Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.)

Q3

lable at ScienceDirect

Plant Physiology and Biochemistry xxx (2014) 1e7

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354

55

PLAPHY4032_proof ■ 26 August 2014 ■ 1/7

Contents lists avai

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

565758596061626364
Research article 6566676869707172
Physiological and molecular responses to drought stress in rubber tree(Hevea brasiliensis Muell. Arg.)

Li-feng Wang*

Danzhou Investigation & Experiment Station of Tropical Crops, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical AgriculturalSciences, Danzhou, Hainan 571737, China

7374
757677787980818283848586
a r t i c l e i n f o

Article history:Received 4 April 2014Accepted 14 August 2014Available online xxx

Keywords:Antioxidative enzymeDroughtHevea brasiliensisOsmoregulationPhotosynthesisReactive oxygen species

Abbreviations: ACAT, acetyl-CoA C-acetyltransferasCAT, catalase; CDPK, calcium-dependent protein kinaacyl-CoA reductase; dww, day without water; Mperoxidase; ROS, reactive oxygen species; RWC, rsuperoxide dismutase.* Tel.: þ86 898 23300459; fax: þ86 898 23300315

E-mail address: [email protected].

http://dx.doi.org/10.1016/j.plaphy.2014.08.0120981-9428/© 2014 Published by Elsevier Masson SAS

87888990919293

Please cite this article in press as: Wang, L.-fArg.), Plant Physiology and Biochemistry (20

a b s t r a c t

Plant drought stress response and tolerance are complex biological processes. In order to reveal thedrought tolerance mechanism in rubber tree, physiological responses and expressions of genes involvedin energy biosynthesis and reactive oxygen species (ROS) scavenging were systematically analyzedfollowing drought stress treatment. Results showed that relative water content (RWC) in leaves wascontinuously decreased with the severity of drought stress. Wilting leaves were observed at 7 daywithout water (dww). Total chlorophyll content was increased at 1 dww, but decreased from 3 dww.However, the contents of malondialdehyde (MDA) and proline were significantly increased underdrought stress. Peroxidase (POD) and superoxide dismutase (SOD) activities were markedly enhanced at1 and 3 dww, respectively. Meanwhile, the soluble sugar content was constant under drought stress.These indicated that photosynthetic activity and membrane lipid integrity were quickly attenuated bydrought stress in rubber tree, and osmoregulation participated in drought tolerance mechanism inrubber tree. Expressions of energy biosynthesis and ROS scavenging systems related genes, includingHbCuZnSOD, HbMnSOD, HbAPX, HbCAT, HbCOA, HbATP, and HbACAT demonstrated that these genes weresignificantly up-regulated by drought stress, and reached a maximum at 3 dww, then followed by adecrease from 5 dww. These results suggested that drought stress adaption in rubber tree was governedby energy biosynthesis, antioxidative enzymes, and osmoregulation.

© 2014 Published by Elsevier Masson SAS.

94
95 96979899
100101102103104105106107108

1. Introduction

Water deficit is a major constraint to plant growth and pro-ductivity (Monclus et al., 2006). Prolonged drought stress leads tosevere problems, such as decrease in water flux, closing of stomataand reduction in carbon dioxide fixation. Tree can die of both hy-draulic failure and carbon starvation during drought stress (Zeppelet al., 2013). Inhibition of photosynthesis and energy dissipation arecommon features under drought stress in many plant species,which reflect as Photosystem II thermostability and electrontransport changes (Zhou et al., 2007; Brestic et al., 2012; Yan et al.,2013; Zivcak et al., 2014). Plant anti-drought characters are mainly

e; APX, ascorbate peroxidase;se; COA, a long-chain-fatty-DA, malondialdehyde; POD,elative water content; SOD,

.

.

109110111112113114115116

., Physiological and molecula14), http://dx.doi.org/10.1016

associated with low transpiration co efficiency and osmoticadjustment, etc. Osmotic adjustment involves the accumulationof compatible solutes (low-molecular-weight organic osmolytes),such as proline, mannitol, sorbitol, fructans, sucrose and oligosac-charides (Rhodes and Hanson, 1993). These large amounts ofcompounds play a key role in maintaining the osmotic equilibriumand protecting membranes as well as macromolecules (Hoekstraet al., 2001; Couee et al., 2006). These regulations were related toabscisic acid (ABA), calcium-dependent protein kinase (CDPK),NADP-malic enzyme (Shao et al., 2013) and phospholipid signalingpathways (Zhu, 2002). Overexpression of key genes in these path-ways, such as DREB transcription factor, enhanced drought toler-ance in Arabidopsis and Lotus corniculatus (Zhou et al., 2012). Inaddition, overexpression of soybean ubiquitin-conjugating enzymegene GmUBC2 can enhance drought tolerance by modulatingabiotic stress-responsive genes expression in Arabidopsis (Zhouet al., 2010). Since drought stress doubtless generates reactive ox-ygen species (ROS) in chloroplasts andmitochondria (Apel and Hirt,2004; Asada, 2006), so ROS-scavenging enzymes play importantroles in drought tolerance responses. ROS-scavenging systems

117118119

r responses to drought stress in rubber tree (Hevea brasiliensis Muell./j.plaphy.2014.08.012

Delta:1_given name

mailto:[email protected]

www.sciencedirect.com/science/journal/09819428

http://www.elsevier.com/locate/plaphy

http://dx.doi.org/10.1016/j.plaphy.2014.08.012



L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e72

1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545556575859606162636465

66676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106


included superoxide dismutase (SOD), peroxidase (POD), ascorbateperoxidase (APX), monodehydroascorbate reductase (NADH),catalase (CAT), etc. Natural rubber is obtained from para rubber tree(Hevea brasiliensis Muell. Arg.). Rubber tree originated from theAmazon basin in South America. This area falling between equatorand 15�S is characterized by a wet equatorial climate (Gonçalveset al., 2009). The optimal growth conditions of rubber tree arehigh temperature around 28 ± 2 �C and high humidity about2000e4000 mm rainfall per annum (Webster and Baulkwill, 1989;Priyadarshan et al., 2005). However, unlike traditional plantationsin south America and southeast Asia, rubber tree planting in thesemarginal areas or non-traditional rubber-growing regions, such asnortheastern states of India, south China, north and northeastThailand, usually faces abiotic stress like drought, strongwinds, andlow temperature, etc. Drought stress results in growth retardationof both rubber tree seedlings and mature tapping trees, shorteningtapping period, blocking latex flow for lowwater supply, decreasingdry latex contents, increasing TPD (tapping panel dryness) occur-rence, and even causes tree death at severe conditions (Huang andPan, 1992).

Many strategies and indices were used for selecting andbreeding drought-tolerant rubber tree clones, such as drought-tolerant rootstock (Ahamad, 1999), leaves with more epicuticularwaxes (Gururaja Rao et al., 1988), etc. Hydraulic mechanism wasused for explaining drought tolerance mechanism in rubber tree(Ayutthaya et al., 2011). The development of molecular biologicaltechniques in rubber tree provides new functional genes to extendour insights of drought tolerancemechanism. Recently, HbCuZnSODand HbMnSOD have been cloned in rubber tree, and over-expression of HbCuZnSOD in rubber tree clone PB260 conferredenhanced drought tolerance (Leclercq et al., 2012). These resultsindicated that ROS-scavenging enzymes played crucial roles indrought tolerance mechanisms. Representative genes in mito-chondria, such as HbAPX, an ascorbate peroxidases gene (Mai et al.,2009), and HbATP (Chye and Tan, 1992) were cloned. However, inrubber tree, the functions of most ROS related genes in droughtresistance mechanism were not well identified. In this study, ex-pressions of 8 genes involved in energy biosynthesis and ROSscavenging systemswere characterized under drought treatment inseedlings of rubber tree clone GT1. The underlying drought toler-ance mechanism in rubber tree was discussed.

107108109110111112113114115116117118119120121122123

2. Methods

2.1. Plant material and drought treatment

Rubber tree clone GT1 (original clone breed in Indonesia)seedlings were grown in the plastic pots in the chamber withvermiculite and turfy soil (1:3) at the experimental farm of theChinese Academy of Tropical Agricultural Sciences in Danzhou city,Hainan province, China (19�51051N; 109�55063E). In growing sea-son, the average temperature was about 30 �C, precipitation wasabout 180mm, and humidity was around 97.5%. Seedlings with twogrowth units of leaves were subjected to progressive drought bywithholding water, and the leaves in dark green stage werecollected at different time points after treatment and used forfollowing assay.

124125126127128129130

2.2. Relative water content

The fresh weight, dry weight and saturated weight of treatedleaves were measured. RWC (relative water content) of leaves wascalculated according to formula: 100� [(freshweightedryweight)/(saturated weight e dry weight)].

Please cite this article in press as: Wang, L.-f., Physiological and moleculaArg.), Plant Physiology and Biochemistry (2014), http://dx.doi.org/10.1016

2.3. Determination of chlorophyll (Chl) content

Chlorophyll was extracted with 80% ice cold acetone from 0.1 gleaves samples. The extract was measured spectrophotometricallyat 475, 645 and 663 nm with spectrophotometer (GE Ultrospec™2100 pro UV/visible, USA), respectively. Specific chlorophyll andb-carotene contents were determined according to the reportedmethod (Lichtenthaler, 1987).

2.4. Measurements of activities of SOD and POD

SOD (EC 1.15.1.1) was prepared by first freezing 0.5 g of leavessample in liquid nitrogen to prevent proteolytic activity, followedby grinding with 5 ml extraction buffer (0.1 M phosphate buffer, pH7.5, containing 0.5 mM EDTA, and 1 mM ascorbic acid). Brie wascentrifuged for 20 min at 15 000 g and the supernatant was used asan enzyme. The soluble proteins concentration in the supernatantwere determined using the method of Bradford with bovine serumalbumin (BSA) as standard (Bradford, 1976). The per unit activity ofSOD was estimated by recording the decrease in optical density ofnitro blue tetrazolium (NBT) induced by the enzyme (Dhindsa et al.,1981). 3 ml of the reaction mixture contained 13 mM methionine,75 mM nitroblue tetrazolium chloride, 0.1 mM EDTA, 50 mMphosphate buffer (pH 7.8), 50 mM sodium carbonate, and 0.1 mlenzyme solution. The reaction was started by adding 2 mM ribo-flavin. The reaction mixtures were illuminated for 15 min at90 mmolm�2 s�1 (placing the test tubes under two 15W fluorescentlamps). A complete reaction mixture without enzyme, which gavethe maximal colour, was served as the control. The reaction wasstopped by switching off the light and putting the tubes into dark.A non-irradiated complete reaction mixture was served as a blank.

POD (EC 1.11.1.7) activity was determined with spectropho-tometer. 0.5 g leaves sample was extracted with 5 ml 100 mMphosphate buffer (pH 6.0). Homogenate was centrifuged at 4000 gfor 10 min. Reaction mixture was 50 ml 100 mM phosphate buffer(pH 6.0) with 23 mM guaiacol and 1.8 mM hydrogen peroxide. 1 mlsupernatant was added into 3 ml reaction mixture. The change ofOD was recorded at 470 nm. The per unit activity of enzyme wasdefined as the increase of 0.1 DOD per minute.

2.5. Measurement of malondialdehyde (MDA) content

MDA content was determined by the thiobarbituric acid reac-tion (Peever and Higgins, 1989). 1.0 g freshleaves sample was ho-mogenized in 5 ml 0.1% (w/v) trichloroacetic acid (TCA). Thehomogenate was centrifuged at 10 000 g for 5 min and 4 ml of 20%TCA containing 0.5% (w/v) thiobarbituric acid (TBA) were added to1ml of the supernatant. Themixturewas heated at 95 �C for 30minand then quickly cooled on ice. The contents were centrifuged at10 000 g for 15 min and absorbance of the supernatant at 532 and600 nm was read. After subtracting the non-specific absorbance at600 nm, the MDA concentration was determined by its extinctioncoefficient of 155 mM�1 cm�1.

2.6. Analysis of soluble sugar content

Soluble sugar content was measured by referring to (Creelmanet al., 1990). Take 0.1 g of leaf samples and put it into centrifugingtubes with a volume of 10 ml. Add 5 ml of 80% alcohol to the tubeand heat it in water for 30 min at 80 �C. Then cool down the tubeand centrifuge it at 1000 g for 10 min. Soluble sugar content wasdetermined by the phenol-sulfuric acid method.


L.-f. Wang / Plant Physiology and Biochemistry xxx (2014) 1e7 3

1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545556575859606162636465

6667686970717273


2.7. Determination of free proline content

Proline was determined following (Bates et al., 1973). Briefly,0.5e1.0 g leaves was homogenized in 10 ml of 3% sulfosalicylic acidand the homogenate filtered. The filtrate (2 ml) was treated with2 ml acid ninhydrin and 2ml of glacial acetic acid, thenwith 4 ml oftoluene. Absorbance of the colored solutions was read at 520 nmwith spectrophotometer.

Fig. 1. Relative water content in rubber tree GT1 seedling leaves after withholdingwater Values represent the mean ± SD of 6 replicate samples tested in replicate.

747576777879808182838485868788899091929394959697

2.8. Gene expression analysis by real-time PCR

Total RNA was extracted from leaves according to the methodsof (Qin, 2013). The quality and concentrations of the extracted RNAwere detected by agarose gel electrophoresis and measured bya spectrophotometer. First strand cDNA was synthesized from 2 mgof total RNAwithMMLV reverse transcriptase and random hexamerprimer (Takara) according to the manufacturer's instruction. ThecDNA was diluted 1:20 with nuclease-free water. Aliquots of thesame cDNA sample were used for real-time PCR with primersdesigned for the selected genes, and 18S rRNA (Hb18SRNA) was usedas a house-keeping gene (Table 1). The PCR reactionwas performedin a 20 mL reaction mixture containing 200 nM of each primer,1 � SYBER Green PCR Master Mix (Takara), and about 30 ng cDNA.Real-time RT-PCR was performed using the Bio-RAD CFX96 system(BioRAD, Hercules, CA, USA). The reactions were carried out asfollows: 3 min at 95 �C for denaturation, 10 s at 94 �C, 20 s at 60 �C,and 30 s at 72 �C for amplification for 45 cycles. The relativeabundance of transcripts was calculated according to the Softwareinstructions in Bio-RAD CFX96 Manager. The specificity of eachprimer pairs was verified by determining the melting curve at theend of each run and sequencing the amplified bands from gelelectrophoresis.

9899

100101102103104105106107108109110

2.9. Statistical analysis

All data were analyzed with IBM-SPSS analytical softwarepackage version 20.0 (IBM Corporation, USA). One-way ANOVA andTukey text were used to assess the different level. P < 0.01 (prob-ability level) was considered significant difference. Figures weredrawn by Origin data analysis and graphing software, OriginPro 9.1(OriginLab Corporation, USA). For real-time PCR analysis, eachvalue was the average of two biological replicates tested in tripli-cate, and for the other analyses, 6 replicate samples tested inreplicate were used.

Table 1Information of primers used in this study.

Genes Accessionnumber

Primer sequences (50e30)

HbCOA AY461413 Forward: GGTGACATGGTGGTGAATReverse: TGAAGTGACGAATGAGGTAA

HbACAT AF429387 Forward: GAGTATCCAGTTAGGCATCAReverse: CTAGTGAATCATGTCCAAGTC

HbAPX AF457210 Forward: CCAACTGACACCGTTCTTReverse: CAGCACCATCCTCTACATC

HbATP X58498 Forward: GCTTCACGCAGACTATTATCReverse: TAGAGGATGGAGATGAGGAA

HbCAT AF151368 Forward: GGTATTGTGGTTCCTGGTATReverse: ATGGTGATTGTTGTGATGAG

HbCuZnSOD AF457209 Forward: GTCCAACCACCGTAACTGReverse: GCCATCATCACCAACATTG

HbMnSOD L11707 Forward: TGTGCTGTAATGTTGACCTAReverse: GTTCACCTGTAAGTAGTATGC

HbRbsS M60274 Forward: GCCAAGGAAGTTGAATACCReverse: CCAGTAACGACCATCATAGT

Hb18SRNA AY435212 Forward: GCTCGAAGACGATCAGATACCReverse: TTCAGCCTTGCGACCATAC


3. Results

3.1. The effect of drought stress on relative water, chlorophyll, andb-carotene contents in the leaves of rubber tree

The relative water content (RWC) is a key indice for droughtstress study. As showed in Fig. 1, the RWC in the seedling leaves ofrubber tree clone GT1was continuously decreasedwith the severityof drought stress. It decreased by almost 20% at 9 daywithout water(dww) compared with that at 0 dww. A wilting phenotype wasobserved in leaves at 7 dww. Since photosynthesis in plants isdependent on capturing light energy in the pigment chlorophyll,and b-carotene (b-Car) is a pigmentwhich assists in light absorptionand energy dissipation in chloroplasts. So drought tolerance ofrubber tree was tested by evaluating photosynthesis, especiallycontents of chlorophylls and b-carotene under drought stress. Totalchlorophyll content was significantly increased at 1 dww, butshowed a sharp decrease at 3 dww, and kept a low level until 9 dww.This variation was associated with both Chl a and Chl b, since sig-nificant change was observed in Chl a and b during drought stress.The ratio of Chl a/b was increased until 5 dww, and then decreasedfrom 7 to 9 dww. Since most Chl a located in the reaction centerchlorophylleprotein complex, and most Chl b located in light har-vesting chlorophylleprotein complex, the attenuations of Chl a, Chl

Amplificationlength (bp)

Amplificationefficiency

Reference

145 1.872 ± 0.0183 (Deng et al., 2012)

119 1.918 ± 0.0099 Direct submission

164 1.815 ± 0.0067 (Mai et al., 2009)

112 1.809 ± 0.0079 (Chye and Tan, 1992)



128 1.873 ± 0.00139 (Miao and Gaynor, 1993)

123 1.794 ± 0.0256 (Chye et al., 1991)


111112113114115116117118119120121122123124125126127128129130


Fig. 2. Contents of chlorophylls and becarotene after withholding water Valuesrepresent the mean ± SD of 6 replicate samples tested in replicate.


1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545556575859606162636465

66676869707172737475767778798081828384858687888990919293949596979899


b, and Chl a/b were resulted by the degradation of chlor-ophylleprotein complex under severe drought condition. The b-Carcontentwas increased slightly at 1 dww, but quickly decreased from3dww(Fig. 2). These results suggested that b-Cardidnot take part inquenching excess excited energy after chlorophylleprotein complexbroken down under drought stress in rubber tree.

3.2. The effect of drought stress on membrane oxidation andosmosis indices

Since MDA, a cytotoxic product of lipid peroxidation is generallytaken as an index of ROS level. Therefore, the change of MDA

Fig. 3. Changes of physiological indices in rubber tree after withholding water Values ruppercase letters show significant differences at the P < 0.01 level.


content in the leaves of rubber tree was determined to reveal thelevel of ROS under drought stress. As showed in Fig. 3, MDA contentin leaves was continuously increased as prolonged drought stress.However, proline content increased slightly at 1 dww, but droppedat 3 dww, and then underwent a sudden increase at 9 dww. As forthe soluble sugar content, it reduced by nearly 50% at 1 dww, butrecovered to the untreated level (0 dww) at 3 dww, then decreasedfrom 5 to 7 dww, and suddenly increased at 9 dww. Under droughtstress condition, the accumulation of MDA usually leads to thedamage of cell membrane in plant and animal. Changes of MDA andRWC suggested that drought induced osmotic stress responsein rubber tree seedlings. However, the soluble sugar took part indrought response as we previously found in chilling stress response(Luo et al., 2012). The plant POD enzyme can decompose hydrogenperoxide, decrease oxygen radical production, and prevent plantdamaged by peroxide. Under drought stress, POD activity increasedslightly at 1 dww, but experienced a continuous decrease from 3 to9 dww. The SOD activity increased at 3 dww, but decreased from 5to 9 dww. These suggested that rubber tree seedling was suscep-tible to drought stress, and the protection role of physiologicalresponses only lasted for 3e5 days after withholding water.

3.3. Expressions of key genes involved in energy biosynthesis andROS scavenging under drought stress

As showed in Fig. 4, drought stress induced the transcripts ofantioxidative enzyme genes HbAPX, HbCAT, HbCuZnSOD, andHbMnSODwith nearly the same pattern. Their expressions reacheda maximum (100-fold over the untreated control) at 3 dww afterwithholding water. The expression patterns of ROS scavengingsystems related genes were coincided with variations in theirenzyme activities. For instance, the gene expression of HbCuZnSODand HbMnSOD were reached their peaks at 3 dww, while SODenzyme activities were highest at 3 dww.

epresent the mean ± SD of 6 replicate samples tested in replicate. Bars with different

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130


Fig. 4. Expressions of ROS scavenging systems related genes HbAPX, HbCAT, HbCuZnSOD, and HbMnSOD after withholding water Values represent the mean ± SD of twobiological replicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.


1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545556575859606162636465

66676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130


Expressions analyses of energy biosynthesis related genesrevealed that HbCOA, HbRbsS, and HbACAT transcripts wereincreased at the first 3 dww, but decreased from 5 dww. HbATPshowed instant response at 1 dww then attenuate its geneexpression from 3 dww. These suggested that these genes involvedin energy biosynthesis and ROS scavenging were response todrought stress, and drought stress responses were occurred at 3e5days after withholding water in rubber tree seedling.

4. Discussion

4.1. Short-term drought stress caused leaves dysfunction in rubbertree seedlings

In the sub-optical rubber tree plantation in China, droughtinhibits rubber tree growth. Research on rubber tree droughtresistance mechanism mainly concentrated in the area of anatomyand physiological response (Nair et al., 1996). The effect of droughtvaried on different physiological metabolism in various growth anddevelopment stages of rubber tree (Devakumar et al., 1988). Tran-spiration coefficient (Nair et al., 1996), membrane integrity (Reddy,2000), osmoregulation, laticifer turgor pressure (Ranasinghe andMilburn, 1995), low solute potential (Ayutthaya et al., 2011) werefound related to drought tolerance in rubber tree. Drought signifi-cantly reduced the relative growth rate and RWC, and inhibitedphotosynthesis in plant seedlings (Li et al., 2011). Our studies foundsimilar physiological responses in rubber tree seedlings underdrought stress (Figs. 1 and 3). Under stresses conditions, the accu-mulation of MDA usually leads to the damage of cell membrane inplant and animal. The increase of MDA content was coincided tobroken down in rubber tree seedlings. Besides of RWC, changes ofchlorophyll contents also indicated that drought reshaped thestructure of chloroplasts, and influenced photosynthesis andHbRbsS gene expression (Figs. 2 and 5). Similar results wereconfirmed by wheat leaves under moderate drought stress, which


found that thylakoid lumen acidification in drought-stressed leavescould be associated with the activity of an enhanced fraction of PSI.

4.2. Osmoregulation was a physiological response to drought stressin rubber tree

The accumulation of proline was involved in regulating the os-motic. The accumulation of proline in leaves of rubber tree seedlingsat later stage after withholding water suggested that rubber treeseedlings had the ability to regulate the osmotic under droughtstress. Stress situations where soluble sugars are involved, such aschilling, herbicide injury, or pathogen attack, are related to impor-tant changes in reactive oxygen species balance (Couee et al., 2006).Fluctuations of soluble sugar content in rubber tree seedlings underdrought stress suggested that soluble sugar involved in the droughttolerance. These results were similar with our previous study inrubber tree seedling under chilling stress. These results suggestedits soluble sugar play an important role in osmoregulation underdrought stress in rubber tree seedlings rather than proline.

4.3. ROS scavenging systems related genes function earlier thanphysiological responses under drought stress but limited by ATPformation

The effect of drought on chloroplasts and mitochondria werewell documented (Bigras, 2005). Changes of chlorophyll contentsand gene expression of HbRbsS indicated that the integrity ofchloroplast had been broken down under drought stress. Theimportant role of chloroplasts and mitochondria is ATP generation.HbATP gene encodes the beta subunit of mitochondrial ATP syn-thase (EC 3.6.3.14), which is the most commonly used “energycurrency” of cells in most organisms. HbCOA encodes a long-chain-fatty-acyl-CoA reductase (EC 1.2.1.50), which takes part in biosyn-thesis of secondary metabolites and cuticular wax biosynthesis.HbACAT encodes an acetyl-CoA C-acetyltransferase (EC 2.3.1.9),


Q1

Fig. 5. Expressions of energy biosynthesis related genes HbCOA, HbATP, HbRbsS, and HbACAT after withholding water Values represent the mean ± SD of two biologicalreplicates tested in triplicate. Bars with different uppercase letters show significant differences at the P < 0.01 level.


1234567891011121314151617181920212223242526272829303132333435363738394041424344454647484950515253545556575859606162636465

66676869707172737475767778798081828384858687888990919293949596979899

100101102103104105106107108109110111112113114115116117118119120121122123124125126127128129130


which mainly takes part in fatty acid and amino acid metabolism.Drought influenced mitochondria function since decreases ofHbATP, HbCOA and HbACAT transcripts were occurred from 3 to5 dww (Fig. 5.). These suggested that drought induced severalmetabolism pathways synchronously but first inhibited energyformation.

ROS may play two different roles: exacerbating damage oractivating defense responses. The numerous ROS generationsources and complex scavenging systems provide the flexibilitynecessary for these functions (Dat et al., 2000). Mitochondria isan important place for ROS production in cell (Møller, 2001). Theintimate relationship between antioxidant enzyme activities anddrought stress were found in woody plant in karst habitats inSouthern China. Transcripts of CAT, MnSOD, and CuZnSOD arelikely to reflecting the ability of mitochondria to scavenging ROSand delaying the aging process. In this study, we found that thechanges of ROS scavenging related genes expressions was tightlyrelated to the changes of corresponding enzymes activities.MnSOD is an integral mitochondrial protein known as a first-lineantioxidant defense against superoxide radical anions producedas by-products of the electron transport chain. In our study,HbMnSOD gene expression was later than that of HbCuZnSODgene expression. These suggested that HbCuZnSOD was moreimportant for drought resistance in rubber tree clone GT1, whichwas similar with previous study in rubber tree clone PB260(Leclercq et al., 2012).

5. Conclusion

Taken together, these results suggested that rubber tree seedlingwas susceptible to drought stress, and the protection role ofphysiological and molecular responses only lasted for 3e5 daysafter withholding water. Moreover, adaptation to drought stresswas a complex process involved in osmoregulation, antioxidativeenzymes and energy biosynthesis related genes in mitochondriaand chloroplasts in rubber tree seedling.


Acknowledgments

This work was supported by the National Natural ScienceFoundation of China (31270643).

Contributions

Conceived and designed the experiments: LF Wang. Performedthe experiments: LF Wang. Analyzed the data: LF Wang. Wrote thepaper: LF Wang.

References

Ahamad, B., 1999. Effect of rootstock on growth and water use efficiency of Heveaduring water stress. J. Rubber Res. 2, 99e119.

Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, andsignal transduction. Annu. Rev. plant biol. 55, 373e399.

Asada, K., 2006. Production and scavenging of reactive oxygen species in chloro-plasts and their functions. Plant Physiol. 141, 391e396.

Ayutthaya, S.I.N., Do, F.C., Pannangpetch, K., Junjittakarn, J., Maeght, J.-L.,Rocheteau, A., Cochard, H., 2011. Water loss regulation in mature Hevea brasi-liensis: effects of intermittent drought in the rainy season and hydraulic regu-lation. Tree physiol. 31, 751e762.

Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline forwater-stress studies. Plant Soil. 39, 205e207.

Bigras, F.J., 2005. Photosynthetic response of white spruce families to droughtstress. New. For. 29, 135e148.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72, 248e254.

Brestic, M., Zivcak, M., Kalaji, H.M., Carpentier, R., Allakhverdiev, S.I., 2012. Photo-system II thermostability in situ: environmentally induced acclimation andgenotype-specific reactions in Triticum aestivum L. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 57, 93e105.

Chye, M.L., Tan, C.T., 1992. Isolation and nucleotide sequence of a cDNA cloneencoding the beta subunit of mitochondrial ATP synthase from Hevea brasi-liensis. Plant Mol. Biol. 18, 611e612.

Chye, M.L., Tan, S., Tan, C.T., Kush, A., Chua, N.H.i., 1991. Nucleotide sequence of acDNA clone encoding the precursor of ribulose-1, 5-bisphosphate carboxylasesmall subunit from Hevea brasiliensis (rubber tree). Plant Mol. biol. 16,1077e1078.


Q2


12345678910111213141516171819202122232425262728293031323334353637383940

41424344454647484950515253545556575859606162636465666768697071727374757677


Couee, I., Sulmon, C., Gouesbet, G., El Amrani, A., 2006. Involvement of solublesugars in reactive oxygen species balance and responses to oxidative stress inplants. J. Exp. bot. 57, 449e459.

Creelman, R.A., Mason, H.S., Bensen, R.J., Boyer, J.S., Mullet, J.E., 1990. Water deficitand abscisic acid cause differential inhibition of shoot versus root growth insoybean seedlings: analysis of growth, sugar accumulation, and gene expres-sion. Plant Physiol. 92, 205e214.

Dat, J., Vandenabeele, S., Vranova, E., Van Montagu, M., Inze, D., Van Breusegem, F.,2000. Dual action of the active oxygen species during plant stress responses.Cell. Mol. life Sci. : CMLS 57, 779e795.

Deng, L.H., Luo, M.W., Zhang, C.F., Zeng, H.C., 2012. Extraction of high-quality RNAfrom rubber tree leaves. Biosci. Biotechnol. Biochem. 76, 1394e1396.

Devakumar, A., Gururaja Rao, G., Rajagopal, R., Sanjeeva Rao, P., George, M.,Vijayakumar, K., Sethuraj, M., 1988. Studies on soil-plant-atmosphere system inHevea: II. Seasonal effects onwater relations and yield. Indian J. Nat. Rubber Res.1, 45e60.

Dhindsa, R.S., Plumb-Dhindsa, P., Thorpe, T.A., 1981. Leaf senescence: correlatedwith increased levels of membrane permeability and lipid peroxidation, anddecreased levels of superoxide dismutase and catalase. J. Exp. bot. 32, 93e101.

Gonçalves, P.d.S., Aguiar, A.T.d.E., Costa, R.B.d., Gonçalves, E.C.P., Scaloppi Júnior, E.J.,Branco, R.B.F., 2009. Genetic variation and realized genetic gain from rubbertree improvement. Sci. Agric. 66, 44e51.

Gururaja Rao, G., Devakumar, A., Rajagopal, R., Annamma, Y., Vijayakumar, K.,Sethuraj, M., 1988. Clonal variations in leaf epicuticular waxes and reflectance:possible role in drought tolerance in Hevea. Indian J. Nat. Rubb Res. 1, 84e87.

Hoekstra, F.A., Golovina, E.A., Buitink, J., 2001. Mechanisms of plant desiccationtolerance. Trends Plant Sci. 6, 431e438.

Huang, Z.D., Pan, Y.Q., 1992. Rubber Cultivation Under Climatic Stresses in China.Elsevier, Amsterdam.

Leclercq, J., Martin, F., Sanier, C., Cl�ement-Vidal, A., Fabre, D., Oliver, G., Lardet, L.,Ayar, A., Peyramard, M., Montoro, P., 2012. Over-expression of a cytosolic iso-form of the HbCuZnSOD gene in Hevea brasiliensis changes its response to awater deficit. Plant Mol. Biol. 80, 255e272.

Li, Y., Zhao, H.X., Duan, B.L., Korpelainen, H., Li, C.Y., 2011. Effect of drought and ABAon growth, photosynthesis and antioxidant system of Cotinus coggygria seed-lings under two different light conditions. Environ. Exp. Bot. 71, 107e113.

Lichtenthaler, H.K., 1987. Chlorophylls and carotenoids: Pigments of photosyntheticbiomembranes. Methods Enzymol. 148, 350e382.

Luo, P., He, J.J., Yao, Y.L., Dai, X.H., Cheng, R.X., Wang, L.F., 2012. Differential responsesof two rubber tree clones to chilling stress. Afr. J. Biotechnol. 11, 13466e13471.

Mai, J., Herbette, S., Vandame, M., Kositsup, B., Kasemsap, P., Cavaloc, E., Julien, J.L.,Am�eglio, T., Roeckel-Drevet, P., 2009. Effect of chilling on photosynthesis andantioxidant enzymes in Hevea brasiliensis Muell. Arg. Trees 23, 863e874.

Miao, Z.H., Gaynor, J.J., 1993. Molecular cloning, characterization and expression ofMn-superoxide dismutase from the rubber tree (Hevea brasiliensis). Plant Mol.Biol. 23, 267e277.

Møller, I.M., 2001. Plant mitochondria and oxidative stress: electron transport,NADPH turnover, and metabolism of reactive oxygen species. Annu. Rev. PlantBiol. 52, 561e591.


Monclus, R., Dreyer, E., Villar, M., Delmotte, F.M., Delay, D., Petit, J.M., Barbaroux, C.,Le Thiec, D., Brechet, C., Brignolas, F., 2006. Impact of drought on productivityand water use efficiency in 29 genotypes of Populus deltoides x Populus nigra.New. Phytol. 169, 765e777.

Nair, D.B., Dey, S.K., Rajagopal, R., Vijayakumar, K.R., Sethuraj, M.R., 1996. Synergisticeffect of heat and osmotic stress in causing membrane injury in Hevea brasi-liensis. J. Plant Biol. 39, 177e181.

Peever, T.L., Higgins, V.J., 1989. Electrolyte leakage, lipoxygenase, and lipid peroxi-dation induced in tomato leaf tissue by specific and nonspecific elicitors fromCladosporium fulvum. Plant Physiol. 90, 867e875.

Priyadarshan, P.M., Hoa, T.T.T., Huasun, H., de Gonçalves, P.S., 2005. Yielding po-tential of rubber (Hevea brasiliensis) in sub-pptimal environments. J. CropImprov. 14, 221e247.

Qin, B., 2013. The function of Rad6 gene in Hevea brasiliensis extends beyond DNArepair. Plant physiol. Biochem. PPB/Soc. francaise De. physiologie Veg. 66,134e140.

Ranasinghe, M.S., Milburn, J.A., 1995. Xylem conduction and cavitation in Heveabrasiliensis. J. Exp. bot. 46, 1693e1700.

Reddy, Y., 2000. Effect of moisture stress on stability of membrane integrity inHevea brasiliensis across temperature regimes. Indian J. For. 23, 110e111.

Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium com-pounds in higher plants. Annu. Rev. Plant Biol. 44, 357e384.

Shao, H.B., Liu, Z.H., Zhang, Z.B., Chen, Q.J., Chu, L.Y., Brestic, M., 2013. Biologicalroles of crop NADP-malic enzymes and molecular mechanisms involved inabiotic stress. Afr. J. Biotechnol. 10, 4947e4953.

Webster, C.C., Baulkwill, W.J., 1989. Rubber. Longman scientific & technical.Yan, K., Shao, H., Shao, C., Chen, P., Zhao, S., Brestic, M., Chen, X., 2013. Physio-

logical adaptive mechanisms of plants grown in saline soil and implicationsfor sustainable saline agriculture in coastal zone. Acta Physiol. Plant. 35,2867e2878.

Zeppel, M.J., Anderegg, W.R., Adams, H.D., 2013. Forest mortality due to drought:latest insights, evidence and unresolved questions on physiological pathwaysand consequences of tree death. New. phytol. 197, 372e374.

Zhou, Y.H., Lam, H.M., Zhang, J.H., 2007. Inhibition of photosynthesis and energydissipation induced by water and high light stresses in rice. J. Exp. Bot. 58,1207e1217.

Zhou, G.A., Chang, R.Z., Qiu, L.J., 2010. Overexpression of soybean ubiquitin-conjugating enzyme gene GmUBC2 confers enhanced drought and salt toler-ance through modulating abiotic stress-responsive gene expression in Arabi-dopsis. Plant Mol. Biol. 72, 357e367.

Zhou, M.L., Ma, J.T., Zhao, Y.M., Wei, Y.H., Tang, Y.X., Wu, Y.M., 2012. Improvement ofdrought and salt tolerance in Arabidopsis and Lotus corniculatus by over-expression of a novel DREB transcription factor from Populus euphratica. Gene506, 10e17.

Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev.Plant Biol. 53, 247e273.

Zivcak, M., Kalaji, H.M., Shao, H.-B., Olsovska, K., Brestic, M., 2014. Photosyntheticproton and electron transport in wheat leaves under prolonged moderatedrought stress. J. Photochem. Photobiol. B Biol..

787980


Documents

Physiological and molecular responses to drought stress in rubber tree (Hevea brasiliensis Muell. Arg.)