Content:1. Tables  S1‐S62. Figures  S1‐S103. Supplemental methods

Table S1. Linear regression analysis of data shown in main Figures.

Linear fit (slopes signif. different from zero?) p-value for WT - Hom

Data in Figure WT Hom slope difference

3C (I103-M, m)# y=0.024SL+0.768 (Y) Y=0.041SL+0.672 (Y) 0.0037

3D (I103-Z, m)# y=0.469SL-1.603 (Y) y=0.453SL-1.453 (Y) 0.03

3D (T12-Z, m) y=0.045SL+0.191 (Y) y=0.067SL-0.762 (Y) <0.001

4A (UN-UC, m) y=0.065SL-0.118 (Y) y=0.096SL-0.164 (Y) 0.002

(T12-UN, m)$ y=0.149SL-0.281 (Y) y=0.119SL-0.202 (Y) 0.002

(I84-I103, m)$ y=0.265SL-0.469 (Y) y=0.246SL-0.388 (Y) 0.01

#The slope difference between I103-Z and I103-M data and the size differences between I-band and A-band segments (~1:2) of WT titin suggests that the I-band segment of titin is ~ 40 times more compliant than A-band titin.

$T12-UN and I84-I103: original data not shown.

Table S2.

Pressure volume analysis of WT and Hom TtnIAjxn mice.

Data shown as mean±SEM. Abbreviations: HR: heart rate in beats per min (bpm); ESP:end systolic pressure; EDP: end diastolic pressure; dP/dtmax: maximum rate of pressureincrease during contraction; dP/dtmin: minimum rate of pressure decrease duringrelaxation; ESV: end systolic volume; EDV: end diastolic volume; SV: stroke volume; EF:ejection fraction; SW: stroke work; tau: time constant of isovolumic relaxation; ESPVR:end systolic pressure volume relationship; V0: zero volume of ESPVR linear regression fit,EDPVR, : exponent of exponential fit to the end diastolic pressure volume relationship.None of the systolic parameters: HR, ESP, EDP, dPmax, dPmin. ESV, SV, SW, Tau, ESPVR, VOare different. However, is significantly increased. . p‐value: significance value calculatedwith t‐test. ** p<0.01 .

WT Hom p-value

n 7 8

HR (BPM) 560±9 555±10 0.70

ESP (mmHg) 104±5 108±2 0.41

EDP (mmHg) 6.9±1.4 5.8±0.9 0.50

dPmax (mmHg/s) 11,204±709 12,343±495 0.20

dPmin (mmHg/s) -10,375±567 -10,537±413 0.82

ESV (L) 28.5±1.9 25.5±2.4 0.36

EDV (L) 56.9±2.4 55.8±3.0 0.79

SV (L) 28.4±2.0 30.3±2.1 0.52

EF () 49.9±2.9 54.6±3.1 0.29

SW (mmHg/L) 0.38±0.01 0.45±0.03 0.10

Tau Glantz (ms) 6.6±0.3 7.7±0.7 0.184

ESPVR (mmHg/L) 4.2±0.4 4.4±0.5 0.73

VO (L) -0.4±3.6 -1.4±3.1 0.84

EDPVR, (mmHg/L) 0.036±0.007 0.076±0.009 ** 0.005

Table S3. Morphometry of WT and Hom TtnIAjxn mice-Cardiac chambers.

Data shown as mean ± SEM. Abbreviations: BW: body weight; ; TL: tibia length; LV: left ventricle; RV: right ventricle; LA: left atrium; RA: right atrium. p‐value: significance value calculated with t‐test.  * p<0.05; ** p<0.01.  A two‐way ANOVA with chamber weight and genotype as experimental variables revealed a significant effect of genotype on chamber weight (p 0.006).  A post‐hoc Bonferroni test (which corrects for multiple testing) showed that the LV weight was significantly increased, on an absolute level and when normalized to either BW or TL.   

WT HOM p-value

n 14 13

Age (days) 105±5 106±4 0.79

BW (g) 26.8±0.9 26.8±0.6 0.96

TL (mm) 17.9±0.1 17.8±0.1 0.85

Chamber: Absolute weight (mg)

LV 86.5 ± 2.1 95.4 ± 3.1 * 0.025

RV 23.8 ± 0.6 24.5 ± 1.1 0.625

LA 3.5 ± 0.2 4.7 ± 0.4 ** 0.009

RA 4.2 ± 0.3 4.3 ± 0.2 0.764

Weight-BW normalized (mg/g)

LV 3.25 ± 0.08 3.56 ± 0.08 * 0.017

RV 0.90 ± 0.039 0.91 ± 0.033 0.801

LA 0.133 ± 0.006 0.175 ± 0.13 ** 0.007

RA 0.157 ± 0.008 0.161 ± 0.008 0.753

Weight-TL normalized (mg/mm*1000)

LV 4.83 ± 0.111 5.34 ± 0.16 * 0.016

RV 0.133 ± 0.036 0.137 ± 0.062 0.603

LA 0.198 ± 0.0096 0.262 ± 0.014 ** 0.008

RA 0.234 ± 0.014 0.241 ± 0.011 0.726

Table S4.

Conscious echocardiography in WT and Hom TtnIAjxn mice.

Table S4. Conscious mouse echocardiography of WT and homozygous TtnIAjnx mice. 

Conscious M‐mode echos were obtained in restrained mice using a parasternal short‐axis 

view at the level of the papillary muscles. Top right, representative M‐mode 

echocardiographic images. Abbreviations: HR: heart rate; BPM: beats per minute; LV: left 

ventricle; LVIDd: left ventricular internal diastolic diameter; WTd: diastolic wall thickness 

(average of posterior and anterior walls); LVIDs; left ventricular internal systolic diameter; 

WTs: systolic wall thickness(average of posterior and anterior walls) ; Eccentricity: 

LVIDd/2xWTd; LV Vol, d: left ventricular diastolic volume; LV Vol, s: left ventricular systolic 

volume; FS: fractional shortening; LVW: left ventricular weight; SV: stroke volume; CO: 

cardiac output; LA: left atrium. p‐value: significance value calculated with t‐test; * p<0.05; 

*** p<0.001; ** p<0.01 .

WT Hom p-value

n 7 7

Age (days) 103±0 104±1.4 0.34

HR, (BPM) 535±8 564±25 0.27

LV-M mode protocol

LVID;d (mm) 3.09±0.10 3.08±0.12 0.99

WT; d (mm) 0.80±0.01 0.93±0.03 *** 0.001

LVID; s (mm) 1.97±0.1 1.99±0.09 0.98

WT; s (mm) 1.18±0.03 1.30±0.06 0.07

Eccentricity 3.87±0.11 3.34±0.20 * 0.034

LV Vol; d (l) 39.3±2.2 38.5±3.4 0.85

LV Vol; s (l) 11.6±1.6 10.3±1.6 0.60

LVW (calculated) 64.9±2.1 80.1±4.7 ** 0.01

FS (%) 39.6±2.1 41.6±1.9 0.52

SV (l) 27.7±1.7 28.1±2.5 0.80

CO (ml/min) 14.8±0.9 15.8±1.6 0.58

LA (mm) 1.41±0.06 1.71±0.10 * 0.023

WT HOM

WT HOM p-value

n 12 10

Age (days) 105±4 103±4 0.71

BW (g) 27.3±0.95 26.7±0.7 0.61

TL (mm) 17.9±0.1 17.8±0.1 0.69

Muscle type Weight (mg)

Diaphragm 82.9±3.4 83.5±4.6 0.91

Soleus 9.5±0.4 9.1±0.3 0.46

EDL 10.8±0.3 10.5±0.3 0.48

Tibialis cranialis 46.1±1.4 45.7±1.1 0.84

Plantaris 17.4±0.5 17.1±0.6 0.69

Gastrocnemius 129.2±2.8 121.4±4.5 0.14

Quadriceps 188.7±6.7 192.5±4.1 0.66

Weight-BW normalized (mg/g)

Diaphragm 3.07±0.12 3.12±0.13 0.78

Soleus 0.36±0.01 0.34±0.01 0.37

EDL 0.40±0.02 0.40±0.01 0.76

Tibialis cranialis 1.68±0.04 1.72±0.04 0.57

Plantaris 0.64±0.03 0.64±0.04 0.96

Gastrocnemius 4.80±0.21 4.56±0.15 0.37

Quadriceps 6.9±0.32 7.2±0.2 0.42

Weight-TL normalized (mg/mm*1000)

Diaphragm 4.7±0.2 4.7±0.2 0.94

Soleus 0.55±0.02 0.51±0.02 0.14

EDL 0.61±0.02 0.59±0.01 0.4

Tibialis cranialis 2.58±0.08 2.56±0.05 0.87

Plantaris 0.98±0.02 0.96±0.03 0.67

Gastrocnemius 7.3±0.2 6.8±0.2 0.08

Quadriceps 10.5±0.4 10.8±0.2 0.62

Data shown as mean±SEM. Abbreviations: BW: body weight; LV: left ventricle; p‐value: significance value calculated with t‐test.   None of the parameters are significantly different.

Table S5. Morphometry of WT and HomTtnIAjxn mice- Skeletal muscle.

Table S6. Tail cuff blood pressure (BP) measurements in conscious ~ 3.5 months male WT and 

homozygous TtnDIAjnx mice. p‐value: significance value calculated with t‐test.  None of the measured 

parameters are significantly different.    

Table S6. Tail Cuff blood pressure measurements.

WT Hom p-value

n 7 7

Systolic BP (mmHg) 121.2±3.4 120.6±3.99 0.90

Diastolic BP (mmHg) 104.7±2.5 101.6±7.0 0.68

Mean arterial BP (mmHg) 116.5±1.0 111.1±6.5 0.68

Pulse rate, (BPM) 611±28 645±12 0.3

251 269

Fold difference (Hom/W

T)

Exon number in mouse TTN

WT Hom p-value

N2BA/N2B 0.25+0.02 0.26+0.01 0.92

T2/T1 0.09+0.01 0.09+0.01 0.78

TT (OD/mg) 30.4+2.5 28.2+2.9 0.58

TT/MHC 0.22+0.02 0.21+0.02 0.54

MHC(OD/mg) 139.1+9.3 138.5+11.9 0.97

B)

A)

C)

Figure S1. Targeting strategy for deletion of titin exons 251-269 that encode the IA-junction.

After homologous recombination in ES cells and Cre-mediated recombination in mice, the resulting

IAjxn recombinant genomic DNA is shown. Genotyping primers are shown in blue. B) Quantitative

analysis of titin expression in myocardium of WT and Hom TtnIAjxn mice. No differences in the studied

parameters were detected. C) Titin exon microarray analysis. Of the 358 titin exons expressed in the

mouse only the targeted exons 251-269 were greatly down regulated.

WT

Hom

WT

Hom

Distance (m)

WT

Hom

B)

Intensity (A.U.)

Intensity (A.U.)

0

2 104

4 104

6 104

0.0 1.0 2.0 3.0

0

2 104

4 104

6 104

0

2 104

4 104

6 104

0

2 104

4 104

6 104

0.0 1.0 2.0 3.0

SIM

I103 I103

T12 T12

A)

Figure S2. Skinned myocardium immune-labeled with I103 (green) and T12 (red) antibodies and

imaged by SIM. Regions of interest that were analyzed by densitometry are indicated by white boxes.

Epitopes were fit with Gaussian equations and peak positions determined. (Calibration bar: 1.0 m).

Distance (m)

sinVM

cosE M

****

**

EM W

T

EM H

om

VM W

T

VM H

om

Mo

du

lus

(pN

/mo

lecu

le)

Figure S3. Dynamic stiffness measured with sinusoidal length oscillation. Left: explanation of

protocol. Imposed sinusoidal length change shown in dark grey with amplitude shown as and resulting

force oscillation in light gray with amplitude shown as . The phase angle between the length and force

signals was measured and used to calculate the elastic modulus (EM) and viscous modulus (VM).

Right: EM and VM are increased in TtnIAjxn mice.

**A) B) C)

BN

P/C

ypA

*

Figure S4. Hypertrophy assessment in Hom TtnIAjxn mice. A) qRT-PCR

expression levels of BNP and B) cross-sectional area of LV cardiomyocytes are

increased whereas C) cell length is unchanged in HOM mice.

WT

Hom

skm

Act

in/C

ypA

WT

Hom

0.0

0.5

1.0

1.5

2.0

WT

Hom

0.0

0.5

1.0

1.5

2.0

A) B)

C) D)

Neonate

αβ

WT Hom WT Hom

E)

Figure S5. Markers for pathological hypertrophy in WT and Hom

TtnIAjxn mice. qRT-PCR analysis of skeletal muscle actin (A), and myosin

heavy chain isoform expression at the mRNA (B-D) and protein (E) levels.

WT

Hom

0.0

0.5

1.0

1.5

2.0

MHC

MHC MHC

skmActin

N.S.

B)

N.S.N.S.

N.S.

A)

N.S.

N.S.N.S.

C) D)

5 10 20 400

25

50

75

100

125

Stretch ampl. (% of slack length)

Pas

sive

Ten

sio

n (

mN

/mm

2)

HomWT

1 5 10 20 40 60 8010015

020

025

0

Act

ive

Ten

sio

n (

mN

/mm

2)

Maximal tetanic tension Time to Max tension

N.S.

Active tension-frequency relationPassive tension - length relation

1

050

100150200250300350

WT HOM

1

0.00

0.05

0.10

0.15

0.20

se

c

WT HOM

N.S.

E) Half-relaxation time F)

N.S.

Fatigue (force of 75th tetanus)

1

0.00

0.01

0.02

0.03

0.04

WT HOM1

0.00

0.05

0.10

0.15

WT HOM

1

1.1

1.2

1.3

1.4

1.5

1.6

A-b

and

wid

th (

m)

WT HOM

A-band width

30

90

150

0.0 0.50 1.0 1.5 2.0 2.5 3.0

HOM

WT

1.52 m 1.52 m

G)

H)

30

90

150

0.0 0.50 1.0 1.5 2.0 2.5 3.0

Figure S6‐caption is on next page

From previous page. Figure S6. Characterizing extensor digitorum longus (EDL)

muscle in WT and Hom TtnIAjxn mice. A) Passive tension - muscle length relation. B)

Active tension – stimulation frequency relation. C) Maximal tetanic tension. D) Time to

maximal tetanic tension. E) Half relaxation time when maximal tetanic contraction is

terminated) A-band width measurement in intact and skinned muscle measured by

electron microscopy. F) Fatigue (force at the end of a train of 75 tetani, see Methods).

No differences were found in any of the parameters between WT and Hom TtnIAjxn mice.

G) Representative transmission electronmicrographs of WT (top) and Hom TtnIAjxn

sarcomere (intact EDL muscle) with densitometry profiles shown at bottom. H) A-band

width measurements from electron micrographs of intact muscle. There are no

difference between WT and Hom mice.

CARP

GAPDH

Ankrd2

GAPDH

MARP3

GAPDH

MuRF2

GAPDH

MuRF1

GAPDH

T-cap

GAPDH

MLP

GAPDH

FHL2

-tubulin

FHL1

-tubulin

αB-crystallin

GAPDH

WT Hom WT Hom WT Hom WT Hom

Figure S7. Expression of titin-binding proteins in WT and Hom TtnIAjxn mice.

Examples of Western blots show that FHL2 is significantly increased in Hom TtnIAjxn mice.

**

Figure S8. qRT-PCR

expression levels of FHL2 in

WT and Hom TtnIAjxn mice .

WT

HOM

FH

L2/

Cyp

A

Figure S9. Multiple sequence alignment of the IA junction. The sequence is highly conserved

throughout the IA junction region. This figure shows alignment for mouse, human, cat and chicken

sequence and the extents of the IG-like and FN3 domains are shown above the sequence.

**

Figure S10. Free-wheel exercise running in WT and Hom TtnIAjxn mice. Both average nightly

running distance (A) and average running speed (B) are reduced whereas running time is

unchanged in Hom TtnIAjxn mice. (Considering the absence of a skeletal muscle phenotype in the

TtnIAjxn mice (Fig. S6), skeletal muscle involvement seems unlikely.)

WT

HOM

km/n

igh

t

WT

HOM

km/h

r**

Running distance Running speed

WT

HOM

tim

e (h

r)

Running timeB) A) C)

1

Supplemental Methods

GENERATION OF MICE DEFICIENT IN THE IA-JUNCTION. Targeting vector construction. The

knockout targeting vector was constructed using the recombineering technique described by Liu et al

(1). A 19,825 bp genomic DNA fragment (position chr2:76,779,615 – 76,799,439; GRCm38/mm10

Assembly) containing exon 245-282 of the gene was cloned. A fragment of 8026 bps containing exons

251-269 was replaced by a floxed PGK-neo (PL452) cassette. The 5’ homologous arm was 2899 bp

and the 3’ homologous arm was 8919 bp long. ES cell targeting and screening. The targeting vector

was linearized with Not1 and electroporated into D1 ES cells which were derived from F1 hybrid

blastocyst of 129S6 x C57BL/6J by the Gene Targeting & Transgenic Facility at University of

Connecticut Health Center. G418-resistant ES colonies were isolated and screened for homologous

recombination by nested PCR using primers outside the construct paired with primers inside the neo

cassette. Primer sequences were as follows: 5’ arm forward primers: GTGAATGTGAAGGCTTTCTTT

and CTTCCAACTTTTTCTTTCCAG, 3’ arm reverse primers: CTGATGGAGCCTAACAATGAATG and

GGAACAAATAGCAAGCATCAC. Clones PCR-positive for both arms were expanded for generation of

chimeric mice. Chimera generation and mice genotype. Confirmed targeted ES cells were

aggregated with 8-cell embryos of CD-1 strain. The aggregated embryos were transferred to

pseudopregnant recipients and allowed to develop to term. Chimeric mice were identified by coat color

and offspring from two chimeras from each line were tested for germline transmission of the targeted

allele. The neo cassette was removed by mating the chimeras with a Cre deleter strain (129S1-

Hprttm1(cre)Mnn Stock Number 004302, Jackson Laboratory, Bar Harbor, ME). The F1 pups with the neo

cassette removed were genotyped by PCR using primers:

WTfor, GTGTCAGTGAGCCATCTGAA; IAjxnfor, GATGGTATGCCATCTTCACC, and Rev,

GCCATCTTTATGCCAGCTCA (products: 267bp WT and 417bp IAjxn).

Mice were subsequently bred onto a C57BL/6J background (Stock Number 000664, Jackson

Laboratory) for 8 generations. Template DNA for genotyping was digested from tail tips using Tail Lysis

2

Buffer (0.1mM Tris pH 8.8, 5mM EDTA, 0.2M NaCl, 0.2% SDS) and 0.4 mg/mL proteinase K

(Worthington Biochemical Corporation) at 55oC overnight. The reaction was carried out for 32 cycles

(94oC 20s, 55oC 30s and 72oC 30s) followed by one cycle of 72oC for 5 min. 1 µL of the template was

amplified using GoTaq Green Master Mix (Promega) in a 20 µL PCR reaction. The heterozygous mice

produce litters at Mendelian ratios and breeding was performed with both heterozygous and

homozygous breeding schemes. Periodic backcrossing of homozygous breeders to C57BL/6J line

was performed to eliminate genetic drift. In our studies we used mice ~ 4 months old and male, unless

indicated otherwise.

TRANSMISSION ELECTRON MICROSCOPY (TEM). Electron microscopy and IEM was performed in

WT and Hom TtnIAjxn mice. Intact Muscle. Intact muscle (in situ fixation) was performed in anesthetized

and ventilated mice using isoflurane delivered in 100% oxygen. A midline sternotomy was performed and

a 27G needle was placed into the apex of the left ventricle to prevent pressure accumulation prior to

slowly infusing 3 mL of an arresting solution containing 30mM KCl and 30mM BDM in HEPES ([in mmol/L]

133.5 NaCl, 5 KCl, 1.2 NaH2PO4, 1.2 MgSO4, 30 BDM, 10 HEPES, pH 7.4) into the left atrium. Following

the flow of arresting solution, a cold solution of 3% glutaraldehyde and 3% paraformaldehyde containing

0.03% tannic acid in PBS pH 7.2 was perfused for 5 minutes. Following fixation, muscles were then gently

removed with microscissors under microscope visualization (3X). The dissected muscles were then

placed in 3% paraformaldehyde in PBS for 30 minutes at 4 ºC. The muscles were rinsed for 15 minutes

in PBS containing protease inhibitors. A secondary fixation was performed in 3% glutaraldehyde

containing 0.03% tannic acid in PBS for 1 hour. After PBS rinses the muscles were post-fixed in 1%OsO4

in PBS for 30 minutes, and were then dehydrated in an ethanol graded series of increasing

concentrations. Following dehydration the muscles were first infiltrated with 100% propylene oxide then

a mix of 1:1 propylene oxide:Araldite, Embed 812 (Epon-812, EMS), and finally embedded in a pure

Araldite, Embed 812 resin. Ultrathin sections (~70 nm) were obtained with a Reichert-Jung

ultramicrotome and contrasted with 1% potassium permanganate and lead citrate. Longitudinal fiber

3

direction was aligned with the edge of the diamond knife during ultramicrotomy procedure. Samples were

observed in a TECNAI Spirit G2 electron microscope operated at 100 kV. SKINNED MUSCLE. Cervical

dislocation was performed and the heart was removed and placed into a petri dish containing relaxing

solution ([in mmol/L]: 10 BES, 10 EGTA, 6.56 MgCl2, 5.88 Na-ATP, 1 DTT, 46.35 potassium-propionate,

15 creatine phosphate) with 1% Triton X-100 and protease inhibitors ([in mmol/L] 0.1 E64, 0.4 leupeptin

and 0.5 PMSF). The muscles were removed and placed in a 5mL tube with skinning solution and placed

on a rotator at 4C overnight. The following day the muscles were washed with relaxing solution and were

stretched and fixed with 3% paraformaldehyde in PBS for 30 minutes at 4 ºC. The remaining methods

were identical to the preparation detailed for intact muscle electron microscopy. In a separate set of

experiments TEM studies were performed on intact extensor digitorum longus (EDL) muscle. Briefly, the

tendons of the EDL muscle were attached to silk suture while in a bath containing calcium-free Ringer

solution (145mM NaCl, 2.5mM KCL, 1.0mM MgSO4, 1.0mM HEPES, 10mM glucose, pH 7.4, 30°C). The

muscle was stretched ~15% and was then fixed in 2% paraformaldehyde and 2% glutaraldehyde

containing 0.03% tannic acid in PBS for 45 min and processed for EM as explained above.

IMMUNOELECTRON MICROSCOPY (IEM). Ultrastructural immunolocalization of the I103 epitope on

cardiac LV wall muscles from WT and Hom TtnIAjxn mice was performed on skinned stretched muscles

(detailed in previous section) by the pre-embedding technique with modifications as previously described

(2). Skinned muscle fixation was performed with 4% paraformaldehyde (PF; Sigma P-6148) in PBS at 4ºC

for 30 minutes, and washed first with PBS then with PBS containing protease inhibitors. Blocking was

performed with 1% BSA in PBS containing protease inhibitors for 1 hour at 4°C followed by overnight

incubation at 4°C with rabbit polyclonal anti-I103 antibody (2mg/ml) diluted 1:25 in the same buffer

containing 1% BSA and protease inhibitors. After rinsing in PBS with protease inhibitors, muscle tissues

were incubated overnight at 4°C with secondary Fab goat anti-rabbit antibody IgG (AP 132, Millipore) at

1:25 dilution in 1% BSA PBS containing protease inhibitors. For negative control the primary antibody

was omitted and replaced with 1% BSA in PBS containing protease inhibitors. Samples were washed in

4

PBS and a secondary fixation was performed with 3% glutaraldehyde in the same buffer for 30 minutes at

4 ºC. After rinsing with PBS, postfixation was performed with 1% OsO4 in PBS for 30 minutes at 4 ºC.

Subsequently, muscle tissues were washed with PBS and distilled water, dehydrated in a graded series

of ethanol (70%, 95%, 100%) and infiltrated with propylene oxide for 15 minutes, then in a mixture of 1:1

propylene oxide:Araldite/Embed 812 resin for 1hour at RT in a rotator followed by Araldite/Embed 812

alone, 3 changes for 30 minutes. After the infiltration, muscle tissues fragments were longitudinally

oriented in a plastic surface and prepared for embedding and polymerization for 48 hours at 60 ºC.

Ultrathin sections were contrasted in 1% potassium permanganate and lead citrate, and observed in a

Tecnai Spirit G2 electron microscope operated at 100 kV. Digital images were stored for further quantitative

analysis using ImageJ and results analyzed with Fityk.

STRUCTURED ILLUMINATION MICROSCOPY (SIM). Mice, dissection, and fixation was identical to that

performed for skinned muscle electron microscopy (see above). Muscles were embedded in Tissue-Tek

O.C.T. compound (Sakura Finetek) and immediately frozen in 2-methylbutane precooled in liquid N2. 5 m

cryosections were then cut and mounted onto number 1.5 coverslips. Tissue sections were permeablized

in 0.2% Triton X-100/PBS for 20 minutes at room temperature, blocked with 2% BSA and 1% normal

donkey serum in PBS for 1 hour at room temp, and incubated overnight at 4C with primary antibodies

diluted in PBS. The primary antibodies included: a chicken polyclonal anti-Titin UN (10 g/ml), a rabbit

polyclonal anti-Titin UC (2 g/ml), a rabbit polyclonal anti-Titin I84 (2 g/ml), a rabbit polyclonal anti-Titin

I103 (1 g/ml), a monoclonal anti-Titin T12 (2.5 g/ml) and a monoclonal anti--actinin (1:200) (EA-53,

Sigma) antibody. (See below for an antibody list.) Sections were then washed with PBS for 20 minutes,

and incubated with secondary antibodies/PBS for 1.5 hours. The secondary antibodies, obtained from

Invitrogen and Jackson Immunoresearch Laboratories, included: Alexa Fluor 594 conjugated goat anti-

rabbit IgG (1:600), Texas Red conjugated goat anti-chicken IgG (1:600), Alexa Fluor 488 conjugated goat

anti-rabbit IgG (1:1000), and Cascade Blue conjugated goat anti-mouse IgG (1:200). The sections were

5

then washed with PBS for 20 minutes and mounted onto slides with Aqua Poly/Mount (Polysciences Inc.).

Super resolution microscopy was performed using a Zeiss ELYRA S1 (SR-SIM) microscope equipped with

an AXIO Observer Z1 inverted microscope stand with transmitted (HAL), UV (HBO) and solid-state

(405/488/561 nm) laser illumination sources, a 60× objective (NA 1.45), and EM-CCD camera (Andor

iXon). Images were acquired with ZEN 2011 software, densitometry was performed in ImageJ and results

analyzed with Fityk. Densitometry profiles were background subtracted and epitope profiles were fit with

Gaussian curves to determine their peak location. Epitope distances were determined across the A-band

(Fig. 3A-C) or Z-disk (Fig. 3D; Fig. 4) and then divided by 2, to obtain epitope to M-band distance or epitope

to Z-disk distance, respectively.

Passive and active tension characteristics of skeletal muscle. Intact muscle mechanics was

performed using the Aurora 1200A in vitro test system that has been described previously (3, 4). Briefly,

EDL muscle was attached between a combination servomotor-force transducer and fixed hook via silk

suture in a bath containing oxygenated Ringer solution (145mM NaCl, 2.5mM KCL, 1.0mM MgSO4,

1.0mM CaCl2x2H2O, 1.0mM HEPES, 10mM glucose, pH 7.4, 30°C). For passive force the muscle was

stretched from slack length to 10%, 20% and 30% of the muscle length at 10% per sec. The muscle was

held for 60 seconds and then returned to slack length waiting seven minutes between each stretch.

Measured force in mN was normalized to cross-sectional area (muscle mass (mg)/ (L0 (mm)*1.056) to

obtain stress (mN/mm2). The optimal length (L0) was determined by adjusting muscle length until optimal

fiber length for maximal twitch force was achieved (pulse duration of 200 μs with biphasic polarity). Active

stress was determined from a force-frequency protocol. The muscle was stimulated at incremental

stimulation frequencies 1, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250 Hz waiting 30, 30, 60, 90, 120, 120,

120, 120, 120, 120, 120 seconds, respectively, in between each activation. From these data, maximal

tetanic tension, time to maximal tetanic tension, and half-relaxation time of tetanic tension were

calculated. The muscle was then fatigued by stimulation for 1 sec at 60 Hz followed by three seconds of

6

rest for a total of 75 tetani. The data from each experiment were analyzed with Aurora's DMA software,

Microsoft Excel, and Kaleidagraph 3.6. When the experiment was completed muscles were dried with

blotting paper and were then weighed. The average cross-sectional area was obtained by dividing the

weight by the specific gravity of muscle (1.065) and by the muscle length.

SINGLE MOLECULE MODELING. Single molecule forces were calculated using the wormlike chain

(WLC) equation(5) using the measured extension of the N2B element (Fig. 4C). The contour length

(CL) was assumed to be 200 nm and the persistence lengths (PL) 0.5 nm, respectively. To avoid

volume-exclusion and self-interaction effects (6, 7) force was calculated at sarcomere lengths where

the fractional extension of the N2B element was >0.1 and we selected for this the 2.1-2.2 m SL range

and the 2.25-2.35 m SL range. (For additional details, see (8-11).) We then calculated the force of a

single titin molecule and compared results for WT with TtnIAjxn mice (Fig. 4D).

CARDIOMYOCYTE STUDIES. Cell isolation. Mice were heparinized (1,000 U/kg, i.p.) and

euthanized by cervical dislocation under isoflurane. The heart was removed and cannulated via the

aorta with a blunted 21-gauge needle for retrograde coronary perfusion. The heart was perfused for 4

min with perfusion buffer ([in mmol/L] 113 NaCl, 4.7 KCl, 0.6 KH2PO4, 0.6 Na2HPO4, 1.2 MgSO4, 12

NaHCO3, 10 KHCO3, 10 HEPES, 10 taurine, 5.5 glucose, 5 BDM, 20 Creatine, 5 Adenosine and 5

Inosin, pH 7.4), followed by digestion buffer (perfusion buffer plus 0.05 mg/ml Liberase TM research

grade; Roche Applied Science, and 13 µM CaCl2) for 20 min. When the heart was flaccid, digestion

was halted and the heart was placed in myocyte stopping buffer (perfusion buffer plus bovine calf

serum 0.08 [BCS]/ml and 8 µM CaCl2) with protease inhibitors ([in mmol/L] 0.4 Leupeptin, 0.1 E64, and

0.5 PMSF (Peptides International,Sigma-Aldrich)). The left ventricle was cut into small pieces, and the

rest of the heart was discarded. The small pieces of left ventricle were triturated several times with a

transfer pipette and then filtered through a 300µm nylon mesh filter. Skinned cells. Cells were

7

skinned for 7 min in relaxing solution ([in mmol/L] 40 BES, 10 EGTA, 6.56 MgCl2, 5.88 Na-ATP, 1.0

DTT, 46.35 K-propionate, 15 creatine phosphate, pH 7.0) with protease inhibitors ([in mmol/L] 0.4

leupeptin, 0.1 E64 , and 0.5 PMSF) and 0.3% Triton X-100 (Ultrapure; Thermo Fisher Scientific). Cells

were washed extensively with relaxing solution pCa 9 and stored on ice. Skinned myocytes were used

for mechanic studies within 48 h after time of cell isolation. Myocyte suspension was added to a room

temperature flow-through chamber mounted on the stage of an inverted microscope (Diaphot 200;

Nikon). Skinned myocyte was glued at one end to a force transducer (Model 406A or 403A, Aurora

Scientific). The other end was bent with a pulled glass pipette attached to micromanipulator so that the

myocyte axis aligned with the microscope optical axis and cross sectional area (CSA) was measured

directly. The cross sectional images of skinned cells were analyzed by ImageJ 1.41 software (National

Institutes of Health) and were used to convert measured force to stress and for cell dimension study

(Fig S4d). Then, the free end of the cell was glued to a servomotor (Model 308B, Aurora Scientific) that

imposes controlled stretches. Sarcomere length (SL) was measured with a MyocamS and SarcLen

acquisition module (IonWizard 6.2, IonOptix Co, MA) attached to a computer. Passive stress in

skinned myocytes. Passive stress was measured in relaxing solution pCa 9 with protease inhibitors at

room temperature. Cells were stretched from slack length at a speed of 1 base length/sec, followed by

a 20 sec hold and then a sinusoidal length oscillation (frequency 0.1-100 Hz, amplitude 5% base length

of the cell) and then a release back to the original length. Recovery time of at least 15 min in between

stretches was utilized to prevent memory-effects in subsequent measurements. Data were collected

using a custom LabVIEW VI (National Instruments, Austin TX) at a sample rate of 1 kHz. Obtained

passive forces were converted to force per titin molecule (assuming 3240 titin molecules per m2 of

myofibril and 50% of the cell’s cross-sectional area taken up by myofibrils(12)).

IN VIVO PRESSURE-VOLUME RELATIONSHIPS. In vivo pressure volume analysis was performed in

mice using a SciSense Advantage Admittance Derived Volume Measurement System and 1.2F

catheters with 4.5 mm electrode spacing (SciSense, London, Ontario, Canada). Mice were

8

anesthetized and ventilated with 1% isoflurane using a ventilator and body temperature maintained at

37oC. Four month old anesthetized mice were secured and a midline incision was made down the

neck. The muscles in the neck were separated and the right carotid artery was isolated from the vagus

nerve. The right carotid artery was cannulated and the catheter guided past the aortic valve. The

abdomen was opened below the sternum; the IVC was located and occluded during a sigh (pause) in

ventilation to acquire load-independent indices. Data acquisition and analysis was performed in

LabScribe2 (iWorx, Dover NH). Diastolic PV data was analyzed using a monoexponential fit (𝑃 =

𝐴𝑒𝛽𝑉)(13) with the exponent (β) reported as the stiffness.

ECHOCARDIOGRAPHY. Echocardiography was used to study LV wall thickness and chamber

dimensions in diastole and systole. We studied mice that were conscious to avoid the well-known

effects of anesthesia on wall thickness and chamber dimensions (14). A Vevo 2100 High Resolution

Imaging System (Visual-Sonics, Toronto, Canada) was used with the model MS550D scan head

designed for murine cardiac imaging. Care was taken to avoid animal contact and excessive pressure

which could induce bradycardia. Imaging was performed at a depth setting of 11 mm. Images were

collected and stored as a digital cine loop for off-line calculations. Mice were consciously echoed while

scruffing the skin at the nape of the neck and a standard short axis (M-mode) cine loop was recorded at

the level of the papillary muscles to asses chamber dimensions (LV systolic and diastolic dimensions

(LVDs, LVDd)) posterior and anterior wall thickness (WT), and cardiac function via Fractional

Shortening (%FS). Functional calculations were obtained according to American Society of

Echocardiography guidelines. In addition, the left atrial dimension was measured in the long-axis view

directly below the aortic valve leaflets. To investigate diastolic function we performed a Doppler echo

on anesthetized mice. (These studies are not possible on conscious mice). Anesthesia was induced

by intraperitoneal (i.p.) injection of ketamine hydrochloride (K2753, Sigma-Aldrich) 100 mg/kg plus

atropine sulfate (A0257, Sigma-Aldrich) 1.2 mg/kg. Following anesthetic induction, the mouse was

placed in dorsal recumbence on a heated platform for echocardiography. Body temperature was

9

maintained at 37°C and anesthesia was maintained with 0.5-1.0% isoflurane (USP, Phoenix) in 100%

oxygen. Transthoracic echo images was obtained with a Vevo 700 High Resolution Imaging System

(Visual-Sonics, Toronto, Canada) using the model 707B scan head designed for murine cardiac

imaging. Care was taken to avoid animal contact and excessive pressure which could induce

bradycardia. Imaging was performed at a depth setting of 1 cm. Images were collected and stored as a

digital cine loop for off-line calculations. Passive LV filling peak velocity, E (cm/sec), and atrial

contraction flow peak velocity, A (cm/sec), were acquired from the images of mitral valve Doppler flow

from tilted parasternal long axis views, according to American Society of Echocardiography guidelines.

A sweep speed of 100 mm/sec was used. The heart rate of animals was maintained in the range of 350

to 450 bpm for Doppler studies.

TISSUES COLLECTION. Mice were weighed, anesthetized with isoflurane and sacrificed by cervical

dislocation. The hearts were rapidly excised and placed into a dish containing HEPES buffer ([in

mmol/L] 133.5 NaCl, 5 KCl, 1.2 NaH2PO4, 1.2 MgSO4, 30 BDM, 10 HEPES). All four chambers were

removed, blotted and weighed separately. The left ventricle (LV) was further separated into 2 sections,

one of which was snap frozen in liquid nitrogen and the other placed into RNALater for subsequent

analysis. Additionally we determined weights of skeletal muscle. Tibias were removed and tibia length

was measured using a caliper.

TAIL CUFF BLOOD PRESSURE MEASUREMENT. Mice underwent blood pressure analysis utilizing

the Hatteras Instruments Blood Pressure Analysis System (Model MC4000) placing individual tails in

small cuffs, gently taping the tail and placing a magnetic cover over each mouse allowing for proper

measurements to be taken. Selected mice were conditioned two consecutive days prior to final analysis

by taking the measurements at the same time of the day in order to allow for mice to become

accustomed to the test. Analysis included five preliminary and ten measurement cycles holding a

constant temperature of 90°F with a maximum cuff pressure of 200 mmHg. Conditioning the mice

10

allowed for stable blood pressure measurements to be taken with low errors (at least 7/10

measurement cycles completed successfully).

EXERCISE TESTING. We used ~3.5 month old mice for voluntary exercise studies. Individual mice

were housed in a large cage that contained a free-running wheel. The exercise wheels have been

previously described(15). Briefly, an 11.5cm diameter wheel with a 5.0 cm wide running surface (6208;

PetSmart; Phoenix, AZ) was equipped with a digital magnetic counter (BC600, Sigma Sport, Olney Il)

that is activated by wheel rotation. Mice were given water and standard rodent feed ad libitum. Nightly

distance run, speed and run time were recorded. After an initial ~10 day ramp-up during which running

distance increased mice reached an approximate steady-state and the average distance, speed and

running time were measures during days 17-21 after starting the running protocol.

QUANTIFICATION OF PROTEIN EXPRESSION. Flash-frozen LV tissues were prepared as

previously described (16-18). Briefly, the LV tissues were flash frozen in liquid nitrogen and solubilized

between glass pestles cooled in liquid nitrogen. Tissues were primed at -20oC for a minimum of 20 min,

then suspended in 50% urea buffer ([in mol/L] 8 Urea, 2 Thiourea, 0.05 Tris-HCl, 0.075 Dithiothreitol

with 3% SDS and 0.03% Bromophenol blue pH 6.8) and 50% glycerol with protease inhibitors ([in

mmol/L ] 0.04 E64, 0.16 Leupeptin and 0.2 PMSF) at 60oC for 10 min. Then the samples were

centrifuged at 13000 rpm for 5 min, aliquoted and flash frozen in liquid nitrogen and stored at -80oC.

Titin isoform analysis was performed as previously described (18). Briefly, the solubilized samples

from each genotype (LV of TtnΔAIjnx +/+ (WT), +/- (Het), and -/- (Hom)) were electrophoresed on 1%

agarose gels using a vertical SDS-agarose gel system (Hoefer). Gels were run at 15 mA per gel for 3 h

and 20 min, then stained using Coomassie brilliant blue (Acros organics), scanned using a commercial

scanner (Epson 800, Epson Corporation, Long Beach CA) and analyzed using One-D scan

(Scanalytics Inc, Rockville MD). Each sample was loaded in a range of five volumes and the integrated

optical density (IOD) of titin and MHC were determined as a function of loading volume. The slope of

11

the linear relationship between IOD and loading was obtained for each protein to quantify expression

ratios. Expression levels were also quantified from LV with western blotting as previously described

(19). Solubilized samples were run on a 0.8% agarose gel in a vertical gel electrophoresis chamber.

Gels run at 15 mA per gel for 3 h and 20 min were then transferred onto PVDF membranes (Immobilon-

FL, Millipore) using a semi-dry transfer unit (Trans-Blot Cell, Bio-Rad, Hercules CA). Blots were stained

with Ponceau S (Sigma) to visualize the total protein transferred. Blots were then probed with primary

antibodies (see Table 1) followed with secondary antibodies conjugated with fluorescent dyes with

infrared excitation spectra (Biotium Company, Hayward CA). Blots were scanned using an Odyssey

Infrared Imaging System (Li-COR Biosciences, Lincoln NE) and the images were analyzed using Li-

COR software. Ponceau S scans were analyzed in One-D scan to normalize WB signal to protein

loading. A list of primary antibodies used in western blot studies is provided is shown below.

Antibody name Titin Target/purpose Source Host Dilution Z1Z2 N-terminus (Ig1-2) Dr.Labeit/www.myomedix.com Rabbit 1:500 I103 I102-104 Dr. C. Gregorio lab Rabbit 1:200 MIR I109-110 (in deleted

region) Dr.Labeit/www.myomedix.com Rabbit 1:200

M8/M9 2 most C-terminal Igs Dr.Labeit/www.myomedix.com Rabbit 1:200 Un N2Bus I15-I16 (x214-

x215) Dr.Labeit/www.myomedix.com Avian 10 µg/ml

Uc N2Bus I18-I19 (x216-x217)

Dr.Labeit/www.myomedix.com Rabbit 2 µg/ml

T12 Ig domains I2-I3 Boehringer Mouse 1 µg/ml I84 Ig I84-86 Dr.Labeit/www.myomedix.com Rabbit 2 µg/ml TCAP Z-disk titin binding Dr.Labeit/www.myomedix.com Rabbit 1:500 MLP Z-disk titin binding Dr.Labeit/www.myomedix.com Rabbit 1:3000 CARP I-band titin binding Dr.Labeit/www.myomedix.com Rabbit 1:500 FHL1 I-band titin binding Abcam Mouse 1:250 FHL2 I-band titin binding Abcam Mouse 1:250 αB-crystallin I-band titin binding Millipore Rabbit 1:1000 Ankrd2 I-band titin binding Dr.Labeit/www.myomedix.com Rabbit 1:2000 MARP3 I-band titin binding Dr.Labeit/www.myomedix.com Rabbit 1:500 MuRF1 M-line titin binding Dr.Labeit/www.myomedix.com Chicken 1:1000 MuRF2 M-line titin binding Dr.Labeit/www.myomedix.com Rabbit 1:1000 Beta Tubulin Loading control Cell Signaling Tech. Rabbit 1:1000 GAPDH Loading control Thermo Pierce Mouse 1:3000

Myosin isoform analysis was performed using 7% acrylamide gels as previously described (20). Thin

and thick filament regulatory proteins expression and phosphorylation were analyzed as previously

12

described (8, 17, 21, 22). Briefly, LV samples from all three genotypes were loaded onto a 12% SDS-

PAGE gel and run for 2 h at 100 V. Gels were fixed in 50% methanol, 10% acetic acid overnight then

stained with Pro-Q Diamond Phosphoprotein Gel stain (Invitrogen), destained with 20% acetonitrile, 50

mM sodium acetate pH 4, and scanned with a 302 nm UV transilluminator (G: BOX Syngene, USA).

Gels were then stained with Coomassie brilliant blue, scanned, and analyzed using One-D scan for

protein content. Each sample was loaded one time in sets of three in a row.

RNA ANALYSIS. Custom Titin Exon Microarray. Ttn mRNA expression was analyzed using our

custom exon microarray as previously described (8, 16, 20, 23, 24). Left ventricular tissues were

dissected from male mice (10 month-old) and stored in Ambion RNAlater (Invitrogen). Total RNA was

isolated using the Qiagen RNeasy Fibrous Tissue Mini Kit (Qiagen). The SenseAmp Kit (Genisphere)

and Superscript III reverse transcriptase enzyme (Invitrogen) were used for sense amplification of each

sample. Samples of the same genotype were pooled for reverse transcription and dye-coupled with

Alexa Fluor 555 and Alexa Fluor 647 using the SuperScript Plus Indirect cDNA Labeling System

(Invitrogen). A 3-point hybridization loop design with technical replicate dye-flip was used; 750 ng of

labeled cDNA with each fluorophore were co-hybridized on individual slides (platform: 50-mer

oligonucleotides specific for each Ttn exon robotically spotted in triplicate on Corning Ultra GAPS

slides) using SlideHyb Buffer #1 (Ambion) in a GeneTAC Hybridization Station (Genomic Solutions) for

16 h at 42oC. Slides were scanned at 595 nm and 685 nm with an ArrayWoRx scanner (Applied

Precision). Spot-finding was performed with SoftWoRx Tracker (Applied Precision) and analyzed with

the CARMA package(25).

qRT-PCR. Total RNA was extracted using the RNeasy Fibrous Tissue Mini Kit with DNase treatment

(Qiagen) from left ventricle tissue which upon dissection had been immediately immersed into RNAlater

(Ambion) and stored at -20oC. Samples were from 6 12-week-old male mice for each group.

SuperScript III (Invitrogen) was used to reverse transcribe total RNA; cDNA equivalent to 25ng total

13

RNA were used for each reaction. Quantitative RT-PCR used Maxima SYBR Green qPCR Master Mix

(Fermentas) in a Rotor-gene 6000 (Corbett Life Science). Primer sequences used: Skeletal actin

(for:5'-GCCGTTGTCACACACAAGAG-3', rev:5'-CTCACTTCCTACCCTCGGC-3', product 102bp),

αMHC (for: 5'-CCGGGTGATCTTCCAGCTAA-3', rev:5'-GCTCAGCACATCAAAGGCACT-3', product

208bp), βMHC (for:5'-TCCCAAGGAGAGACGACTGTG-3', rev:5'-CCTTAAGCAGGTCGGCTGAGT-3',

product: 253bp), Fhl2 (for: 5'-CCTGTGAGGAGTGTGGAACA-3', rev: 5'-GAGCAATGGAAGCAGCCTT-

3', product:91bp), BNP (for: 5'-ACAAGATAGACCGGATCGGA-3', rev: 5'-

ACCCAGGCAGAGTCAGAAAC-3', product: 110bp), and CypA (for: 5'-CAGACGCCACTGTCGCTTT-

3', rev: 5'-TGTCTTTGGAACTTTGTCTGCAA-3', product: 133bp). Analysis used Standard Curves,

averages of three technical replicates for each data point, and expression was normalized to CypA.

MULTIPLE SEQUENCE ALIGNMENTS. Amino acid sequences for the IA-junction region from

multiple mammalian species and chicken were obtained by using BLAST search at http://ensembl.org.

Once retrieved, alignments of the IA-junction sequences were assembled using Clustal Omega and T-

coffee at http://www.ebi.ac.uk/Tools/msa/.

STATISTICS. Statistical analysis was performed in Graphpad Prism (GraphPad Software, Inc). A

one-way ANOVA with a Bonferroni post-hoc analysis that calculates p-values (when needed corrected

for multiple comparisons) was performed to assess differences between multiple groups. A t-test was

used when comparing two groups only. A two-way ANOVA was used in Table S3 (chamber weights

(LV, LA, RV, RA) and genotype (WT and HomTtnIAjxn) with a Bonferroni posthoc test. Results are

shown as mean ± SEM. p<0.05 was defined as significant with * p<0.05; ** p<0.01 and *** p<0.001.

References.

14

1. Liu P, Jenkins NA, & Copeland NG (2003) A highly efficient recombineering-based method for

generating conditional knockout mutations. Genome Res 13(3):476-484.

2. Trombitas K & Granzier H (1997) Actin removal from cardiac myocytes shows that near Z line

titin attaches to actin while under tension. Am J Physiol 273(2 Pt 1):C662-670.

3. Labeit S, et al. (2010) Modulation of muscle atrophy, fatigue and MLC phosphorylation by

MuRF1 as indicated by hindlimb suspension studies on MuRF1-KO mice. J Biomed Biotechnol

2010:693741.

4. Ottenheijm CA, Hidalgo C, Rost K, Gotthardt M, & Granzier H (2009) Altered contractility of

skeletal muscle in mice deficient in titin's M-band region. J Mol Biol 393(1):10-26.

5. Kellermayer MS, Smith SB, Bustamante C, & Granzier HL (1998) Complete unfolding of the

titin molecule under external force. J Struct Biol 122(1-2):197-205.

6. Bustamante C, Marko JF, Siggia ED, & Smith S (1994) Entropic elasticity of lambda-phage

DNA. Science 265(5178):1599-1600.

7. Marko JF & Siggia ED (1995) Statistical mechanics of supercoiled DNA. Phys Rev E Stat Phys

Plasmas Fluids Relat Interdiscip Topics 52(3):2912-2938.

8. Granzier HL, et al. (2009) Truncation of titin's elastic PEVK region leads to cardiomyopathy

with diastolic dysfunction. Circ Res 105(6):557-564.

9. Trombitas K, Freiburg A, Centner T, Labeit S, & Granzier H (1999) Molecular dissection of

N2B cardiac titin's extensibility. Biophys J 77(6):3189-3196.

10. Trombitas K, et al. (2000) Extensibility of isoforms of cardiac titin: variation in contour length

of molecular subsegments provides a basis for cellular passive stiffness diversity. Biophys J

79(6):3226-3234.

11. Watanabe K, Muhle-Goll C, Kellermayer MS, Labeit S, & Granzier H (2002) Different

molecular mechanics displayed by titin's constitutively and differentially expressed tandem Ig

segments. J Struct Biol 137(1-2):248-258.

12. Granzier HL & Irving TC (1995) Passive tension in cardiac muscle: contribution of collagen,

titin, microtubules, and intermediate filaments. Biophys J 68(3):1027-1044.

13. Burkhoff D, Mirsky I, & Suga H (2005) Assessment of systolic and diastolic ventricular

properties via pressure-volume analysis: a guide for clinical, translational, and basic researchers.

Am J Physiol Heart Circ Physiol 289(2):H501-512.

14. Yang XP, et al. (1999) Echocardiographic assessment of cardiac function in conscious and

anesthetized mice. The American journal of physiology 277(5 Pt 2):H1967-1974.

15. Konhilas JP, et al. (2004) Sex modifies exercise and cardiac adaptation in mice. Am J Physiol

Heart Circ Physiol 287(6):H2768-2776.

16. Lahmers S, Wu Y, Call DR, Labeit S, & Granzier H (2004) Developmental control of titin

isoform expression and passive stiffness in fetal and neonatal myocardium. Circ Res 94(4):505-

513.

17. Hidalgo C, et al. (2009) PKC phosphorylation of titin's PEVK element: a novel and conserved

pathway for modulating myocardial stiffness. Circ Res 105(7):631-638, 617 p following 638.

18. Warren CM, Jordan MC, Roos KP, Krzesinski PR, & Greaser ML (2003) Titin isoform

expression in normal and hypertensive myocardium. Cardiovasc Res 59(1):86-94.

19. Hudson BD, Hidalgo CG, Gotthardt M, & Granzier HL (2010) Excision of titin's cardiac PEVK

spring element abolishes PKCalpha-induced increases in myocardial stiffness. J Mol Cell

Cardiol 48(5):972-978.

20. Chung CS, et al. (2013) Shortening of the elastic tandem immunoglobulin segment of titin leads

to diastolic dysfunction. Circulation 128(1):19-28.

15

21. Chung CS & Granzier HL (2011) Contribution of titin and extracellular matrix to passive

pressure and measurement of sarcomere length in the mouse left ventricle. J Mol Cell Cardiol

50(4):731-739.

22. Radke MH, et al. (2007) Targeted deletion of titin N2B region leads to diastolic dysfunction and

cardiac atrophy. Proc Natl Acad Sci U S A 104(9):3444-3449.

23. Granzier H & Labeit S (2007) Structure-function relations of the giant elastic protein titin in

striated and smooth muscle cells. Muscle Nerve 36(6):740-755.

24. Labeit S, et al. (2006) Expression of distinct classes of titin isoforms in striated and smooth

muscles by alternative splicing, and their conserved interaction with filamins. J Mol Biol

362(4):664-681.

25. Greer KA, McReynolds MR, Brooks HL, & Hoying JB (2006) CARMA: A platform for

analyzing microarray datasets that incorporate replicate measures. BMC Bioinformatics 7:149.