GENETIC STRUCTUREOF HUCHEN (Hucho hucho)ASSESSED USING mtDNA

(CONTROL REGION AND NADH1 GENES) AND TWO MICROSATELLITE LOCI

AND FISHERIES MANAGEMENT WITH HUCHEN STOCK IN SERBIA

Predrag SIMONOVIĆ, Ana TOŠIĆ, Dubravka Škraba & Vera NIKOLIĆ

Huchen are endemic for the River Danube basin (Holčik, 1990).• Live in rivers and large streams• Can live in lakes and large reservoirs• At altitude 200 – 600 m, and out of it if life conditions are suitable:

• cold water, usually up to 15oC• sufficient amount of dissolved oxygen (8 – 9 mg l-1).

However, in contrast to other salmonid fish, huchen tolerate the water temperature up to 22oC and the amount of dissolved oxygen down to 5 mg l-1 (Holčik et al., 1988).

GENERAL FEATURES OF HUCHEN-DANUBE SALMON

Recently, huchen endures in about 33% of its former dispersal areaFormerly continuous area inhabited by the huchen is now disrupted into isolated submountain zones of rivers, mainly due to:• increased streams’ embankment construction,• damming of rivers,• industrial and agricultural pollution,• heating due to deforestation,• eutrophication• poaching

Translocations of huchen among river drainages undoubtedly threaten aboriginality of huchen populations.

THREATENING FACTORS

Therefore, since 1990: on the IUCN Red List of Threatened species:•EN – Endangered B2ab(ii,iii),• in the Appendix III of the Bern Convention (Protected Fauna) and • Annexes II and IV of the EU Habitat Directive (IUCN, 2008).

In contrast to their conservation status and due to their great attractiveness for angling and financial benefit contributing to the local rural communities, huchen is allowed for angling, following the:1. closed season for huchen fishing (1 March – 31 August)*,

2. daily fishing time limitation (daylight, from dawn to dusk)*

3. minimal landing size (100 cm SL) proscribed*

*Anonymous (2009). Order on measures for conservation and protection of fish stocks. Off. Gazzette of the Rep. Serbia, 104/09.

The minimal landing size was proscribed in 2003 (Anonymous, 2009) after the investigation of adult huchen growth characteristics (Simonović et al., 2000).

SL (cm)

Mas

s (k

g)

0

4

8

12

16

20

24

28

50 60 70 80 90 100 110 120 130 140

breakpoints16.541 kg & 110 cm

< 110 cm SLb = 3.23 ± 0.227

> 110 cm SLb = 1.68 ± 0.654

Meanwhile, an analysis accomplished on huchen from the Drina River in the last three years revealed lower values both for length and mass at wich adult huchen alter their growth (Simonović et al., 2011).

Simonović, P., Marić, S. & Nikolić, V. (2000). Growth characteristics of huchen Hucho hucho (L.) from Rivers Drina, Una and Sana. Acta Biologica Iugoslavica – Ekologija Belgrade 35: 123-126.Simonović, P.D., Nikolić, V.P., Tošić, A.D. & S.P. Marić (2011). Length-weight relationship in adult huchen Hucho hucho (L., 1758) from Drina River, Serbia. Biologia, Bratislava Section Zoology 66/1: 156-159, DOI: 10.2478/s11756-010-0135-2.

14 huchen samples from six locations in Serbia were collected by electrofishing and angling from 2002 until 2007 (Fig 1). Fin clips were taken and stored in 96% ethanol and two mtDNA genes, CR and NADH1, were amplified in 14 individuals using polymerase chain reactions (PCR).

Sequencing of two mtDNA genes (Control Region, 834 bp with addition of 8-10 repetitions of 82 bp each, and NADH-1, 811 bp) revealed the same haplotypes (CR_1 and ND_1) in all investigated specimens, i.e., the complete lack of genetic variability.

Sequence of control region (haplotype CR_1) of huchen from Serbia (unpublished)ACCCTCTGGCGCCAATGTACAATAATAAATGTTATATCTTACAAGTCAGTACGATATAACACTTATGTATTATATTACATATTATGTATTTACCCATATATAATATTGCACGTGAGTAGTACATTATATGTATTATCAACATAAGTGGTTTCAACCCCTCATACATCAGCACAAATCCAAGGTTTACATTAAGCAAAACACGGATAACCACCAACTAAGATGTTTTAACCTGATTAATTGCTACACCACAAACCTTCAGCTAACACGAGCTCCGTCTTTACCCACCAACTTTCAGCATCGGTCCTGCTTCATGTAGTAAGAACCGACCAACGATTTATCAGTAGGCATACTCTTATTGATGGTCAGGGGCAGAAATCGTATTAGGTAGCATCTCGTGAATTATTCCTGGCATTTGGTTCCTATATCAAGGGCTATCCTTAAGAAACCAGCCCCTGAAAGCCGAATGTAATGCATCTGGTTAATGGTGTCAATCTTATTGCCCGTTACCCACCAAGCCGGGCGTTCTCTTATATGCATAGGGTTCTCTTTTTTTTTTTTTCCTTTCAGCTTGCATATACAAGTGCAAGCAAAGAAGTCTAACAAGGTCGAACTAGATCTTGAATTCCAGAGAACTAATGTATCATTATAGAATGATATTTTATAAAGAACCACATACTTGGATATCAAGTGCATAAGGTCCAATTCCATCCTCACAGATATCTAATAGATCCCCGGCTTCTGCGCGACAAACCCCCCTACCCCCCTACGCTGAACGATCCTTGTGTTCCTGTCAAACCCCTAAACCAGGAAGTCTCAACAGCGCTAATTTTTGTT

Sequence of NADH-1 gen (haplotype ND_1) of huchen from Serbia (unpublished)ATGACTACCCTTATCACCCATGTTATTAACCCACTCGTATACATTGTGCCTGTTCTCCTAGCAGTTGCTTTCCTCACCCTCCTCGAACGAAAAGTTCTCGGGTACATGCAACTTCGAAAGGGACCTAATATTGTTGGTCCATATGGGTTACTTCAACCCATTGCAGACGGCCTTAAGCTATTTATTAAAGAGCCAGTTCGACCATCCACCTCTTCCCCCTTCCTATTTCTTGCCACACCAATACTTGCCTTAACACTTGCACTCACTTTATGAGCCCCCATACCAATCCCCTACCCCGTTACAGACCTAAACCTAGGGGTATTATTTGTCCTGGCACTCTCTAGCCTCGCTGTGTACTCTATTTTAGGTTCAGGATGAGCTTCAAATTCCAAATATGCCTTAATCGGAGCCCTACGAGCAGTAGCACAAACTATTTCCTATGAAGTCAGCCTAGGCCTAATCTTACTAAGCGTGATTATTTTTACAGGCGGATTCACACTCCAAACCTTCAACGTTGCTCAAGAAAGTATCTGACTACTTGTACCAGCCTGACCCCTTGCCGCCATATGATACATCTCAACCCTAGCTGAGACAAACCGTGCACCATTTGACCTCACAGAAGGAGAATCAGAATTAGTCTCCGGATTTAATGTAGAATATGCTGGGGGACCCTTCGCCCTTTTTTTCTTAGCCGAATACGCTAATATCCTTCTAATAAATACACTCTCAGCCATCCTATTCCTGGGCGCATCCCATATCCCAACTCTCCCTGAACTAACAGCCCTTAATCTCATAACAAAAGCTGCCCTAC

Explanation for the lack of variability:• Small investigated territory• Small number of drainage areas• Small number of samples• Small number of genes, their location and specificityResult of analysis of genetic structure in huchen using the mtDNA are preliminary.Since mtDNA:•is inherited almost exclusively from mother’s side• is selectivelly neutralit is not a good indicator of relationships between populations.An evolution of one gene can differ from an average evolution of whole genom (Zhang & Hewitt, 2003; Boero 2010). Therefore, the use of mtDNA as a genetic marker can be misleading.

Zhang D.-X., Hewitt G. M. 2003. Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology 12: 563-584Boero, F. (2010). The study of species in the era of biodiversity: A tale of stupidity. Diversity 2010 (2): 115-126, doi:10.3390/d2010115

The analysis that included two microsatelite markers on more numerous samples from larger territory gave more reliable insight into genetic differentiation of huchen, since three unique alleles (336, 356 &360) were found at the HLJZ003 locus in huchen at the territory of Serbia (Drina and Ibar Rivers).*

It revealed the large scale of huchen populations’ structuring (Western: Austria + Slovenia; Eastern: Serbia + E Bosnia + Montenegro; Slovakia + Ukraine), indicating that stocking between the adjacent drainages within the Danube River catchment must be stopped, if the aboriginality of huchen stocks is to be retained.

Even the mtDNA on that large geographic scale revealed two CR and four NADH-1 haplotypes, which additionally supports the strong recommendation for avoiding the stocking with huchen out of the native drainage area.

• Weiss, S., Marić, S. & Snoj, A. (2011). Regional structure despite limited mtDNA sequence diversity found in the endangered Huchen, Hucho hucho (Linnaeus, 1758). Hydrobiologia (2011) 658:103–110

• Marić, S., Razpet, A., Nikolić, V., Snoj, A. & Simonović, P. (2012). Genetic diversity of huchen (Hucho hucho ) in Serbia. II International Hucho Symposium – Lopuszna, Poland, September 19 – 22, 2012. Book of Abstracts, 35-36.

•Before the 2000, it was detected that growth of huchen from the Drina River altered at 16.5 kg and 110 cm Sl, •In the last three years the recorded values were 10.5 kg and about 98 cm Sl. •Indicates to changes in life-history characteristics of huchen, probably the drop in fecundity, i.e., in reproductive effort of adult huchen. •The coincidence between decrease in size and in fecundity might reflect the change in population structure of huchen from the Drina River.•Unfortunately, the records are so far too sparse for inferring on the character of that change.•The frequency of fish lengths in available landing records in 2007 – 2008 period (Marić et al. 2009) warrants that small decrease in landing size in relevance to the results of investigation would not remarkably increase the rate of landing.•Therefore, it was recommended to the fishery administrative authority to decrease the minimal landing size from 110 cm (Anonymous 2003) to 100 cm SL.

MANAGEMENT RELEVANCES

The only available records about the huchen production are those from the Fisheries Management Plan for the Drina River, assessed in 2003.•Section Bajina Bašta held biomass of 27 kg km-1 (12.65% of the total standing fish community), which yielded annual natural production of 23.077 kg km-1.•Section Ljubovija held biomass of 34.511 kg km-1 (10.84% of the total standing fish community), with the annual natural production of 24.000 kg km-1.Having in mind that total estimated fish biomass in the Bajina Bašta section in 2003 was 212.852 kg km-1 and in the Ljubovija section it was 318.211 kg km-1, comprising associating fish species common in the huchen’s ecosystem (e.g., grayling, nase, chub, Danubian roach, barbel, brook barbel, schneider and bullhead), it is clear that those sections of the Drina River were favorable for the production of huchen with the•sufficient food availability•sufficient ecosystem integrity•sufficient water qualityMain adverse effect is the lack of consistent spawning sites, due to the fluctuation in water level caused by hydropower plant “Perućac” in the spawning period, which either dries out redds situated usually inshore in the main river bed, disrupts the way into the inlets of spawning tributaries, or does both of harms for spawning huchen.

• complies with the recommendations in the Precautionary Principle

• add to an improvement of the recent conservation status of huchen

• enable fisheries utilization through an opportunity to catch and play the largest World’s salmonid

• provide a remarkable component of developmental force for the local rural communities

That point of view, however, was neglected by fishery management authority, who narrowed in 2009 (Anonymous 2009) the huchen fishing season for three months by excluding the whole summer from it, despite of that might decrease the incomes of fishery managers and their capability to cope with the still frequent practice of nocturnal summer huchen poaching in field.

HUCHEN STOCK MANAGEMENT ACTIVITIES

ARTIFICIAL SPAWNING AND REARING FOR STOCKING PURPOSES

Hitherto, there were two stocking occasions with huchen in last ten years, both with the brood fish taken from the Drina River.•The first one was acconmplished in 2000 and yielded about 104 yearlings which were stocked to the Rivers Drina and Lim and introduced for the first time into the River Djetinja*.•The second one was accomplished in 2012 and yielded about 103 yearlings stocked into the Drina River.

Mijović-Magdić, J. i Hegediš, A. (2000). Savremeni status mladice (Hucho hucho) u vodama Srbije i mogućnost kontrolisanog mresta i gajenja mlađi u uslovima intenzivne ribnjačke proizvodnje. «savremeno ribarstvo Jugoslavije» - Vršac, 20. – 22.septembar 2000. Zbornik sa IV Jugoslovenskog simpozijuma «Ribarstvo Jugoslavije»: 75-80.

Thank you for your attention and have a nice day!

In addition, poaching and river bed regulation made also harms for huchen stocks.In catchments of other rivers and streams in Serbia (Lim, Uvac and Vapa, Ibar and Djetinja, where huchen were introduced from the Drina River), data about the huchen stocks are very limited.Regardless the state authorities have adopted the Action Plan for Management with Huchen Stocks in Serbia*, implementation of activities and measures it recommended is very narrow and limited.

Hegediš, A., Mićković, B. & Cvijanović, G. (2005). Akcioni plan upravljanja mladicom u ribolovnim vodama Republlike Srbije. Centar za multidisciplinarne studije Univerziteta u beogradu, 52 pp.