Upload
others
View
7
Download
0
Embed Size (px)
Citation preview
October 2014 1575Biol. Pharm. Bull. 37(10) 1575–1582 (2014)
© 2014 The Pharmaceutical Society of Japan
Regular Article
Polyphenol Extracts from Punica granatum and Terminalia chebula Are Anti-inflammatory and Increase the Survival Rate of Chickens Challenged with Escherichia coliXinlu Zhong,a,# Yaran Shi,a,# Jiajia Chen,a Jianqing Xu,b Lei Wang,a Ross C Beier,c Xiaolin Hou,*,a and Fenghua Liu*,a
a College of Animal Science, Beijing University of Agriculture; Beijing 102206, China: b College of Veterinary Medicine, China Agricultural University; Beijing 100193, China: and c Food and Feed Safety Research Unit, Southern Plains Agricultural Research Center, Agricultural Research Service, United States Department of Agriculture; 2881 R&B Road, College Station, TX 77845, U.S.A.Received February 18, 2014; accepted July 3, 2014
Avian pathogenic Escherichia coli (APEC) causes inflammation in multiple organs of chickens called avian colibacillosis, and results in serious economic loss to the chicken industry. Polyphenolic compounds possess a wide range of physiological activities that may contribute to their beneficial effects against in-flammation-related diseases. In this study, the curative effect and mechanism of action of the polyphenolic extracts from Punica granatum L. and Terminalia chebula RETZ. in chickens challenged with APEC were studied. Specific-pathogen-free white Leghorn chickens (males, 21-d old) were challenged with APEC and then given oral administration of extracts of P. granatum and T. chebula. The extracts decreased the mor-bidity and inflammation induced by APEC. Data from quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay showed that the extracts of P. granatum and T. chebula polyphenols (GCP) reversed the over-expression genes of the Toll-like receptor (TLR) 2, 4, and 5, down-regulated the activation of nuclear factor-kappa B signal transduction pathways, and inhibited the production of pro-inflammatory cytokines. Naturally occurring GCP may be a potential alternative medicine for the prevention or treatment of avian colibacillosis.
Key words polyphenol; Escherichia coli; specific-pathogen-free chick; anti-inflammatory
Avian pathogenic Escherichia coli (APEC)1) are E. coli strains that can cause acute and predominant systemic coli-bacillosis in birds. Avian colibacillosis is a complex syndrome characterized by multiple organ lesions with airsacculitis and associated pericarditis, perihepatitis and with peritonitis being most typical; and the additional diseases, septicaemia, chronic respiratory disease, vitellus infection, salpingitis, peritoni-tis, chronic skin infections, and osteomyelitis,2) and swollen head syndrome3) are usually involved. APEC is found in the intestinal microflora of healthy birds and most of the diseases associated with them result from environmental and host pre-disposing factors. APEC strains cause invasive infection in chickens, and more specifically in broilers. Diseases resulting from APEC decrease growth rate, increase mortality and mor-bidity, and cause significant economic losses in the poultry industry.2) APEC also can be transmitted to other animals or even humans by certain vectors, and can be a human health risk.3,4)
At present, the approach for the prevention and control of APEC infections include the control of environmental contam-ination and environmental parameters such as humidity and ventilation. Vaccines containing killed or attenuated virulent bacteria protect against infection with the homologous strain, but are less efficient against heterologous strains. Therefore, vaccination for colibacillosis is not widely practiced due to the large variety of strains involved in field outbreaks.1) Chemical drugs (antibiotics) are widely used, but antimicrobial com-pounds often eradicate intestinal commensal bacteria as well as pathogenic bacteria. The increasing antibiotic resistance
makes the use of antibiotic treatments less effective.5,6) As a result, the potential drug residues in livestock and poultry caused by the high use of antibiotics threaten the safety of our food supply.4) Thus, it is highly desirable to find alternative ways to control APEC.
Pomegranate (Punica granatum L.) and fruit of the Harītakī deciduous tree (Terminalia chebula RETZ.) are used in tradi-tional herbal Chinese medicine, and are used as an intestine astringent to relieve diarrhea and enteritis. P. granatum contains a wide range of phytochemicals which are primar-ily polyphenols.7) Studies have shown that activity of peel extracts of P. granatum is related to the polyphenol content.8) The polyphenols found in P. granatum have been shown to exert anti-inflammatory, antioxidant, and anticarcinogenic activity,9–11) and promote wound healing.12,13) Extracts of P. granatum were effective at protecting human skin fibroblast from cell death following UV exposure, which was related to reduced activation of the pro-inflammatory transcription fac-tor nuclear factor-kappa B (NF-κB).14) Extracts of P. granatum were also a potent inhibitor of a number of bacteria, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, Yer-sinia enterocolitica, and Salmonella enteritidis,8) and may be used to control various bacteria associated with oral infections in humans.15) The pharmacological effects of pomegranate have been known for a very long time and were mentioned in Greek and Egyptian documents.16,17) Terminalia chebula RETZ. has been used for its healing properties throughout the ages in India and South-East Asia, and is anti-inflammatory, antioxi-dant, antimicrobial, and has demonstrated wound healing ac-tivity.18) The fruits of T. chebula are rich in tannins, phenolics, and polyphenols, which are related to the antigenotoxic and chemopreventive activities of T. chebula.19,20)
* To whom correspondence should be addressed. e-mail: [email protected]; [email protected]
The authors declare no conflict of interest.# These authors contributed equally to this work.
1576 Vol. 37, No. 10
APEC invades Birds primarily by damaging the intestine mucosa, which induces regional inflammation. Activation of the Toll-like receptor (TLR) signaling pathway plays an important role in defense against invading pathogens.21) The TLR pathway strongly potentiates NF-κB activity and induces enhanced levels of the innate immune response.22) However, the over-activation of the TLR pathway may cause it to break out of immune equilibrium and lead to injury of the host. Therefore, the TLR pathway activation must be controlled within a certain range. In the present study, the polyphenols from P. granatum and T. chebula modulation of TLR/NF-κB signaling and pro-inflammatory mechanism was investigated in specific-pathogen-free (SPF) chickens following challenge with APEC.
MATERIALS AND METHODS
The experimental procedures involving animals in this study were approved by the Animal Care Center of the Beijing University of Agriculture, Beijing, China.
Reagents and Materials P. granatum and T. chebula were purchased from the Tongrentang Traditional Chinese Medicine Shop (Beijing, China). Folin-Ciocalteau reagent was procured from Sigma Chemical (Beijing, China). Other reagents were all analytical grade and from Beijing Chemical Reagents Co. (Beijing, China)
APEC (serotype O2 : K1) and O2 Serotype monoclonal-antibody were obtained from the China Institute of Veterinary Drug Control (Beijing, China). Nutrient broth, nutrient agar, MacConkey aga, Eosin methylene blue agar and other bio-chemical test tubes were obtained from the Beijing Aoboxing Bio-tech Co., Ltd. (Beijing, China).Interleukin (IL)-1β and tumor necrosis factor (TNF)-α
enzyme-linked immunosorbent assay (ELISA) kits were obtained from Wuhan Cusabio Biotech. Co., Ltd. (Wuhan, China). Primers were synthesized by the Shanghai Shengong Bioengineering Co., Ltd. (Shanghai, China).Twenty one-day old SPF male white Leghorn chickens
were obtained from the Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (Beijing, China). The chickens were maintained under clean conditions in wire cages and were given access to water and feed ad libitum. The birds did not receive any vaccination. The feed for the chickens were obtained from Keaoxieli Feedstuff Co., Ltd. (Beijing, China). Basal diet nutrition was as follwoings: corn 62.05%, wheat bran 2%, soybean meal 17.7%, rapeseed meal 5%, cottonseed meal 2%, calcium bicarbonate 0.75%, limestone powder 9.2%, salt 0.3%; metabolic energy 2561 KJ/kg, crude protein 15.7%, calcium 3.49%, total phosphorus 0.49%, lysine 0.691%, me-thionine 0.256%, methionine+cysteine 0.549%.
Inoculum Preparation A small quantity of the APEC freeze-dried powder was added in nutrient broth, and incu-bated at 37°C for 24 h with agitation for recovery. Then the culture was harvested by centrifugation at 5000×g for 10 min and the cell pellets were re-suspended in phosphate-buffered saline (PBS), pH 7.0. The number of bacteria in these solu-tions was determined by plate counting 1 : 10 serial dilution suspensions on nutrient agar plates. The titer was expressed as cfu/mL.
Preparation of Polyphenol Extract from Punica grana-tum L. and Terminalia chebula RETZ. Briefly, extracts of
P. granatum and T. chebula polyphenols (GCP, 1 : 1, g/g) were prepared by mechanically grinding air-dried plant material to a fine powder. The powder was extracted twice with 10× volumes of ethanol–water (60 : 40, v/v) at 40°C for 10 h. The twice extract was centrifuged 2000×g for 10 min, and the supernatant was rotatorily evaporated to near dryness under decreased-pressure at 40°C and freeze-dried. The extracted dried material was stored in dark bottle until use.
Polyphenol Assay for the Extract Polyphenol content was determined according to the method of Anesini et al.23) Briefly, 5.0 mL of the sample extract dissolved in water–methanol (80 : 20, v/v) was transferred in duplicate to separate tubes containing 1.0 mL of a 20% Folin–Ciocalteu’s reagent in water. Then, 4.0 mL of a sodium carbonate solution (7.5% w/v) was added. The tubes were allowed to stand at room tempera-ture for 60 min. Then the absorbance was measured at 760 nm against water. The total polyphenol content was expressed as gallic acid equivalents in g/g dried material. The concentra-tion of polyphenols in samples was calculated from a standard curve of gallic acid ranging from 10 to 50 µg/mL (Pearson’s correlation coefficient: r2=0.9998).
Toxicity Effect of the GCP Extract on SPF Chick-ens Twenty four chickens were provided water and feed ad libitum. At 28-d of age, they were randomly divided into 4 groups. The treatment lasted for seven days for each group: (1) the control (C): the birds were daily given sterile saline by oral gavage; (2) clinical dose of the GCP extract treatment (1×): birds were received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.3 g/kg body weight (BW); (3) 3 times of clinical dose of the GCP extract treatment (3×): birds were received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.9 g/kg BW; (4) 5 times of clinical dose of the GCP extract treat-ment (5×): birds were received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 1.5 g/kg BW. On the 8th day, all birds were sacrificed. the GCP toxicity was assessed by autopsy, histological examination and blood biochemical index.
Effects of the GCP Extract on Survival Rate of Chick-ens Challenged with APEC At 28-d of age, the 150 chick-ens were randomly divided into five groups according to treatment; all groups received treatment for 7 d at 8:00 pm by controlled oral intake using syringe delivery of saline or the GCP extract. During the experimental period, the birds were provided water and feed ad libitum. The chickens were divided into the following groups. (1) Negative control (NC): the birds received standard water and feed ration, and were daily given sterile saline by oral gavage during the course of the experiment. (2) Positive control (PC): birds were injected in the abdomen with 200 µL of an aqueous APEC solution at a concentration of 2×109 colony forming unit (cfu)/mL at the beginning of the experiment. 12 h after challenge, and each following day the birds received an oral gavage of sterile sa-line at a dose of 0.3 mL/kg BW for seven consecutive day; (3) PC plus a low dosage of the GCP extract treatment (PC+LT): birds were administered APEC as was the PC, and 12 h after challenge the birds received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.15 g/kg for seven consecutive day; (4) PC plus a medium dosage of the GCP extract treatment (PC+MT): birds were administered APEC as was the PC, and 12 h after challenge the birds re-
October 2014 1577
ceived a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.3 g/kg BW for seven consecutive day; (5) PC plus a high dosage of the GCP extract treatment (PC+HT): birds were administered APEC as the PC, and 12 h after challenge the birds received a daily oral gavage of the GCP extract dissolved in distilled water at a dose of 0.6 g/kg BW for seven consecutive day. The mortality rate for each group was carried out at day 8.
The Anti-inflammatory Effect of APEC Infected Chick-ens Treated with GCP Fifty-four chickens at 28 d of age were divided equally into three groups and provided water and feed ad libitum. (1) Negative control (NC), the birds re-ceived daily oral gavage of sterile saline at a dose of 0.3 mL/kg BW. (2) Positive control (P), animals were injected in the abdomen with 200 µL of an aqueous solution of APEC at a concentration of 8×108 cfu/mL at the beginning of the experi-ment. Twelve hours after challenge, the birds received a daily oral gavage of sterile saline at a dose of 0.3 mL/kg BW. (3) Positive control plus treatment (P+T): birds were administered APEC as was the P, and beginning 12 h after challenge, the birds received a daily oral gavage of the GCP extract dis-solved in distilled water at dose of 0.3 g/kg BW.At 24, 72, and 120 h post-challenge, six birds were ran-
domly chosen from each group. The birds were anesthetized and sacrificed by jugular exsanguination. Approximately 2 cm of ileum intestinal sections were collected under sterile condi-tions. Samples were stored at –80°C until analyzed by poly-merase chain reaction (PCR) and ELISA.
Total RNA Extraction, Reverse-Transcription and Quan-titative Real-Time PCR The ileum intestinal tissue was homogenized, and the total RNA was isolated from each ho-mogenized tissue sample using the TRIzol extraction method as described by the manufacturer (Invitrogen, Beijing, China). The total RNA was quantitated using an ND-1000 spectropho-tometer by determining the 260 nm/280 nm absorbance ratio (NanoDrop Technologies, Wilmington, DE, U.S.A.).cDNA used for quantitative real-time PCR (QRT-PCR) as-
says was synthesized from 2 µg of purified RNA by using 50 ng of random hexamers and the SuperScript II first-strand
cDNA synthesis kit according to the instructions of the manufacturer (Invitrogen, Beijing, China). Briefly, A 20 µL reaction mixture contained 2 µg of total RNA, 0.5 µg of oligo dT primer (16–18 mer), 40 U of RNasin, 1000 µM of deoxy-ribonucleotide triphosphate mix, 10 mM of dithiothreitol, and 5 U of Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega Biotech Co., Ltd., Beijing, China) in 1× reverse transcriptase buffer. The reaction mixture was in-cubated at 37°C for 1 h.All primers for genes encoding for TLR4, NF-κB1(p50),
IL-1β, IL-8, TNF-α, intercellular adhesion molecule 1 (ICAM1) and vascular cell adhesion molecule 1 (VCAM-1) were designed using Primer premier 5.0 and the DNAMAN software program using sequences acquired from GenBank. The specificity of the designed primers was initially examined by comparison of the primers with sequences in the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) through BLAST analysis, and then experimentally verified through PCR assays. The PCR conditions for each target gene were optimized, and the optimal conditions are listed in Table 1.QRT-PCR assays were performed on an Applied Biosys-
tems ABI 7500 Real-Time PCR System (Thermo Fisher Sci-entific, Waltham, MA, U.S.A.) with Brilliant II SYBR Green QPCR Master Mix (Stratage, Beijing, China). cDNA was diluted 10-fold, and 1 µL of each diluted cDNA sample was added to a 25 µL reaction mixture containing 12.5 µL of Bril-liant SYBR Green QPCR master Mix, 150 nM (each) primers, and 0.375 µL ROX reference dye. Cycling parameters were as follows: an initial denaturation at 95°C for 10 min; 40 cycles of 30 s at 94°C, 1 min at the annealing temperature of 58°C, and extension for 0.5 min at 72°C. The conditions used for the dissociation curves were as follows: 95°C for 1 min, 55°C for 30 s, and 95°C for 30 s.
Validation of the Expression for IL-1β and TNF-α Using ELISA Analysis To further validate the PCR data, an ELISA method was used to determine IL-1β and TNF-α.
Statistical Analysis The results are presented as the mean with the standard error (S.E.). The data were analyzed using GraphPad Prism 5 software to determine the significant dif-
Table 1. PCR Primers
Gene Accession number Primer sequence 5′→3′ Product length (bp)
β-Actin NM_205518 F: ACGTCTCACTGGATTTCGAGCAGG 298R: TGCATCCTGTCAGCAATGCCAG
NF-κB1 NM_205134 131 F: GAAGGAATCGTACCGGGAACA 131R: CTCAGAGGGCCTTGTGACAGTAA
TLR2 XM_003641159.1 F: CATTCACCATGAGGCAGGGATAG 157R: GGTGCAGATCAAGGACACTAGGA
TLR4 NM_001030693 F: TGCACAGGACAGAACATCTCTGGA 347R: AGCTCCTGCAGGGTATTCAAGTGT
TLR5 NM_001024586.1 F: TCCATCCTGGAGGAGCGTTA 260R: GGGCATTTGGCCCAGATCAT
IL-1β NM_204524.1 F: TGGGCATCAAGGGCTACAAG 267R: TGTAGGTGGCGATGTTGACC
TNF-α NM_204267.1 F: TGTGTATGTGCAGCAACCCGTAGT 229R: GGCATTGCAATTTGGACAGAAGT
ICAM-1 M_003642866.2 F: CCATACACATTGCGCTGCTC 170R: TCTACCACATCCTCCCCTGG
VCAM-1 M_004936551.1 F: CTGACTCGGGGCAGTACATC 228R: GGGTTGTGACCACATCACCT
1578 Vol. 37, No. 10
ference. The t-test values of less than 0.05 were considered statistically significant.
RESULTS
APEC infections were validated based on the clinical mani-festation of signs, pathologic examination, and isolation of E. coli. All E. coli strains were isolated from the liver surface of debilitated or dead chickens. The colony characteristics of the isolated strains were observed on MacConkey agar and Eosin methylene blue agar plates, and biochemical tests and serotype confirmed that these were confirmed to be APEC strains.
Extract Yield and Polyphenols Content Previous study showed that Punica granatum L. and Terminalia chebula RETZ contained relative higher polyphenolic substance.8,19,24) In this work, we extracted the polyphenols using water–ethanol solu-tion, and obtained a 33% yield of extracted dried material. The total phenolic content was determined at 28% calculated as gallic acid equivalents in dried extract material.
The GCP Extract Showed No Toxicity on SPF Chickens To assess the toxicity, the mental status, food intake and other behavior for the chickens from four groups were investigated in the whole experiment. The GCP toxicity was further diag-nosed at the 8th day by the means of autopsy, pathological ex-
amination, and biochemical test. After hematoxylin and eosin (HE) staining, the liver, kidney, lung histopathology were investigated under light microscopy. The results indicated that all the groups were normal; the representative histopathology of liver, kidney, and lung from the control and the highest dosage group (5×) was shown in Fig. 1. The blood chemistry indexes were shown in Table 2, which were no significant difference between the control group and the three GCP treat-ment groups. The present results indicate that GCP, under the dosage, was non-toxicity under the described experimental conditions.
The GCP Extract Increased the Survival Rate of Chick-ens Challenged with APEC Strains In this study, the GCP extract curative effect on APEC signs in SPF chickens was initiated using an APEC challenge dose equivalent to a 40% SPF chicken survival rate. The study demonstrated that the GCP extract alleviated the state of illness and prevented the mortality of chickens challenged with APEC. APEC caused acute systemic infection and inflammation. Chickens in each group began to die about 24 h after challenge, but the mortal-ity of the APEC positive control group was higher than the other GCP extract treated groups. The spiritual status and ill signs showed a significant improvement in a dose-dependent relationship. The bird survival rates in the GCP treated
Fig. 1. The Presentative Histopathology of the Control and the Highest Dose Group (5×) (HE, 200×)The above was the control, and the bottom was the highest dose group. From left to right, the tissues were liver, kidney, and lung, respectively.
Table 2. Blood Biochemical Index of the GCP Extract on SPF Chickens
Groups ALT (U/L) AST (U/L) BUN (mmol/L) UA (umol/L)
C 4.00±2.10 225.0±42.05 0.43±0.10 188.17±12.371× 3.67±1.03 235.0±18.25 0.40±0.09 192.83±45.523× 3.33±1.03 265.0±43.51 0.32±0.04 197.83±63.395× 4.67±1.86 262.5±33.39 0.37±0.08 170.83±25.54
Table 3. Survival Rate of Infected Chickens in Different Groups (n=30)
NC PC PC+LT PC+MT PC+HT
Daily weight gain (g) 14.49±2.05a 7.00±3.26c 12.68±2.29ab 11.57±2.26b 11.62±2.26b
Feed conversion 2.13±0.13c 3.02±0.48a 2.63±0.36b 2.24±0.27c 2.07±0.20c
Survival rate (%) 100 36.67 43.33 53.33 60.00
The difference was significant among different alphabets (p>0.05).
October 2014 1579
groups were shown in Table 3. When the GCP extract dosage increased from 0.15 g/kg to 0.6 g/kg BW, the survival rate in-creased from 43.3% to 60%. This effect was attributed to the GCP extract used to treat the chickens.
The GCP Extract Inhibited TLR2, 4, and 5 Expres-sion and the Activation of NF-κB in Chickens Challenged with APEC The TLR family is a highly conserved group of proteins that participate in pathogen recognition and in the initiation and regulation of the innate and adaptive immune responses. In this study, as shown in Fig. 2, the control group intestinal tissue expressed a baseline response for TLR2, 4, and 5, and NF-κB; whereas, the APEC challenge stimu-lated the expression of the TLRs and the activation of NF-κB (p<0.05). The GCP extract inhibited the over-expression of the TLRs and activation of NF-κB to APEC (p<0.05).
GCP Extracts Decreased the Inflammatory Cytokine Concentration in Chicken Intestinal Tissue Following APEC Challenge The mRNA expression of genes encoding for the cytokines, TNF-α, IL-1β, IL-8, ICAM1, and VCAM1 in intestinal tissues were measured by QRT-PCR. The cyto-kines were expressed in the intestinal tissue of the negative chicken group, and were significantly enhanced in response to APEC challenge (p<0.05). The expression levels of the cyto-kines decreased at all three time points after receiving GCP treatment (Fig. 3).The gene expression end-products, IL-1β and TNF-α, were
further validated using an ELISA, the two different types of data were relatively consistent. As shown in Fig. 4, IL-1β and TNF-α in the positive control group both increased post-challenge, while treatment with GCP extracts inhibited the over-expression of the pro-inflammatory cytokines.
DISCUSSION
The extractable chemical constituents of Punica grana-tum L. and Terminalia chebula RETZ. belong mainly to the polyphenols. The polyphenol content is 25–30% in P. grana-tum, and 23–37% in T. chebula RETZ.24) Their extracts have shown multiple pharmacological activities, such as antimi-crobial,8,15,25) cardiac action, antioxidant,11,26) antitumor,10,27,28) antiviral,29) and the promotion of wound healing.12,13)
The intestinal tract contains the largest reservoir of bacteria and endotoxins in an animal’s body. The intestinal tissue is the first line of defense against invading microbial pathogens. Intestinal bacterial infection can lead to lower growth rate, disease and even death. APEC strains are the first pathogens associated with digestive tract diseases in poultry production. The infected tissues respond to APEC infection by producing pro-inflammatory cytokines to combat the invading APEC strains.
In this research, intraperitoneal injection of APEC was used,30) following a high challenge dose of APEC (2×109), the occurrence of death in infected chickens decreased following treatment by the GCP extract in a dose-dependent manner. For studying the pharmacological action mechanism of the GCP extract, the APEC challenge dose used was 8×108. This dos-age caused chickens 100% morbidity without mortality. The advantage of this dosage ensured a good consistency between samples. The GCP toxicity of 1, 3, 5 times of clinical dose and consecutive administration of drug for 21 d on SPF chicken was previously tested, and the results showed that GCP had no affect on survival rate, blood biochemistry, histopathology. So we did not set the GCP control group in the study.
TLRs play an important role in the intestinal innate im-mune system initially in helping the intestinal tract recognize
Fig. 2. The Relative Expression Levels of the Genes Coding for TLR2, 4, and 5, and NF-κBDifferent letters, a and b, indicate differences between groups at p<0.05.
1580 Vol. 37, No. 10
bacteria. TLR2, 4, and 5 participate in the innate immune response to APEC and the development of enteritis.21,31) TLRs not only are immune recognition receptors on the cell surface, but also are transmembrane signal transduction molecules. TLR stimulation by pathogen-associated molecular patterns (PAMPs) with subsequent changes in the cytokine profile are major components of innate immunity,32) which are major in-teractions involved in the innate resistance to Gram-negative
bacteria, but also in the pathogenesis of septic shock. TLR 2, 4, and 5 recognize APEC strains,33,34) TLR 2, 4, 5, respective-ly identify bacterial teichoic acid, LPS and flagellin. But inac-tive Escherichia coli induce TLR 2 and 4.35) In the process of Escherichia coli pathogen, LPS and other ingredients together help initiate the pro-inflammatory cytokines.21,36)
TLRs initiate a series of signal transduction intermediators and activate NF-κB to induce the production of pro-inflamma-
Fig. 3. The Relative mRNA Expression Levels of the Cytokine GenesDifferent letters, a and b, indicate differences between groups at p<0.05.
Fig. 4. IL-1β and TNF-α Levels of Intestine TissueDifferent letters, a and b, indicate differences between groups at p<0.05.
October 2014 1581
tory cytokines. NF-κB activation is essential for the expres-sion of a variety of cytokines.22) In the study, Escherichia coli induced expression of TLR 2, 4, 5 in various degrees. TLR4 was firstly induced, and reached peak at the third day, recov-ered close to normal at the fifth day. TLR2, TLR5 expressions were later induced, and kept higher at the fifth day. NF-κB1 (p50) was jointly induced by TLR2, 4, and 5, and partly re-covered at the fifth day. It indicated TLRs-NF-κB pro-inflam-mation pathway was activated in the course of the disease. The GCP treatment significantly reversed the over-expression of TLR2, 4, 5, and NF-κB1 (p50).Although TLR-mediated signaling is paramount in eradicat-
ing microbial infections and promoting tissue repair, the regu-lation must be tight. TLRs-NF-κB signal pathway induces the transcription and translation of pro-inflammatory cytokines, which leads to the massive release of inflammatory cytokines and adhesion molecules, including TNF-α, IL-1β, IL-6, IL-8. ICAM1, VCAM1, and promote the proliferation of epithelial cells and inhibit intestinal bacterial translocation.37)
However, over-production of cytokines can cause impair-ment to the host. Macrophages and monocytes secreted pro-inflammatory cytokines like TNF-α, IL-1β, and IL-8 fol-lowing the bacteria infectious stimulation. These cytokines activated inflammatory cells like neutrophils, macrophages, and monocytes released large amounts of the toxic oxidizing radicals, the result caused organ injury via the peroxidation of membrane lipids and the oxidative damage of proteins and DNA, further led to augment of local tissue injury.38) TNF-α and IL-1β are thought to be relative pro-cytokines can trigger the inflammatory cascade and induce other cells to produce other cellular factors. Blocking the production of these cyto-kines by receptor antagonists inhibits the previous mentioned diseases. In local regions, these molecules lead to apoptosis of intestinal mucosal epithelial cells and damage organs and tis-sues of the intestinal tract. Cytokines can also act on distant organs and amplify systemic inflammatory reactions.31) Com-pared to wild-type mice, intestinal epithelial damage caused by colitis was milder in TLR4-deficient mice.39,40) Expression of NF-κB might contribute to the ureter damage observed in obstructive uropathy, and inhibition of NF-κB could attenu-ate the tissue damage of obstructed ureters.41) VCAM-1 and ICAM-1 participate in firm adhesion of leukocytes to endo-thelial cells, which are secreted by endothelial cells activated by proinflammatory factors and are thought to play a central role in the development of tissue inflammation. Inflammation can induce VCAM-1 and ICAM-1, cause local thrombosis, and thrombosis can amplify inflammation.42)
In the study, TNF-α, IL-1β, IL-8, VCAM-1, and ICAM-1 were all induced by Escherichia coli challenge, The over-expressioned cytokines indicated that the chickens were in an inflammatory reaction status, while the down-regulation of these inflammatory by administration of the GCP extract may partly explain the beneficial anti-inflammatory and antithrom-botic effects, which exhibited protection of intestinal tissue in APEC infected chickens.
In summary, APEC infection elevated levels of TLR2, 4, and 5, induced the activation of NF-κB and enhanced the pro-duction of TNF-α, IL-1β, and other cytokines in chickens. The GCP extract treatment inhibited the TLRs/NF-κB signaling pathway, and down-regulated the production of TNF-α, IL-1β, IL-8, ICAM1, and VCAM1. The treatment exerted an anti-
inflammatory action, and resulted in the decreased mortality rate after challenge with APEC strains.
Acknowledgments This work was supported by Grants from the National Natural Science Foundation of China (31272478, 31372485), the National Twelve-Five Techno-logical Supported Plan of China (2011BAD34B01), and the Public Service Sectors Agriculture Research Projects (201003060–9/10).
REFERENCES
1) Dho-Moulin M, Fairbrother JM. Avian pathogenic Escherichia coli (APEC). Vet. Res., 30, 299–316 (1999).
2) Barnes HJ, Gross WB. Colibacillosis. Diseases of poultry. 10th ed. (Barnes HJ, Beard CW, Calnek BW eds.) Iowa State University Press, Ames, pp. 131–141 (1997).
3) White DG, Wilson RA, Gabriel AS, Saco M, Whittam TS. Genetic relationships among strains of avian Escherichia coli associated with swollen-head syndrome. Infect. Immun., 58, 3613–3620 (1990).
4) Doyle MP, Erickson MC. Reducing the carriage of foodborne patho-gens in livestock and poultry. Poult. Sci., 85, 960–973 (2006).
5) Angst DC, Hall AR. The cost of antibiotic resistance depends on evolutionary history in Escherichia coli. BMC Evol. Biol., 13, 163–170 (2013).
6) Witte W. Antibiotic resistance. Int. J. Med. Microbiol., 303, 285–286 (2013).
7) Galego LR, Jockusch S, Da Silva JP. Polyphenol and volatile profiles of pomegranate (Punica granatum L.) fruit extracts and liquors. Int. J. Food Sci. Technol., 48, 693–700 (2013).
8) Al-Zoreky NS. Antimicrobial activity of pomegranate (Punica gra-natum L.) fruit peels. Int. J. Food Microbiol., 134, 244–248 (2009).
9) Kawaii S, Lansky EP. Differentiation-promoting activity of pome-granate (Punica granatum) fruit extracts in HL-60 human promy-elocytic leukemia cells. J. Med. Food, 7, 13–18 (2004).
10) Afaq F, Saleem M, Krueger CG, Reed JD, Mukhtar H. Anthocy-anin- and hydrolyzable tannin-rich pomegranate fruit extract modu-lates MAPK and NF-kappaB pathways and inhibits skin tumorigen-esis in CD-1 mice. Int. J. Cancer, 113, 423–433 (2005).
11) Seeram NP, Adams LS, Henning SM, Niu Y, Zhang Y, Nair MG, Heber D. In vitro antiproliferative, apoptotic and antioxidant activi-ties of punicalagin, ellagic acid and a total pomegranate tannin ex-tract are enhanced in combination with other polyphenols as found in pomegranate juice. J. Nutr. Biochem., 16, 360–367 (2005).
12) Murthy KNC, Reddy VK, Veigas JM, Murthy UD. Study on wound healing activity of Punica granatum peel. J. Med. Food, 7, 256–259 (2004).
13) Hayouni EA, Miled K, Boubaker S, Bellasfar Z, Abedrabba M, Iwaski H, Oku H, Matsui T, Limam F, Hamdi M. Hydroalcoholic extract based-ointment from Punica granatum L. peels with en-hanced in vivo healing potential on dermal wounds. Phytomedicine, 18, 976–984 (2011).
14) Pacheco-Palencia LA, Noratto G, Hingorani L, Talcott ST, Mertens-Talcott SU. Protective effects of standardized pomegranate (Punica granatum L.) polyphenolic extract in ultraviolet-irradiated human skin fibroblasts. J. Agric. Food Chem., 56, 8434–8441 (2008).
15) Abdollahzadeh Sh, Mashouf R, Mortazavi H, Moghaddam M, Roozbahani N, Vahedi M. Antibacterial and antifungal activities of Punica granatum peel extracts against oral pathogens. J. Dent. (Tehran), 8, 1–6 (2011).
16) Braga LC, Shupp JW, Cummings C, Jett M, Takahashi JA, Carmo LS, Chartone-Souza E, Nascimento AM. Pomegranate extract in-hibits Staphylococcus aureus growth and subsequent enterotoxin production. J. Ethnopharmacol., 96, 335–339 (2005).
17) Reddy MK, Gupta SK, Jacob MR, Khan SI, Ferreira D. Antioxi-
1582 Vol. 37, No. 10
dant, antimalarial and antimicrobial activities of tannin-rich frac-tions, ellagitannins and phenolic acids from Punica granatum L. Planta Med., 73, 461–467 (2007).
18) Bag A, Bhattacharyya SK, Chattopadhyay RR. The development of Terminalia chebula RETZ. (Combretaceae): in clinical research. Asian Pac. J. Trop. Biomed., 3, 244–252 (2013).
19) Pfundstein B, El Desouky SK, Hull WE, Haubner R, Erben G, Owen RW. Polyphenolic compounds in the fruits of Egyptian me-dicinal plants (Terminalia bellerica, Terminalia chebula and Termi-nalia horrida): characterization, quantitation and determination of antioxidant capacities. Phytochemistry, 71, 1132–1148 (2010).
20) Pellati F, Bruni R, Righi D, Grandini A, Tognolini M, Pio Prencipe F, Poli F, Benvenuti S, Del Rio D, Rossi D. Metabolite profiling of polyphenols in a Terminalia chebula RETZIUS ayurvedic decoction and evaluation of its chemopreventive activity. J. Ethnopharmacol., 147, 277–285 (2013).
21) Munyaka PM, Tactacan G, Jing M, O K, House JD, St. Paul M, Sharif S, Rodriguez-Lecompte JC. Response of older laying hens to an Escherichia coli lipopolysaccharide challenge when fed diets with or without supplemental folic acid. Poult. Sci., 92, 105–113 (2013).
22) Luo H, Guo P, Zhou Q. Role of TLR4/NF-kappaB in damage to intestinal mucosa barrier function and bacterial translocation in rats exposed to hypoxia. PLoS ONE, 7, e46291 (2012).
23) Anesini C, Ferraro GE, Filip R. Total polyphenol content and anti-oxidant capacity of commercially available tea (Camellia sinensis) in Argentina. J. Agric. Food Chem., 56, 9225–9229 (2008).
24) Reddy BM, Rao NK, Ramesh M, Rao AVN, Lin LJ, Lin LZ, Cordell GA. Chemical investigation of the fruits of Terminalia che-bula. Pharm Biol., 32, 352–356 (1994).
25) Choi JG, Kang OH, Lee YS, Chae HS, Oh YC, Brice OO, Kim MS, Sohn DH, Kim HS, Park H, Shin DW, Rho JR, Kwon DY. In vitro and in vivo antibacterial activity of Punica granatum peel ethanol extract against Salmonella. Evid. Based Complement. Alternat. Med., 2011, 690518 (2011).
26) Kaur G, Jabbar Z, Athar M, Alam MS. Punica granatum (pome-granate) flower extract possesses potent antioxidant activity and abrogates Fe-NTA induced hepatotoxicity in mice. Food Chem. Toxicol., 44, 984–993 (2006).
27) Lin CC, Hsu YF, Lin TC. Effects of punicalagin and punicalin on carrageenan-induced inflammation in rats. Am. J. Chin. Med., 27, 371–376 (1999).
28) Sineh Sepehr K, Baradaran B, Mazandarani M, Khori V, Shahneh FZ. Studies on the cytotoxic activities of Punica granatum L. var. spinosa (apple punice) extract on prostate cell line by induction of apoptosis. ISRN Pharmaceutics, 2012, 547942 (2012).
29) Biasi F, Astegiano M, Maina M, Leonarduzzi G, Poli G. Polyphenol supplementation as a complementary medicinal approach to treat-ing inflammatory bowel disease. Curr. Med. Chem., 18, 4851–4865 (2011).
30) Li J, Li D. Study on the broilers model infected with E. coli. and its pathological indexes. China Poultry, 28, 12–15 (2006).
31) Fukata M, Michelsen KS, Eri R, Thomas LS, Hu B, Lukasek K,
Nast CC, Lechago J, Xu R, Naiki Y, Soliman A, Arditi M, Abreu MT. Toll-like receptor-4 is required for intestinal response to epi-thelial injury and limiting bacterial translocation in a murine model of acute colitis. Am. J. Physiol. Gastrointest. Liver Physiol., 288, G1055–G1065 (2005).
32) Manicassamy S, Pulendran B. Modulation of adaptive immunity with Toll-like receptors. Semin. Immunol., 21, 185–193 (2009).
33) Bambou JC, Giraud A, Menard S, Begue B, Rakotobe S, Heyman M, Taddei F, Cerf-Bensussan N, Gaboriau-Routhiau V. In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epi-thelial cells by a commensal Escherichia coli strain. J. Biol. Chem., 279, 42984–42992 (2004).
34) Gilbert FB, Cunha P, Jensen K, Glass EJ, Foucras G, Robert-Granie C, Rupp R, Rainard P. Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli ago-nists of the innate immune system. Vet. Res., 44, 40 (2013).
35) Yang W, Zerbe H, Petzl W, Brunner RM, Gunther J, Draing C, von Aulock S, Schuberth HJ, Seyfert HM. Bovine TLR2 and TLR4 properly transduce signals from Staphylococcus aureus and E. coli, but S. aureus fails to both activate NF-kappaB in mammary epithelial cells and to quickly induce TNFalpha and interleukin-8 (CXCL8) expression in the udder. Mol. Immunol., 45, 1385–1397 (2008).
36) Kogut MH, He H, Kaiser P. Lipopolysaccharide binding protein/CD14/ TLR4-dependent recognition of Salmonella LPS induces the functional activation of chicken heterophils and up-regulation of pro-inflammatory cytokine and chemokine gene expression in these cells. Anim. Biotechnol., 16, 165–181 (2005).
37) Wullaert A. Role of NF-kappaB activation in intestinal immune homeostasis. Int. J. Med. Microbiol., 300, 49–56 (2010).
38) Feihl F, Waeber B, Liaudet L. Is nitric oxide overproduction the target of choice for the management of septic shock? Pharmacol. Ther., 91, 179–213 (2001).
39) Heimesaat MM, Fischer A, Siegmund B, Kupz A, Niebergall J, Fuchs D, Jahn HK, Freudenberg M, Loddenkemper C, Batra A, Lehr HA, Liesenfeld O, Blaut M, Gobel UB, Schumann RR, Bereswill S. Shift towards pro-inflammatory intestinal bacteria ag-gravates acute murine colitis via Toll-like receptors 2 and 4. PLoS ONE, 2, e662 (2007).
40) Ohkawara T, Takeda H, Nishihira J, Miyashita K, Nihiwaki M, Ishiguro Y, Takeda K, Akira S, Iwanaga T, Sugiyama T, Asaka M. Macrophage migration inhibitory factor contributes to the develop-ment of acute dextran sulphate sodium-induced colitis in Toll-like receptor 4 knockout mice. Clin. Exp. Immunol., 141, 412–421 (2005).
41) Chuang YH, Chuang WL, Huang SP, Liu CK, Huang CH. Inhibi-tion of nuclear factor-kappa B (NF-κB) activation attenuates ure-teric damage in obstructive uropathy. Pharmacol. Res., 60, 347–357 (2009).
42) Ryu M, Kim EH, Chun M, Kang S, Shim B, Yu YB, Jeong G, Lee JS. Astragali Radix elicits anti-inflammation via activation of MKP-1, concomitant with attenuation of p38 and Erk. J. Ethnophar-macol., 115, 184–193 (2008).