Plasmid pKUN9, a versatile vector for the selective packaging of both DNA strands into single-stranded DNA-containing phage-like particles

Gene.41 (1986)39-46

Elsevier

GENE 1493

39

Plasmid pKUN9, a versatile vector for the selective packaging of both DNA strands into single- stranded DNA-containing phage-like particles

(Recombinant DNA; filamentous phages; nucleotide sequence analysis; shotgun cloning)

B.P.H. Peeters*, J.G.G. Schoenmakers and R.N.H. Konings**

Department ofMolecular Biology, Faculty of Science, University of Nijmegen. Toernooiveld, 6525 ED Nijmegen (The Netherlands) Tel. (3 I -8O)-558833

(Received September 19th, 1985)

(Accepted October 14th, 1985)

SUMMARY

A versatile vector plasmid, pKUN9, has been constructed which, simply by infecting cells harboring this plasmid with either bacteriophage IKe or Ff (M13, fd, and fl), permits the selective packaging of both of its DNA strands into, single-stranded (ss) DNA-cont~n~g, phage-like particles. The plasmid, which is a derivative of plasmid pUC9 [Vieira and Messing, Gene 19 (1982) 269-2761, contains in opposite orientations the replication origins and contiguous packaging signals of the distantly related filamentous phages IKe and Ff. As a result of the selective packaging, both strands of a DNA fragment cloned in pKUN9 can be obtained in a single-stranded form and can be sequenced by the dideoxy method using commercially available ( + ) and (-) sequencing primers. In addition, plasmid pKUN9 possesses all unique properties incorporated in the M13mp phages and the pUC plasmids.

INTRODUCITON

Replication of the ss DNA genome of the N-specific (IKe) and F-specific (Ff’s; M13, fd, and fl) filamentous bacteriophages occurs in three stages: (i) conversion of the parental ss DNA into a double- stranded intermediate (RF); (ii) replication of RF

* Present address: Department of Genetics, University of

Groningen, Kerklaan 30, 9751 Haren (The Netherlands) Tel.

(31-50)-l 15273.

**To whom correspondence and reprint requests should be

addressed. The complete (compiled) nucleotide sequence of

pKUN9 is available on request.

Abbreviations: Ap, ampicillin; cfu, colony-forming unit(s); A, deletion; F-strand, see Fig. 4; Ff, F-speciftc filamentous phage;

yielding a large pool of RF molecules, and (iii) conversion of RF back to viral progeny ss DNA. Where- as in the first stage only host enzymes are involved, the phage-encoded gene II protein is absolutely required for RF replication and ss DNA synthesis (Denhardt et al., 1978).

Gene II protein introduces a nick at a specific position (viral strand &or ( + >ori) in the viral strand (Meyer et al., 1979) thereby creating a 3’“OH primer -- I-strand, see Fig. 4; moi, multiplicity of infection; on‘, replication

origin; ( + )oti, otion viral strand; PolIk, KIenow (large) fragment

of E. edi DNA polymerase I; pfu, plaque-forming unit(s); R,

resistance; RF, rephcative form DNA; ss, single-stranded; str,

streptomycin; sul, sulfonamide; tet, tetracycline; wt, wild type;

XGal, 5-bromo-4-chloro-indolyl-fi-n-galactoside; YT, yeast

tryptone; [ 1, indicates plasmid-carrier state.

0378-I 119~86~~~3.50 0 1986 Elsevier Science Publishers B.V. (Biomedical Division)

40

for replication according to a rolling circle mecha-

nism. After one round of replication gene II protein

again cleaves the displaced viral strand at exactly the

same position, separating the parental ( + ) from the

newly synthesized ( + ) strand. Concomitantly, the

resulting RF and ss DNA molecules are covalently

closed yielding circular molecules (Meyer and

Geider, 1982). Early in infection the newly synthe-

sized ss DNA is converted into RF. Late in in-

fection, however, the ss DNA is covered by the

phage-encoded ss DNA binding protein (gene V pro-

tein) leading to the synthesis of progeny ss DNA.

Maturation of phage particles takes place at the host

cell membrane. For this process a specific DNA

sequence (packaging or morphogenetic signal) con-

tiguous to the ( + )ori is required (Dotto and Zinder,

1983; B.P.H.P., J.G.G.S. and R.N.H.K., sub-

mitted).

MATERIALS AND METHODS

(a) Bacteria, phages and plasmids

Escherichia coli JMlOl/F’/N3 {supE, thi, A(lac-

proAB), [F’, traD36, proAB+, lacP, lacZAM151,

[N3, tet, str, ml]}, was constructed by introduction

via conjugation of the N3 plasmid of strain JE257 1

(Peeters et al., 1985). Strains N4156 (PoZA, en&t. thy.

gyrA ) and N4156/F’ are described by Gellert et al.

(1977). The N3 plasmid was transferred to strain

N4156 via conjugation with strain JE257 1.

The Ff bacteriophage IRl, a variant of wt fl, was

used for the packaging of the F-strand of plasmid

pKUN9, because IRl is resistant to negative inter-

ference by plasmids that carry a functional Ff origin

(Dotto et al., 1981; Enea and Zinder, 1982). Bac-

teriophage IKe-9, a variant of wt IKe, was isolated

by us and was used for the packaging of plasmid

pKUN9, because infection with this phage results in

a much higher yield of transducing particles than

infection with wt IKe (unpublished results).

Recently we showed that the biological functions

of the gene II proteins of IKe and Ff are not ex-

changeable (B.P.H.P., J.G.G.S. and R.N.H.K.,

submitted). In addition we have demonstrated that,

provided the orientations of the viral strand oti’s

are opposite to each other, recombinant plasmids

that contain the ( + )on’s of both IKe and Ff can be

replicated by gene II protein of either phage. In the

presence of IKe gene II protein, only the IKe ( + )oti

is used for replication, whereas the ( + )oti of Ff is

used in case gene II protein of Ff is present

(B.P.H.P., J.G.G.S. and R.N.H.K., submitted).

Furthermore, these plasmids can be efficiently

packaged into phage-like particles, provided they

also contain the phage morphogenetic signal. The

function of this signal is coupled to the presence of

a functional phage ( + )oti on the same DNA strand

(Dotto et al., 1981; Dotto and Zinder, 1983;

B.P.H.P., J.G.G.S. and R.N.H.K., submitted).

Consequently, if a recombinant plasmid carries

both the viral strand ori, as well as the morphogenetic

signal of each phage in an opposite orientation, one

might expect that infection of cells harboring such

plasmid with either IKe or Ff, will lead to the selec-

tive packaging of either DNA strand into phage-like

particles. Since these properties permit the determi-

nation of the nucleotide sequence on both strands of

one single clone, we have incorporated these selec-

tive packaging capabilities in a new versatile clon-

ing/sequencing vector, pKUN9, which is a derivative

of plasmid pUC9 (Vieira and Messing, 1982).

Plasmid pIKori-2b( 1) contains an IKe DNA frag-

ment on which both the viral strand ori of IKe as well

as the morphogenetic signal that is required for the

packaging of ss DNA into phage-like particles is

located (B.P.H.P., J.G.G.S. and R.N.H.K., sub-

mitted). Plasmids pEMBL8 and pUC9 have been

described (Dente et al., 1983; Vieira and Messing,

1982).

(b) Enzymes and biochemicals

All restriction enzymes, T4 DNA ligase and PolIk

were obtained from Bethesda Research Labora-

tories, New England Biolabs or Boehringer-Mann-

heim and used with the three buffer system described

by Maniatis et al. (1982) or with the buffer suggested

by the supplier.

Blunt ends were created with PolIk as described

(Peeters et al., 1985).

The deoxyribonucleotide sequencing primers

5’-dGTAAAACGACGGCCAGTG-3’ [(-) or

master primer] and S’-dAACAGCTATGAC-

CAT-3’ [( + ) or reverse primer] were synthesized

by Dr. J. van Boom and co-workers (Department of

Organic Chemistry, Leiden University). The master

(-) and reverse ( + ) primers are complementary to

the codogenic and non-codogenic strands of the 1acZ

gene, respectively (see Fig. 4).

41

The sources of the other biochemicals used have

been given previously (Konings, 1980; Peeters et al.,

1983; 1985).

(c) Transformation

E. coli was made competent and transformed by

the method of Mandel and Higa (1970) as described

by Maniatis et al. (1982). If required, the cells were

infected by IKe or Ff 10 min prior to CaCl,-treat-

ment.

Transformed cells were spread on 2YT agar-

plates (Miller, 1972) containing 100 pg Ap/ml and

0.004% of XGal when appropriate.

(d) Isolation of ss DNA and sequence analysis

E. coli JMlOl/F’/N3[pKUN9] was grown at

37°C until the culture had reached a density of

5 x lo* cells/ml. Subsequently the cells were infected

with either bacteriophage IKe-9 or IRl at an moi of

20. After incubation overnight, ss DNA was isolated

from the lilamentous (phage-like) particles produced

as described by Peeters et al. (1985).

DNA sequence analysis was performed by the

dideoxy-method described by Sanger et al. (1977).

In case packaging was instructed by phage IRl, the

ss DNA (F-strand) was sequenced with the aid of

the reverse ( + )primer whereas the master (-)primer

was used for the sequence analysis of the DNA

strand (I-strand) packaged under the instruction of

IKe-9 (see Fig. 4). Commercially available se-

quencing primers can be used as well.

RESULTS

(a) Construction of plasmid pKUN9

As drawn schematically in Fig. 1, for the construc-

tion of pKUN9 we chose pUC9 as parental plasmid

because it contains several attractive features for

cloning (Vieira and Messing, 1982). Foreign DNA

can be inserted at a variety of restriction endo-

nuclease cleavage sites within a short polylinker

DNA, present in the coding sequence of the a-pep-

tide of p-galactosidase. This allows the direct identi-

fication of recombinant clones without the need of

replica-plating (Messing 1983).

Previously we have described the construction of

a plasmid, pIKori-2b(l), that contains both the

functional ( + )ori and the morphogenetic signal of

bacteriophageIKe(Fig. l)(B.P.H.P.,J.G.G.S., and

R.N.H.K., submitted). As schematically outlined in

Fig. 1, the IKe insert was recovered from this plas-

mid and subsequently cloned into the NdeI site of

pUC9. Recombinant plasmids were selected by

making use of the fact that the ColE 1 origin of pUC9

is not functional in cells lacking DNA polymerase I

(Bolivar et al, 1977). Thus in cells in which this

enzyme is absent (PolA mutants), pUC9-derived

recombinant plasmids cannot replicate unless

another functional origin is present. The ligation

mixture was therefore used to transform polA cells

(strain N4 156/N3) which had been infected with IKe

to provide in tram a source for gene II protein. ApR

colonies were obtained indicating that the IKe

( + )oti was successfully cloned. The plasmid DNA

of several colonies was isolated and used to trans-

form strain JMlOl/F’/N3. After selection on plates

containing Ap and XGal, the plasmid DNA of

several blue colonies was isolated and analyzed by

restriction enzyme digestion (not shown). The results

demonstrated that the IKe fragment could be cloned

in both orientations. The plasmid that contained the

( + )otiof IKe in an orientation identical to that of the

lad gene of pUC9 was called pUCI-2e (Fig. 1).

The functional ( + )ori plus the morphogenetic

signal of Ff (fl) is contained in a RsaI-fragment that

almost completely spans the phage intergenic region

(Hill and Petersen, 1982). The same fragment is also

present in the Ff (fl) DNA sequence present in the

pEMBL-plasmids (Dente et al., 1983). After di-

gestion of plasmid pEMBL8( + ) with RsaI, a 5 14-bp

fragment containing the ( + )oti and the morpho-

genetic signal of Ff was isolated and ligated into the

NarI-site of pUCI-2e (Fig. 1). After transformation

of IRl-infected poL4 cells (strain N4156/F’), ApR

colonies were obtained and their plasmid DNA was

isolated and used to transform strain JMlOl/F’/N3.

Analysis of the plasmid DNA of several blue ApR

colonies by restriction enzyme digestion (not shown)

indicated that all plasmids examined had an identical

structure and contained the Ff (fl) (+ )oti in an

orientation opposite to that of IKe and the IacZgene.

42

pKUN9

(4000)

Fig. 1. Construction ofplasmid pKUN9. The EcoRI-BumHI fragment containing the viral strand ( + )ori and contiguous packaging signal

of the N-specific lilamentous phage IKe (Khatoon et al., 1972; Peeters et al., 1985) was recovered from plasmid pIKori-2b(l) (B.P.H.P.,

J.G.G.S, and R.N.H.K., submitted) and subcloned into the unique NdeI site of plasmid pUC9 (Vieira and Messing, 1982), yielding

plasmid pUCI-2e. Subsequently the ( + )oti and contiguous packaging signal of Ff phage fl, which are present on a 5 14-bp RFaI fragment

in plasmid pEMBL8 (Dente et al., 1983) were cloned into the NurI site of plasmid pUCI-2e yielding plasmid pKUN9. The ( + )ori’s are

indicated by an arrow and a plus sign in parentheses ( + ). The cleavage sites ofthe restriction enzymes used in the construction of pKUN9

are indicated. ori, ColEl ori of pUC9; lacZ, part of the lac-operon, including the N-terminal part of the IacZ gene, present in pUC9.

(b) Efficient packaging of the DNA strands of

pKUN9

To obtain evidence that under the instruction of

both IKe-9 and of IRl, ss DNA of pKUN9 is

efficiently packaged into particles transducing ApR,

JMlOl/F’/N3 cells harboring pKUN9 were grown

to a density of 5 x 10’ cells/ml and subsequently

infected with either IKe-9 or IRl (moi of 20). After

overnight infection, the number of infective phage

and transducing particles was established. From the

data presented in Table I, it can be seen that the

number of transducing particles present in the super-

natant of both IKe-9 and IRl-infected cultures is

approx. 10’ ‘/ml, which is identical to or slightly less

than the number of phages present in the super-

natant. This indicates that plasmid pKUN9 is

packaged efficiently by the helper phages.

Similar observations were made after isolation of

the ss DNA from the culture supematants and sub-

sequent fractionation on agarose gels (Fig. 2). In

each DNA preparation two ss DNA species, one

representing phage DNA and the other plasmid

DNA, were present in large amounts. Phage IKe-9

43

TABLE I

Production of phage and transducing particles by phage-infected cells harboring pKUN9”

Infective phage Transducing particles

(pfu/ml) (cfu/ml)

JMlOl/F’/N3[pKUN9]

IKe-9 infected

JMlOl/F’/N3[pKUN9]

IR 1 infected

1.4 x 10” 1.4 x 10”

2.1 x 10” 0.8 x 10”

a To establish the number ofinfective phages and ApR-transducing particles, 100 ~1 of culture was centrifuged for 5 min in an eppendorf

centrifuge. Subsequently 50 ~1 of the supernatant was transferred to another tube and incubated for 2 min at 65’ C to kill the remaining

bacteria. 10 ~1 of appropriate dilutions was then added to 100 ~1 of exponentially growing E. coli cells and incubated at 37°C for 10 min.

The mixtures were spread on 2YT agar plates containing Ap (100 pg/ml) and incubated overnight at 37°C. The number of ApR colonies

formed was used to calculate the number oftransducing particles (cfu) present in the original culture supernatant. The number ofinfective

phages (pfu) present in the culture supernatant was determined by plating serial dilutions on an appropriate indicator strain.

gives rise to additional DNA species which are the result of the presence of IKe miniphages in the phage stock (unpublished results).

From the data presented above we conclude that both under the instruction of IKe-9 as well as IRl, ss DNA of pKUN9 is efficiently packaged into phage-like particles.

(c) Sequence analysis of the ss plasmid

The fact that gene II protein of IKe is unable to replicate DNA molecules containing the ( + )~ti of

A B C D

Fig. 2. 1% agarose gel electrophoresis of the ss DNA isolated

from culture supernatant of phage-infected plasmid-less or

pKUN9-harboring JMlOl/F’/N3 cells (see MATERIALS AND

METHODS, section d). (A) JMlOl/F’/N3-[pKUN9], IRl-

infected; (B) JMlOl/F’/N3, IRl-infected; (C) JMlOl/F’/N3-

[pKUN9], IKe-9 infected; (D) JMlOl/F’/N3 IKe-9 infected. The

smaller band in lanes C and D represents ss DNA from IKe

miniphages which are present in the tilamentous phage stock.

Ff and vice versa (B.P.H.P., J.G.G.S. and R.N.H.K., submitted) indicates that after infection by IKe-9 of cells harboring pKUN9 only the ( + )oti of IKe, and after infection by Ff only the ( + )oti of Ff will be used for replication by gene II protein. Consequently after infection by IKe-9 the I-strand and after infection by IRl the F-strand will be packaged into transducing phage-like particles. To provide evidence that this is indeed correct, the nucleotide sequence of the IacZ gene present on the ss plasmid isolated from the culture supernatant of IKe-9 and IRl infected cells was established with the aid of the master and reverse sequencing primers (see MATERIALS AND METHODS, section b). Because these primers are complementary to only one strand of the IacZ gene (which is present in both the I- and F-strand of pKUN9, but not in the phage DNA), sequence analysis using these primers will determine whether only one or both strands of pKUN9 are present in the ss DNA preparations. As shown in Fig. 3, the nucleotide sequence of the 1acZ gene, present in the ss DNA isolated from transducing particles produced by IKe-9-infected cells can be established using the master primer, whereas for the analysis of the nucleotide sequence of the 1acZ gene present in the ss DNA, isolated from transducing particles produced by IRl-infected cells, the reverse sequencing primer must be used. Similar conclusions were reached after dot-blot hybridization of the ss DNA preparation using the same primers as probe. The master primer only hybridized to ss DNA packaged by IKe-9, whereas the reverse primer only hybridized to IRl-packaged DNA (not shown).

T G A T T A c G c c A A G C T T G G c T G C A G G T C G A c G G A T C C C C G G

J)

, .?\

f

r, c

4 A

master-primer

L

T C G A A G T G A A T T c c c G G G G A T C c G T C G A C C T G C A G C C A A G C T T G

7 G c

reverse-primer ‘G

Fig. 3. Sequence analysis ofthe ss DNA isolated from the supernatant of either IKe-9 infected JMlOI~F‘~N3[pKUN9], using the master/( -)primer (left) or IRl infected JMlOl~F’~N3- [pKUNY], using the reverse/( + Iprimer (right). The sequence shows the region containing the multiple cloning sites at the beginning of the 1ucZ gene (cf., Fig. 4).

These observations definitely prove that after infection of cells harboring pKUN9 with IKe-9 the I strand and, after infection with IRI, the complementary F strand is packaged efficiently and selec- tively into phage-like transducing particles. More- over, the results demonstrate that the ss DNA isolated from these particles can easily be used for nucleotide sequence analysis.

(d) Cloning in plasmid pKUN9

For cloning in plasmid pKUN9 the same proce- dures as described for cloning in plasmid pUC9 (Vieira and Messing, 1982) should be followed. The efficiencies of cloning in both vectors are comparable and ceils harboring a recombinant plasmid grow as well as nontransformed cells. The efficiency of packaging by phage IKe-9 is generally lower than that by phage IRI. To establish the nucleotide sequence of a DNA insert the ss DNA isolated from filamentous particles present in 0.2-0.4 ml of culture supernatant is sufficient.

As an example of cloning, the HueIII-C fragment (53 1 bp) of the genome of the filamentous phage PM (Luiten et al., 1985) was inserted in the SmaI-site of pKUN9. After selection for the recombinant plasmid, its single strands were separately recovered by infection with either IKe-9 or IRl (see MATERIALS

AND METHODS, section d). Subsequently the nucleotide sequence of the insert in the I and F strand was established with the aid of the master and reverse primer, respectively. From the results it could be concluded unambiguously that either strand of the recombinant plasmid was separately packaged, and that the sequence of the insert was exactly identicai, c.q. complements, to the nu~leotide sequence established previously for the HueHI C fragment in the Pf3 viral strand.

Studies which place the host vector system in the EK-1 category of the NIH Guidelines are in pro- gress.

SuPi /iiunHI 1acZ ii&d111 P&I H<ncII SIRUI fcoR1

5’-AAACAGCTATGACCATGATACGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAA~CACTGGCCGTCG~ACAA-3’ I-strand (TKe-9 packaged) *******t**t*******

3’-GTGACCGGCAGCAAAATG-5’ reverse/(+)-primer master/f-)-primer

5’-AACAGCTATGACCAT-3’ *O*$tlC*******:~

3’-?TTGTCGATACTGGTACTAATGCGGTTCGAACCGACGTCCAGCTGCCTAGGGGCCC~AAGTGACCGGCAGCAAAATGTT-5’ F-strand (IRl packaged)

Fig. 4. Nucleotide sequence of the beginning of the 1ucZ gene present in pKUN9 showing the multiple cloning sites and the position of the sequencing primers. The I- and F-strands are defined as the ones packaged under the instruction of bacteriophage IKe and Ff

(M 13, fd, and fl), respectively.

45

DISCUSSION

During the last few years a large number of recombinant DNA molecules have been constructed in which several unique biological functions have been combined to yield attractive tools for cloning and manipulation of DNA (Old and Primrose, 1982). These vectors are generally characterized by the

presence of a genetic dete~inant, the phenotype of which is altered by insertional inactivation. In addition, these vectors contain multiple unique restriction-enzyme cleavage sites allowing the direct cloning of variety of restriction fragments.

More recently cloning vehicles have been constructed which allow the direct identification of recombinant clones without the need of replica- plating. The most versatile of these vectors are the lilamentous phage vectors and pUC plasmids which make use of complementation of the lad mutation of suitable host strains (Vieira and Messing, 1982; Messing, 1983). Recently, Dente et al. (1983) have described the construction of a family of cloning vectors in which the properties of the pUC plasmids and the M13mp phages are combined. By cloning a fragment containing the functional viral strand oti and the morphogenetic signal of the Ff phage into the pUC plasmids, new plasmid vectors (pEMBL plasmids) were obtained. In the absence of helper phages replication of these plasmids is dependent on the ColEI origin. Upon supe~nfection of ceils h~bo~ng these plasmids with phage Ff, the plasmids enter the Ff mode of replication leading to the selective packaging of one strand (F strand) into phage-like particles.

Although the Ml3mp phages and the pEMBL plasmids are particularly suited for the preparation of large amounts of ss DNA which, for instance, can be used for DNA sequence analysis, they suffer from one great drawback. With the aid of these vectors only one of the DNA strands (i.e., the strand on which the viral strand &is located) can be packaged. Since it is generally necessary to establish the nucleotide sequence of both strands of a DNA fragment, the fragment of interest must therefore be cloned in both orientations in the same vector. Frequently, however, the RNA sequence of a relativety large DNA molecule is established via shotgun cloning of randomly generated fragments (Peeters et al., 1985; Sanger et al., 1980; Messing et al., 198 1). In this case

sequencing of both DNA strands requires the presence in the DNA library of clones containing over- lapping fragments whose o~entation is reversed. If this requirement is not met, the fragment of interest must be recovered from the particular recombinant and recloned in the opposite orientation. Alterna- tively, the nucleotide sequence can be established via sequence analysis using double-stranded DNA, either directly (Wallace et al., 1981) or after exonuclease III treatment (Guo and Wu, 1982). It is ob- vious that either method requires the isolation and purification of intracellular plasmid DNA, a process which is rather time-consuming, particularly when a large number of clones is involved. Moreover, the results of sequence analysis using double-stranded DNA are not routinely as good as those using a ss DNA template (Deininger, 1983). The cloning/sequencing vector pKUN9, described in this paper, overcomes these problems.

Despite the introduction of the Ff (fl) and IKe sequences in pUC9, with the exception of the Ace1 site, all cloning sites present in the 1ucZ DNA remain unique.

Plasmid pKUN9 not only combines all unique properties of the ss phage vectors and the pUC-plasmids, but, moreover, it extends their use by making it possible to obtain separately either DNA strand of a recombinant plasmid in an ss form. The latter property has been demonstrated in our laboratory not only for the DNA strands of pKUN9, but also for recombinant DNA molecules constructed from pKUN9 and DNA fragments obtained from differ- ent sources (unpublished results). Undoubtedly, this property will appeal especially to those investigators who intend to make use of shotgun cloning for the establishment of the sequence of a relatively large DNA molecule. Since, by using pKUN9, twice the amount of sequence information can be obtained from one single clone, the time needed for the collec- tion of the desired sequence data can considerably be reduced. Alternatively, by cloning relatively small fragments, the nucleotide sequence of both strands can be established simultaneously. This is especially useful when ambiguities are encountered in the sequence analysis of one strand.

In conclusion, pKUN9 is a useful vector for cloning and DNA sequencing (Sanger et al., 1980) as well as for site directed mutagenesis (Zoller and Smith, 1982), Sl-mapping, mRNA cloning (Hei-

46

decker and Messing, 1983), expression of cloned DNA (Slocombe et al., 1982) and for use as a ss hybridization probe (Hu and Messing, 1982).

ACKNOWLEDGEMENTS

We thank Dr. J. van Boom and coworkers for the synthesis of the sequencing primers, Els Verhoeven and Georg van der Staaij for technical assistance, and Dr. R. Luiten for his help in the preparation of the manuscript.

NOTE ADDED IN PROOF

A patent application has been tiled by the University of

Nijmegen for the construction and use of recombinant DNA

molecules in which the unique properties of the ( + )orr%, and

their contiguous packaging signals, of Ff and IKe are combined.

REFERENCES

Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C.,

Heyneker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.:

Construction and characterization of new cloning vehicles,

II. A multipurpose cloning system. Gene 2 (1977) 95-113.

Bradley, D.E.: Morphology ofpili determined by the N-incompa-

tibility group plasmid N3 and interaction with bacteriophages

PR4 and IKe. Plasmid 2 (1979) 632-636.

Deininger, P.L.: Approaches to rapid DNA sequence analysis.

Anal. Biochem. 135 (1983) 247-263.

Denhardt, D.T., Dressler, D. and Ray, D.S. (Eds.): The Single-

Stranded DNA Phages. Cold Spring Harbor Laboratory,

Cold Spring Harbor, NY, 1978.

Dente, L., Cesareni, G. and Cortese, R.: pEMBL: a new family

of single-stranded plasmids. Nucl. Acids Res. 11 (1983)

1645-1655.

Dotto, G.P., Horiuchi, K. and Zinder, N.D.: Functional analysis

of bacteriophage fl intergenic region. Virology 114 (1981)

463-473.

Dotto, G.P. and Zinder, N.D.: The morphogenetic signal of

bacteriophage fl. Virology 130 (1983) 252-256.

Enea, V. and Zinder, N.D.: Interference resistant mutants of

phage fl. Virology 122 (1982) 222-226.

Gellert, M., Mizuuchi, K., O’Dea, M.H., Itoh, T. and Tomizawa,

J.: Nalidixic acid resistance: a second genetic character

involved in DNA gyrase activity. Proc. Natl. Acad. Sci. USA

74 (1977) 4772-4776.

Guo, L-H. and Wu, R.: New rapid methods for DNA sequencing

based on exonuclease III digestion followed by repair syn-

thesis. Nucl. Acids Res. 10 (1982) 2065-2084.

Heidecker, G. and Messing, J.: Sequence analysis of zein cDNAs

obtained by an efficient mRNA cloning method. Nucl. Acids

Res. 11 (1984) 4891-4906.

Hill, D.F. and Petersen, G.B.: Nucleotide sequence of bacterio-

phage fl DNA. J. Virol. 44 (1982) 32-46.

Hu, N. and Messing, J.: The making of strand-specific Ml3

probes. Gene 17 (1982) 271-277.

Kathoon, H., Dyer, R.V. and Dyer, V.: A new tilamentous bacterio-

phage with sex-factor specificity. Virology 48 (1972) 145-155.

Konings, R.N.H.: Template function of restriction enzyme frag-

ments of phage M 13 replicative form DNA. Methods Enzy-

mol. 65 (1980) 795-811.

Luiten, R.G.M., Putterman, D.C., Konings, R.N.H., Schoen-

makers, J.G.G. and Day, L.A.: Nucleotide sequence of the

genome of Pf3, an IncP-1 specific filamentous phage of

Pseudomonas aeruginosa. J. Virol. 56 (1985) 268-276.

Mandel, M. and Higa, A.: Calcium dependent bacteriophage

DNA infection. J. Mol. Biol. 53 (1970) 154-161.

Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning.

A Laboratory Manual. Cold Spring Harbor Laboratory, Cold

Spring Harbor, NY, 1982.

Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgun

DNA sequencing. Nucl. Acids Res. 9 (1981) 309-321.

Messing, J.: New Ml3 vectors for cloning. Methods. Enzymol.

101 (1983) 20-78.

Meyer,T.F., Geider, K., Kurz, C. and Schaller, H.: Cleavage site

of bacteriophage fd gene II-protein in the origin of viral

strand replication. Nature 278 (1979) 365-367.

Meyer, T.F. and Geider, K.: Enzymatic synthesis of bacterio-

phage fd viral DNA. Nature 296 (1982) 828-832.

Miller, J.H.: Experiments in Molecular Genetics. Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY, 1972.

Old, R.W. and Primrose, S.B.: Principles of Gene Manipulation,

2nd ed.. Blackwell, London, 1982.

Peeters, B.P.H., Konings, R.N.H. and Schoenmakers, J.G.G.:

Characterization of the DNA binding protein encoded by the

N-specific filamentous Escherichia coli phage IKe: binding

properties of the protein and nucleotide sequence of the gene.

J. Mol. Biol. 169 (1983) 197-215.

Peeters, B.P.H., Peters, R.M., Schoenmakers, J.G.G. and

Konings, R.N.H.: Nucleotide sequence and genetic organi-

zation of the genome of the N-specific filamentous bacterio-

phage IKe: comparison with the genome of the F-specific

filamentous phages M13, fd and fl. J. Mol. Biol. 181 (1985)

27-39.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with

chain terminating inhibitors. Proc. Nat]. Acad. Sci. USA 74

(1977) 5463-5467.

Sanger, F., Coulson, A.R., Barrel, B.G., Smith, A.J.H. and Roe,

B.A.: Cloning in single-stranded bacteriophage as an aid to

rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178.

Slocombe, P., Easton, A., Basely, P. and Burke, D.C.: High level

expression of an interferon a2 gene cloned in phage M 13mp7

and subsequent purification with a monoclonal antibody.

Proc. Natl. Acad. Sci. USA 79 (1982) 5455-5459.

Vieira, J. and Messing, J.M.: The pUC plasmids, an M13mp7-

derived system for insertion mutagenesis and sequencing

with synthetic universal primers. Gene 19 (1982) 269-276.

Wallace, R.B., Johnson, M.J., Suggs, S.V., Miyoshi, K., Bhatt, R.

and Itakura, K.: A set of synthetic oligodeoxyribonucleotide

primers for DNA sequencing in the plasmid vector pBR322.

Gene 16 (1981) 21- 26.

Zoller, M.J. and Smith, M.: Oligonucleotide-directed muta-

genesis using M13-derived vectors: an efftcient and general

procedure for the production of point mutations in any

fragment of DNA. Nucl. Acids Res. 10 (1982) 6487-6500.

Communicated by H. van Ormondt

Documents

Plasmid pKUN9, a versatile vector for the selective packaging of both DNA strands into single-stranded DNA-containing phage-like particles