Polyphenol oxidase genes in Hordeum chilenseand implications in tritordeum breeding

Cristina Rodrıguez-Suarez • Sergio G. Atienza

Received: 3 April 2014 / Accepted: 30 June 2014

� Springer Science+Business Media Dordrecht 2014

Abstract Polyphenol oxidase (PPO) genes are

implicated in the darkening of various wheat end-

products, affecting their final color and therefore their

quality and consumer acceptance. The importance of

PPO1 and PPO2 genes in chromosomes 2A, 2B and

2D in wheat and the orthologous genes in barley

chromosome 2H has been studied in several works.

Minor quantitative trait loci affecting PPO activity

have also been described in other locations. Wheat

breeding programmes have selected low PPO activity

varieties and great efforts have been made to design

markers for assisted selection. The new cereal tritord-

eum (derived from the cross between the wild barley

Hordeum chilense Roem. et Schult. and durum wheat)

is known for the high yellow pigment and carotenoid

content of its grain. Given that the final color of end-

products is also influenced by the oxidation caused by

PPO enzymes, the characterization of H. chilense PPO

genes in tritordeum background is needed. Therefore,

in this work we characterized and mapped PPO

sequences including the orthologous PPO1 and

PPO2 genes in H. chilense as well as other PPO-like

sequences in 3HchL and 4HchL. The first evaluation of

PPO activity in a collection of tritordeum is also

reported. Finally, marker–trait associations with

Diversity Arrays Technology markers revealed the

importance of chromosome 2HchL in tritordeum PPO

activity, but associations with markers in wheat

chromosomes 2A, 2B, 3B, 5B, 6A and 7A were also

detected. In conclusion, all the results presented in this

work provide valuable information for future chal-

lenges in tritordeum breeding.

Keywords Polyphenol oxidase �Hordeum chilense �Tritordeum � Marker–trait associations � DArT

markers

Introduction

Polyphenol oxidase (PPO, EC 1.14.18.1) is a copper

enzyme widely distributed in plant species and

implicated in the oxidation of phenolic substrates.

The resulting products undergo different chemical

reactions leading to enzymatic browning in plant

tissues and also in many plant-derived products

(Whitaker and Lee 1995). Although knowledge of

their biological function in plants is scarce, it has been

proposed that their main role is in defense responses,

as they are up-regulated in wounded tissues (Constabel

and Barbehenn 2008). In wheat, PPO activity is

mainly located in the aleurone layer of kernels which

is usually removed in milling. Nevertheless, the small

quantities retained in the flour cause discoloration and

Electronic supplementary material The online version ofthis article (doi:10.1007/s11032-014-0145-9) contains supple-mentary material, which is available to authorized users.

C. Rodrıguez-Suarez (&) � S. G. Atienza

Instituto de Agricultura Sostenible, IAS-CSIC,

Apdo. 4084, 14080 Cordoba, Spain

e-mail: crodriguez@ias.csic.es

123

Mol Breeding

DOI 10.1007/s11032-014-0145-9

browning of wheat end-products such as noodles or

steamed and pan bread. This darkening affects the

final color and appearance of products, reducing their

quality and affecting consumer acceptance (Feillet

et al. 2000; Anderson and Morris 2001; Rani et al.

2001; Fuerst et al. 2008).

In wheat, PPO genes belong to a multigene family

consisting of at least two distinct phylogenetic groups

with three members each (Jukanti et al. 2004). The

importance of PPO genes in wheat homeologous

group 2 chromosomes, especially those located on the

long arm of 2A and 2D chromosomes, has been widely

documented in several works (Jimenez and Dubcov-

sky 1999; Anderson and Morris 2001; Mares and

Campbell 2001; Raman et al. 2005; Ficco et al. 2014).

Several markers associated with high and low PPO

activity alleles in chromosomes 2A, 2B and 2D have

been designed for their use in breeding programs (Sun

et al. 2005; He et al. 2007; Wang et al. 2009; Si et al.

2012). Quantitative trait loci (QTLs) with small effects

have also been identified in chromosomes 3B, 3D and

6B (Demeke et al. 2001). Recently, new PPO alleles

have been described and classified into PPO1 (PPO-A1,

PPO-B1 and PPO1-D1) and PPO2 (PPO-A2, PPO-B2

and PPO1-D2), and their expression has been followed

during grain development (Beecher and Skinner

2011). In addition, in Hordeum vulgare, the ortholo-

gous genes PPO1 and PPO2 have been described and

mapped to the long arm of chromosome 2H (Taketa

et al. 2010).

Tritordeum is a new cereal derived from the cross

between the wild barley Hordeum chilense Roem. et

Schult (2n = 2x = 14; HchHch) and durum wheat

(Martin and Sanchez-Monge Laguna 1982). Hexaploid

tritordeum endosperm (9Tritordeum Ascherson et

Graebener; 2n = 6x = 42; AABBHchHch) exhibits a

high yellow pigment and carotenoid content given by

the addition of the H. chilense genome (Alvarez et al.

1999; Atienza et al. 2007; Rodrıguez-Suarez et al.

2010, 2011). In recent years, great efforts have been

directed towards gaining knowledge of the H. chilense

genome as a necessary step for tritordeum breeding. As

a result, H. chilense-derived Diversity Arrays Tech-

nology (DArT) markers have been developed, and a

genetic map has been constructed and then used for the

location of genes of interest (Rodrıguez-Suarez and

Atienza 2012; Rodrıguez-Suarez et al. 2012). DArT

technology has also been revealed to be a powerful tool

for tritordeum genotyping (Castillo et al. 2013).

Previous works have pointed out the importance of

H. chilense genes Zds, Psy1 and e-Lcy in tritordeum

grain carotenoid content (Rodrıguez-Suarez et al.

2014). Considering that the final color of end-products

is also influenced by the oxidation caused by PPO

enzymes, the characterization and the putative role of

H. chilense PPO genes in the tritordeum background

needs to be clarified. For this purpose, the objectives of

this work were (1) the characterization and location of

PPO1 and PPO2 genes in H. chilense, (2) the

evaluation of PPO activity variation in a collection

of tritordeums and (3) the analysis of the putative

associations of PPO activity with the DArT markers

previously scored in the tritordeum collection.

Materials and methods

Plant material

Genomic DNA was isolated from leaves of lines H1

and H7 of H. chilense using the CTAB method

(Murray and Thompson 1980). The tritordeum col-

lection used in this work has been recently described

and genotyped with DArT markers (Castillo et al.

2013), showing that it consists of complete tritorde-

ums (complete copies of A, B and H. chilense

genomes) and substituted tritordeums carrying diso-

mic substitutions (DS) of: DS1D (1Hch), DS2D (2Hch),

DS5D (5Hch), DS6D (6Hch) or the double substitution

DS2D/DS5D (2Hch and 5Hch). Additionally, five

tritordeum lines (HT240, HT335, HT609, HT621

and HT630) and five durum wheat lines (Kofa,

UC1113, D. Pedro, Simeto and Claudio), character-

ized in a previous work (Rodrıguez-Suarez et al.

2014), were also included. Seed samples for PPO

analysis of the tritordeum collection were obtained

from a field trial following a complete randomized

block design with two field replicates and provided by

Agrasys S.L.

Amplification and sequencing of H. chilense PPO

genes

Specific primers based on Hordeum vulgare PPO1,

PPO2 and NIASHv1086A23 (AK358933) sequences

were designed to amplify H. chilense copies in H1 and

H7 lines. All primers used for amplifying and

sequencing are shown in Table 1. PCR reactions were

Mol Breeding

123

carried out using the Certamp kit for complex

amplifications (Biotools B&M Labs, Madrid, Spain)

according to the supplier’s instructions and performed

as follows: 5 min at 94 �C, 35 cycles of 30 s at 94 �C,

30 s at 59 �C and 2:30 min at 72 �C, followed by

7 min at 72 �C. PPO1 was amplified in two overlap-

ping fragments using primer pairs PPO1HV-F1/PPO1-R2

and PPO1-F2/PPO1HV-R1. The fragments obtained

(of approximately 1,500 and 700 bp, respectively)

were directly sequenced using these and an inner

primer (Table 1). PPO2 complete sequences were

amplified in a single fragment with PPO2HV-F1/

PPO2HV-R1 primer pair. The fragments obtained

were cloned in pGEMT-Easy vector (Promega, Mad-

ison, WI, USA), and introduced into competent cells

JM109 (Promega) by transformation. Plasmids were

isolated and purified using Illustra plasmid Prep Mini

Spin Kit (GE Healthcare, UK) and used as templates

for sequencing.

Sequences were aligned using Edialign software

(http://emboss.sourceforge.net/index.html) and edited

using GeneDoc software (http://www.psc.edu/

biomed/genedoc). Sequence identity searches were

performed at the NCBI (http://www.ncbi.nlm.nih.gov)

using BLAST. Primer pairs were designed using Pri-

mer3Plus software (Untergasser et al. 2007). Putative

open reading frames were predicted using ORF finder

(http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi).

Marker design and mapping

A DArT-based map constructed in 92 F7 recombinant

inbred lines (RILs) derived from the cross H1 9 H7

(Rodrıguez-Suarez et al. 2012) was used for mapping

purposes. Molecular markers were designed based on

the polymorphisms found between H1 and H7 in PPO

sequences. All PCR amplifications were performed in

25-ll reactions consisting of 0.625 U of DNA

Table 1 Primers used for the characterization of PPO genes in H. chilense

Primer Sequence 50–30 Purpose

PPO1HV-F1 ATGGAGAGCACTCGCATGAT Amplifying and sequencing PPO1

PPO1HV-R1 TCACTTGAGGTAGCTGATGCTG Amplifying and sequencing PPO1

PPO1sec-R GGCCTGAAGTCGGTGATAAG Sequencing PPO1

PPO1Hc-F CCGCTCAACCTCGACTACAG Mapping PPO1

PPO1Hc-R AGAAGAGGAAGGTGGCGTCT Mapping PPO1

PPO2HV-F1 GTTCACCATGGAGATGAGCA Amplifying PPO2

PPO2HV-R1 GGTGCTTCACTTGGCATAGC Amplifying PPO2

PPO1-F1 AGCTTCGAGCAGCAGTGG Sequencing PPO1 and PPO2

PPO1-R1 GTGGTGCGCGAAGAAGAT Sequencing PPO1 and PPO2

PPO1-F2 GACATGGGCAACTTCTACTCG Amplifying and sequencing PPO1

PPO1-R2 GAACCTCGCCACCGTCTT Amplifying and sequencing PPO1

PPO2Hc-F TGTCGAGTGCCAAGAAGACC Mapping PPO2

PPO2Hc-R GGCTGGTTCACTAGCACGTC Mapping PPO2

PPO2HcH1-F TCGAGGAGCAGCAAGGAA Mapping PPO2

PPO2HcH7-R ACCTCCTCTGCCTCCTCTTTC Mapping PPO2

PPO3-F2 AACGTCCACTGCGCCTAC Amplifying and sequencing PPO3.1/.2/.3

Mapping PPO3.2 and PPO3.3

PPO3-R2 CTCGTCGTAGAAGAGGAAGGA Amplifying and sequencing PPO3.1/.2/.3

Mapping PPO3.2 and PPO3.3

PPO3mapF GGTTCTTCTTCCCGTTCCAT Mapping PPO3.1

PPO3mapR GGTCCATGTTGCTGTGGT Mapping PPO3.1

PPO3mapRH7 GTGCACCGTGTTGTGTGC Mapping PPO3.1

PPO3mapFH1 GATAAATCCAGCCTCTCTGACA Mapping PPO3.1

Mol Breeding

123

polymerase (Biotools B&M Labs, Madrid, Spain),

19 PCR buffer, 1.6 mM MgCl2, 320 mM dNTPs

(Promega, Madison, WI, USA), 0.6 mM of each

primer and 50 ng of genomic DNA. The primer pair

PPO1Hc-F/PPO1Hc-R, flanking a deletion in the H1

allele, was used for mapping the PPO1 gene. PPO3.2

and PPO3.3 were amplified in the mapping population

using the primer pair PPO3-F2/PPO3-R2. PPO3.1

was mapped with a tetra-primer PCR using the

combination of primers PPO3mapF/PPO3mapR/

PPO3mapRH7/PPO3mapFH1. For PPO2 allele-spe-

cific amplifications with tetra-primer PCR (PPO2Hc-

F/PPO2Hc-R/PPO2HcH1-F/PPO2HcH7-R), a touch-

down of five cycles of 30 s at 94 �C, 30 s at 65 �C and

1 min at 72 �C, reducing by 1 �C/cycle, was added

beforehand. For the rest of the amplifications, PCRs

were carried out as follows: 5 min at 94 �C, 35 cycles

of 30 s at 94 �C, 30 s at 60 �C and 1 min at 72 �C,

followed by 7 min at 72 �C. New molecular markers

were added to the previous map using JoinMap 4.0

(Van Ooijen 2006).

Evaluation of PPO activity

PPO activity was determined according to the

Approved Method 22–85 (AACC 2000), using five

grains per 1.5 ml 10 mM L-DOPA substrate and

Tween-20 as a surfactant. Two field replicates and two

samples from each replicate were evaluated for each

line. Absorbance was recorded at 475 nm and PPO

activity was calculated per gram of sample. Absor-

bance readings under 0.5 are considered to be low PPO

activity values in the method used.

DArT markers data sets

Genotyping information of a set of 2,377 high-quality

polymorphic markers derived from H. chilense and

hexaploid wheat from a previous work was selected

(Castillo et al. 2013). A subset of 450 DArT markers

was shared with the mapping project (Rodrıguez-

Suarez et al. 2012). The DArT markers sets used have

been previously filtered by the quality criteria

described in Castillo et al. (2013), and all of them

were therefore used for association analysis.

Tritordeum lines were also genotyped with markers

F-18, PPO-18 and PPO33 described as associated with

PPO activity in wheat (Sun et al. 2005; Si et al. 2012).

Population structure and association mapping

The set of 2,377 markers was used to infer population

structure and for association mapping. Population structure

was calculated using STRUCTURE software version 2.3.1

(Pritchard et al. 2000) assuming a population admixture

model and correlated allele frequencies. The number of

assumed groups (K) was set between 1 and 10, and for each

value of K five times independently MCMC (Markov

chain Monte Carlo) of 50,000 iterations was run.

TASSEL 3.0 (Bradbury et al. 2007) was used to

perform association mapping analysis using the gen-

eral linear model (GLM) with the population structure

(Q matrix) as the fixed covariate and the mixed linear

model (MLM) including the population structure

(Q) and kinship matrix.

Results

Identification and characterization of PPO

sequences in Hordeum chilense

Searching ‘polyphenol oxidase’ in the putative func-

tion search in the rice genome (http://rice.plantbiology.

msu.edu/cgi-bin/putative_function_search.pl) revealed

two main locations of PPO-related genes. In rice chro-

mosome 1, the two closely linked genes LOC_

Os01g58070 and LOC_Os01g58100 were identified.

Bradi2g52090, Bradi2g52260 and LOC_Os01g58100

belong to the same Poaceae orthologous group (http://

rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi?

orf=LOC_Os01g58100). Using the barley genome

zipper (http://mips.helmholtz-muenchen.de/plant/

barley/gz/searchjsp/index.jsp), Bradi2g52090 could

be located in the long arm of chromosome 3H. Brad-

i2g52260 was also located in 3HL, orthologous to H.

vulgare flcDNA NIASHv1086A23 (AK358933). This

sequence was used as template to design primers for the

partial amplification of the orthologous gene in H.

chilense.

The second region identified was in rice chromo-

some 4, where the four genes LOC_Os04g53250,

LOC_Os04g53260, LOC_Os04g53290 and LOC_

Os04g53300 are located. Following the same strategy,

this region is syntenic to barley chromosome 2H,

where PPO1 and PPO2 genes have been located and

characterized (Taketa et al. 2010).

Mol Breeding

123

PPO1and PPO2 gene sequences of H. vulgare

(AB549330 and AB549331, respectively) were used

to design primers for amplifying the orthologous genes

in H. chilense. Complete genomic sequences of PPO1

and PPO2 were obtained in H. chilense genotypes H1

and H7. PPO2 sequences were obtained using the

primer pair PPO2HV-F1/PPO2HV-R1 which ampli-

fied a single fragment of 1,992 bp in H1 and H7 lines.

Based on the exon–intron structure of the orthologous

gene in H. vulgare, the PPO2 gene in H. chilense

would be 1,979 bp in length with three exons and two

introns, an expected coding region of 1,716 bp and a

predicted protein of 571 residues in both lines. Alleles

in H1 and H7 (GenBank accessions KJ472487 and

KJ472488, respectively) are 99.64 % identical, dif-

fering by seven single nucleotide polymorphisms

(SNPs) (one in exon 1 and six in exon 3) leading to

three protein polymorphisms in the third exon.

Regarding PPO1, complete genomic sequences were

obtained in both lines by amplification with primer

pairs PPO1HV-F1/PPO1-R2 (pair 1) and PPO1-F2/

PPO1HV-R1 (pair 2). Pair 1 amplified a single

fragment of 1,782 bp in H1 and 1,808 bp in H7. An

overlapping sequence of 730 bp was obtained both in

H1 and H7 with primer pair 2. By comparison with H.

vulgare, PPO1 in H. chilense would be constituted by

three exons and two introns with a complete gene

length of 1,909 bp in H1 and 1,935 bp in H7. Coding

sequences of 1,708 and 1,732 bp and proteins of 569

and 577 residues would be expected for H1 and H7,

respectively. Alleles in both lines (GenBank acces-

sions KJ472485 and KJ472486, respectively) are

97.88 % identical in sequence, with 18 SNPs leading

to seven amino acid differences (two in exon 2 and five

in exon 3). Furthermore, the PPO1 allele in H1 harbors

an in-frame deletion in exon 3 leading to the short-

ening of the expected protein by eight residues.

The primer pair PPO3-F2/PPO3-R2, designed based

on the PPO-like sequence NIASHv1086A23 in H.

vulgare, yielded four PCR fragments in H1 and H7 lines.

A fragment of approximately 900 bp-length, named

PPO3.1, amplifies both in H1 and H7 (GenBank acces-

sions KJ472489 and KJ472490). Both sequences were

blasted against the assembly from whole genome shotgun

sequencing of barley cultivar Morex (http://webblast.

ipk-gatersleben.de/barley/viroblast.php), showing high

homology (92–93 %) to Morex contig_138890, mapped

to chromosome 4HL. BLAST results also showed that

both sequences may contain an intron.

Two smaller fragments of 685 bp (PPO3.2) and

585 bp (PPO3.3) amplify only in H7. They were both

sequenced and submitted to GenBank (accessions

KJ472491 and KJ472492, respectively). BLAST

results against the Morex contigs database showed

the same results for both sequences: a homology of

94 % with Morex contig_1579564, mapped to chro-

mosome 3HL (73.15 cM). No introns are included in

these partial sequences.

Multi-alignments of the PPO sequences and

expected proteins in the H1 and H7 lines are provided

as Supplementary material (Fig. S1–S3).

Mapping PPO genes in H. chilense

Based on the genomic sequences of PPO genes in H1

and H7, polymorphic markers were designed to locate

these genes in the H1 9 H7 RIL mapping population.

This population has been previously used for the

construction of a high-density map based on DArT

markers (Rodrıguez-Suarez et al. 2012) and for the

location of carotenoid-related genes in H. chilense

(Rodrıguez-Suarez and Atienza 2012).

PPO1 and PPO2 genes mapped to the long arm of

chromosome 2Hch, at 158.8 cM, flanked by DArT

markers bPt-1931 and bPb-802944. No recombination

was detected between these two genes. Primer pair

PPO3-F2/PPO3-R2 yielded two patterns in the map-

ping population: a single 900-bp fragment in H1-like

genotypes and three fragments of 900, 685 and 585 bp

in H7-like genotypes. The presence/absence of the

685 ? 585 pair (PPO3.2 and PPO3.3) co-segregated

in the population and was mapped to the long arm of

chromosome 3Hch at 115.1 cM. New primers for tetra-

primer PCR were designed to map the 900-bp

fragment (PPO3.1) based on the SNPs found in H1

and H7. The PPO3.1 sequence was mapped to the long

arm of chromosome 4Hch at 148.5 cM. Figure 1

shows the location of these genes in chromosomes

2Hch, 3Hch and 4Hch.

PPO activity evaluation

A preliminary field trial was performed to compare the

PPO activity of the tritordeum and durum wheat lines

characterized in a previous work (Rodrıguez-Suarez

et al. 2014). Analysis of variance (ANOVA) analysis

showed that the PPO activity in tritordeums was nearly

4-fold higher than in durum wheat (2.297 vs. 0.577,

Mol Breeding

123

p \ 0.05). A panel of 42 lines available from the

tritordeum collection was evaluated for PPO activity,

which was scored in two field replicates and in two

samples of each replicate. ANOVA resulted in signif-

icant differences for genotype (p = 0.0000). Table 2

shows the phenotypic variation for PPO activity. PPO

activity in tritordeum varied from 0.471 in HT296 to

4.066 in HT328. The mean activity of tritordeums was

2.297 ± 0.116, higher than in the durum wheat lines

evaluated (0.577 ± 0.196). However, tritordeum lines

such as HT295, HT296 or HT322 showed PPO

activity values similar to those of durum wheat, or

even lower if compared to Kofa.

Marker–trait associations

Population structure was calculated using the data set

composed of 2,377 polymorphic DArT markers

derived from H. chilense and hexaploid wheat. In a

previous work, the population structure of this

tritordeum collection was established by using only a

subset of the DArT markers, those of genomes Hch and

D, as the objective of the work was to identify D/Hch

chromosome substitutions (Castillo et al. 2013). In the

present work all DArT markers were used, detecting

an underlying structure with five groups (K = 5)

which was used for Q matrix calculation (Fig. S4).

DArT marker association with PPO activity was

determined by GLM analysis with Q covariate matrix

for population structure correction (GLM-Q) and by

MLM considering the Q and K matrices for population

structure and relatedness corrections respectively

(MLM-Q-K). With GLM-Q analysis, 23 DArT mark-

ers (10 from H. chilense and 13 from the A or B

genomes) showed significant association with PPO

activity at p \ 0.001 (Table 3). The three H. chilense

markers bPt-791431, bPt-789248 and bPt-789534,

showing association with PPO activity, were not part

of the data subset scored in the mapping population

and therefore their location is unknown. The remain-

ing seven H. chilense markers were common with the

mapping data set and they could be successfully

located in the long arm of chromosome 2Hch. The

strongest association was detected with marker

bPt-786768, mapping at 159.5 cM in 2HchL. In addition,

associations with bPt-789812 (102.4 cM), with a

block of three markers at 137.2 cM (bPt-789609,

bPt-789148 and bPt-789323), with bPt-790349

(142.4 cM) and with bPt-789956 (163.1 cM) were

detected in chromosome 2HchL (see Fig. 1). Further-

more, associated DArT markers derived from wheat

were identified in chromosomes 2A (tPt-3136), 2B

(wPt-3755), 3B (wPt-5522, wPt-7225, wPt-8446,

wPt-7254, wPt-2280 and wPt-10142), 5B (wPt-0054

and wPt-5429), 6A (wPt-2400) and 7A (wPt-0321 and

wPt-7053).

GGPPSbPt-789812ZDSbPt-787052S208.4bPt-789609bPt-789148bPt-789323bPt-801612HYD3bPt-790349bPt-787983bPt-1931PPO1PPO2bPb-802944bPt-786768bPt-789956bPb-792214bPb-791562bPt-800966bPb-804306bPt-790051bPt-804393bPt-786845bPb-801217bPt-791531bPt-788067bPt-788984bPb-801589bPt-789872bPt-789975bPb-801175bPt-790317bPb-804457bPb-804094bPt-29330bPt-787235

LECbPt-788555PPO3.2/3bPt-23391bPt-787209

bPb-23391bPt-792986bPt-790309

bPt-0959

S197

bPt-801802bPt-29205bPt-801075

bPb-791820bPt-788045bPt-791623

bPb-791293

bPb-801924

bPt-789051

bPb-803325

bPb-5245

bPt-801466

bPt-791446bPb-787055

bPt-789475Cos286bPt-792793PDSbPt-792329bPb-792051bPb-790810bPt-787997bPb-803175bPb-802140bPb-16544bPt-789418bPb-804636bPt-49174bPt-802669bPt-787179bPb-788133bPb-791864PPO3.1bPt-38224bPt-35303

A B C

Fig. 1 Location of H. chilense PPO genes based on the

mapping information previously reported (Rodrıguez-Suarez

et al. 2012; Rodrıguez-Suarez and Atienza 2012). a PPO1 and

PPO2 genes position in the long arm of chromosome 2Hch.

DArT markers associated with PPO activity are shown in bold.

The estimated centromere position is indicated as a colored

segment. b PPO3.2/3 position in the long arm of chromosome

3Hch. c PPO3.1 position in the long arm of chromosome 4Hch

Mol Breeding

123

By MLM-Q-K analysis, three markers were signif-

icantly associated with PPO activity (p \ 0.001), all

from H. chilense and also detected with GLM-Q

analysis: bPt-786768 marker located on 2HchL and the

two unmapped bPt-791431 and bPt-789248 DArT

markers.

No associations were detected with markers F-18,

PPO-18 and PPO33 previously described as associated

with wheat grain PPO activity (Sun et al. 2011; Si et al.

2012).

Discussion

PPO sequences in H. chilense

PPOs in plants belong to multigene families with

different number of members, where variation in

intron number and position are frequent (Tran et al.

2012). Evidence of a multigene family in wheat has

been also reported at the molecular level (Massa

et al. 2007). Synteny with other Poaceae species

Table 2 Evaluation of PPO activity of five durum wheat lines, five tritordeum lines and the tritordeum collection according to the

Approved Method 22–85 (AACC 2000) and calculated per gram of sample

Line Group PPO activity Line Group PPO activity

HT223 Complete 2.571 ± 0.121 HT424 DS2D/DS5D 1.850 ± 0.133

HT294 DS1D 2.032 ± 0.168 HT425 DS2D/DS5D 1.112 ± 0.186

HT295 Complete 0.682 ± 0.074 HT426 DS6D 2.856 ± 0.037

HT296 Complete 0.471 ± 0.029 HT427 Complete 1.889 ± 0.100

HT320 Complete 1.869 ± 0.237 HT428 DS5D 2.073 ± 0.095

HT322 Complete 0.639 ± 0.124 HT429 Complete 2.872 ± 0.430

HT323 Complete 2.490 ± 0.261 HT430 DS5D 3.016 ± 0.274

HT324 Complete 3.294 ± 0.143 HT431 DS5D 3.497 ± 0.285

HT325 Complete 2.624 ± 0.350 HT432 Complete 2.989 ± 0.891

HT326 Complete 1.699 ± 0.061 HT433 DS5D 2.567 ± 0.064

HT327 Complete 2.172 ± 0.343 HT434 DS5D 2.547 ± 0.271

HT328 DS1D 4.066 ± 0.148 HT435 Complete 2.512 ± 0.110

HT400 DS2D 3.161 ± 0.305 HT436 DS5D 3.517 ± 0.411

HT409 DS5D 1.724 ± 0.151 HT631 Complete 1.943 ± 0.154

HT410 Complete 1.690 ± 0.119 JB2 DS2D 2.838 ± 0.344

HT411 Complete 2.268 ± 0.048 JB3 Complete 2.422 ± 0.135

HT412 Complete 2.486 ± 0.151 HT240 Complete 2.470 ± 0.167

HT413 Complete 2.242 ± 0.157 HT335 Complete 1.998 ± 0.082

HT414 Complete 2.199 ± 0.149 HT609 Complete 2.019 ± 0.087

HT415 DS2D 2.583 ± 0.190 HT621 Complete 2.392 ± 0.088

HT416 DS2D 2.515 ± 0.166 HT630 DS2D 2.422 ± 0.133

HT417 DS2D 3.244 ± 0.315 Kofa DW 1.340 ± 0.118

HT418 Complete 0.822 ± 0.067 UC1113 DW 0.315 ± 0.018

HT419 Complete 2.289 ± 0.135 D. Pedro DW 0.339 ± 0.013

HT421 DS2D/DS5D 1.549 ± 0.161 Claudio DW 0.319 ± 0.025

HT422 Complete 2.781 ± 0.298 Simeto DW 0.572 ± 0.020

Standard error is shown. Tritordeums are classified into ‘complete’ or substituted carrying disomic substitutions DS1D (1Hch), DS2D

(2Hch), DS5D (5Hch), DS6D (6Hch) or double substituted DS2D/DS5D (2Hch and 5Hch). NA not available for PPO assay. DW durum

wheat

Mol Breeding

123

reveals the existence of at least two PPO gene

clusters in H. chilense in chromosomes 2Hch and

3Hch, which is also in agreement with our mapping

results. Taketa et al. (2010) proposed two major

clades for PPO sequences. One clade would include

orthologous genes in rice chromosome 4 along with

PPO1 and PPO2 from wheat and barley homoeol-

ogous group 2. The PPO1 and PPO2 sequences from

H. chilense described in this paper would also fit

this group. The second major clade proposed by

Taketa et al. (2010) corresponds to the rice gene

LOC_Os01g58100 in chromosome 1. No sequences

from barley or wheat had been identified as

belonging to this clade at that time. In this work,

we identify new PPO-like sequences, named PPO3.2

and PPO3.3, that would fit this clade along with the

barley sequence NIASHv1086A23 (AK358933). A

third location of the PPO-like sequence (PPO3.1) is

detected in chromosome 4Hch although no synteny

with rice or barley could be established.

Variation of PPO activity

The mean PPO activity in tritordeums is higher than

that of the durum wheat lines tested in this work.

However, the existence of low PPO activity tritorde-

ums (HT295, HT296 or HT322) shows that the

addition of H. chilense genes per se does not increase

PPO activity. In durum and common wheat, final PPO

phenotype depends on allelic variation at loci on the A,

B and/or D genomes. Wheat has been traditionally

subjected to selection for low PPO activity varieties.

Conversely, tritordeum has not been selected for low

PPO activity in the breeding program and would

probably harbor alleles for high PPO activity elimi-

nated from the commercial wheat lines, as well as high

Table 3 Significant DArT markers associated with PPO activity in the tritordeum collection by GLM and MLM analyses

Marker Chr. Allele Freq. GLM-Q MLM-Q-K

p value Effect R2 p value Effect R2

bPt-791431 n.m 1 0.86 1.74E-6 1.494 0.419 4.68E-04 1.632 0.347

bPt-789248 n.m 1 0.85 2.25E-6 1.500 0.423 4.60E-04 1.644 0.342

bPt-786768 2Hch 1 0.68 2.34E-6 1.467 0.418 5.36E-04 1.403 0.336

bPt-789534 n.m 1 0.73 1.43E-5 1.621 0.379

bPt-789812 2Hch 1 0.71 2.30E-5 1.394 0.361

bPt-789956 2Hch 1 0.67 3.82E-5 1.250 0.336

wPt-7053 7A 1 0.83 4.02E-5 1.292 0.344

wPt-10142 3B 0 0.71 4.78E-5 1.471 0.329

wPt-2280 3B 1 0.71 4.78E-5 1.471 0.329

wPt-7254 3B 1 0.71 4.78E-5 1.471 0.329

bPt-789609 2Hch 1 0.71 1.42E-4 1.328 0.306

bPt-789148 2Hch 1 0.71 1.44E-4 1.312 0.296

bPt-789323 2Hch 1 0.71 1.44E-4 1.312 0.296

wPt-3755 2B 0 0.69 1.67E-04 0.961 0.291

wPt-2400 6A 1 0.81 3.98E-04 1.083 0.263

tPt-3136 2A 1 0.81 5.29E-04 -1.087 0.254

wPt-0321 7A 0 0.93 5.97E-04 1.690 0.250

bPt-790349 2Hch 1 0.76 7.13E-04 1.413 0.244

wPt-0054 5B 0 0.62 7.62E-04 0.991 0.242

wPt-5429 5B 0 0.62 7.62E-04 0.991 0.242

wPt-5522 3B 0 0.85 9.81E-04 1.137 0.240

wPt-7225 3B 0 0.85 9.81E-04 1.137 0.240

wPt-8446 3B 0 0.85 9.81E-04 1.137 0.240

n.m not mapped, Chr. chromosome location, Freq. allele frequency

Mol Breeding

123

PPO activity alleles from H. chilense. In agreement

with this, marker–trait association results show that

variation in tritordeum PPO activity may be explained

by alleles at 2Hch, 2A, 2B, 3B, 5B, 6A or 7A. Finally,

the effect of D genome substitutions in tritordeum

PPO activity is not detectable in the collection studied.

Marker–trait associations

For marker–trait associations we used a limited number

of tritordeum genotypes evaluated in one environment

and one year. A greater number of genotypes and

environments would have been desirable, and more and

stronger associations would probably have been

detected. This fact does not necessarily invalidate the

associations found, which are consistent with previous

works, as discussed in this section.

Marker–trait associations revealed the importance

of chromosome 2Hch in PPO kernel activity in

tritordeums. Both GLM and MLM analyses showed

that the DArT marker bPt-786768, located at

159.5 cM in the long arm of chromosome 2Hch, was

associated with the highest probability (among the

mapped ones) to PPO activity. PPO1 and PPO2 genes

were mapped with the gene markers designed in this

work at 158.8 cM in the same chromosome, being the

closest marker to the candidate genes. There are other

markers in the mapping data set (bPt-787983,

bPt-1931 and bPb-802944) that map closer to PPO

genes (see Fig. 1), but their association could not be

tested as they are not included in the data set used for

association analysis. In addition, other markers along

chromosome 2HchL are associated with the trait by

GLM analysis. although with lower probabilities.

Marker–trait associations revealed by GLM analysis

could be considered spurious since all but three of them

are not detected by MLM analysis. Nevertheless, there

are some coincidences that might be taken in consid-

eration as they are in agreement with the results

presented in this and previous works and then they

may hold true associations. For example, the DArT

marker tPt-3136 has been located at 79.5 cM in the long

arm of chromosome 2A (Marone et al. 2012). This is the

region where the PPO-A1 gene has been located by

using the PPO18 sequence-tagged site marker (Sun et al.

2005). Although tPt-3136 is not integrated in the wheat

composite map, there are other common markers useful

for comparing their positions. For example, the SSR

marker Xwmc170 is located at 1 cM from PPO-A1 in

the composite map and also at 1 cM from tPt-3136 in the

map information published by Marone et al. (2012). In

addition, the trait marker Xgwm312 described as linked

to the PPO18 marker and PPO-A1 gene (Sun et al. 2005)

is located at 4.3 cM from tPt-3136 (Marone et al. 2012).

Therefore, PPO-A1’s effect would be also detectable in

PPO activity in tritordeum.

Regarding the associated marker wPt-3755 located

on chromosome 2B, the relation with the PPO-B1 gene

can also be established. PPO-B1 has only been

mapped in the Louise 9 Penawawa mapping popula-

tion (Beecher et al. 2012). Marker wPt-3755 has been

located in a durum wheat map constructed with five

data sets at 176.2 cM in chromosome 2BL, 1.5 cM

distant from the marker wmc332 (Letta et al. 2013).

This marker is also included in the mapping popula-

tion used by Beecher et al. (2012), where it is located

at approximately 15 cM from PPO-B1. It can then be

concluded that wPt-3755 is located in the same region

of the PPO-B1 gene, confirming the effect of this gene

in the PPO tritordeum phenotype.

The three DArT markers wPt-5522, wPt-7225 and

wPt-8446 associated with tritordeum PPO activity

(Table 3) have been located in the telomeric region of

the short arm in the chromosome 3B consensus map,

between 10.5 and 10.7 cM (Wenzl et al. 2010). QTLs for

PPO activity have been identified in the same chromo-

somal region, associated with the restriction fragment

length polymorphism marker Xbcd907a (Demeke et al.

2001). Although this marker is not included in the

consensus map, the equivalence between regions can be

established by other common markers. For instance, the

SSR marker gwm389 mapped at 8.4 cM in the chromo-

some 3B consensus map (Wenzl et al. 2010) and co-

segregates with Xbcd907a in the Arina 9 Forno inte-

grative linkage map (Paillard et al. 2003). Therefore, the

implication of this region in wheat PPO activity is again

revealed, as proposed in previous works (Demeke et al.

2001). This effect is also detectable in the tritordeum

background where the H. chilense orthologous region

does not seem to participate in the final phenotype, or it is

not detected in the population studied. A second region in

the long arm of chromosome 3B (between 69.7 and

75.2 cM) seems to be implicated in PPO activity, as

revealed by the association shown with markers

wPt-10142, wPt-2280 and wPt-7254 (Table 3). To our

knowledge no QTLs for PPO activity and no PPO genes

have been previously identified in this region of wheat.

Curiously, the PPO-like sequences named PPO3.2 and

Mol Breeding

123

PPO3.3 map to the long arm of chromosome 3Hch

(115.1 cM). BLAST results confirm the same position of

the orthologous sequences in H. vulgare chromosome

3HL (73.1 cM). The existence of a second PPO region in

chromosome 3 related to grain PPO activity can thus be

suggested. Putative effects of H. chilense chromosome

3Hch in PPO activity are not detected in this work, which

could be explained by the lack of variation between

tritordeum lines.

Finally, other associations with DArT markers

located in chromosomes 5B, 6A and 7A have been

detected with GLM analysis. Previous works have

proposed the existence of QTLs for PPO activity in

group 5, 6B and 7A and 7D (Li et al. 1999; Demeke

et al. 2001), although the equivalence with our DArT

markers is not evident, and spurious associations

cannot be discarded.

Final remarks

The tritordeum lines evaluated show a great variation

for grain PPO activity. The PPO phenotype in the

collection studied relies mainly on the alleles of PPO

genes in the long arm of chromosome 2Hch. The effect

of PPO genes in chromosomes 2A and 2B is also

revealed by association analysis, in concordance with

previous results in wheat. Taken together with the

results presented in this work, a putative effect of two

regions in group 3 chromosomes on PPO activity

might be suggested. Finally, breeding for low PPO

tritordeum varieties in the future should take into

consideration allelic variation at the three genomes.

Acknowledgments This research was supported by grant

AGL2011-24399 from the Ministerio de Economıa y

Competitividad, and P09-AGR-4817 grant from the

Consejerıa de Economıa, Innovacion, Ciencia y Empleo (Junta

de Andalucıa), all of them including FEDER funding. C.R.-S.

acknowledges financial support from JAE-Doc program (CSIC,

co-funded by FSE). The authors thank Agrasys S.L. for

providing seed samples for PPO activity analysis.

References

AACC (2000) AACC method 22-85.01. Measurement of poly-

phenol oxidase in wheat kernels (L-DOPA Substrate).

AACC International Approved Methods

Alvarez JB, Martin LM, Martin A (1999) Genetic variation for

carotenoid pigment content in the amphiploid Hordeum

chilense x Triticum turgidum conv. durum. Plant Breed

118:187–189

Anderson JV, Morris CF (2001) An improved whole-seed assay for

screening wheat germplasm for polyphenol oxidase activity.

Crop Sci 41(6):1697–1705. doi:10.2135/cropsci2001.1697

Atienza SG, Avila CM, Martin A (2007) The development of a

PCR-based marker for Psy1 from Hordeum chilense, a

candidate gene for carotenoid content accumulation in

tritordeum seeds. Aust J Agric Res 58(8):767–773

Beecher B, Skinner DZ (2011) Molecular cloning and expres-

sion analysis of multiple polyphenol oxidase genes in

developing wheat (Triticum aestivum) kernels. J Cereal Sci

53(3):371–378

Beecher B, Carter A, See D (2012) Genetic mapping of new

seed-expressed polyphenol oxidase genes in wheat (Triti-

cum aestivum L.). Theor Appl Genet 124:1463–1473.

doi:10.1007/s00122-012-1801-2

Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y,

Buckler ES (2007) TASSEL: software for association map-

ping of complex traits in diverse samples. Bioinformatics

23(19):2633–2635. doi:10.1093/bioinformatics/btm308

Castillo A, Ramirez M, Martin A, Kilian A, Martin A, Atienza S

(2013) High-throughput genotyping of wheat-barley am-

phiploids utilising diversity array technology (DArT).

BMC Plant Biol 13(1):87

Constabel CP, Barbehenn RV (2008) Defensive roles of poly-

phenol oxidase in plants. In: Schaller A (ed) Induced plant

resistance to herbivory. Springer, New York, pp 253–269

Demeke T, Morris CF, Campbell KG, King GE, Anderson JA,

Chang HG (2001) Wheat polyphenol oxidase: distribution

and genetic mapping in three inbred line populations. Crop

Sci 41(6):1750–1757

Feillet P, Autran J-C, Icard-Verniere C (2000) Pasta brownness:

an assessment. J Cereal Sci 32(3):215–233. doi:10.1006/

jcrs.2000.0326

Ficco DBM, Mastrangelo AM, Trono D, Borrelli GM, De Vita

P, Fares C, Beleggia R, Platani C, Papa R (2014) The

colours of durum wheat: a review. Crop Pasture Sci

65(1):1–15. doi:10.1071/CP13293

Fuerst EP, Xu SS, Beecher B (2008) Genetic characterization of

kernel polyphenol oxidases in wheat and related species.

J Cereal Sci 48(2):359–368

He XY, He ZH, Zhang LP, Sun DJ, Morris CF, Fuerst EP, Xia

XC (2007) Allelic variation of polyphenol oxidase (PPO)

genes located on chromosomes 2A and 2D and develop-

ment of functional markers for the PPO genes in common

wheat. Theor Appl Genet 115(1):47–58. doi:10.1007/

s00122-007-0539-8

Jimenez M, Dubcovsky J (1999) Chromosome location of genes

affecting polyphenol oxidase activity in seeds of common

and durum wheat. Plant Breed 118(5):395–398. doi:10.

1046/j.1439-0523.1999.00393.x

Jukanti AK, Bruckner PL, Fischer AM (2004) Evaluation of wheat

polyphenol oxidase genes. Cereal Chem 81(4):481–485

Letta T, Maccaferri M, Badebo A, Ammar K, Ricci A, Crossa J,

Tuberosa R (2013) Searching for novel sources of field

resistance to Ug99 and Ethiopian stem rust races in durum

Mol Breeding

123

wheat via association mapping. Theor Appl Genet

126(5):1237–1256. doi:10.1007/s00122-013-2050-8

Li WL, Faris JD, Chittoor JM, Leach JE, Hulbert SH, Liu DJ,

Chen PD, Gill BS (1999) Genomic mapping of defense

response genes in wheat. Theor Appl Genet 98(2):

226–233. doi:10.1007/s001220051062

Mares DJ, Campbell AW (2001) Mapping components of flour

colour in Australian wheat. Aust J Agric Res 52:1297–1309

Marone D, Panio G, Ficco DM, Russo M, Vita P, Papa R, Ru-

biales D, Cattivelli L, Mastrangelo A (2012) Character-

ization of wheat DArT markers: genetic and functional

features. Mol Gen Genomics 287(9):741–753. doi:10.

1007/s00438-012-0714-8

Martin A, Sanchez-Monge Laguna E (1982) Cytology and

morphology of the amphiploid Hordeum chilense 9 Trit-

icum turgidum conv. Durum. Euphytica 31(1):261–267

Massa AN, Beecher B, Morris CF (2007) Polyphenol oxidase

(PPO) in wheat and wild relatives: molecular evidence for a

multigene family. Theor Appl Genet 114:1239–1247

Murray YHG, Thompson WF (1980) Rapid isolation of high

molecular weight plant DNA. Nucl Acids Res 8:4321–4326

Paillard S, Schnurbusch T, Winzeler M, Messmer M, Sourdille

P, Abderhalden O, Keller B, Schachermayr G (2003) An

integrative genetic linkage map of winter wheat (Triticum

aestivum L.). Theor Appl Genet 107(7):1235–1242. doi:10.

1007/s00122-003-1361-6

Pritchard JK, Stephens M, Donnelly P (2000) Inference of

population structure using multilocus genotype data.

Genetics 155(2):945–959

Raman R, Raman H, Johnstone K, Lisle C, Smith A, Matin P,

Allen H (2005) Genetic and in silico comparative mapping

of the polyphenol oxidase gene in bread wheat (Triticum

aestivum L.). Funct Integr Genomics 5(4):185–200. doi:10.

1007/s10142-005-0144-3

Rani KU, Prasada Rao UJS, Leelavathi K, Haridas Rao P (2001)

Distribution of enzymes in wheat flour mill streams.

J Cereal Sci 34(3):233–242. doi:10.1006/jcrs.2000.0393

Rodrıguez-Suarez C, Atienza SG (2012) Hordeum chilense

genome, a useful tool to investigate the endosperm yellow

pigment content in the Triticeae. BMC Plant Biol 12:200.

doi:10.1186/1471-2229-12-200

Rodrıguez-Suarez C, Gimenez MJ, Atienza SG (2010) Progress

and perspectives for carotenoid accumulation in selected

Triticeae species. Crop Pasture Sci 61(9):743–751

Rodrıguez-Suarez C, Atienza SG, Piston F (2011) Allelic vari-

ation, alternative splicing and expression analysis of Psy1

gene in Hordeum chilense Roem. et Schult. PLoS ONE

6(5):e19885

Rodrıguez-Suarez C, Gimenez M, Gutierrez N, Avila C,

Machado A, Huttner E, Ramırez M, Martın A, Castillo A,

Kilian A, Atienza SG (2012) Development of wild barley

(Hordeum chilense)-derived DArT markers and their use

into genetic and physical mapping. Theor Appl Genet

124:713–722. doi:10.1007/s00122-011-1741-2

Rodrıguez-Suarez C, Mellado-Ortega E, Hornero-Mendez D,

Atienza S (2014) Increase in transcript accumulation of

Psy1 and e-Lcy genes in grain development is associated

with differences in seed carotenoid content between durum

wheat and tritordeum. Plant Mol Biol 84(6):659–673.

doi:10.1007/s11103-013-0160-y

Si H, Zhou Z, Wang X, Ma C (2012) A novel molecular marker

for the polyphenol oxidase gene located on chromosome

2B in common wheat. Mol Breed 30(3):1371–1378.

doi:10.1007/s11032-012-9723-x

Sun D, He Z, Xia X, Zhang L, Morris C, Appels R, Ma W, Wang

H (2005) A novel STS marker for polyphenol oxidase

activity in bread wheat. Mol Breed 16(3):209–218. doi:10.

1007/s11032-005-6618-0

Sun Y, He Z, Ma W, Xia X (2011) Alternative splicing in the

coding region of Ppo-A1 directly influences the polyphenol

oxidase activity in common wheat (Triticum aestivum L.).

Funct Integr Genomics 11(1):85–93. doi:10.1007/s10142-

010-0201-4

Taketa S, Matsuki K, Amano S, Saisho D, Himi E, Shitsukawa N,

Yuo T, Noda K, Takeda K (2010) Duplicate polyphenol

oxidase genes on barley chromosome 2H and their functional

differentiation in the phenol reaction of spikes and grains.

J Exp Bot 61(14):3983–3993. doi:10.1093/jxb/erq211

Tran L, Taylor J, Constabel C (2012) The polyphenol oxidase

gene family in land plants: lineage-specific duplication and

expansion. BMC Genom 13(1):1–12. doi:10.1186/1471-

2164-13-395

Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Le-

unissen JAM (2007) Primer3Plus, an enhanced web inter-

face to Primer3. Nucl Acids Res 35:W71–W74

Van Ooijen J (2006) Joinmap 4, Software for the calculation of

genetic linkage maps in experimental populations. Kyazma

B.V., Wageningen

Wang XB, Ma CX, Si HQ, Qiao YQ, Chang C, He XF, Xia YX

(2009) Gene markers for grain polyphenol oxidase activity

in common wheat. Mol Breed 23(1):163–170

Wenzl P, Suchankova P, Carling J, Simkova H, Huttner E,

Kubalakova M, Sourdille P, Paul E, Feuillet C, Kilian A,

Dolezel J (2010) Isolated chromosomes as a new and

efficient source of DArT markers for the saturation of

genetic maps. Theor Appl Genet 121(3):465–474. doi:10.

1007/s00122-010-1323-8

Whitaker J, Lee C (1995) Recent advances in chemistry of

enzymatic browning: an overview. In: Enzymatic brown-

ing and its prevention. ACS symposium series, pp 2–7

Mol Breeding

123