blots). The Hoechst 33258 assay is

also useful for measuring products of the polymerase chain reaction (PCR) synthesis.

Upon binding to DNA, the fluorescence characteristics of Hoechst 33258 change

dramatically, showing a large increase in emission at ~458 nm. Hoechst 33258 is

nonintercalating and apparently binds to the minor groove of the DNA, with a marked

preference for AT sequences (Portugal and Waring, 1988). The fluorochrome 4′,6-

diamidino-2-phenylindole (DAPI; Daxhelet et al., 1989) is also appropriate for DNA

74


quantitation, although it is not as commonly used as Hoechst 33258. DAPI is excited with

a peak at 344 nm. Emission is detected at ~ 466 nm, similar to Hoechst 33258.

Ethidium bromide is best known for routine staining of electrophoretically separated

DNA and RNA, but it can also be used to quantify both DNA and RNA in solution (Le

Pecq, 1971). Unlike Hoechst 33258, ethidium bromide fluorescence is not significantly

impaired by high GC content. The ethidium bromide assay (with excitation at 546 nm) is

~20-fold less sensitive than the Hoechst 33258 assay. In addition to the advantages

mentioned in the protocol itself (see Alternate Protocol 3), the PicoGreen assay protocol

also minimizes the fluorescence contribution of RNA and single-stranded DNA (ssDNA).

Although the Hoechst 33258–based method is not significantly affected by the presence

of RNA when the assay is carried out in the recommended high-salt buffer, Hoechst

33258 does exhibit a large fluorescence enhancement with ssDNA under these

conditions. Furthermore, when the Hoechst 33258–based assay is carried out in TE alone

(10 mM Tris.Cl/1 mM EDTA, pH 7.5, with no NaCl added), RNA contributes a

significant fluorescence signal. Using the PicoGreen dsDNA quantitation reagent as

described in Alternate Protocol 3, researchers can quantitate dsDNA in the presence of

equimolar concentrations of ssDNA and RNA with minimal effect on the quantitation

results.

Critical Parameters

Care should be taken when handling sample cuvettes in all spectrophotometric

procedures. Fluorometers use cuvettes with four optically clear faces, because excitation

and emitting light enter and leave the cuvette through directly adjacent sides. Thus,

fluorometric cuvettes should be held by the upper edges only. In contrast, transmission

spectrophotometers use cuvettes with two opposite optical windows, with the sides

frosted for easy handling. It is important to check that the optical faces of cuvettes are

free of fingerprints and scratches. In addition, for accurate absorbance readings,

spectrophotometer cuvettes must be perfectly matched. Proteins in general have A280

readings considerably lower than nucleic acids on an equivalent weight basis. Thus, even

a small increase in the A280 relative to A260 (i.e., a lowering of the A260/A280 ratio)

can indicate severe protein contamination. Other commonly used buffer components

absorb strongly at 260 nm and can cause interference if present in high enough

concentrations. EDTA, for example, should not be present at ≥10 mM. Sensitivity of the

Hoechst 33258 fluorescence assay decreases with nuclease degradation, increasing GC

content, or denaturation of DNA (Labarca and Paigen, 1980; Stout and Becker, 1982).

75


Increased temperature of the assay solution and ethidium bromide contamination also

decrease the Hoechst 33258 signal. Sodium dodecyl sulfate (>0.01% final concentration)

also interferes with accurate readings (Cesarone et al., 1979). The pH of the assay

solution is critical to sensitivity and should be pH ~7.4 (Labarca and Paigen, 1980; Stout

and Becker, 1982). At a pH <6.0 or >8.0 the background becomes much higher and there

is a concomitant loss of fluorescence enhancement. High-quality double-stranded DNA is

recommended, although single-stranded genomic DNA also works well with this assay.

However, with very small fragments of DNA, the Hoechst 33258 dye binds to double-

stranded DNA only. Thus, the assay will not work with single-stranded oligomers. Linear

and circular DNA give approximately the same levels of fluorescence (Daxhelet et al.,

1989). When preparing DNA standards, an attempt should be made to equalize the GC

content of the standard DNA and that of the sample DNA. In most situations, salmon

sperm or calf thymus DNA is suitable. An extensive list of estimated GC content for

various organisms is available (Marmur and Doty, 1962). Eukaryotic cells vary

somewhat in GC content but are generally in the range of 39% to 46%. Within this range,

the fluorescence per microgram of DNA does not vary substantially. In contrast, the GC

content of prokaryotes can vary from 26% to 77%, causing considerable variation in the

fluorescence signal. In these situations, the sample DNA should be first quantitated via

transmission spectroscopy and compared to a readily available standard (e.g., calf thymus

DNA). Future measurements would then use calf thymus as a standard, but with a

correction factor for difference in fluorescence yield between the two DNA types. For

further troubleshooting information, see Van Lancker and Gheyssens (1986), in which

the effects of interfering substances on the Hoechst 33258 assay (and several other

assays) are compared.

In the ethidium bromide assay, single-stranded DNA gives approximately half the

signal as double-stranded calf thymus DNA. Ribosomal RNA also gives about half the

fluorescent signal as double-stranded DNA, and RNase and DNase both severely

decrease the signal. Closed circular DNA also binds less ethidium bromide than nicked or

linear DNA. Further critical parameters of the ethidium bromide assay are described by

Le Pecq (1971).

With PicoGreen, dsDNA can be quantitated in the presence of equimolar

concentrations of single-stranded nucleic acids with minimal interference. Table A.3D.6

shows the concentrations of RNA or ssDNA that, for a given dsDNA concentration,

result in less than a 10% change in the signal intensity using the PicoGreen assay

76


protocol. Fluorescence due to PicoGreen reagent binding to RNA at high

concentrations can be eliminated by treating the sample with DNase-free RNase. The

use of RNase A/RNase T1 with S1 nuclease will eliminate all single-stranded nucleic

acids and ensure that the entire sample fluorescence is due to dsDNA.

Anticipated Results

The detection limit of absorption spectroscopy will depend on the sensitivity of

the spectrophotometer and any UV-absorbing contaminants that might be present. The

77


lower limit is generally ~ 0.5 to 1 μg nucleic acid. Typical values for a highly purified

sample of DNA are shown in Table A.3D.2. For the Hoechst 33258, ethidium bromide,

and PicoGreen assays, a plot of relative fluorescence units or estimated concentration (y

axis) versus actual concentration (x axis) typically produces a linear regression with a

correlation coefficient (r2) of 0.98 to 0.99 (Fig. A.3D.2). Table A.3D.3 provides a

comparison of the sensitivities and specificities of the three assays.

Time Considerations

The three assays described can be performed in a short period of time. In a well-

planned series of assays, 50 samples can be prepared and read comfortably in 1 hr.

Although some error might be introduced, DNA samples can be sequentially added to the

same cuvette containing working dye solution. The increase in fluorescence with each

sample is noted and subtracted from the previous reading to give relative fluorescence or

concentration of the new sample, eliminating the need to change solutions for each

sample. Be certain that the final amount of DNA does not exceed the linear portion of the

assay.

Literature Cited

Applied Biosystems. 1987. User Bulletin Issue 11, Model No. 370. Applied Biosystems,

Foster City, Calif. Cesarone, C.F., Bolognesi, C., and Santi L. 1979.

Improved microfluorometric DNA determination in biological material using 33258

Hoechst. Anal. Biochem. 100:188-197.

Daxhelet, G.A., Coene, M.M., Hoet, P.P., and Cocito, C.G. 1989. Spectrofluorometry of

dyes with DNAs of different base composition and conformation. Anal. Biochem.

179:401-403.

Labarca, C. and Paigen, K. 1980. A simple, rapid, and sensitive DNA assay procedure.

Anal. Biochem.102:344-352.

Le Pecq, J.-B. 1971. Use of ethidium bromide for separation and determination of nucleic

acids of various conformational forms and measurement of their associated enzymes. In

Methods of Biochemical Analysis, Vol. 20 (D. Glick, ed.) pp. 41-86. John Wiley & Sons,

New York.

Marmur, J. and Doty, P. 1962. Determination of the base composition of

deoxyribonucleic acid from its thermal denaturation temperature. J. Molec. Biol. 5:109-

118.

78


Portugal, J. and Waring, M.J. 1988. Assignment of DNA binding sites for 4′,6-diamidine-

2- phenylindole and bisbenzimide (Hoechst 33258): A comparative footprinting study.

Biochem. Biophys. Acta 949:158-168.

Stout, D.L. and Becker, F.F. 1982. Fluorometric quantitation of single-stranded DNA: A

method applicable to the technique of alkaline elution. Anal. Biochem. 127:302-307.

Van Lancker, M. and Gheyssens, L.C. 1986. A comparison of four frequently used assays

for quantitative determination of DNA. Anal. Lett. 19:615-623.

Wallace, R.B. and Miyada, C.G. 1987. Oligonucleotide probes for the screening of

recombinant DNA libraries. In Methods of Enzymology, Vol. 152: Guide to Molecular

Cloning Techniques (S.L. Berger and A.R. Kimmel, eds.) pp. 432-442. Academic Press,

San Diego.

Key References

Labarca and Paigen, 1980. See above. Contains a detailed description of the Hoechst

33258 fluorometric DNA assay. Contributed by Sean R. Gallagher UVP, Inc.

Upland, California

Supplement 66 Current Protocols in Molecular Biology A.3D.12

Quantitation of DNA and RNA with Absorption and Fluorescence Spectroscopy.

Monitoring and interpreting separations of

DNA through agarose gels

When choosing the amount of DNA to be loaded, the width of the well plus the depth

of the gel and the number and size of DNA fragments should be considered. Between

5 and 200 ng of a single DNA fragment can be loaded into a 0.5-cm-wide ~ 0.2-cm

deep sample well; 5 ng approaches the minimal amount of an individual DNA

fragment that can be detected by ethidium bromide staining, and 200 ng approximates

the most that can be resolved before overloading occurs (the trailing and smearing

characteristic of overloading become more pronounced with DNA fragments above

10 kb). For samples of DNA containing several fragments, between 0.1 and 0.5 µg of

DNA is typically loaded per 0.5 cm sample well. Up to 10 µg of DNA can be

adequately resolved for samples containing numerous fragments of different sizes

(e.g., restriction digests of genomic DNA).

The most common means of monitoring the progress of an electrophoretic

separation is by following the migration of tracking dyes that are incorporated into the

79


loading buffer. Two widely used dyes displaying different electrophoretic mobilities

are bromphenol blue and xylene cyanol. Xylene cyanol typically migrates with DNA

fragments around 5 kb and bromphenol blue usually comigrates with DNA molecules

around 0.5 kb. Bromphenol Blue therefore provides an index of the mobility of the

fastest fragments and is particularly valuable in determining the length of the gel over

which the separation of DNA has occurred.

Xylene cyanol is useful for monitoring the progress of longer runs. Both dyes can

interfere with the visualization of the fragments that comigrate with them.

Ethidium bromide is commonly used for direct visualization of DNA in gels.

The dye intercalates between the stacked bases of nucleic acids and fluoresces red-

orange (560 nm) when illuminated with UV light (260 to 360 nm). This allows very

small quantities of DNA to be detected (~5 ng) (Sharp et al., 1973). Ethidium bromide

is frequently added to the gel and running buffer prior to electrophoresis. While this

has a slight effect on the mobility of the DNA, it eliminates the need to stain the gel

upon completion of the separation. An added advantage to running gels with ethidium

bromide is that the mobility of the DNA can be monitored throughout the run until the

desired separation is achieved.

Among the samples loaded onto the gel, at least one lane should contain a

series of DNA fragments of known sizes so that a standard curve can be constructed

to allow the calculation of the sizes of unknown DNA fragments. The most commonly

used molecular weight markers are restriction digests of phage λDNA or, for

smaller fragments, the plasmid pBR322. Figure 2.5A.3 shows the migration pattern

and fragment sizes for restriction digests of λ DNA and pBR322 that are frequently

used as molecular weight markers. Aside from restriction fragments, many

commercial preparations of molecular weight markers are also available. These

products usually cover a wide range of DNA sizes, and some manufacturers also offer

supercoiled (form I) markers for calculating plasmid sizes.

Troubleshooting

Common problems encountered in agarose gel electrophoresis are described

below, along with several possible causes.

Poor resolution of DNA fragments. The most frequent cause of poor DNA

resolution is improper choice of agarose concentration. Low percentage agarose gels

should be used to resolve high-molecular-weight DNA fragments and high percentage

80


gels for low-molecular weight DNAs. Fuzzy bands, encountered particularly with

small DNA fragments, result from diffusion of the DNA through.

Band smearing: Trailing and smearing of DNA bands is most frequently observed

with high-molecular-weight DNA fragments. This is often caused by overloading the

DNA sample or running gels at high voltages. DNA samples loaded into torn sample

wells will also cause extensive smearing, as the DNA will tend to run in the interface

between the agarose and the gel support.

Melting of an agarose gel during an electrophoretic separation is a sign that

either the electrophoresis buffer has been omitted in the preparation of the gel or has

become exhausted during the course of the run.

For high-voltage electrophoresis over long time periods, TBE should be used instead

of TAE as it has a greater buffering capacity. Also, minigel and midigel boxes, which

typically have small buffer reservoirs, tend to exhaust buffers more readily than larger

gel boxes.

Among the parameters that influence the length of time required to complete

an electrophoretic separation, the one that has the greatest effect is the applied

voltage. Most large agarose gels are run overnight (~16 hr) at voltages between 1 and

1.5 V/cm. While gels can be run much faster, particularly if the gel apparatus is

cooled, resolution of larger DNA fragments is lost when higher voltages are used.

Because the resolution required depends on the relative molecular weights of the

fragments of interest, the time required for adequate separation is best determined

empirically. As described above, this is most easily done by including ethidium

bromide in the gel and then monitoring the progress of the run directly by

visualization with UV light. Two consequences of high-voltage runs should be kept in

mind: First, as mentioned above, buffers become quickly exhausted and therefore

TBE should be used, or gel tanks with large buffer capacities. Second, high voltages

provide poor resolution of high-molecular-weight DNA fragments (see previous

discussion). If large DNA fragments are to be separated, it may be advisable to use

larger gels and/or lower applied voltages.

Gels and Electric Circuits

Gel electrophoresis units are almost always simple electric circuits and can be

understood using two simple equations. Ohm’s law, V = IR, states that the electric

field, V (measured in volts), is proportional to current, I (measured in milliamps),

81


times resistance, R (measured in ohms). When a given amount of voltage is applied to

a simple circuit, a constant amount of current flows through all the elements and the

decrease in the total applied voltage that occurs across any element is a direct

consequence of its resistance. For a segment of a gel apparatus, resistance is inversely

proportional to both the cross-sectional area and the ionic strength of the buffer.

Usually the gel itself provides nearly all of the resistance in the circuit, and the

voltage applied to the gel will be essentially the same as the total voltage applied to

the circuit. For a given current, decreasing either the thickness of the gel (and any

overlying buffer) or the ionic strength of the buffer will increase resistance and,

consequently, increase the voltage gradient across the gel and the electrophoretic

mobility of the sample. A practical upper limit to the voltage is usually set by the

ability of the gel apparatus to dissipate heat.

A second useful equation, P = I2R, states that the power produced by the

system, P (measured in watts), is proportional to the resistance times the square of the

current. The power produced is manifested as heat, and any gel apparatus can

dissipate only a particular amount of power without increasing the temperature of the

gel. Above this point small increases in voltage can cause significant and potentially

disastrous increases in temperature of the gel. It is very important to know how much

power a particular gel apparatus can easily dissipate and to carefully monitor the

temperature of gels run above that level.

Two practical examples illustrate applications of the two equations. The first

involves the fact that the resistance of acrylamide gels increases somewhat during a

run as ions related to polymerization are electrophoresed out of the gel. If such a gel is

run at constant current, the voltage will increase with time and significant increases in

power can occur. If an acrylamide gel is being run at high voltage, the power supply

should be set to deliver constant power. The second situation is the case where there is

a limitation in number of power supplies, but not gel apparati.

A direct application of the first equation shows that the fraction of total

voltage applied to each of two gels hooked up in series (one after another) will be

proportional to the fraction of total resistance the gel contributes to the circuit. Two

identical gels will each get 50% of the total voltage and power indicated on the power

supply.

Finally, it should be noted that some electrophoretic systems employ lethally

high voltages, and almost all are potentially hazardous. It is very important to use an

82


adequately shielded apparatus, an appropriately grounded and regulated power

supply, and most importantly, common sense when carrying out electrophoresis

Restriction Fragment Length Polymorphism (RFLP)

Introduction

Restriction Fragment Length Polymorphism (RFLP) is a difference in homologous

DNA sequences that can be detected by the presence of fragments of different lengths

after digestion of the DNA samples in question with specific restriction

endonucleases. RFLP, as a molecular marker, is specific to a single clone/restriction

enzyme combination. Most RFLP markers are co-dominant (both alleles in

heterozygous sample will be detected) and highly locus-specific.

An RFLP probe is a labeled DNA sequence that hybridizes with one or more

fragments of the digested DNA sample after they were separated by gel

electrophoresis, thus revealing a unique blotting pattern characteristic to a specific

genotype at a specific locus. Short, single- or low-copy genomic DNA or cDNA

clones are typically used as RFLP probes. The RFLP probes are frequently used

in genome mapping and in variation analysis (genotyping, forensics, paternity tests,

hereditary disease diagnostics, etc.).

How It Works:

SNPs or IN DE

Ls can

create or

abolish

restriction

endonuclease (RE) recognition sites, thus affecting quantities and length of DNA

fragments resulting from RE digestion.

Genotyping

Developing RFLP probes

83

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/Glossary.shtml#indel



http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/Glossary.shtml#snp

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/ApplVariation.shtml

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/ApplMapping.shtml

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/Glossary.shtml#re

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/Glossary.shtml#re


Total DNA is digested with a methylation-sensitive enzyme (for example, PstI),

thereby enriching the library for single- or low-copy expressed sequences (PstI clones

are based on the suggestion that expressed genes are not methylated).

The digested DNA is size-fractionated on a preparative agarose gel, and fragments

ranging from 500 to 2000 bp are excised, eluted and cloned into a plasmid vector (for

example, pUC18).

Digests of the plasmids are screened to check for inserts.

Southern blots of the inserts can be probed with total sheared DNA to select clones

that hybridize to single- and low-copy sequences.

The probes are screened for RFLPs using genomic DNA of different genotypes

digested with restriction endonucleases. Typically, in species with moderate to high

polymorphism rates, two to four restriction endonucleases are used such

as EcoRI, EcoRV, and HindIII. In species with low polymorphism rates, additional

restriction endonucleases can be tested to increase the chance of finding

polymorphism.

PCR-RFLP

Isolation of sufficient DNA for RFLP analysis is time consuming and labor intensive.

However, PCR can be used to amplify very small amounts of DNA, usually in 2-3

hours, to the levels required for RFLP analysis. Therefore, more samples can be

analyzed in a shorter time. An alternative name for the technique is Cleaved

Amplified Polymorphic Sequence (CAPS) assay.

84

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/TechCAPS.shtml

http://www.ncbi.nlm.nih.gov/projects/genome/probe/doc/TechCAPS.shtml


Amplified fragment length polymorphism (AFLP)

Amplified fragment length polymorphism (AFLP) DNA fingerprinting is a firmly

established molecular marker technique for evolutionary, genetic, and ecological

studies of plants, animals, and microorganisms. The AFLP technique (Vos et al.,

1995) was developed by KeyGene (Netherlands), a private biotechnology company

that has filed property rights on the technology. For more information, see KeyGene’s

home page: http://www.keygene.com. AFLP has a number of broad applications,

ranging from linkage mapping to analyses using population-based and phylogenetic

methods. Genomic DNA is first digested using two restriction endonucleases,

typically one with a 6-bp recognition sequence (usually EcoRI) and one with a 4-bp

recognition sequence (usually Msel). Adapters of known sequence are then ligated to

each end of the fragments and two successive rounds of selective PCR amplification

are performed. The first round of PCR (preselective or -f-1 amplification) uses

primers that match the adapters on the EcoRI end and Msel end of the fragments plus

one extra nucleotide. The second round (selective or +3 amplification) has an

additional two nucleotides added to the +1 primers sequences. These rounds of

selective amplification reduce the resulting pool of DNA fragments to a size more

manageable for analysis. Although the DNA fragments are anonymous, the method is

remarkably reliable and consistent (Vos et al., 1995). This technique is readily

adapted to new taxa because no taxon-specific information is needed and AFLPs are

suitable for use in both prokaryotic and eukaryotic organisms. Moreover, the

technique surveys the entire genome, is relatively inexpensive, and generates many

potential marker candidates. Many other enzyme combinations are possible, but for

convenience this discussion will focus on the EcoR I—Mse I system. Usually in

excess of 50 products, with a size range of 50–500 bp (including the non-genomic

adapter sequences), are reported for this enzyme combination per +3/+3 primer pair,

and there is a distinct skewing towards the lower end of this size range. The subset of

fragments are analysed by denaturing polyacrylamide gel electrophoresis to generate a

fingerprint and DNA bands may be detected, using different methods. In addition to

the advantage of not requiring radioisotopes, fluorescent primers can be loaded as sets

of three, each labelled with a different coloured dye, into the same gel lane, thus

maximising the number of data points gathered per gel.

85


Fig.1. Schematic representation of AFLP workflow.

The molecular basis of AFLP polymorphisms will usually be caused at the nucleotide

level. Single nucleotide changes will be detected when (1) the actual restriction sites

are affected; and (2) nucleotides adjacent to the restriction sites are affected, which

cause the primers to mispair at the 3' end and prevent amplification. Most AFLP

markers will be mono-allelic, meaning that only one allele can be scored and the

corresponding allele is not detected. At a low frequency, bi-allelic markers will be

identified, as a result of small insertions or deletions in the restriction fragments. The

AFLP technology can be applied to any DNA sample, including human, animal, plant

and microbial DNA, giving it the potential to become a universal DNA fingerprinting

system. Because of the nature of AFLP primers, the markers obtained are highly

reliable and robust, unaffected by small variations in the amplification process. A

typical AFLP fingerprint contains between 50 and 100 amplified fragments, many of

which, or even most, may serve as genetic markers. The generation of transcript

profiles using AFLPs with cDNAs is an efficient tool for identifying differentially

expressed mRNAs. This tool has several advantages that can be useful for discovering

genes in germplasm. A further drawback of AFLP technology is perhaps the lack of

guarantee of homology between bands of similar molecular weight (MW), thus

creating difficulties for some types of studies such as phylogenetic analyses.

However, while non-homologous bands with similar weight are also found with other

86


markers such as RAPDs, they may, in fact, be less common with AFLP technology

because gel resolution is very high and, consequently, the likelihood of non-

homologous bands being coincidentally of the same molecular weight is low.

Fig.2. Adapter ligation and fluorescent labeling .

Technical details: Setting up an AFLP study

Commercial AFLP kits or DIY?

Commercial AFLP kits (usually from Applied Biosystems or Invitrogen) offer the

advantages of convenience and some level of technical support. However, assembling

your own set of reagents can reduce the consumables cost by 50%, and is suitable for

larger projects and more experienced users. Protocols are readily available on the

Web and in the literature see: http://awcmee.massey.ac.nz/aflp/AFLP_Protocol.pdf).

87


DNA

Successful AFLP digests require _100–1000 ng high molecular weight DNA (i.e. not

obviously degraded) that is free of contaminants (e.g. inhibitory compounds and non-

target DNA) that could otherwise interfere with the digestion, ligation and

amplification steps. Commercial DNA extraction kits (e.g. Qiagen DNeasy) can give

better quality DNA than some other methods. Researchers should not use DNA

samples obtained from different extraction methods because the method can affect the

resulting AFLP profile. Use of degraded and/or smaller quantities of DNA (such as

that often obtained from herbarium material) can result in poor quality profiles with

low reproducibility. Whole genome amplification (WGA) techniques have the

potential to enable AFLP fingerprinting in situations where previously insufficient

quantities of tissue were available (e.g. herbarium material or small individuals).

Choice of restriction enzymes

The restriction enzymes EcoR I (a six base cutter) and Mse I (a four base cutter) are

used in most AFLP studies, yielding fragments in an appropriate size range for

amplification and electrophoresis. Alternatives to Mse I include Taq I (which can

produce better quality results) and Tru I (a cheaper isoschizomer of Mse I). Pst I, the

most common alternative to EcoR I, is

methylation-sensitive, and although it might be appropriate for differential gene

expression and some mapping applications, it can have undesirable effects for most

other applications of the technique (i.e. when differences in gene expression between

samples could affect the AFLP profiles).

Choice of selective primers – length, composition and screening

The number of selective nucleotides on the selective primers should be increased with

increasing genome size so that the number of fragments is high enough to maximize

resolution but low enough to minimize homoplasy. This ranges from Eco+2–Mse+3

primers for small genomes to Eco+4–Mse+4 for larger genomes. Previous AFLP

studies on related taxa or those with similar genome sizes provide the best guide for

appropriate length selective primers http://www.rbgkew.org.uk/cval/homepage.html).

The ‘quality’ of AFLP profiles varies widely between selective primer combinations

partly because of the base composition of the selective primers. Therefore it is

necessary to screen potential combinations on a small number of samples before

embarking on the full project. High-quality profiles have well-separated peaks, a high

signal-to-noise ratio, a lack of shoulder or stutter peaks, fragments distributed

88

http://www.rbgkew.org.uk/cval/homepage.html


throughout the available size range, and clear polymorphisms. In a screen of 32

primer combinations assessed (subjectively) using these criteria, we found 20% of

primer combinations produced profiles suitable for high-throughput genotyping. If a

fluorescent system is used, it will normally only be economical to screen different

unlabelled primers (e.g. Mse+3) and, therefore, the selective bases of the fluorescent

primers (e.g. Eco+3) will need to be decided a priori (usually based on a literature

survey of successful fluorescent primers). The number of primer combinations

required depends on the application and biological question. It should be determined

by measuring the proportional increase in resolving power and decrease in error with

the accumulation of data from each additional primer combination.

Fluorophores

Fluorescent labelling has dramatically increased the output of AFLP fingerprinting

by enabling poolplexing of differently labelled products (up to four, plus a size

standard for Applied Biosystems’ Genetic Analysers). Choice of fluorophores is

largely determined by the available electrophoresis system (gel or capillary) and

software because potentially significant problems can occur with nonrecommended

dyes, including weak fluorescence and interference between emission spectra

(spectral ‘bleed-through’) and absorption spectra of poolplexed fluorophores. Even

with recommended set-ups there will be differential amplitude of emission between

fluorophores, which can be compensated for by empirically determining the optimum

pooling ratio.

Duplication, randomization and reproducibility

Although AFLPs are highly reproducible, replicate or duplicate AFLP profiles –

preferably from separate DNA extractions of a single individual – should be generated

for at least 5–10% of all samples. These should represent all treatments (e.g. DNA

extraction method, position on plate or gel and time stored in refrigerator). This is

crucially important for AFLP because replicates are the only objective measure of

quality (unlike DNA sequencing, where correct nucleotides can be determined with a

high degree of confidence). The same subset of samples should be included as

positive controls in every electrophoresis ‘run’ to ensure between-run reproducibility,

and to act as anchor points to detect errors in sample order (e.g. mistakes in plate

orientation). To enable any positional biases to be identified, sample order should be

randomized (e.g. order should not reflect evolutionary relationships or DNA

extraction method). Samples should be anonymously labelled to prevent any

89


investigator-associated scoring biases. To ensure reproducibility, it is essential to

standardize the method and maintain consistency for the duration of the study. In

addition to the factors already mentioned, factors such as fluorescent dyes, size

standard, laboratory equipment and capillary instrument can affect reproducibility and

comparability of AFLP profiles. For example, it is advisable not to change

fluorophores mid-project, because different fluorophores have different emission

properties, which might make the resulting data incomparable.

Error rates in AFLP data

Quantifying genotyping error rates is an essential component of an AFLP study.

Because it is usually not possible to know the ‘true’ genotype of an individual, error

rates cannot be assessed directly but instead must be estimated using replicates. Using

replicates, the error rate per locus has been estimated at between 2–5% for AFLP, but

unfortunately this is not explicitly calculated in most empirical studies. There are

multiple causes of genotyping errors in AFLPs, including the technical aspects of

generating the profiles (e.g. PCR stutter, non-specific amplification), subjectivity or

human error in (mis)reading the profiles, and differences in peak mobility and

intensity in the fingerprint profiles. Although these errors might not bias the results of

the analysis, they cause a reduction in the signal-to-noise ratio and hence a loss of

resolving power. Several strategies have been proposed to reduce errors in AFLPs,

and some software has been developed for finding and removing errors from AFLP

data.

Recommended Literature

Vos P, Hogers R, Bleeker m, Reijans M, van de Lee T, Hornes M, Frijters A, Pot j, Peleman J, Kuiper M (1995) AFLP: new technique for DNA fingerprinting. Nucleic Acids Res 23(21):4407-4414.

Meudt HM, Clarke AC (2007) Almost forgotten or latest practice? AFLP applications, analyses and advances. Trend Plant Sci 12(3):106-117.

90


DNA Extraction from Plant tissues

1- CTAB DNA Extraction Protocol

• Required reagents:

1- Extraction Buffer (pH 8) 100ml:

1- Tris- Base (100 mM= 1.576gm).

2- Nacl (1.4 M= 8.18gm).

3- EDTA (20 mM= 0.744gm).

4- 2% CTAB (2 gm/100 ml).

2- 1X TE Buffer (pH=8.0):

• Tris- Base (0.01 M, pH=8.0).

• EDTA (0.001 M, pH=8.0).

3- TBE Buffer 5X (pH 8) 500 mL:

• 27 g of Tris base

• 13.7.5 g of boric acid

• 10 ml of 0.5 M EDTA (1.861gm, pH 8.0) and pH should be

adjusted in this solution separately.

TBE can be diluted to 0.5X prior to use in electrophoresis, 1x is acceptable as well.

1- RNAase (10 mg/ ml).

2- Proteinase-K (1mg/ ml).

3- Sodium acetate (3 M, 20.412 gm of Sodium Acetate in 50ml dH2O).

4- Ethidium Bromide (10 mg/ml dH2O, stored in a dark bottle).

5- Chlorophorm : isoamyle alcohol (24:1).

6- Loading Dye (stored at 4o C):

• 3ml glycerol (30%)

• 25mg bromophenol blue (0.25%)

• dH2O 10mL

Species-specific primers and RAPD-PCR analysis for Saccharomyces cerevecia

1.DNA extraction

Total genomic DNA was isolated using CTAB protocol for plants (Murray and

Thompson, 1980; Saghai-Maroof, et. al., 1984; and Kumar, et. al., 2003) with some

modifications.

91


1) Freshly prepared cultures were grown onto solidified yeast-peptone-

dextrose medium. Collected yeast cells were ruptured by using smashed slide

covers in the presence of liquid nitrogen while using a mortar and a pestle.

2) Ground powder was transferred to 2 ml Eppendorf tube. Then, 1 ml of

60ºC extraction buffer (100mM Tris-HCl, 1.4M NaCl, 20 mM EDTA, 2%

hexadecyl trimethyl ammonium bromide (CTAB), adjusted to pH 8.0 with 50

µl β-mercaptoethanol were added to the samples, mixed by gentle inversion

and incubated in 60ºC water-bath (with occasional gentle mixing) for 30

minutes.

3) Samples were then removed from the water-bath and cooled to room

temperature for 4-6 minutes. An equal volume of chloroform: isoamylalcohol

(24:1) (v/v) was added to the cooled mixture then samples were mixed by

gentle inversion to form an emulsion.

4) Samples were centrifuged at 5000 rpm for 20 minutes at 10ºC. The

supernatant was transferred to a new 1.5 ml Eppendorf tube. An equal

volume of cold (-20ºC) isopropanol was added to supernatant.

5) Samples were then placed in a freezer (-20ºC) for 1hour or left

overnight at 4ºC to accentuate precipitation. Then, samples were centrifuged

at 10000 rpm for 5 minutes at 4ºC.

6) Supernatant was poured and pellets were washed with cold 70%

ethanol (v/v) and centrifuged at 10000 rpm for 2 minutes at 4ºC. The latter

step was repeated twice, and then pellets were dried (under vacuum) at 37ºC

incubator (under vacuum) or left overnight at room temperature.

7) Pellets were dissolved in 300-500µl TE buffer (250mM Tris-HCl,

0.5mM EDTA, (pH 8.4)). Dissolved pellets were then treated with 3µl RNase

A (10 mg/ml) and incubated at 37ºC for 30 minutes (with occasional gentle

mixing).

8) Samples were then treated with 3µl proteinase-K (1mg/ml) and

incubated at 37ºC for 30 minutes (with occasional gentle mixing).

92


9) An amount of 300 µl chlorophorm: isoamyl alcohol 24:1 (v/v) was

added to a 1.5 ml Eppendorf tube, mixed gently then centrifuged at 1000 rpm

for 5minutes at 20ºC.

10) Then the supernatant was transferred to a new Eppendorf tube where

two volumes of cold ethanol were added to it and 1/10 volume of sodium

acetate (3M) was added to the previous mixture, mixed and left for one hour

in a freezer (-20ºC).

11) Samples were then centrifuged at 10,000 rpm for 10 minutes at 4ºC,

drained and washed with 70% ethanol (v/v) as previously mentioned.

12) Ethanol was then removed and pellets were left to dry (under vacuum)

or overnight then dissolved in 50-µl TE buffer. DNA dilutions were made to

detect the optimum concentration for RAPD-PCR analysis.

2. PCR assays

2.1. Species - specific primers used in PCR assay

The 5' specific primer (SC1) was designed from the ITS-1 region (between

positions 161 and 181 from the 3'-SSU end, forward).

Its sequence was: 5'-AACGGTGAGAGATTTCTGTGC-3'. The 3' specific

primer (SC2) was located in the LSU gene (between positions 562 and 582 from the 5'

end of this gene, backward) and its sequence was: 5'-

AGCTGGCAGTATTCCCACAG-3' (Josepa, et al., 2000).

2.2. RAPD analysis

RAPD assays were based on the polymerase chain reaction (PCR) amplification

of random sites spread allover the genomic DNA. DNA amplification protocol was

performed as described by (Williams, et al., 1990) with some modifications.

2.3. Preparation of PCR reactions

To perform several parallel reactions, a master mix containing water, buffer,

dNTPs, primers, and Taq DNA Polymerase was prepared in a single tube. MgCl2 and

93


template DNA solutions were then added. The master mix was prepared in a 1.5 ml

Eppendorf tube, according to the number of PCR reactions to be performed, with an

extra reaction included for compensating the loss of solution due to frequent pipetting.

An aliquot of 24 µl master mix solution was dispensed in each PCR tube (0.5 ml),

containing 1-2µl of the appropriate template DNA dilution, so that each reaction

contained:

Components of PCR reactions

Component Amount of one PCR reactiondH2O 11.0 µl10X reaction buffer 3.0 µl

dNTP's mix 3.0 µlPrimer 2.0 µlTaq polymerase 1.0 µlMgCl2 4.0 µlTemplate DNA 1.0 µlTotal volume 25.0 µl

2.4. PCR program and temperature profile

For DNA amplification, a TECHNE thermocycler (Model FTGEN5D,

TECHNE, Cambridge Ltd, Oxford, and Cambridge, U.K.) was used. The

thermocycler program for specific primers was characterized by:

1) Initial denaturation for 5 minutes at 94ºC (1st step),

2) 10 cycles of 94ºC for 1 minute 20 seconds, 55ºC for 40 seconds, and 72ºC for 1

minute 10 seconds (2nd step);

3) 30 cycles of 1 minute 20 seconds at 94ºC, 40 seconds at 50ºC and 1 minute 10

seconds at 72ºC (3rd step),

4) 10 minutes at 72ºC (4th step), then followed by a final hold at 4ºC.

And a different program was adopted for RAPD PCR and was characterized by:

1. initial denaturation for 3 minutes at 90ºC (1rst step),

94


2. 40 cycles of 1 minute at 90ºC, 2 minutes at 33ºC and 2 minutes at 72ºC

(2nd step),

3. 10 minutes at 72ºC (3rd step), then followed by a final hold at 4ºC.

Extraction of DNA from whole blood

Nucleated cells are separated from whole blood by lysing the red cells, followed by centrifugation to pellet the nuclei. Following white cell lysis contaminating proteins are removed by precipitation with a high concentration of ammonium acetate. DNA is then precipitated with isopropanol followed by washing the DNA with ethanol. The DNA is then dissolved in TE buffer and used for analysis.

Solutions and Chemicals

Red Blood cell Lysis Solution

155 mM Ammonium Chloride 8.3 g per liter10 mMpotassium bicarbonate 1 g per liter1 mM EDTA 0.4 g liter or 2 mls 0.5 M EDTA

White cell lysis Solution

25 mM EDTA 9.3 g per liter or 50 mls 0.5 M EDTA2 % SDS 20 g per liter or 200 mls 10 % SDS

Protein precipitation solution 10 mM Ammonium Acetate 385.4 g per 500 ml

Procedures:1. Transfer 300 µl of the whole blood into a clean 1.5 ml tube.2. Add 900 µl of RBCs lysis solution.3. Incubate at room temperature for 10 minutes with occasional inversion.4. Centrifuge at 12000 rpm for 30-60 seconds to collect the WBCs.5. Pour off the supernatant but leave behind about 20 µl residual liquid.6. Add 300 µl white blood cells lysis solution to resuspend pellet-pipette up/down to lyse cells.7. Invert several times, then add 100 µl of protein precipitation solution.8. Whirly mix for 20 seconds.9. Centrifuge at 6000 rpm for 3 minutes.10. Pour supernatant into a clean tube, and then add equal volume of isopropanol to precipitate the DNA.11. Collect the DNA by centrifugation at 6000 rpm for 5 minutes.12. Gently pour off the supernatant, blot onto a paper towel.13. Wash once with 70 % ethanol.14. Decant the ethanol and leave the pellet to dry at room temperature for 10minutes.15. Resuspend the DNA pellet in 100 µl of TE buffer.

95


16. Analyze the DNA by running a small aliquots onto 1 % Agarose gel.

Conversions

Micrograms (µg) = 10−6 grams

Micro liters (µl) = 10−6 liters

Milligrams (mg) = 10−3 grams (g)

Milligrams per liter (mg/liter) = 1 part per million (ppm)

Milliliters (ml) = 10−3 liters

Nanogram (ng) = 10-9 grams

Picomole (pM) = 10-12 Mole

Picogram = 10-12 gram

DNA Isolation protocols

DNA عزل الـ طرق

في الكائنات وذلك حسب نوع الكائن كما يلي:DNAتختلف صور وأماكن تواجد الـ

ل: الكائنات غير مميزة النواة : Prokaryotes أو

في الكائنات غير مميزة النواة (مثل البكتريا) عادة في سيتوبلزم الخلية في صورةDNAيوجد الـ

DNA حلقي Circular DNAالشكل حيث تتميز تلك الكائنات بعدم وجود غشاء نووي يحيط بالنواة ويحددها

Bacterial البكتيري DNA الخاص بالبكتريا بالكروموسوم البكتيري أو الـ DNAويسمي جزئ الـ

DNA.

صغيرة حلقية مستقلةDNA(ومن المعروف أن الكائنات غير مميزة النواة مثل البكتريا تتميز بوجود جزيئات

).Plasmids البكتيري تسمى بالبلزميدات DNAعن الـ

ا: الكائنات مميزة النواة : Eukaryotes ثاني

في عضيات خاصة أهمها:DNAتمتاز الكائنات مميزة النواة بوجود الـ

: Nucleus النواة -1

الخلوي الذي يعتبر المادة الوراثية الرئيسية في الخلية ويسمى بالـDNAوهي تحتوي على معظم الـ

Genomic DNA or Nuclear DNA (nDNAوهو يوجد مغلف بأغلفة بروتينية في صورة .(

عن طريق البDNA يختلف عددها على حسب النوع، وينتقل هذا الـ Chromosomesكروموسومات

ا. والم مع

: Mitochondoria الميتوكوندريا -2

وعادة ما يحتوي على جينات خاصة بأنزيمات الطاقة.DNAوهي تحتوي على كمية صغيرة من الـ

) وهو يتوارث عن طريق الم فقط.Mitochondorial DNA (mtDNAويسمى بالـ

: Plastids البلستيدات -3

96


عادة ما يحتوي على الجينات الخاصة بأنزيمات البناءDNAوتحتوي على كمية صغيرة من الـ

) ويتوارث عن طريق الم فقط.Chloroplast DNA (cpDNAالضوئي ويسمى بالـ

): DNA أهمية إستخلص المادة الوراثية (

في صورة نقية لستخدامه في التطبيقات المختلفة مثل:DNAالحصول على الـ

PCRالــ •

•DNA sequencing

•Fingerprinting

•Genomic map

•Transformation

في الخلية.DAN عل حسب نوع الكائن وكذلك حسب موقع الـ DNAتختلف طرق عزل الـ كما

: تتضمن عدة خطوات هي DNA الخطوات العامة لعزل الـ

الحصول على مكونات الخلية:-1

ا، وتتم تلك حيث يتم تكسير جميع الغشية الخلوية والحصول علي جميع مكونات الخلية مختلطةمع

العملية إما بالطحن أو باستخدام المعاملة النزيمية. وتتم عملية الطحن وتكسير الخليا في محلول منظم لبد أن

أو مادة الـEDTA) مثال الـ DNA (الذي يقوم بتكسير خيوط الـ DNAaseيحتوي على مثبطات لنزيم الـ

SDS والتي تثبط نشاط إنزيم الـ DNAase.

والتخلص من البروتين:DNA فصل الـ -2

.RNA مثل البروتينات والـ DNAيتم في هذه العملية استبعاد المواد المرتبطة بالـ

)):DNA DNA precipitation ترسيب الـ -3

من المحول المائي الذي توجد به.DNAفي هذه العملية يتم الحصول على خيوط الـ

:DNA إذابة الـ -4

يتم إذابته لعمل محلول منه ليستخدم في الغراض المختلفة بعد ذلك.DNAبعد ترسيب الـ

بعد العزل.DNA الكشف عن وجود الـ -5

المعزل.DNA قياس تركيز الـ -6

***

:خطوات العمل

من أنسجة نباتية و إنسانية:DNAخطوات عزل الــ

يوضع النسيج في نيتروجين سائل بكمية تمل هون كبير الحجم ثم تتبخر ثم تضاف كمية أخرى بنفس-1

.powderالحجم ويستمر الطحن لتلك النسجة بإستمرار حتى تصير تراب

قدر ملئ نصف أنبوبة إبندورف سعة واحد ونصف ملليليتر.powderيوضع من هذا التراب الــ -2

97


3-

ويضافExtraction Buffer ميكروليتر من منظم الستخلص الـ 1000توضع في أنبوبة البندورف

الذي يعمل على فكβ-Mercaptoethanolإلى منظم الستخلص من خمسين إلى مائة ميكروليتر من

مما يتيح الفرصة لفرد البروتينات وأحيانا فك مجموعة منdisulfide bondsالروابط ثنائية السلفايد

مترابطة بواسطة الروابط ثنائية السلفايد. ويفضل بالضافة إلى ذلك إضافة خمسينالعديدات البيبتيد

) أيضاβ-Mercaptoethanol (إن توفر فهخو يؤدي غرض الــdithiothreitol DTTميكروليتر من الـ

ساعة. ويراعى تقليب النابيب2/1 إلى 1 لمدةoC 90-85 ثم توضع أنبوبة البندورف في حمام مائي على

مرارا طوال فترة الحمام المائي.

4-

بعد استخراج النابيب تترك لبضع دقائق حتى تصل لدرجة حرارة الغرفة.

يضاف إلي أنبوبة إبندورف جديدة ذات سعة إثنين ملليليتر، -5 ميكروليتر من الـ (1000و

Chlorophorm:Isoamyle (24:1تكمل حتى آخرها بما كان في النبوبة ذات (حجم إلى حجم) ثم و

السعة واحد ونصف ملليليتر ثم ترج جيدا بخفة ولطف وهذا يعمل على ترسيب الجزاء الخلوية وفصلها عن

. DNAالـ

دقيقة ويضبط الجهاز على عشر20 (خمسة ألف لفة في الدقيقة) لمدة rpm 5,000يعمل طرد مركزي -6

درجات مئوية فتظهر بعد إنتهاء الطرد المركزي ثلث طبقات: طبقة سفلى وأخرى وسطى (وهي البقايا

) والخيرة عليا رائقة.cellular debrisالخلوية غير المرغوب فيها

خمسمائة أو سبعمائة وخمسين ميكروليتر من الرائق بحذر شديدsupernatentيؤخذ من الطبقة العليا -7

يوضع محلول الطبقة العليا في أنبوبة ايبندورف جديدة . ويمكن بعد هذه الخطوة في بعض الحالتml 1.5و

القفز إلى الخطوة الثامنة عشر.

يضاف الى أنبوبة البندورف السالفة نفس حجم الطبقة العليا (خمسمائة أو سبعمائة وخمسين ميكروليتر)-8

) ثم ترج النابيب بهدوء وتوضع النابيب في الفريزرDNA (لترسيب الـ Cold Isopropanolمن الـ

-)20oC 4) لمدة ساعة أو على درجة حرارةoC.أي في الثلجة طوال الليل

.4oC دقائق على 5 لمدة rpm 10,000يعمل طرد مركزي -9

لو الراسب -10 يع يترك الراسب pelletيزال الرائق (أي ما في قاع النبوبة ثم يتم غسل الراسبPellet) و

) لكل أنبوبة والرج بهدوء حتى يتحرر الراسب من قاع النبوبة ثمEthanol 70% (1mlبكحول إيثيلي

لمدة دقيقتين.rpm 10,000يعمل طرد مركزي

توضع تحت تفريغ -11 يترك الـراسب في قاع النبوبة لتجف على (أو لتجف).Vaccumيزال الرائق و

.37oC ساعة على 1/2) وتترك لمدة TE Buffer (500 µl في Pelletيتم إذابة الـراسب -12

(يراعي التقليب37oCساعة على درجة 1/4 وتترك على لمدة RNAase من إنزيم الـ µl 4يضاف -13

برفق بين الحين والخر).

يضاف -14 ساعة على1/4 وتترك لمدة RNAase لهضم إنزيم الـ Proteinase-K من الـ µl 4ثم

(يراعي التقليب برفق بين الحين والخر).37oCدرجة

) ثم يتم الرج برفق.Chlorophorm:Isoamyl (24:1 من الـ µl 500يضاف -15

98


(للتخلص منoC 20 دقائق على حرارة 5 (ألف لفة في الدقيقة) لمدة rpm 1,000يعمل طرد مركزي -16

وباقي البروتينات) فتتكون ثلث طبقات.RNAase والـ Proteinase-Kالـ

يؤخذ الرائق (الطبقة العليا) بحذر شديد ويراعى عدم سحب الهالة الوسطية (بقايا الخليا ويراعي التأكد-17

ا). من ذلك جيد

يضاف إلى الرائق ضعف حجمه (أي حجم الرائق) كحول إيثيلى مطلق بارد (موضوع في الفريزر) ثم-18

) (أي في مثالنا هذا يؤخذ خمسين3M) Sodium acetate حجم الرائق خلت الصوديم 10/1يضاف

DNA دقيقة إلى ساعة فيظهر الــ 45) لمدة oC 20ميكروليتر من خلت الصوديوم) وتوضع في الفريزر (-

لقلة كميتة وفي هذه الحالة إن كانت العينة ل تعوض يمكنDNAفي صورة هالة قطنية وقد ل يظهر الـ

لخمسة ميكروليتر معgel electrophoresisالستمرار للخر ثم تقدر كميتة إما وصفيا بالتفريد الكهربي

.UV Spectrophotometer أو بإستخدام جهاز loading bufferمنظم التحميل

فيظهر4oC دقائق على درجة حرارة 10 (عشرة آلف لفة) لمدة rpm 10,000يعمل طرد مركزي -19

.pellet في صورة راسب DNAالــ

يترك الـراسب -20 ) مع مراعاة أن500µl-1000% (70 في القاع لتغسل بـإيثانول Pelletيزال الرائق و

يعمل طرد مركزي (عشرة ألف لفة) لمدة دقيقتين ومنrpm 10,000يزحزح الراسب من مكانة ثم

الفضل تكرار خطوة الغسيل هذه مرتين.

يراعى التأكد من تمام التجفيف).Pelletبعد استبعاد الكحول تجفف الـ -21 ا ( جيد

معpellet حسب حجم الـراسب TE Buffer من الـ µl 50 إلى 20µlيضاف إلى الراسب من -22

.Pellet لضمان تمام ذوبان الـراسب 37oCالتحضين على

يحفظ هذا الـ -23 في فريزر الثلجة لحين الستخدام.TE Buffer المذاب في الـ DNAثم

***

بعد العزل: DNA الكشف عن وجود الـ

Gel في العينات المعزلة باستخدام طريقة التفريد الكهربي على الجيل DNAيتم الكشف عن تواجد الـ

electrophoresis ا لن الـ عند القطب السالب فإنه يحدثDNA شحنته سالبه فإنه عند وضع الـ DNA. نظر

ا عن القطب السالب، من خلل ذلك يمكن عن طريق تفريد الـ علىDNAله هجرة ناحية القطب الموجب مبتعد

فيها ثم السماح للتيار الكهربيDNA القطب السالب ووضع عينات الـ د عنwellطبقة من الجيل بعمل حفر

ا عن القطب السالب من خلل مروره خلل بالمرور من القطب السالب إلى القطب الموجب يحدث هجرة له مبتعد

Ethidium بعد عملية التفريد من خلل إضافة الـ DNAالثقوب الموجودة في الجيل، ويمكن رؤية الـ

bromide للجيل قبل تصلبه وهي مادة تتداخل بين خيوط الـ DNA حيث تظهر حزم الـ DNAعلى أبعاد

مختلفة على حسب الوزن الجزيئي على لوح الجيل بلون برتقالي وذلك عند تعريض الجيل للشعة الفوق بنفسجية

U.V.((.

99


)TBE buffer (0.5 X من الـ ml 100 جرام أجاروز لكل 0.7- 2%) بإضافة 2-0.7يحضر الجيل بتركيز (

hotعلى أو microwaveفي مايكروويف ثم إذابة الجاروز plate 0.5 ثم يضاف µl مـن الـــ Ethidium

Bromide عند وصول درجة حرارته oC 50.

لسفل البئرDNA وتتم من خلل صبغ وجذب الـ well loading في البار DNAوتسمى عملية وضع الـ

يرسب في قاع البئر كما إن هذهDNA (التي تعمل على جعل الـ Loading Dyeبإستخدام صبغة التحميل

فتبين نهاية عملية التفريدDNA ولكن بسرعة أكبر من أصغر شظية من الـ DNAالصبغة تهاجر مع الـ

الكهربي ).

100


Gel reading and troubleshooting

قراءة وتحليل الجل

مقدمة:

ا. تعتبر طرق التفرقة بين تراكيب وراثية مختلفة على اساس جزيئي من أهم الطرق المستخدمة حالي

حيث انها توفر وسيلة سهلة وسريعة للتنبؤ بوجود اختلفات بين هذه التراكيب فى وقت قصير وفى أي مرحلة

عمرية. ومن ضمن هذه الطرق المستخدمة:

Total Protein: وهى تشمل التحليل الكلى للمحتوى البروتينى طرق تحليل البروتين-1

analysis و تحليل مشابهات النزيمات Isozymes analysis.

SSR و الـ RFLP و الـ RAPD: وهى تشمل تحليل الـ طرق تحليل الحمض النووى-2

وغيرها من التحليلت.

ونتائج جميع هذه الطرق تنتهى بالحصول على جل أو صورة لهذا الجل سواء كان بولى أكريلميد

Ployachrylamid gel أو أجاروز Agarose Gel ا على نمط حزمى معين خاصBand pattern محتوي

بكل عينة مدروسة. والشكل التالى يوضح ذلك.

101


RAPD GelProtein Gelوالن، كيف يمكننا قراءة هذا الجل وكيفية تحليل الحزم الموجودة به؟

Gel Readingقراءة الجل

فى البداية يجب أن نحصل على صورة لهذا الجل على جهاز الكمبيوتر، سواء بالتصوير اللكترونى-

Digital أو تسجيل الصورة بالماسح اللكترونى Scanner.

. وهذه النوعية تعمل عليها معظم برامج التحليل.TIFFالصورة الى إتحويل إمتداد -

استخدام أحد برامج التحليل.-

Band detectionهناك العديد من برامج الكمبيوتر التى تقوم بتحليل صور الجل وعمل تعيين لمناطق الحزم

فى العينات المختلفة. وتعتمد هذه البرامج على درجةBand Matchingوكذلك عمل مطابقة لمواضع الحزم

ا ما تفشل هذه البرامج فى التحديد الكلى وضوح وإضاءة الحزمة الموجودة بالصورة وجودة الصورة، ولكن غالي

ا نوع البرنامج والفعلى للحزم الموجودة على الصورة و يتوقف ذلك على جودة الصورة والحزم التى بها وأيض

المستخدم، مما يتطلب تدخل المستخدم فى إعادة تعين وتحديد للحزم على الصورة بشكل يدوي. فكيف يمكنا ذلك؟

يمكن ذلك بعد الخذ فى العتبار هذه النقاط:

يجب تجاهل الحزم الى تقع خارج المجال وتكون باهتة ويقصد بخارج المجال هنا الحزم التى-

توجد فى أعلى أو أسفل الصورة فى واحدة أو أكثر من العينات ويفصلها مسافة كبيرة بين مجال الحزم

ا ما تكون هذه الحزم قليلة العدد وباهتة ول يقابلها حزم كثيرة فى باقى العينات. الساسية الكثيرة، وغالب

يجب أن نقوم بتحديد الحزم الباهتة التى لم يحددها البرانامج والموجودة داخل المجال ويقابلها-

حزم من باقى العينات.

من بداية نقطتى الحزمة من أعلى.Smiley shapeيجب تحديد الحزم ذات الشكل المبتسم -

يجب أن تحدد الحزمة فى منتصفها.-

يجب محاكاة الميول الموجود فى بعض حارات الجل إن وجد.-

فى قراءة الجلGene profiler برنامج شرح مبسط لستخدام

يعتبر هذا البرنامج من البرامج السهلة فى التعامل لتحليل الجل. والن سنأخذ مثال على تحليل صورة

على نسخة تجريبية من البرنامج يمكنك الحصول عليها من الموقع اللكترونى:RAPDلجل خاص بتحليل

www.scanalytics.com.

102


:الخطوات

نقوم بفتح البرنامج بعد تثبيته على الجهاز.-1

مع العلم بأن البرنامج يعملOK ثم Enterستظهر لنا النافذة التالية، ونقوم بالضغط على -2

دقيقة فقط حيث أنه نسخة غير كاملة.45لمدة

كما سبق أن وضحنا.tifسيطلب منك فتح الصورة بإمتداد -3

بعد إختيار الصورة سيطلب منك حفظ المشروع (يمكنك تجاهله).-4

Mark نختار المر Analyzeنبدأ أول خطوة فى التعامل مع الصورة وهى من قائمة -5

lanes locationل منها عينة. بعد إختيار هذا المر وهو يمكننا من تحديد أماكن الحارات الى تمثل ك

ا ما يوجد بها الـ معLadderنقوم بالضغط على الصورة باستخدام الماوس فى قمة أول حارة وغالب

الستمرار فى الضغط حتى نصل لنهاية الحارة، ونكرر ذلك مع آخر حارة. كما فى الشكل التالى.

103


لتظهر لناDefine lanes المر Analyzeبعد النتهاء من تحديد الحارات نختار من قائمة -6

كما فى الشكل التالى.Ladderنافذة نقوم بكتابة عدد الحارات الموجودة بالصورة بما فيها حارة الـ

ستظهر نافذة أخرى نقوم بكتابة اسماء العينات فى كل حارة خاصة بها مع تحديد حارة الـ-7

Ladder كـ Standard.كما فى الشكل التالى

104


ا. وفى-8 ستظهر لك الن صورة الجل وعليها تحديدات الحزم التى قام البرنامج بعملها تلقائي

الغالب يكون بها أخطاء. كما نرى فى الشكل التالى.

Editولعلج هذه الخطاء نقوم بالضغط بالزر اليمن للماوس على الصورة ونختار -9

detected bands ثم نضغط مرة أخرى ونختار delete band لزالة الحزم أو Add bandلضافة

لتحريك حزمة معينة الى مكانها الصحيح. كما هو واضح من الشكل التالى.Move bandحزمة أو

105


Done ويراعى وضع العلمة فى منتصف الحزمة. وبعد النتهاء من التحرير نضغط على -10

editing bands.

ستظهر لنا نافذة يمكن من خللها إضافةCalibrate MW/PI نختار Analyzeمن قائمة -11

.. كما فى هذا الشكل.Add Stds المستخدم بالضغط على Ladderالوزان الجزيئية الخاصة بالـ

.Calibrate. ثم Apply Stds نضغط على MWوبعد إضافة الـ -12

لجعل البرنامج يقوم بمطابقة الحزم المشتركة.Match Bands نختار Analyzeمن قائمة -13

والتي تحدد مقدار دقة تطابق الحزم عن بعضها وكلماMatch toleranceوالبرنامج يضع قيمة للـ

أخذ عدد كبير من المستويات كمستوى واحد من الحزم ويفضل استخدام القيمة التى زادت القمية كلما

يحددها البرنامج أو أقل منها على حسب التطابق، وبعده سيتم وضع دائرة صغيرة على الحزم التى

يعتبرها البرنامج متطابقة أى فى نفس الموضع ويمكن التنقل بين مستويات الحزم المتطابقة باستخدام

أسهم لوحة المفاتيح. كما فى الشكل التالى.

106


لمعرفة الوزان الجزيئية للحزم المتطابقة.Match Statistics نختار Analyzeمن قائمة -14

ويوضح البرنامج أماكن وجود الحزم مع إعطاء مدى للوزن الجزيئى للحزم التى ليست على نفس

المحازاة، مع إعطاء متوسط لقيمة الوزن الجزيئى لهذه الحزم وهى القيمة التى يجب استخدامها فى

التحليلت التالية. كما فى الشكل التالى.

ولن هذه نسخة تجريبية من البرنامج، ل يمكن لنا أن نقوم بحفظ هذه القيم، لذا يجب علينا-15

كتابتها فى جدول يبين رقم الحزمة والوزن الجزيئي الخاص بها وأماكن تواجدها فى الحارات بإضافة

للتواجد و صفر لعدم التواجد. كما يمكننا أن نظهر تقرير مفصل عن صورة الجل وذلك من قائمة1

File فنختار Reports.ومنها نحدد الختيارات المطلوبة لعرضها كما فى هذا الشكل

107


ويمكننا إظهار منحنى الحزم الخاص بكل حارة بالضغط المزدوج على الحارة ليظهر الشكل-16

التالى.

ولكن ل يمكن حفظ هذه الصور لنها نسخة تجريبية.

وبهذا نكون أنهينا العمل على هذا البرنامج وحصلنا على جدول يحتوى على توقيع الحزم الخاصة

بالجل.

108


Cluster analysisالتحليل الحصائى والتحليل العنقودى

أصبح الن معنا جدول توقيع الحزم لصورة الجل السابق، حيث أن الواحد يدل على وجود الحزمة والصفر يدل

على غياب الحزمة. والجدول التالى يوضح ذلك.

Band No. Guava-1 Guava-2 Guava-3 Guava-4 Guava-51 1 1 1 1 12 1 1 0 1 13 1 1 0 1 14 1 1 1 1 15 1 1 1 1 16 1 0 0 0 17 1 1 1 1 1

وحساب درجة التشابهCluster Analysisيتم بعد ذلك استعمال هذه البيانات فى عمل التحليل العنقودى

Similarity Indexبين العينات وذلك عن طريق استخدام أحد البرامج المتخصصة فى عمل الـ

Dendrogram أو التحليل العنقودى ومن هذه البرامج برنامج الـ Multi Variants Statistical Package

(MVSP:ويمكنك الحصول على نسخة تجريبية من البرنامج على الموقع (

http://www.kovcomp.co.uk/mvsp

:خطوات التحليل

بعد تثبيت البرنامج على جهاز الكمبيوتر وفتحه. سيظهر لك الشكل التالى.-1

والعمدةCases ستظهر لك نافذة يتم تحديد عدد الصفوف New نختار Fileمن قائمة -2

Variables.كما فى الشكل التالى

109


سيظهر لنا جدول البيانات الذى سنقوم بتغذيته بالبياناتEdit data نختار Dataمن قائمة -3

الموجودة فى جدول توقيع الحزم مع كتابة أسماء العينات.

ستظهر لنا نافذة الختيارت، ومنها يتمCluster Analysis نختار Analysesمن قائمة -4

ومنها نختار طريقة التحليلSimilarity coefficientتحديد طريقة التحليل وكذلك معامل التشابه

UPGMA ا لـ يمكننا أن نحدد نتائجAdvanced. وبإختيار Nei & li's Coefficient والمعامل طبق

وذلك يتضح من الشكل التالى.Similarity Matrixالتحليل المراد إظهارها ويجب إختيار

كما هوDendrogram سيظهر لنا التحليل ممثل فى الشكل العنقودى Okبالضغط على -5

موضح بالشكل التالى.

110


فى جدول كالتالى.Similarity Indexوكذلك نتيجة درجة التشابه

وبذلك نكون قد انتهينا من قراءة وتحليل الجل.

111


112

Documents

Principles of Molecular Biology - Assiut University€¦ · Principles of Molecular Biology Chromosomes The 3 billion bp in the human genome are organized into 23 distinct, physically