7

PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Download PDF Report

Upload
others
View
1
Download
0

Embed Size (px)

Citation preview

Page 1: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Page 2: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Page 3: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Page 4: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Page 5: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Ce

ll g

row

th r

ate

(%

)

Page 6: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Page 7: PowerPoint Presentationo 1.0 0.5 0.0 P TEN+/+ Control p300 shRNA CBP shRNA Figure Sl. Knockdown efficacy of shRNAs of p300 and CBP. Real-time PCR of p300 and CBP mRNA after transfection

Documents

shrna termi vinod

shrna termi vinod

Documents

Lentiviral shRNA expression Cloning Kit User Manual for ...Lentiviral shRNA expression Cloning Kit User Manual for making shRNA expression lentivectors Each Kit Contents Amount One

Lentiviral shRNA expression Cloning Kit User Manual for ...Lentiviral shRNA expression Cloning Kit User Manual for making shRNA expression lentivectors Each Kit Contents Amount One

Documents

Chromatin-associated ncRNA activitiesH. sapiens CCND1 TLS Binding activates TLS, which represses CBP/p300 Wang et al. 2008 M. musculus Jpx CTCF Extricates CTCF from Xist promoter Sun

Chromatin-associated ncRNA activitiesH. sapiens CCND1 TLS Binding activates TLS, which represses CBP/p300 Wang et al. 2008 M. musculus Jpx CTCF Extricates CTCF from Xist promoter Sun

Documents

Documents

BMC Genomics BioMed - core.ac.uk · FEBS J 2005, 272:5129-5148). Results: ... Mdm2, RPA, CBP/ p300 and CSN5/Jab1 among many other proteins [52]. The C-terminal domain interacts with

BMC Genomics BioMed - core.ac.uk · FEBS J 2005, 272:5129-5148). Results: ... Mdm2, RPA, CBP/ p300 and CSN5/Jab1 among many other proteins [52]. The C-terminal domain interacts with

Documents

P300 in Detecting Concealed Informationgroups.psych.northwestern.edu/rosenfeld/documents/BRUNO... · Web viewNote that in computing the P300 value for each iterated average, the P300

P300 in Detecting Concealed Informationgroups.psych.northwestern.edu/rosenfeld/documents/BRUNO... · Web viewNote that in computing the P300 value for each iterated average, the P300

Documents

Research Paper Localized Delivery of shRNA against … Paper Localized Delivery of shRNA against PHD2 ... ... Theranostics)

Research Paper Localized Delivery of shRNA against … Paper Localized Delivery of shRNA against PHD2 ... ... Theranostics)

Documents

Transcriptional corepressor SIN3A regulates hippocampal ... · CBP, and p300 in memory and synaptic plasticity (6, 10, 11). Conversely, HDACs and other histone-mod-ifying effector

Transcriptional corepressor SIN3A regulates hippocampal ... · CBP, and p300 in memory and synaptic plasticity (6, 10, 11). Conversely, HDACs and other histone-mod-ifying effector

Documents

Download Ruckus P300 - Amazon Web Servicesruckus- · Ruckus P300 enables installers to deploy wireless bridges ... deploy multimedia hotspots, or ... SmartCell Gateway* P300 Network

Download Ruckus P300 - Amazon Web Servicesruckus- · Ruckus P300 enables installers to deploy wireless bridges ... deploy multimedia hotspots, or ... SmartCell Gateway* P300 Network

Documents

CBP/p300 in cell growth, transformation, and developmentgenesdev.cshlp.org/content/14/13/1553.full.pdf · 2000-07-07 · Kung et al. (2000). Mice engineered to contain a null mutation

CBP/p300 in cell growth, transformation, and developmentgenesdev.cshlp.org/content/14/13/1553.full.pdf · 2000-07-07 · Kung et al. (2000). Mice engineered to contain a null mutation

Documents

CBP CBP CBP CBP - cementbarriers.org

CBP CBP CBP CBP - cementbarriers.org

Documents

MUC1-TCF7L2-JBC1 NO COI2 CBP/p300, BCL9 and Pygo, with the induction of gene transcription (3,4). In this model, certain TCFs, for example TCF7L2, thus function as transcriptional

MUC1-TCF7L2-JBC1 NO COI2 CBP/p300, BCL9 and Pygo, with the induction of gene transcription (3,4). In this model, certain TCFs, for example TCF7L2, thus function as transcriptional

Documents

Journal of Plant Physiology - CASsourcedb.ib.cas.cn/cn/ibthesis/201304/P...HAC1, HAC5, and HAC12 of the p300/CBP family are involved in regulating ﬂowering time (Han et al., 2006;

Journal of Plant Physiology - CASsourcedb.ib.cas.cn/cn/ibthesis/201304/P...HAC1, HAC5, and HAC12 of the p300/CBP family are involved in regulating ﬂowering time (Han et al., 2006;

Documents

Contributions of HIF-1, AP-1, GATA-2, and CBP/p300

Contributions of HIF-1, AP-1, GATA-2, and CBP/p300

Documents

Chemical Biology - Future Science · analysis and experimental validation showed C646 is selective for p300/CBP in comparison with other HATs and reduces the levels of histone acetyla-tion

Chemical Biology - Future Science · analysis and experimental validation showed C646 is selective for p300/CBP in comparison with other HATs and reduces the levels of histone acetyla-tion

Documents

manual federal p300

manual federal p300

Documents

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC…

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC…

Documents

CBP and P300 regulate distinct gene networks required for ... · Gronemeyer, Laurence Vandel To cite this version: Lucas Fauquier, Karim Azzag, Marco Antonio Mendoza Parra, Aurélie

CBP and P300 regulate distinct gene networks required for ... · Gronemeyer, Laurence Vandel To cite this version: Lucas Fauquier, Karim Azzag, Marco Antonio Mendoza Parra, Aurélie

Documents

Manual Micromax P300

Manual Micromax P300

Documents

Downregulation Of P300/CBP-Associated Factor Attenuates ... · Introduction Myocardial ... creatine kinase (CK) assay commercial kits were obtained from Elabscience Biotechnology

Downregulation Of P300/CBP-Associated Factor Attenuates ... · Introduction Myocardial ... creatine kinase (CK) assay commercial kits were obtained from Elabscience Biotechnology

Documents

CBP CBP CBP CBP - Cementitious Barriers Partnershipcementbarriers.org/.../2014/08/cbp-tr-2013-004-1_rev0.pdfCBP CBP CBP CBP GOLDSIM INTERFACE FOR THE CBP SOFTWARE TOOLBOX, VERSION

CBP CBP CBP CBP - Cementitious Barriers Partnershipcementbarriers.org/.../2014/08/cbp-tr-2013-004-1_rev0.pdfCBP CBP CBP CBP GOLDSIM INTERFACE FOR THE CBP SOFTWARE TOOLBOX, VERSION

Documents

EP300 as an oncogene and correlates with poor prognosis in ... · Web viewRank sum and Chi square ... Kung AL, Grossman SR. CBP and p300 are cytoplasmic E4 polyubiquitin ligases

EP300 as an oncogene and correlates with poor prognosis in ... · Web viewRank sum and Chi square ... Kung AL, Grossman SR. CBP and p300 are cytoplasmic E4 polyubiquitin ligases

Documents

VEGF-A Œ CELEM ANTYANGIOGENNEJ TERAPII ... 557-580.pdfkoaktywatora transkrypcji bia‡ka p300/CBP (ang. CREB binding protein). p300/CBP wi„¿e bia‡o CREB-1 (ang. cAMP response

VEGF-A Œ CELEM ANTYANGIOGENNEJ TERAPII ... 557-580.pdfkoaktywatora transkrypcji bia‡ka p300/CBP (ang. CREB binding protein). p300/CBP wi„¿e bia‡o CREB-1 (ang. cAMP response

Documents

Mdm4 Mdm2 HAUSP 1: BT202: BT4744: BT5495: CAMA-1 6: DU4475 7: EVSA-T 8: HCC19379: Hs578T p53 p300 pRB ATM CBP p16 p21 p14ARF Tropomysosin Tubulin PUMA

Mdm4 Mdm2 HAUSP 1: BT202: BT4744: BT5495: CAMA-1 6: DU4475 7: EVSA-T 8: HCC19379: Hs578T p53 p300 pRB ATM CBP p16 p21 p14ARF Tropomysosin Tubulin PUMA

Documents

The p300 and CBP Transcriptional Coactivators Are Required ......protein (1/5,000; Abcam), as described previously (21). Low-Input Native Chromatin Immunoprecipitation The low-input

The p300 and CBP Transcriptional Coactivators Are Required ......protein (1/5,000; Abcam), as described previously (21). Low-Input Native Chromatin Immunoprecipitation The low-input

Documents

P300 Alzheimers Testing

P300 Alzheimers Testing

Documents

DATASHEET Movexx P300 600 x 1000 - WorktechDatasheet Movexx V160104 2 Specifications P300 600 x 1000 Dimensions P300 600 x 1000Pulling power P300 600 x 1000 (in kg) Frame Steel, powder

DATASHEET Movexx P300 600 x 1000 - WorktechDatasheet Movexx V160104 2 Specifications P300 600 x 1000 Dimensions P300 600 x 1000Pulling power P300 600 x 1000 (in kg) Frame Steel, powder

Documents

Generation of a Selective Small Molecule Inhibitor of the ... · Therapeutics, Targets, and Chemical Biology Generation of a Selective Small Molecule Inhibitor of the CBP/p300 Bromodomain

Generation of a Selective Small Molecule Inhibitor of the ... · Therapeutics, Targets, and Chemical Biology Generation of a Selective Small Molecule Inhibitor of the CBP/p300 Bromodomain

Documents

Documents