PHYSICAL AND GENETIC ANALYSIS OF THE HUPIAN

CHROMOSOR/IE 14 LONG ARM SUBTELOMERIC REGION

AT 14q32.33+ 1Sqter

RICHARD F. WINTLE

A thesis subrnitted in conformity with the requirements for

the degree of Doctor of Philosophy, Graduate Department of

Molecular and Medical Genetics, University of Toronto

O 1997 by Richard F. Wintle

National: Library Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Sbest 395. rue Wellington Otrawa ON K1A ON4 ûttawaON K1AON4 Canada canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de

reproduction sw papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantid extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Physical and genetic analysis of the human chromosome 14 long arm subtelomeric region at 14q32.33- 14qter. Ph.D.. 1997, Richard Francis Wintle. Graduate Department of Molecular and Medical Genetics, University of Toronto-

ABSTRACT

The human immunoglobulin heavy chain gene cluster (IGH) is located at 14q32.33.

near the long arm telomere of chromosome 14. Physicd maps suggested that Mqter might be

some distance from IGH. Human subtelomeric regions are the sites of increased

recombinaiion and have a mde to fernale recombination ratio that is higher than elsewhere in

the genome. My goal was to complete the map of distal 14q, to develop genetic markers for

Mqter. and to examine recombination in this subtelomeric region. Initially, 13 DNA markers

were used to characterize naturally occurring terminal deletions. to refine the physical rnap and

determine if deletion breakpoints were near 14qter. Two markers. previously mapped disial to

IGH. were mapped proximal to IGH. The breakpoint of a ring chromosome was rnapped to a

350 kb interval within IGH. representing the smallest region of distal monosomy 14q reported

to date. Somatic ce11 hybrid lines were next used to map IGH variable region (.VH) segments

that previously were not placed within IGH. Four Nor1 DNA fragments. representing eleven

VH segments, mapped to chromosomes 15 and 16. Two yeast artificial chromosomes (YAC)

contiiining functional hurnan telorneres were mapped to the telomeric end of IGH. A VH

segment at the distal ends of the YACs was sensitive to nuclease Bu13 1 digestion of human

DNA. demonstrating that these represent the l l q telomere. The physical rnap of IGH ivas

completed and extends to within 25 kb of the telornere. Polymorphic markers were cloncd

from the distd part of IGH. approximately 90 and 200 kb from the telomere. Haplotypes of

these rnarkers were constructed for use as a highly polymoryhic genetic marker which will be

useful for anchoring genetic rnaps. Linkspe analysis using the 40 pedigree CEPH reference

panel revealed increased recombination within this region. Recombination was not

significantly higher in males than in fernales, indicating that this region differs from other

human subtelomeric regions.

ACKNOWLEDGEMENTS

This thesis would not have been possible without constant support and encouragement from my

supervisor. Diane Cox. Special thanks are also extended to the two other mernbers of my

permanent supervisory cornmittee. Gillian Wu and Lap-Chee Tsui.

I thank rny collaborators, Drs. Robert Haslarn. Teresa Costa, Ikuko Teshima, Toby Nygaard

and Kirsti Kvaley. Some results were supplied by other collaborators: Catherine Duff (NCE

somatic hybrid mapping facility), Lin Anderson and Alessandra Duncan (NCE in sitrl

hybridization facility). Ikuko Teshima (HSC cytogenetics [ab). 1 am particularly indebted ro lo-

Anne Herbrick, who worked for one surnmer under my guidance. I thank the following for

providing reagents: Drs. William Brown, Harold Riethman. Steve Reeders. Ad Guerts van

Kessel and Ian Tornlinson. I am grateful to Dr. Celia Greenwood for her assistance with the

statisticd analyses.

I am indebted to Drs. -Wke Wdter and Steve Scherer for their insights and suggestions. I have

been pnvilrged to work in a lab filled with people who over the years have hrlprd me in müny

wnys. Particular mention goes to Gai1 Billingsley. Babs Byth. Mary Grace Bnibacher. and of

course to my fellow students Gord Thomas and John Forbes. Numerous members of othcr

labs in and around the HSC Genetics department and the U. of T. Department of Molecular and

Medical Genetics have helped to make this a more pleasant experience: thanks to all.

My persona1 thanks to Louise for putting up with my years of graduate school. to Alessandra

Duncan for giving me a push in the right direction. to Dijen and Boomerang for biting me when

it was necess'q. and to rny parents for bankrolling the entire operation.

TABLE OF CONTENTS

ABSTRACT

ACKNOWLEDGEMENTS

LIST OF TABLES

LIST OF FIGURES

LIST OF APPENDICES

LIST OF ABBREVIATIONS

Chapter 1. INTRODUCTION AND LITERATURE REVIEW

1.1 MAPPING OF HUMAN CHROMOSOME 14

1.1 .a Physical and genetic maps of chromosome 14q32-qter

1.1 .b The human irnmunoglobulin heavy chain gene cluster

1.2 TELOMERE STRUCTURE AND FUNCTION

1 2 . Telonieres

1.3. b Telomeric DNA

1 2.c Unusud telorneres of Drusophilr

1 -3.d Interstitial telorneric DNA repeats in humans

1.2.r interstitial telomrric DN.4 repeüts in other specirs

1 2 . E Protein components of telorneres

1.3 TELOMERASE

1.4 SUBTELOMERIC DNA

1 -4.a Subtelomeric DIVA sequences

1 -4.b Methods of cloning subtelomeric DNA

1 -4.c Transcription repression in subtelomeric regions

page

U

.-. U1

ix

.Y

xii

. . . .Ull

1

3

2

4

6

6

7

9

10

1 1

15

17

20

20

23

29

1.5 PHYSICAL MAPPING OF HUMAN SUBTELOMERIC REGIONS 30

1 -5.a Humnn subtelomeric regions 30

1 . 5 . b Terminal deletions 3 1

T.4BLE OF CONTENTS (continuedl

1.6 RECOMBINATION IN SUBTELOMEWC REGIONS

1 -6.a Genetic linkage andysis and genetic maps

1 -6 . b Recombination in subtelomenc regions

1.7 OBJECTIVES

Chapter 2. PHYSICAL MAPPING OF THE TELOMERIC REGION

14q32.33-t Irlqter: THE USE OF CHROMOSOMAL DELETIONS

3.1 INTRODUCTION

2.1 .a The map of subte!amrric 1 Jq

2.1 .b Chromosome drletions for mapping within distal 14q

2.1 .c Terminal deletions of i l q

2.1 .d Ring chromosome 14

2.2 MATERIALS AND METHODS

2.3.a Patient materiais

2 . 2 . b Genomic DNA and probes

3.2.c Poiymorphic CA repeats

2.3 RESULTS

2.4 DISCUSSIOI\J

2.4.a Marker order ciarified by moleculm deletion analysis

2.J.b The smallest region of distal monosorny 14q

2.4.c Ring chromosome 14 syndrome

2.l.d Differrnt deletions undrrlying similiu cytogenetic findings

2.4.e P henotypes of terminal deletions of Ilq

TABLE OF CONTENTS (continuedl

Chapter 3. PHYSICAL MAPPING OF THE IGH GENE

CLUSTER NEAR THE TELOMERE OF 14q: THE USE OF

TELONIERIC YACS AND SOMATIC CELL HYBRIDS

3.1 INTRODUCTION

3.1 .a The physical map ncar I-lqter

3.1. b The human immunoglobulin heavy chain prne cluster

3.1 .c Human VH segments at other genomic locations

3.1 .d Telomenc YACs from distal Mq

3.2 MATEMALS AiiD METHODS

3.2.a Somatic ce11 hybrids

3.2.b Genomic DNA and probes

3 2 . c Physical mapping of telomeric YACs

3.2.d Alri-PCR generation of probes from telomeric YACs

3.7.e VH segment nomenclature

3 -2. f Nuclrase Ba13 1 digestion of genomic DNA

3.2.g Two-dimensionri1 DNA electrophoresis

3 2 . h Chromosomal NI sitlr mappinp of VHI probe

3.3 RESULTS

3.3.a Itz sirri hybridization of VH2 probe to metaphase

chromosomes

3.3.b The VH region of chromosome 14 hybrid ce11 tines

3.3.c VH segments on chromosomes 15 and 16

3.3.d The IGHV4B7.5 gene segment on chromosome 14

3 .? .e ID-DE mapping of the VH 1 f probe

3.3. f du-PCR clone grneration

page

62

TABLE OF CONTENTS (continuedl

3.3 .g VH segments within telomenc YAC yRM206

3 -3. h PFGE mapping of two telorneric YACs

3.3. i Nuclease Ba13 1 sensitivity

3.4 DISCUSSION

3 - 4 2 IGH segments located nrar the 14q telomere

3 -4. b VH segments on chromosomes 1 5 and 1 6

3.4.c Two VH segments detected by the VH l f probe

3 -4.d YACs representing the tdomere of 14q

3 -4.e The IGH gene cluster at 14qter

Chapter 4. GENETIC RECOMBtNATION AND POLYMORPHIC

MARKERS IN THE 14qter SUBTELOMERIC REGION

4.1 INTRODUCTION

4.1 .a Recombination in human subtelomeric regions

4.1 .b Linkage maps of chromosome 14

4.2 .MATERIALS .&ND METHODS

4.2. a Isolation of microsatellite markers

4.2. b PCR amplification of microsatellite markers

4 . 3 . ~ Linkase analyses

4.î.d Typing of IGH constant region markers

4.3 RESULTS

4 . 3 .a Polymorphic CA repeats at the telomere of 14q

4.3.b Analysis and physicd mapping of CA repeat clones

at the telomere of 14q

4.3 .c Linkage Analyses

4.3.d Re-typing of known IGH recombinant families

page

52

82

88

94

94

95

98

99

1 O0

vii

TABLE OF CONTENTS (continuedl

4.4 DISCUSSION

4.4.a tncreased recornbination near 14qter

page

123

4.4. b The recombination hotspot within the IGH constant region I L +

4.4.c CA repeat polymorphisms near 14qter 125

Chapter 5. SU&IhIARY AND FETljRE DIRECTIONS

5.1 THESIS SUMMARY

5.1 a Genetic markers distai to IGH actually map in proximal 13s

locations

5.1 . b The tGH gene ctcister is located irnmediately adjacent to 128

the telomere at I4qqter

5.1 .c A highly polymorphic systern of two haplotyped CA 128

repeats is locüted near 14qter

5.1 .d Recornbination is elevated near the telornere at I-lqter 139

5.2 FUTUFE DIRECTIONS 129

5.3 CONCLUSION: TELOMERES AND MAPPING THE HUMAN 132 p p p p p p p p p p - - - - - - - -

- - - -

-

GENOME

APPENDICES

APPENDtX A. Raw genotypes of IGHV markers

APPENDIX B. fGHV hiiplotypes of TCA7 and TCA 1 1

APPENDIX C. Numerical coding of IGHV haplotypes in

CEPH families

APPENDIX D. Statisticril analyses

REFERENCES

LIST OF TABLES

CHAPTER 1. INTRODUCTION AND LITER4TURE REVIEW page

Table 1 - 1. Human subtelomeric DNA clones 23

CHAPTER 2. PHYSICAL MAPPING OF THE TELOMERIC REGION

14q32.33-tl4qter: THE USE OF CHROMOSOLMAL DELETIONS page

Table 2- 1. Clinical vaiiability in delrtion 1 Jq 40

Table 2-2. Markers typed on patients with chromosome 14 deletions 48

Table 2-3a. Densitometry results, adjusted for gel loading 50

Table 2-3b. Dose number of DNA markers in deletion patients 5 1

CHAPTER 3. PHYSICAL hIAPPING OF THE IGH GENE CLUSTER NEAR

THE TELOMERE OF 14q: THE USE OF TELOMERIC YACS AND SOMATIC

CELL HYBRIDS page

Table 3- 1. VH segments on Nor1 fragments not in the IGH physical map 74

Table 3-2. Probes hybridized to telomeric YACs 83

Table 3-3. Sitrnmaq of PFGE fragments from telornsric YACs 86

CHAPTER 4. GENETIC RECOMBINATION AND POLYMORPHIC

MARKERS IN THE 14yter SUBTELOiCIERIC REGION page

Table 4- 1 . Allele frequrnçies and sizes of microsatellite markers 110

Table 4-2. Haplotypes of IGH CA repeat polymorphisms observed in 1 1 1

CEPH hmilies

Table 4-3. L inkqe results betwren pIJBRH BsEII and lGHV coded 115

haplotypes

Table 4-1. CEPH families informative for p24BRH 116

CHAPTER 1. INTRODUCTION AND LITERATURE REVIEW

Figure 1 - 1. The region adjacent to the I4q telomere 3

CHAPTER 2. PHYSICAL kIAPPING OF THE TELOMERIC REGION

14q32.33+ 14qter: THE USE OF CHROMOSOMAL DELETIONS

Figure 2- 1. Partial karyoty pes of patients HSC 1 287 and HSC 1 363 45

Figure 2-2. DNA markers typed on families of three chromosome 14 53

deletion patients

CHAPTER 3. PHYSICAL MAPPING OF THE IGH GENE CLUSTER NEAR

THE TELOMERE OF 13q: THE C'SE OF TELOiMERIC YACS AND SO!'VIATIC

CELL HYBRIDS page

Figure 3- 1.

Figure 3-2.

Figure 3-3.

Figure 3-4.

Figure 3-5.

Figure 3-6.

Figure 3-7.

Figure 3-8.

Figure 3-9.

Figure 3- 10.

Figure 3- 1 1.

III sitn hybridization of VH2 probe to human chromosomes

VH6 hybridizrition to chromosome 14 somatic ceil hybrids

Somatic ce11 hybrid miipping of VH se, uments

Two-dimensionri1 PFGE rnripping of VH 1 f probe

V H segments on telomei-ic YXC yR-M2006

PFGE maps of two telomeric Y ACs

Two telomeric YACs are identicai at their telomeric ends

Restriction map of the 14q telomere

PCR amplification of markers from telomenc YACs

The 13.5 kb BssHIl fragment contiiining V H 1 sesment 4-80

Nuclease Ba13 1 digestion of human genomic DNA

LIST OF FIGURES (continuedl

CKAPTER 4. GENETIC RECOMBINATION AND POLYNIORPHIC

MARKERS IN THE 14qter SUBTELOMERIC REGION page

Figure 4- 1. Sequences of IGHV CA repeats 1 08

Figure 4-2. Samples of CA repeat amplifications from CEPH individuals 1 09

Figure 4-3. Deletion mapping of IGH CA repeats 113

Figure 4-3. Known IGH recombinant families 118

Figure 4-5. G3m re-typing by PCR of IGH recombinant families 121

Figure 4-6. Fdybli~ polyrnorphisrn re-typed on IGH recombinant families 122

LIST OF APPENDICES

APPENDIX A. Raw genotypes of IGHV markers

APPENDIX B. IGHV haplotypes of TCA7 and TCA 1 1

APPENDIX C. 'lumerical codins of IGHV haplotypes in

CEPH famiLes

APPENDIX D. Statistical analyses

page

134

146

150

xii

LIST OF ABBREVIATIONS

2D-DE

e

bp

BSA

CM

IG H

IGH@

IG HC

kb

LOD

Mb

PFGE

RFLP

u V. h

VH

VNTR

YAC

two-dimensional DNA electrophoresis

theta. genetic map distance

base pair of DNA

bovine serum albumin

centiMorgan. one genetic map unit

immunoglobulin heavy chain gene cluster

locus for the immuno_olobulin hravy chain gene clustrr nt I4q32

constant region of the immunoglobulin heavy chain gsnr cluster

kilobase. one thousand base pairs of DNA

logarithm of udds

megabase. one million base pairs of DNA

pulsed-tir ld gel electrophoresis

restriction I'rqrnent length poly rnorphisrn

units of enzyme rictivity

volt hours

variable region of the immunoglobulin heavy chain gene cluster

variable number of tandem repeots polymorphisrn

yeast anifkial chromosome

S . .

Xlll

CHAPTER 1.

INTRODUCTION AND LITERATURE REVIEW

1.1 MAPPING OF HUMAN CHROMOSOME 14

l a Physical and genetic maps of chromosome 14q32-qter

The worldwide effort to establish complete physical and genetic maps of a11 24

human chromosomes is a major scientific challenge. Complete genetic and physical maps

will üilow the location of functionally important sequences. such as genes. and structural

features, such as centromeres and telorneres, and are an important resource for genome

sequrncing. In addition. cornparison of physical and genetic maps will make possible the

correlation of genetic distance with physical distance, and the identification of regions that

undergo more recombination than the average rate for human chromosomes. The drtection

of loci predisposing to genetic disease. as well as improved diagnosis and carrier

screening. will also be facilitated through genome mapping. As one aspect of the

completion of the human genome map. it is important to establish accurately the locations

of telomeres in order to provide anchors at the ends of the physical maps of r x h

chromosome. This. in tum. allows accurate physical placement of polymorphic genrtic

rnarkers near telomeres, to ensure complete genome coverage during scans for loci linked

to humari diseases.

At the outset of this project. the most distal genes mnpped to the long a m of

chromosome 14 were those of the immunoglobulin heavy chain gene cluster ( IGH).

Physical rnapping of this locus to 14q31.3 was initially accomplished in this laboratory

through the analysis of a patient with a ring chromosome. having a deletion breakpoint

distal to 14q32.2 (Cox el (il. 198-a). This piacement was further refined through the

analysis of a patient with a translocation between chromosome 1 and chromosome 14.

placin? IGH within 14q32.33, the most terminal cytogenetic band visible (Benger et al.

199 1 ). The size of chromosome 14 is estirnatrd to be 109 iMbp. througli autoradiography

and flow and image cytometry (Morton. 199 1 ). Based on cytogsnetics, 1 Jq32.33

comprises. at most, 8.0 Mb of DNA (Daniel. 1985). This region was known to include

immunoglobulin heavy chain gene cluster

variable (VH) DH JH CH 1.1 Mb 350 kb

D l 4S20, D14S23, VH segments

other VH on chr(l5) segments? and chr(l6)

Figure 1-1. The region adjacent to the l l q telomere. At the outset of this work.

some IGH variable region segments urrre known to rnap to chrornosornrs 15 and 16. in

addition to those within the IGH@ locus on chromosome 14 (Cherif and Berger. 1990;

Matsuda et ri!. 1990). Polymorphic markers D 14S20 and D 14S23 were suggested to map

distal to IGH. through multipoint linkage nnalysis (Nakamura et al. 1989: NIHKEPH

Collaborative Mapping Group. 1992). The distance frorn IGH to the 14q telomere was

unknown. but wus espected to includr up to 1.000 kb of genomic DNA. contüining

aments. previously unmapped VH se,

approximately 1.5 iMb of the IGH g n e cluster (Walter er al. 1990). The remaining region.

between IGH and the 14q telomere. was therefore potentially quite large. and was thought

to require larje scale physical mapping in order to characterize the 14q telomere. Some

genetic markers. which had been genrticiilly mapped distal <O IGH. could possibly serve as

starting points to construcr a map towards the telomere (Nakamura rr (il. 1989: NIWCEPH

Collaborative Mapping Group, 1992). This region is depicted in Figure 1- 1.

Recent gene assignments to distal 14q include the x-ray repair cross-compirmenting

3 gene (XRCC3: mapped by fluorescence in sini hybridization (FISH) to 1 Jq33.3 (Tebbs

rr al. 1995)). and a cDNA homologous to the 64 kD subunit of the heavy chain of

cytoplasmic dynein (DNECL: mapped by HSH to 14q32.3 (Narayan er al. 1994)).

Establishg the exact location of the Ilq telomere in relation to other loci already

positioned on the physical map will aid efforts in the exact localization of these and othrr

genes that have been mappcd at low resolution by FISH.

1.l.b The human imrnunoglobulin heavg chain gene cluster

LGH is tocatd within the most telomeric cytogenetic band of chromosome 14.

q32.33 (Benger et cd . 199 1) . and is orientrd with its variable region closest to l-lqter

(Erikson et (il. 1982). The sene cluster is comprised of approximately 90 variable region

(VH) senr segments. at least 20 diversity (DH) segments. six tùnctional joining (JH)

segments. and a constant region (IGHC) of nine genes and two pseudogrnrs. Site-spccific

recombinrition of VH. DH and JH eleinents d~iring B ce11 drveloprnent results in the

juxtaposition of these rlements to form a mature IGH gene that is capable of coding for a

functional antibody heavy chain (Tonegawri. 1983).

Proximally . tlir cons tant region encodes C-terminal antibody effec tor lunctions.

The most ielomeric rrgion. the variable region (IGHV), contains the VH segments. which

encode the N-terminiil regions of the httavy chain polypeptide that are responsible for

determining antibody specificity. The nurnber of VU segments is variable. becausr of

numerous polyrnorphic insertions and deletions that include some VH segments (Walter et

al. 1990). The approximately 1 10 VH segments are classified into seven different families.

VH 1 through VH7. on the buis of DNA sequence. with individual members of the same

family sharing greater than 80% DNA homology.

The size of IGH. as deterrnined by physical mapping. was approxirnately 1.5 .Mb.

including 350 kb of the constant region and 1 100 kb of the variable region (Hotker et trl.

1989: Walter et c d . 1990: Walter et cd. 199 1 ). However, some VH segments had not brrn

mapped and were thought to lie distal to the existing rnap (Walter r t al. 1990: see Chapter

3). The total size of al1 M M and Nor1 DNA restricrion fragments that hybndized to

constant and variable region probes was reported üs approximatsly 2500 kb (Bermm et d.

1988: Matsuda rr rd. 1988). Thus. there was potentially a funher 1000 kb of the grnomr

that contained VH segments. The orientation of IGH. with the VH region most telomsric.

suggested that these VH segments mapped in a large interval between IGH and the

telomcre. One aim of this project was to determine whether these VH segments mapped

dista1 to the existing physical map of IGH (see Figure 1- 1 ).

DNA scquences hornolo_oous to VH segments had bcen identified at loci physicülly

separated tiom the IGH gene cluster. Ir2 sitci hybridization located such sequences on

cbrornosomes 15 and 16 (Cherif and Berger. 1990). and cosrnid clones containing VU

segments were mapped to chromosomr 16 by somatic cell hybnd panel analysis (Matsuda

et al. 1990). A second aim of this project was to determine whether the previously

unm;ipped VH segments thoueht to lie disial to IGH actually mapped to thrse chromosomr

15 and 16 loci.

The extensive chuacterization of the genomic structure of IGH. and its location by

cytogenetics near llqter, provided an excellent entry point for rnapping efforts of the

region.

1.2 TELOMERE STRUCTURE AND FUNCTION

1.2.a Telomeres

Telorneres are nucleoprotein structures found at the ends of linear eukaryotic

chromosomes (reviewed in Zakian. 1995). Their tlrst functional detïnition was brised on

cytological and genetic expiments in Dt-osophiln and maize (&ri t n c r p ) that dernonstrated

the instability of broken chromosomes without their niitural ends. Subsequently, telorneres

have been most extensively studied in ciliated protozoans such as Tetrdiyzcncl. in which

many new telorneres are formed at the termini of chromosome fragments produced during

the development of the somatic mxronucleus. Telomeres protect chromosome ends from

exonuclease degradation. and from recornbination with other DNA molecules. Telorneres

are also expected to solve the "end-replication problem" of linear DNA duplexes. that

lagging strand synthesis from an RNA primer cannot completely polymerize a DN.4 strand

that extends to the 3' end of the tcmplate strand. Each successive round of replication

would shorten one strand of the new DXA molecule if there were no mechanism to

maincriin its Length. Telomeres also have ri role in positioning chromosomes kvithin the

nuc1e;u rnvelope. and are attached to the nuclrar matrix during interphase (de Lange.

1992).

Since chromosome instability and remangement are c haracteristic of many

tumours, i t lias long been accepted that changes to chromosome structure may be ctitical in

tumourigenesis. End-CO-end trlomeric fusions are oftrn seen in cancer cclls. and most

tumour cells have shorter telorneres than corresponding normal cells. As a result of these

observations. it has been sug_oestrd that changes to chromosome termini rnay either initiate.

promote. or be a consequence of tumour progression (Hecht and Hecht. 199 1 ). Telornere

Ioss also o c c u ~ during passase of primary cells in tissue culture. suggesting a rolc for

telomere maintenance in ageing and senescence of cells UI vivo (Harley et al. 1992).

1.2.b Telomeric DNA

Telorneres are generally compnsed of short tandem DNA repeats with a rnarked

strand asymmeuy in their base composition, in that guanosine residues are clustered on one

strand (Zakian. 1995). The repeats are invariably oriented 5' to 3' toward the telomere on

the G-nch strand. There is a 12 to 16 nucleotide single stranded DNA overhang of the G-

rich strand at the termini of protozoan chromosomes. and similar overhangs have been

observed in yeast. These rnay be involvrd iii associations between telorneres on different

chromosomes. or in the formation of non-WatsodCrick "G-quartsr" DNA stmctures.

Telomere repcat miiys are dso found at interstitial locations in many organisms (sections

1.2.d and 1 L e ) . The l o n p t telomere reprat sequence described belongs to the yeast

Klirvrrorriyces. which has ti 25 bp repeat. A ribonucleoprotein. telornerase. is responsible

for the extension and maintenance of the G-rich strmd of telomeric DNA (section 1.3).

Telornerase activity from nucleür extracts can be assayed in virro. In humans. telornerase is

responsible for the addition of tandem repeats of the sequence TTAGGG (Morin. 1989).

~Most otherorganisins have repeats ofbetween tlveandright bpinlrngth. Interestingly.

tdomeres of Dt-osphii~i are quits different. being comprised of retrotransposons with no

similarity to telomeric simple sequence repeats of othrr organisrns (section 1 -2.c).

Telomere len_oth is iisually measured as the average length of DNA restriction

fragments hybridizing to an oligonuclrotide probe of telomeric repeats. since the rrpeat

sequences themselves do not con tain recognition si tes for restriction endonuclsases. More

accuarate analyses of telonwes may considsr both the lrngth of telomeric restriction

fragments and the total hybridization sisna1 from a telomere probe. as rnrasured by

densitometry. A critical test of telorneric location of a DNA sequence is its ssnsitivity to

nuclease Ba13 1. which digests linear duplex DNA from its ends by exonucleolytic digestion

of one striind. followrd by endonuclease cleavage of the remaining strand (Brown et al.

l99O).

Telomeres of human spem are generally longer than those of somatic tissues

(Allshire et (11. 1988: de Lange et cri. 1990). Approximately 10-20 kb of TTAGGG repeats

per chromosome end are present in spem, compared to 5- 15 kb in penpheral blood.

Telomeres tiom human fetal liver. brain and kidney are longer than thosr from adult

lymphocytes (Hristie PC tri. 1990). Altho~igh the same tissues were not studied in both the

fetal and adult stages. it was suggestcd that trlomeres shorten with age i i i ririo.

The first higher eukaryote from which telomenc DNA was isolated was the plant

Arabidopsis tlialinriri. Arnhilopsis telorneres consisr of the sequence TïTAGGG in arrays

of approximately 3.5 kb in size. These were cloned with a strategy based on annraling of

high copy single stranded DNA directionally cloned from ürtificially blunted chromosome

ends. followed by isolation of double stranded molecules by hydroxyapatitr

chroniatogriiphy (Richards and Ausubel. 1988 ). This sequence cross-hy bridizes to DNA

from rnany dicotyledon plants and to the monocotyledon Zrcr r>icly.s. in which the repeats rue

ais0 clearly iocated at telomcres. as dernonstr;ited by their sensitivity to nuclerise Bd3 1.

Telorneres of robacco. Nicoticirirr t<ibocia~r. are comprised of TITAGGG repeats on

fragments between 20 kb and 166 kb in size: howrver. it is not clex exrictly how rnuch of

thcse frqnents are tclomeric reprats and how much is due to othrr subtelomeric srquencrs

(Suzuki er cd . 1994. Most plants sharc this telomere rrprat (Zakiiin. 1993).

In humans, the telomere sequence TTAGGG wxi identified through denaturation of

genornic DNA, followed by renüturation of high copy number sequences and S 1 nuclrase

digestion of reinaining single copy. single strinded DNA. The resulting double stranded

DNA molecules werr then cloned. T A G G G sequences were shown to hy bridize to the

ends of chromosomes iri sitir. and to gttnoniic DNA frügments that were sensitive to

nuclease B d 3 ldigestion (Moyzis et cd. 1988 1. Between 5 and 15 kb of rhese repeats are

found at rach chromosome end in DNA from peripheral blood. with significant length

heterogeneity between different telorneres within the sarne cell. and also between

homologous telorncres froni different cells (Zakian. 1995). Viuiünts of this DNA repeat

(for example. TTGGGG and TGAGGG) exist proximal to the TTAGGG repeats (Allshire

et ni. 1989). Some human herpes viruses also have TTAGGG repeats at the temini of

their genomes. suggesting that they use host machinery to maintain their telomeres

(Secchiero er ai. 1995).

Mouse telomeres are much longer thiin their human counterparts. wi th te lomeric

restriction fragments from individual chromosomes of spleen. liver and kidney of Mirs

rnuscirllrs. M. thmesriclts and Apodetriris syh~rricirs readily resolvüble by pulsed-field gel

electrophoresis (PFGE) into discrets bands between 20 and 150 kb in size. TeIomeres of

M. cciroii and M. sprrnis arc smallrr. 20 to 30 kb and 5 to 20 kb. respectivsl!;. N~iclrüse

Bai3 1 digestion reveüls that almost ail of these fragments are composed of seq~tences that

hybridize to a poly-TTAGGG probe. Telorneres of DNA from rnouse liver are less

heterogeneous in size than in humans. and cm be resolved into discrete frao_ments. with the

variability in size of an individual telomeric being as little as 2 kb. The telomeric restriction

fragments are highly polymorphic. even in inbred strains. and new length variants are

sstimated to aise at n frequency of one new end per 20 mice. per generation. These novel

fragments are generally inherited in a Mendrlian fashion (Kipling and Cooke. 1990:

Starling et cil. 1990). which has allowed thrir use as genetic markers (section 1.6.a).

1.2.c Unusual telomeres of Drosophifa

Unlike other orgnnisrns. chron~osomrs of the dipteran fly Drosophilr do not have

simple srquence repeats at their telorneres. D~osopltila telomeres consist o f tandemly-

repeated arirays of LtNE-like retrotransposons, nsimed HeT-A and TART (reviewiid in

Mason and Biessmann. 1995). Thrse srquznces are added in the gem-line at <i frequcncy

of about 1 % of chromosome ends per fly generation. The addition of both elements is

polar. in that their poly-A tnils are invariübly found at the centromeric end of the rlrment.

Truncation of these elements due to incomplete DNA replication is counterbalanced by their

addition. It is trmpting to speculatr that Drosopliikc has lost its necessity to have TTAGG

telomerk sequences as in other insects. as a result of the introduction or evolution of these

unusud terminus specific retrotransposons. Whether Drosophila nuclei contain telomerase

üctivity rernains to be seen. althouph there rxist rnutator loci. which allow broken

chromosomes to be stabilized in the absence of Het-A addition (Wang et cd. 1994). Loci

like 1 i r d may prove to be alleles of DNA repair enzymes. telomerase. or genes important in

the control of chromosome structure.

1.2.6 Interstitial telomeric DNA repeats in hurnans

Although telomenc sequencss are found predominantly at the ends of humm

cliromosomes. there are also interstitial blocks of these repeats (Weber rf ni. 1990: Weber

et ai. 199 1 a). These are mainly found near the ends of chromosome m s (Wells rr al.

1990). Intersti tid telomeric sequences might function as fragile si tes for chroiiiosomr

breakage. or as substrates for chromosome "healing7' via new telomere formation in the

rvent of ü terminal deletion. Two cloned regions that apparently represcnt DNA btttwcen

inverted arrays of telornrre repeats map to Yp2 1 and IOq2l.l-qZ1.3 (Weber et al. 199 la):

with the exception of the chromosome 2 locus detailed below. these are the only telomeric

reperits detected outside the terminai cytogeneric bands of human chroniosomes.

Telomeric sequences werr detectttd in the long m of chromosome 2 . at 2q 15-q 14.

by in situ hybridization with n tritiated (TTAGGG)n probe (Wells et cri. 1990). This locus

is near the site of a rare folütr-sensitive fragile site. FRAZB. which led ro the suggestion

thüt the reprats might be a molecular basis of chromosome fragility. However. FISH

analysis revealed that the frqile site is not located at the repeats (IJdo et al. 199 1 b). The

region of repeats is approximately 1 kb in length. and consists of two blocks arranged in a

head to head fashion. suggesting that an end to end fusion of ancestral chromosomes may

have occurred. DNA tlnnking the repeat hybridizrs to subtelomeric regions of human

chromosomes. with probes irom cither side detecting different subsets of human telorneres

(IJdo et c d . 199 la). Cytogrnetic studies have long suggested that there is a n ancestral

fusion point between chromosomes 17 and 13 of the great apes at a locus corresponding to

human 2q 12-q 14. FISH studies confirmed that chimpanzee chromosomes 12 and 13 are

homologous to the appropriate portions of hurnan chromosome 2. but some material from

the short m s of the ape chromosomes did not hybridize. A simple end to end fusion

therefore does not explain these telomeric repeats (Luke and Verma. 1992). Interstitial

telomeric sequences have dso bern postulateci to br the result of a 'jumping" translocation.

in which a segment of a chromosome becornes fused to several other chromosomr tmnini

( c g . chromosome 15: Park ci 111. 1992 ).

It is tèasible that interstitial telorneric sequences can contribute to chromosome

instability. by functioning as "hotspots" for illegitimate recombination. as has been s h o w

for exogenous DNA molecules injected into the macronucleus of Piircitwcirmr with

subsequent integration into chromosomes i Knrinka and Bourguin. 1992). Telomeric

fusions are often seen in a wide vririety of human turnours (Hastie and Allshire, 1959).

Although there is no direct evidence from human turnours that interstitial telorneric

sequences contribute to chromosome instability. it is s till possible that if such sequences do

arise (for instance. as ü result of telomeric filsion of two chromosomes). they çould

contribute to chromosome brciikage ;ind Ioss of hcterozygosity due to a resulting

lin bülanced karyoty pe.

1.2.e Interstitial telomeric DNA repeats in other species

The investigation of the presence of interstitial tclomere DNA repeats in orpnisms

other than humans has largely been accomplished by the hybridization iii sitrl of telomrre

probes to chromosome preparations. The @est buch study wns performrd on 100

venebrate species from 5 distinct CI~~sscs and 14 distinct Orciers (Meyne rr cil. 1990).

Mnny mammals were observed to 11ave interstitial signals. often at nucleolar organizing

regions (NORs). at mugins of centromeric heterochromatin, or at other heterochromritic

regions. such as the long a m of the Y chromosome. Interstitial signals were also observed

in four of seven bird and four of six reptile species. Four frog species had interstitial

signals. although two toad and four fish species did not. Tracts of (TTAGGGIn are a

major component of satellite DNA in a nurnber of mamals . including rodents. cats and

whales of the Gcnus Bairiotoptercr (Msyne et tri. 1990: Allshire et ( I I . 1989).

A strong signai detected by FISH hybridizrition to an interstitial location on one

chromosome of the Armenian hamster (G-icrtrilirs irrigrcrroriirs) has been soggrsted to be a

recombination hotspot ( Ashlry and W x d . 1903 ). Chiasinata urere observed iii this location

in 69% of cells examined. implying a recombination rate of 34.5% However. there are

other sites of frequent chiasma formation in cells of this species at which telomeric signals

were not detected. The excimination of chiasma formation in other or_oanisms in which

interstitial trlornere-like DNA sequences have been observed should establish ihat this

observation has relevancr. The related Chinese hamster ( C. griserrs) hrid several signals in

centromeric DNA or on the short m s of subrnetacentric chromosomes. but no other

obvioiis interstitial sites ( Meyne eî al. IWO).

Genetic crosses of recombinant inbred mouse s ~ a i n s rnapped a restriction fragment

containing teiomere repeats to a location on rnouse chromosome 1 1 that is homologous to

the distal p;tn of humnn chr«inosome 16p. including the HBA (a-globiri) locus (Elliot and

Pazik. L996). .4t lrlist 130 kb OC DNA at this locus is simikir betwcen thesç tu1o species.

suggestins that a region of DNA corresponding to distal ancestral 16p material was

triuislocnted into an interstitial location in the mouse genome üftcr the divergence of these

species. This represents an earlier event in rvoiution than the interstitial site on human

chromosome 3p. and is the only example in normd mice that appeürs to represent a

translocation of a teloniere into an existing interstitial location. The genomr of rî4u.s

muscdris conrains no interstitial sites of telomere repeats that can be detected by FISH

(~Meyne rr ai. 1990). In recent Robertsonian translocations. telomere signal wus not

detectrd al the centromere. suggesting that telomeric sequences have been lost from the

short arms of the fiised chromosomes t Schubert t.r cil. 1992): however. ii si mil;^ fusion in

the rodent Si,qnodun nwscorensis retained telomere signal at its centromere (Meyne ri al.

1990). The abnormal Xssi- chrornosomr of Se.r reversai mice contins a ponion of the Y

chromosome that has been traoslocated distal to the long a m telomere of the X. resulting in

the presrnce of telomeric repeats in an interstitial location (Ashley et al. 1995).

A recent study considered chromosomes of the two members of the Family

Giraffidae. the giraffe r Gir&i~ cerwlopcirrlnlis) and the okapi (Oklipicr jolvistorzi)

(Vermèesc h ef d. 19%). A balanced chromosoma1 trrinslocation. t( rob )(-C:% ). reduces the

diploid chromosome number 2n from 46 to 45 or U in some individuals within the okapi

population. FTSH with a telomere probe revealed interstitial signals only at telomeres of a

2n = 46 specimen, but signals were observed at telomeres and at the centromeric fusion

point of the translocation chromosome in a 2n = 4 4 specimen. By cornparison. interstitial

signal'; wsre observed in the girafi karyotype at the centromeres of tlve chromosomes

thought to have evolved throiigh centric fusions. and at sites of centromc-ric

heterochromütin found in al1 tive biarmed autosome pairs. As the karyotype of the

Giraffidae is thought to have evolved from a I n = 60 karyotype similar to that of cattlc via

multiple ccntric fusions, the probe was also hybndized to bovine chromosomes, but no

inrerstitial signais were obslrrved. The authors concluded that the interstitiai signal

observsd in the okapi may represent a remnant of a relatively reccnt chromosome fusion

event. whrreaï teloincre repoat DNA sequencrs may not necrssxily be foiind at al1 sites of

end to end chrornosome fusions that have occurred earlier in evolution.

Members of rhe same Order as the Giraffidae (Aniodtictyla) have also bren studied.

The Indian rnuntjac (iC.lwiri~icrrs r~lrrrirjtrk ixl,yimtli.~) has the smrillest chromosome number of

al1 rnammnls studied (2n = 6). and also has two interstitial telomeric signÿls that were

detected at sites thought to represent ancestral chromosome fusions derived iiom a

karyotype similar to that of the Cliinesc muntjüc (Mmzti~rcrts rce\:rsi: 2n = 46). These sites

3150 hy bridize to a centromrric heterochromatin probe. Neither the Chinese muntjac nor the

reIated woodland caribou (Rangger tcirclticitls cnriboti: 2n = 70) were observed to have any

signal at locations other than their telomeres.

Seven species of hylid frogs were each observed to have interstitial sites, at

locations that Vary between species and in one case appear to be polymorphic within a

species (Wiley et cil. 1992 1. However. these species have 2n = I I chromosomes (iilthoi~gh

one is tetrnploid and one a triploid hybrid). It therefore does not appeür that these signals

represrnt remnants of cliromosome fusions involved in karyotype P. olution. The locations

of the signals have been takcn to agret: with existing knowledgr of the speciation of thesc

hylid frogs. It is possible thüt these interstitial sites were generated at a very ancicnt timr.

and have become polymorphic between species as a result of differential sene conversion.

amplification or submicroscopic deletion.

lnterstitial te lomeric repeats have cils0 been found in the protozoans Tm-d~yrne~zct

and O . ~ ~ i c l z c i , at the ends of transposon-like DNA elements. Telomcric reprats arc also

found at interstitial locations in the nematode C. eleg~îris, predominantly in the dista1

regions of chromosome xms. and often in association with othrr repetitive DNA elrments

t Cangiano and La Volpe. 1 993). In the yeast Smclioror~i~*ces cerei?sicie. small blocks of

telomrriç repeats are often hund at the junctions bctween subtelorneric Y' rleinents. or

betcveen Y' and ,Y slsmcnts. witliin a t ; ' ~ kilobases of the end of the chromosome

(reviewed in Zakian. 1995 i . Among plants. ntiither the broüd hem. Vicili firbci. nor

At-r~bi(lopsi.s t l z d i m c i was obsei-vcd to have üny interstitial signals ( Schubert et rd. 1 992 ).

In summary. the presence of interstitial telomeric repeat seqiienccs appears to retlçci

the dy namic nature of genomrs during speciation and evolution. Recent chromosome

fusions and translocations often Ieave behind inte fititial tclomeric DNA that is readily

detectablr. More iincirnt rvents have also occurred. in which interstitial sequences have

later degenemted or have perhaps shortened below the sensitivity of detection of FISH.

Even so. such repeat arriiys c m severely hamper methods of cloning subtelomeric DNA

based on hybridization to telomere sequrnçes or PCR amplification of DNA adjacent to

them. and must be considered during the analysis of clones that are thought to denve from

telomeric locations.

1.2.f Protein components of telorneres

A variety of proteins that bind telomenc DNA have k e n cloned from different

organisms (reviewed in Zakian. 1995). The best characterized telomere binding protein is

Rapip of the yeast S. crrei-isiïtr (reviewed in Shore. 1994). RAPI is an essenrial _orne thüt

sccodrs ii protein that binds specifically to telomeric repeats. as well as to many promoters.

The Rap l p protrin is very abundünt. prcsrnt at about 104 molecules pcr nuclrus. Rap Ip

binds to a 12 bp sequcncr of double stranded DNA (CACCCACACACC). found within S.

cerevisicir telomeres. although in ritro i t nlso binds to single stranded DNA of the süme

sequence with a mucli l o w r affinity. Overproduction of wildtype Rap 1 p. or some point

mutations (nipl" rniitcints) result in increased tclomere lrngth (Diftley. 1992). C-terminal

truncutions of RapIp irtrpl[ mutants) result in extremely long telorneres that cire pronr to

deletion ( Kyrion et cil. 1992). in addition. Rap Ip is required for transcriptional silencing

due to telomere position effect (.section 1 .?.cl. Rap l p also assists in the positionin: of

telomeres üt the nucleu envslope. through interactions with the products of the SIR (silent

information regulator~ grnes. Sir3p anci Sis4p. Thesr interactions at the nuciear envelopr

are also likely to br related to transcriptional silencing through telomere position etirect.

A protein that binds double stranded telorneric DNA was isolated from human

nuclear estract (Chons et cil. 1993). The 60 kD protein. terrned hTRF I for "human

tdomtric repeat binding factor") does not reqiiire a DNA end for its binding. is specific for

double stranded TTAGGG repeats. and is presrnt at al1 stages of the ce11 cycle. A sirnilx

protein wns also idrntifird in rnonkey and mousr nuclear estrricts. The transcript rncoding

hTRF is iibiquitously exprrssed. hTRF contains a DNA binding domain. iwo overlapping

nucleoplasmin-like nuclrx localization sigais and an acidic amino-terminiil domain thnt is

rich in asprirtate and glutamate residues. hTRF was shown to colocalizr with telomeric

DNA dunng interphase and metaphase. This protein may have similar functions to double

stranded telomere binding proteins. such as Rap l p from S. cerevisicir. although the binding

site in telornenc sequences differs. and no similarity in their amino acid sequences has bren

detected.

An abundant. 37 kD. single stcindrd TTAGGG binding protein. trrmsd sTBP. ha';

also been idrntitïed in mousc liver (McKay and Cooke. 1991). A similür protein wüs

deteçted in a variety of tissues h m rat. chicken. cow and pis. sTBP protrin nia- bs

involvecl in binding to single stranded DNA at the sxtreme termini of chromosomes.

perhaps in order to aid in trlomeric interactions with the nuclrar membrane.

In addition to Rap 1 p. a protein called Tbf 1 p/Tbfup was isolated from S. coriisitrr

through screening of an expression library with labelled (TTAGGG) jo probe. This protein

binds TTAGGG repsats. which are found just proximal to some yeast telorneres. The

TBFI sene is essential for viability. Tbf 1 p c m bind isolared TTAGGG repcats separated

by short non-telomeric spaccr regions. unlike Rap Lp and humün hTRF. Tbf lp hüs no

obvious sinilarities to othrr DNA binding proteins.

Tdomere binding proteins have dso bren isolated from the hypotrichous cilinted

protozoan 0.yrricliri rioiur and from the frog .Yeriuptts ( reviewed in Zakian. 1995 ). The 56

kD u protcin of 0z-p-icitu binds to the single sirandrd teminal overhüng stquence.

(TTTTGGGG)?. The 41 kD B polypeptide ncts with a. in ordrr to cause ii telornrrc-

specitic methylation pattern (Gray rr d. 199 1 i. Genes rncoding homologous poiy peptide?;

were cloned from the hypo tric hous cil iate Sh~lorzcltin nzpiliv (Fang and Crch. 1 99 1 ). and a

5 1 kD homologue of the Osyrriclitr u polypeptide has also been charactenzed in another

hypotrichous ciliate. Etrplotes cnissiis (Price rt al. 1992). A small number of proteins

apperir to bind specifically to telomeric DNA. witli distinct proteins binding to double

strandcd and single stranded regions. These proteins possibly have f~inctions in the

protection of telomeric DNA from degradation, in poçitioning of chromosomes within the

nucleus. or in the establishment and maintenance of specific chromatin structures adjacent

to telorneres.

Trlomeric DNA is synthesizrd by a ribonucleoprotein activity cdled teiomrr~sr.

originally characterized in the ciliated protozoun Terrdiyrrrici. The essential R N A

cornponent of telornmae provides the trrnplate for the synthesis of telomers repeats.

Telornerrisr activity (rom human nuclear extriiçrs can be aïsayed by the formation of

extension products of telomrre-like oliponuclsotide primers. yielding a characteristic six

base pair lüdder due to pausing of telornerase aiirr synthesis of rnçh repeat (~Morin. 1989).

Eariy studies o f maizs chromosomes showed that broken chromosome ends are

"healzd" in germlinr. but nut somatic. tissues (reviewed in Zakiün. 19%). An andogous

situation is observed in humans. where telornerase activity cannot be drtected in rirher

primüry humm tibroblasts (Counter ef <il. 1992) or embryonic kidney cells ( Allsopp et c d .

1992). Telornerase activity was dctected in ovary and trstis. but not in fifty other adult

somatic rissues of hurnans i Kim er al. 1994). The RNA component. hTR. is however

widely éspressed in adult somntic iissurs and in the gemiline. supsesting that replation of

telomrrasc activity is achievcd through the expression of its protcin componrnts ( Feng el

cl. 9 9 Human telomrrasc is probably active only in p-mlinr. and perhüps early

rrnbryonic tissues. leciding to the hypothesis that telornerase is present in grrmlinr tissues

and becomes less efficient with age or is "switched off' during cmbryogenrsis (Lindsey ri

(11. 1991)

Thc substrate speciticity of telornerasr has brrn studied in some detüil. Analysis of

terminai deletion and new tclomrre formation in Pl~isniorli~ri~ijiricipc~r~~~~z suggcsts that there

is no sequence requirement at the site of a chromosome break. other than possibly the

dinucleotide CA. which was often found at or adjacent to new telomere repeats (Scherf and

Mattei. 1992). A similar observation was made in the fungus Nerrrosporu crussa. in which

new telomere formation occurred at many sites after breakage within ribosornai DNA genes

(Butler. 1993). New telorneres have also been observed on marker chromosomes formed

during gene rimplification events in Chinese hamster o v q (CHO) cells (Brrtoni et trl.

1994). Extensive arrays of TTAGGG detzcted on these nmplified DNA segments may

represent bretlkage events within mays of TTAGGG found near cenuorneres. which then

hnction as telomeres. X siinilar phenornenon was also obsen'ed in spontaneously

transfotmed CHO d l cultiires ( Meyne er d. 1990 1. New telorneres have also been

obsrrved on fission Jrrivüti~es of a metaçrntriç chromosome of the broüd ban. Viciti j i h r

(Schubert er c d . 1992). and in three cases in humans in which terminal deletions have

unambiguously been accompanied by new telomere formation (Hen et rd. 1995; Wilkie er

cil. 1990: Lamb et trl. 1993). In contrast. a study of five human malignant melanoma ce11

lines showed that apparent terminal deletions were actually cryptic translocations. in which

the telomere hiid been xqiiiréd tiom another chromosome I .Mrltzer er d. 1997 ). In human

tumours. new relornew formation by telornerisr may not be the rnost freqiirnt mechanism

by wliich broken chroinosorne ends arc stabilized.

Telornerasr also has a role in cellular irnmortiilization. In a study of huinan cell

types. 90% of tumours and 98% of irnmortal ceIl lines were found to have telornerrise

activity. In contrast. no mortal ce11 lines ur adu1t sornatic tissues were found to have

telornerasr iictivity. and nor did bcnign fibroid tumours (Kim et [ri. 1994). During

transformation. human ernbryonic kidney cells were shown to activate telornerase and to

xquire stable telomsres thüt no longer decrwsed in sizr with each ce11 passagr. (Couiitcr et

d. 1992). Telornerase activcition appenrs. therefore. to br an important event in thé

establishment of immortalized ce11 lines both i r z vitro and iir vivo.

Mechanisms tliüt stabilize telomeres w i thout telornerase activity have also bcrn

observed. ln humans. ci study of a widr viirirty of immortalized çrll lines. and the mond

lines fr-orn w hich the' arose. reveriled thrlt about 40% of immortnlized ce11 lines had

extremely long and heterogeneous telomeres. but no detectable telornerase üctivity. There

was no correlation between ce11 type or method of immortalization and telornerase rictivity.

Hybrid lines between telomerase positive and negative ce11 lines were mortal. Telornerasr

activity waï concluded to bs neither necessary. nor sufficient. for ce11 immortalization.

alihough it occurs in the majority of cases and probably has an important role in the

establishment of a growth iidvantage for crlls passing through crisis on their way to

becoming immortalized (Bryan et cil. 1995 ).

Thrre is also svidence from the yeast S. cerrvisitrr rhat a recombination mechanisni

can substitiite for tt=lornerrisc' to stabilize broken chromoson~c: ends (seviewed in Ziikirin.

1995). In an est1 strain. in which telomeres progressivrly shortrn and celis rvrntually dis.

surviving clones occiIr which tlcquire longer trlomeres. This process does not occur in

t-(id52 mutmts. which are deticient in inost forms of mitotic recombination. irnplyiiig a

rscombinritional rnechrinism ( Lundbtad and Blackburn, 1993). An alternative mechanism

hüs bern observrd in wildtypr yrast. in which recombination during tclomrre formation

occurs independent of RAD52 (Wang and Zakian. 1990). This moy be relatsd to a

tdomrrüse-like activity more recrntly observçd in yeast that is not dependent on the yeast

telornerase RN4 trmplate ( Steiner rr id. 19% ). Drosopliiki telomeres. as previously noted.

are miiintnined by retrotransposition of ~ w o types of DNA sequencr clçrnrnts to

cliromosomc ends r wction 1.Z.c ).

Only three candidates for protrin compoiicnts of trlomeriisc have besn described

(reviewcd in Zakiiin. 1995 1. The S. cei-wisicre protein Est 1 p copuri iles with telonrrasc

açtivity (Steiner et r d . 1996). Deletion of the EST1 gene results in a phenotypr where

telomeres shorten w ith racli round of repl ication. eventually rrsul ting in ceIl scnescrncr.

This plienotype is identical to thüt ohsenai when the yeast telomerase RNA sene. TLC. is

deletrd. Est 1 p is likely an nccessory I:.ictor thüt incrrasrs the processivity of tclomcrasr.

but is not absolutely requircd for tc1omrr;ise :ictivity in S. tel-eiisiw. Two genes. encoding

proteins of 80 kD and 95 kD. have been identifieci in Trtr<rhymvrci. Both CO-purify with

telomerase activity, and the 80 kD component binds to Terrnhymencr telomerase RNA. The

95 kD protein interacts with the G-strand telomenc DNA. Neither is essential for

telomrra~e activity. al though either may be an accessory factor. similx to yeast Est 1 p.

1.4.a Subtelomeric DNX sequences

The nature of sequcnces adjacent to telorneres (subtelomeric DNA) haï bern

described for many organisrns. inçludiny yrast. protozoa. ryr grass. Drosophilcr. micr and

humans. These Lue refened to as subirlomrric DNA. and ai-e ipierally direct DNA rrpeats

(reviewed in Brown er <il. 1990). Ln humans. a variety of tandem repeiits have been

identified in subtelomrric loçütions (Table 1 - 1 : also reviewed in Royle. L 995).

Minisatellites, N i t repeat sequences. transcribed and evolutionarily conserved sequences

have also been reported within srverd kilobases of the boundaiy between the trlomeric

TTAGGG repeiits and non-telorneric D M . A lrirger tandem repeat of 3.2 kb was müpped

by high resolution FISH to within 15 kb of the telomere of chromosome 4q. nrar the locus

for tàciosciipulohumrr~l miiscular dystrophy (FSHD) ( Bengtsson rr d. 1994 ). Trindrmly

repeared VNTR poly iiiorphisms are more I'requent neür telorneres than rlsrwhrre in the

oenome (Royle et c d . 1988 ). Ln addition. ü variet). of mildly repctitive dispsrsed reperit C

sequences have been locdized. niainly by FLSH or somatic ce11 hybrid rntipping. dose to

hurn~in telorneres. but not nr2cessarily immsdiately adjacent to telomere repeats (Martin-

Gallardo er nl. 1993: Weber el al. 199 1 b: Altherr cr c d . 1989). Subtelomeric repeats are

often polymorphic both in the number of repcÿt units present. and in their prrsrnce or

absence at il given chromosoma1 end. The repeats often hybndize to subtelomeric regions

of several chromosome arms (IJdo et (11. 1993: Youngman er 01. 1993). A cosmid clone

dcrived from the üncrsrral telomere to trlomere chromosome fusion junction on the long

arm of chromosome 2 (section 1 -3.d) has been shown to hybridize to 1 Jqter in

chromosomes of some individuals ( IJdo er c d . 199 1 a and J. W. IJdo. personal

communication). No other subtelomeric repeats have been identified at Irlqter.

DNA sequencing h;ls shown thiit somc arrays of human subtelomeric repeats cnn

contain incornplete repeats that are truncatrd ot variable positions i Royle rr rd. 1992 1.

Together with the observation that not al1 chromosome ends contain subtelorneric DNA

sequences. this suggesrs that these repeats are not required for telomere function. This is

reminiscent of experiments in Socclrcrro~n~ces cerrvisicze with cinificiai chromosomrs

lacking subtelomeric reperits. Subteloriieric sequences were s h o w not to be required for

correct chromosome replic~ition or segrqation (reviewed in Zakian. t 995).

In the rnouse. crntromeric minor satellite DNA is located immediately proximal to

the telomeres of the short arms of 311 chromosomes (Kipling et d. 199 1 1. Xntilysis of

telomeric YACs initiiiily suggested that thrre were no widrspread subtelomeric DNA

hmiiies found ai many long arm çhroniosome termini. as thrre are in humans ( Kipling cr

<i l . 1995). A single 670 bp subtelorneric repcat was subsrqucntly cloned by anchored

PCR. and shown to hybridize to nearly dl mouse telorneres. betwsn the minor satellite

DNA and the telomeric repeats (Broccoli er al. l992 ).

Dmsophilti subtsloii~rric D'lh consists of arrays of up io 7 kb in total length.

cornprisrd of tandem repeats of 460 bp. 0.9 kb or 1.8 kb. present at each chromosorne end

that has been studied. Euchromatic genes can be found as little as 10.5 kk from the

retrotriinsposon arrays at thc telorneres (Mason and Biessmnnn. 1995). Tandernly repeated

subtelomei-ic scqiiences are located in regions that tire polymorphic on Plastwdiio~r

firlcipc<nitti chromosomes. with lcngths ranging from 50 to 300 kb at chromosomr termini

(de Bruin el ( i l . 1994). S. cet-rvisim chiomosomrs also have subtelomeric sequences. the

6.7 kb Y' ekment that is foiind in zero to four copies adjacent to ~ h e telomeric repcats. and

the X rlement that is çornprised of several types of moderately reprtitive DNA rlernents

totalling 0.3 to 3.0 kb in length. located proximal to Y' sequences (Zrikian. 1995). Anothcr

fiingus. Piwionocïsris cru-itiii. htis v r r y short subtelomrriç repeats of six to twelve bp in

length. as well as 160 bp repeats (Wüda and Nakamun. 1996). In numerous other

species. ribosomal DNA repeats are found in subtelomenc regions (for exarnple. the

protozoan parasite. Gicrrciicl Icmhlin (Adam et cri. 199 1 )).

The fact that subtelomeric DNA sequsnces are found in rnany speciss sug=ésts that

they are either caused by ü process important in the maintenance of telorneres. such aï

recombination betwcirn difkrrnt subtelorneric regions. or that thry have a Rinction in

maintaining chromosome structure near telomeres.

1.4.b Meihods of' cloning subtelonieric DNA

Telorneres are refrrictory to coiiventioniil cloning tcchniqiirs. as tslomrtric tiindrin

repeats are dc fi ficent in sites for restriction cndonucleases. Some restriction enzymes

cleave variant repeilts: for rsample. IC.lril1 and Hplil digest the TGAGGG arrays found nex

human telorneres (Allshire rt cd. 1989). These enzymes can not be used for cloning in

conventional plasrnid vectot-S. An early strategy for cloning human subtelomeric DNA

relied on the observation thor fragments containing telornsrr reprats are liuger than the bulk

of DNA fragments producrd after digestion with fiequentlp cuttin: enzymes. Size srlectsd

human DN.4 was digested for one hoiir wirh nuclease B d 3 1, then blunt clonsd into

plilsrnids ide L a y e P r cil. 1990). This iippronçh provided a subtcloinrric probe. pTH2A.

that was subsequently ~ i x d to map disial 2 1 q ( Burmeister cf cd. 199 1 ). Plasmid cloning of

DNA that lias previocisly b w n paninlly t l iptrid with an esonucleüse to remove telomrric

rrpeats aiid produce blunt ends has also brcn ~issd in other orpnisms. for example the

fungus Prteru~roqstis cnri~iii ( Wada and Nakamura. L 996 ).

Telomere function is conserved ilcross eukaryotic species. This observation led to

the development of n Iùnctional complsrnrn&ation strategy for cloning telomeres in yeast.

Yeast x t i ficial chromosome ( Y AC ) vectors were constnicted to include a functional

ccntromere. origin of replication. selecrciblc markers. cloninp site. and a single telomerr

derivcd froin Terrclhyimtr. When the vrctor was linearized and lisated to DNA frngnirnts

Table 1-1. Hurnan subtelomeric DNA clones

cIone cloning tandem chromosomal - name source repeats location references

p ~ ~ ? ~ b - c plasrnid 29. 37 bp 7. 16. 17. 11 de L~inst. t)r ci l . 1990

~e l~ l i i n3 .4b Y X 29. 37. 16p "A"? 16p "CM Wilkie rr cd. 199 1

61 bp b. 3q. 6 ~ 3 , 9p. a. Brown et cil. 1990:

10. 1 1 p. 12p. 1 Sp. Kviilsy c.1 (ri. 1994

1 5q. 1 OP. N p . ?OP.

m. a. Yci, 2q13

-

TelBiirnS YAC none 7q Riethman Cr c d . 1993:

Brown ct cd. 1990

- -

7a1/-lf Y AC 63. 75 bp Xp. Yp

- - - - - -

Brown. 1989;

Brown et cil. 1990

- -- - -- -

TelBnm 1 Il YAC 79. 37. 16p "B" W i l kie er cri. I 99 1

~ e l ~ a u 2 . 0 " ~ ~ 61 bp me. 16q "B" Harris and Thomas,

1992

31q Reston er tri. 1995

Iq. 2q. 5q. 7p. Sp, Brown cJt (11. 1990

10. 17q. 19q. 'Op.

31q. 22q

Table 1- 1 (continued). Hurnan subtelomeric DNA clones

clone cloning tandem chromosomal name source repeats location references

39C 1 cosmid VNTR: N S ~ Xp. Yp Cooke et id. 1985

HC 1403 YAC NS Iq. ochers 'Jegoreu rrcrl. 1994

HC 1208" YAC N S lq. othrrs Negorev er cd. 1994

3q Macina et LI/. 1994

phage A Y A C Y S B T NS A q Brngtsson rt L I / .

1994 Yuun, ~JI'H;LII c'l

d* 1993

YXSBT Y .AC YS -&p. 13p. I jp . 2 1 p. Youngmnn er d. 1992

22p

cos56.1.1 cosmid N S II>. 6p. 6q. 9q. 1 1 P. [Jdo er d. 1992

i 5s . 16p. 1 6 ~ . I9p.

20q

Table 1-1 (continued), Human subtelomeric DNA clones

clone cloning tandem chromosomal name source repeats location references

cGIA3 cosmid NS 3p. 3q. 6p. 9p. 9q. Weber rr cil. 199 1 b

Ilp. 12p. 1Sq. 16p.

19p. 19q. IOP. X q .

Xq. 2q 14+q2 1

S47EC phage none 4p. 14p. 31p Al therr et a/. 1 989

many (not mapped) Cross rr d. 199 1

15. 82 bp b. Jp. 4q. 6p. 8p; Cross et d. 199 1

Lip, I ~ P ,

Nq. 3. 32q. 2q 13

A 1. ,-Cc YAC 46. 61 bp 9. 5. 19. 21. -- i 7 Cheng rr tr l . 199 I

BC YAC none 43 Cheng rr ( I I . 199 1

- -

TS K8 PCR 63 bp Xp. Yp Royls rr (11. 1992

TSK16.1 PCR nons 7q Royle er c d . 1992

Table 1-1 (continued). Human subtelomeric DNA clones

clone cloning tandem chromosomaï narne source r e ~ e a t s location references

STIR cosmid 350 bp XP- YP Simmler er al. 1985

i tandem only 1 p. 7q. I p . 5q. 6q. Rouyer et c d . 1990

on Xp. Yp) Sp. Sq. 9p. 1-q. 13q.

I5q. 19p. 23q

- -

CS. 1 A cosmid YS -3q. 6p. 9p. [?p. IJdo et al. 199 1 a

m. 19q. ?Op. ?Oq.

Yq. Zq 13

CS. 1B cosmid N S 1 q. 7q. 3q. 4 3 . 4q. IJdo er <ri. 199 1 a

5p.Sq. 6p. 6q. 7p. Yp.

9p. 9q. 10q. L2p. 13q.

I5q. 16p.16q. 17q. 19p.

199. 20p.20q. 3 1 q. 22q.

xq. Yq

G2- 1 H PCR none -h Weber CI c d . 1 990

D4Z.C cosmid 3.2 kb 4q. 10q. lq12. Hewitt rr trl. 1991

1 3 ~ 1 3 . 1 4 ~ 1 2 . 1 5 ~ 1 2 .

2 1 ~ 1 2 . 3 2 ~ 1 2

Table 1-1 (continued). Humtin subtelorneric DNA clones

Underlined locations Lire known to be polymorphic. present or absent at this telomere.

When repeats of different lengths are present al a single telomere. they are manged as

separrite blocks of siiriilar tandem repecits.

a TelBam 1 1 is Iiomologous ro HC 1208 t Miicina et c l / . . 1994). TeISttii1.0 is :i sliorter

clone. corresponding to the distal portion of TslBüm1 1 (Brown et cri. 1990).

h pTH2A. TelSau2.O and TrlBam3.4 are homologous to each other (RoyIr rr cri. 1992).

An additional clone. pTH l4A. was not mapprd. çontains no repeats. bot hybridizes to

hurnan telomeric DNA fragments (de Lange t.f tri. 1990).

pTHI4 and pGB-IG7 are honiologous to A 1. .A2 and B t Cross et d. 199 1 : Cheng et d.

I9Çl i .

d XS: nor squrnced. VXTR: variable nurnber of tandem repcüts polymorphisrn.

S i x polymorphism of 16p and 16q results in different alleles of these telorneres (Wilkir

rt al. 199 1 : Harris md Thomas. 1992). 16p "A" is the shortest; "B" is 1 Y0 kb. "Cu 260

kb. and "D" 75 kb lonser than "A". The shorrest allele of 16q is "Cu: "A" is 125 kb and

"B" 170 kb longer thnn "C". Wliich alleles of 16q conrain TelBaml ITTelSau2.0 was not

detern~ined.

7a l/A is homologous to TSK8. Additional clones TS K7 and TSK.18. I were not rnappecl

and contain no repents: clones TSK6 and TSK37.1 were nor mapped but are homologous

to TelSau2.O. TelBüni3.1 and pTH2A ( Royle et d. 1992 1.

to be cloned. only molecules that ligated to another functional tçlomere from eukqot ic

DNA were expected to propagatr as lincar ch~omosomes after transformation into yeast

spheropiasts. YACs generated in this rnanner had two functional telorneres. one derived

from the vector. and one from the cloning source. This method has bcen used to clone

tslomeres frorn numcrous organisms. including humans (Riethman rr al. 1989: Brown.

1989: Bates et cr i . 1990: Cross rr (ri. 1989: Cheng er d. 1989). mouse < Kipling ct rd. 1995 i.

Pfcisrirotlirrr~i$1Icip~i1-11111 (tlr Bruin et trl. 1992 i and Pilrio~iocj~sfis clrriiiii ( Lhdciwood rt ( i l .

1994.

An alternative stcitegy for cloning telorneres is anchored PCR. using (i prinier

çomplsmrntaiy to trlomsric repcats. This method avoids cloning large iimiys of taiidernly

repeiited telorneric DYA in bacterial hosts. While this is an effective method for the

isolation of sequences adjacent to tslorneric repeiits. clones obtainsd in this miinner arc

necessarily short. There is no requirrriic.nt for trlomere funçtion with this striitegy and

clones therefore rnay be derived from interstitial sites. or frorn alternate sequences in the

grnome that hybridize to the telomeric primer. Such clones must be extensively

cha~icterized in order to estriblish their telomeric location. This method has been

successf~illy üpplied to the human. rnouse and chimpanzee senornes (Royle rr d. 1992:

Weber et c d . 199 1 a: Broccoli er r d . 1992; Royls et c d . 1994 ). An alternative striitsgy.

involving nffinity capture of teloineric DNA with biotinylated RNA and subsequent PCR

amplification using primers fsom disprrsed repetitive DNX elemrnts. was succcssfully

~ised to isolate subtelomeric DNA sequences from mouse chromosomes (Rounds et ( i l .

1995).

The most popi l lx iipproaçh for mapping human subtelorneric regions has bren the

analysis of telorneric YACs. Chapter 3 of this thesis describes two telomeric YACs from

14qter. and their use in mapping the l-lq subtelomeric region.

1.4.c Transcription repression in subtelomeric regions

In the yeast Strcclzaromyces cereviskir. transcription of a marker gene that was

artiticially placed immediatrly adjacent to telomenc repeats was found to be repressed.

This has bcrn termed rhe telomere position effect. and is rerniniscent of position sffect

variegation of D~*n~.oplrilu irsviewed in Grrider. 1997). The repression is indcpendrnt of

the marker gene inserted. the orientation with respect to the telornrre. or the sprcitic

telornere adjacent to which the gene is insertcd (Gottschling rr (ri. 1990). The

triinscriptional silencing occurs in rnost cells and is mrdiated by proteins involved in

silencing at many other loci. as describsd below. The transcriptional status of the m a r k is

inhsrited in an rpigenetic hshion. in that i t can switch frorn one statr ("on" or "oK') to the

other. from genrration to generdtion. Genes plüccd near telorneres have many similarities

to heterochrornatin. in that they are late replicnting and localizrd to the nuclear cnvelops.

These chromatin domains are resistant to endonuclease cleavage. suggesting that a different

cliromatin structure rxists near telorneres than elsewhere in the genome (Kornberg and

Lorch. 1995).

In yrast. the sileni iiihrrnrition regulator (SIRI genrs are required for transcriptional

silencing iit many loci. Of these. SIR?. SIR3 and SIR4 are necsssriry for teio~neric

silencing. .ilthough SIR/ i \ not recluired for transcriptioncil silrncing ;it wlonierrs. the

SAS2 gene. which snliiinces SIR/ silrncing. is itsclf rrquired for trlomsric silrncing

(Rrihnyder cl d. 1996).SIR3 is required for maintaining the silenced state once it has been

initiated.

The link brtwern telornrre position el'fsct and chromosome stnicture involves

ucetylation of core histones (reviewed in Kornberg and Lorch. 1995). SIR proteins bind to

the N-terminal "tails" of histones. Ovsrprod~iction of wildtype SIR2 protein rrsulis in

decreased acetylation of the core histones H?B. H3 and H4. SIR2 may therefore rncode

either a histone dcacetyiasc. or an inhibitor of histone acetylation. mutants of the /VAT/

and ARDI genes. which encode subuni ts of an N-terminal acetyltransfrrrise activity that

ricetylrites many proteins. rire atso deîëctive in telorneric silencing. The SAS2 gene is

homologous to acetyltransferases. and may also have a role in determining chromritin

structure in regions subject to telomenc silencing (Reifsnyder et cil. 1996). Mutations of

the histone £34 genr. H H F L also impair telomeric silencing (Greider. 1992).

It should be noted that some genes of S. cererisirir that are located very close to

specific telomeres are known to be transçriptionally active. and that Y' subtelomeric repeats

rire also tr:inscribed. indicating that silencins is not essential [or hinctionril telorneres.

Transcriptiond silencing of genes iidjacent to telorneric hrtrrochromatin of

Drusopliii<i h a also bern documrntrd. Gsncs located adjacent ro the ends of cliro~nosomtis

that have had their telomeric heterochromiitin deleted are transcribcd. sugp t ing thiit

location is itself not sufticient for transcriptional silencing in Di-osophila. A v&ty of other

organisms have trcinsçribed senes located adjacent to telorneres. suggesting that silcncing ot

telorneres is riri event tliat is specific to certain chromosomal ends (Grsider. 1992).

1.5 PHYSICAL kIAPPING OF HU8IAN SUBTELOMERIC REGIOXS

1.5.u Human subtelomeric regions

Tslomeric YACs have besn used to chruacterize a numbsr of humm subtslorntxic

regions. notably thosc of chromosomes 14q t Cook et d. 1994: Wintle and Cox. 1994:

Wintltt er d.. in press Geiiot~iics 1997: Chnptrr 3 ): the XqlYq pseudociutosomal region

( K v ü b y rr ci l . 19941: Ip. 6q. 8q. 12q. and 1 Sq (Macina rr ci l . 1995): 7q (Riethman Cr d.

1993 ): 2q (Macina cr d . 1994): I p (Battis rt ol. 1990): 1 q (Nrgorev et ci l . 1994) and 2 1 q

(Reston et LI/. 1995). It was necessary to establish foi- each telomeric YAC that the YAC

sequeilces are truly located adjacent to the trlomerr in grnomiç DNA. rother thon having

been formed from intmtitinl tracts of tdomeric reprots. This has bren ;iccomplishrd by

drrnonsuating nuclrasc &il3 1 sensitivity of sequences present on the YAC (Riethman er crl.

1993: Reston et cri. 1995: Wintle rr td.. in press Grriomicv 1997: Chapter 3). or by iising

RecA-assisted restriction endonuclease clsavage (RARE) to compare distances in YAC and

genomic DNA (Femn and Camerini-Otero. 1994: Macina rt rrl. 1994: Negorev et c d . 1994:

Reston er cd. 1995: Macina and Riethman. 1994: iMacina et cil. 1995).

In the absence of relomeric YACs. characterization of subtelomeric resions has

relied on Ion? range mapping by PFGE. typically through partial digestion and probing

with n sequsnce ülready known to be located near a telomere. This approach was used to

müp the huinnn Xp/Yp psrudoautosomril rqion I Rappold and Lshrach. 198s: Brown.

1988) and the subtelorneric region ot'chrornomne 16p disttil to the a-globin scne cluster

1 et 1 1 1 ) Combination of PFGE with radiation hybrid mapping hus dso been

used sucçesstùlly to map the region neau I lqter. again with a previously cloned

subtelomeric probe (pTHW) that anchnred the map at its distal end (Burmeistcr et d.

199 1). RARE is also ;i usefi11 procedure for müpping telorneres that have not been cloned

in p s t .

An attractive alternative to PFGE rnapping is hizh resolution FISH. used

succrssfully to niap ilie subtelomcric rcpion of chromosome 4q. nrar the locus for

facioscapulohumerd muscular dystrophy (FSHD) (Bengtsson cr d. 19911. This ctpproach

again relisd on rhe existence of o known probe that hybridizrs to the region. This is likrtly

to be a usrtul alterna[ivr to RARE cleavasc. niiipping. for subtr.loineriç regions char cannot

bc çloned in telorntiric YACs.

1.S.b Terminal deletions

Naturally occurrin~ icrminal deletions have bern reponed for many human

chromosonies. Howswr. apparsni terminal deletions can br dur to interstitial deletions that

retain ri snirill amount of thc telornue. or to cryptic translocations in whicti ~i

submiçrosçopic portion of the trlomeric region of imothrr diromosomc: has bern

translocüted to the apparently drlrted cliromosomr. In order to drfine regions of terminal

cieletions that can contribute to specific phrnotypes. i t is necrssq to have a rnethod to

charactenze telomeres of al1 chromosomrs. A recent study reports a panel of probes

specific to almost al1 human telomeres. that cm be used for clinical cytogenetic study of

patients with suspected terminal deletions or cryptic translocations (National Institiites of

Health and Institute of Molrcular Mediciiie Collaboration. 1996). Notably absent to date

are probes for the shon m s of the acrocentric chromosomes (13. 14. 15.2 1 and 22).

1.6 RECOMBINATION IN SCTBTELOMERIC REGIONS

1.6.a Genetic linkage analysis and genetic müps

The average cite of meiotic recombincition for huinan DNA is often quoted as one

crntiMogan (CM) per million base pairs (Mb). This estirnate is based on the division of the

observcd numbrr of chiasrnata per cell by the estimated grnome size. A more recent

çstimate suggestrd a \es avrrrigrd aiitosomal rate of 1-24 c W M b ( Morton. 199 1 ). The

corresponding rate Tor chroinosomr I - I was I .OS cM/Mb. The subtrlonirric rcgion of

chromosome 14. I-lq33- I-lqter. \vas wported to undcrpo a 1.4 fold increasrd rate of

recornbination. of 2 5 ch4 in about 2 1 .Mb (Nakamura et cil. 1989). The devation of

rccombination in subtelomctric DNA is a feature that has bern obsrrved for many hurnan

chromosoines (Rouycr er td. 1990). .At the oiitset of tliis project. most grnrtic maps of

human subtelomrric regions had bern constniçtrd with variable number of randem repeat

(VNTR) mi r k ers.

H ighly poly niorphiç niicrosatellitt: genetic markers have betn widely usrd ils an

alterniitive to restriction fragment length polymorphism (RFLP) or VNTR markers for the

construction of human genetic maps. Diniicleotide CA repeats. the most comrnonly used

microsatellite mnrkcrs. arc gcnerülly lsss freqiient in subtelomeric regions than elsewhere in

the genome. resultin~ in genetic rnaps tlist do not incltide chromosomal termini ( for

example. that of chromosome 9q (Collins et ol. 1993)). Alternatives to riindoin sci-eening

of conventionnl librririrs lime bern employed in order to develop polymorphic markers for

subtelomeric regions. including the specific isolation of CA repeats from telomeric YACs

(Blouin el al. 1995). Chapter 4 of this thesis describes a highly polymorphic haplotyped

systern near I4qter. developed from CA repeats of low individuai inforrnativeness (Wintle

et al.. in press Grriotuics 1997).

As an altenilitive to conventional polymorphic markers. DNA fragments that

hybridize to a telomere probe were usetl as gnet ic markers ro map mousr rrlorneres in

rccornbinmt inbred strains. The restriction endonuclerise Dtid . which cuts variant telomere

repeats (it the scquence CTNAG. was iiszd to reveal telomçric fripments. This mrthod wiis

siiccessfiil in part due to the low Icngth hrterogeneity o l telorneres in the mouw. cnabling

resolution of discretr restriction fragments. rather than the overlapping smears typically

seen for human telorneres (Kipling and Cooke. 1990). The distal ends of rnurine

chromosomes 4.9. 13. X and Y. and the proximal (centromere adjacent) telorneres of

chromoso~nes 7 and Y. were mapped in this mmnsr (Elliott and Yen. 199 1 : Eicher et ui.

1991: Kipling et tif. 199 1 ). .A very similar approach used variants of the murinz

centromrric minor s~itellitr io mrip the prosinid telomeres of chromosomes 1. 1 and 14

( rrvirwed in Kipling rr d. 1995 ). Teloinrres cran be mapped in any sprcies for wliich

DNA cont;tining telomeric repeats can be rcsolved into discrete fragrnenw: for exaniple.

termiiii of I V P I I I - O S ~ O ~ ~ I chr~~nosornzs hiive also been successfuully rnapped with telomere

probes (Schechtman. 1089 1.

L.6.h Recornbination in subtelomeric regions

Increased recombination Lias been observed in a nrirnber of human subtelomeric

regions. Exly rnaps constnicted with polyrnorphic variable number of tandem reprats

(VNTR) nixkers led to the Iiypothesis that the prrferential location of VNTRs ncür

telomcres rnight proniote recornbination (Royle er dl. 1985). An aiternative h>.pothesis

suggested that VXTRs are instead a result of the high recombination rate that is caused by

ünothrr. uiiknoan mechanisni acting in siibtelomeric locations (Jarman and Wells. 1989).

Increased recombination near l-lqrer w u first suggested by ünalysis of VNTR

polyrnorphisrns. Male recombination was 2.5 tines higher than female in the most distal

interval. between IGH and the tetomeric rnarker D L3S3O ( Nakamiira er (il. 19S9).

However. the VNTR markers at that time were not physicülly mapped. and their locations

were implied from the linkage mmcip. Increased recombination and a high rnakfernale

recombination ratio were üiso noted for the subtelomeric regions of 5p. 12q. 70q and 2 1q.

in maps predominantly conipriscd of VNTR rnarkers (Rouyer et ci l . 1990).

A similx situation wns obsewrd for the inregrateci physic~il and senetic maps of

human chroniosome 9. in which increasrcf male recornbination was observçd near the p

terminus. A recornbination distance of 30 ciM in 2 Mb of DNA was reported (Collins rr rd.

199 5 j. Increased recornbin;irion has also been observed in the Xq/Yq psrudoautosom~il

region (Kvaloy rr ol. 1994) and in the regions adjacent to the telorneres at 4q (Wijnienga er

(11. 19933. 1 1 p i Browne rr ( i l . 1995) and 2 1q i Blouin er (il. 1995 j. However. in m;iny

cases the markers iised for these genetic analyses liiivt: not bccn accuratdy physicnlly

mappcd. such thiit the recornbination rotes obsrwed miiy not be a true rrflcction 01-

recombinütion in these rttgions. In addition. srndl numbcrs of typing mors. piuticularly of

VNTR pol~~morphisms foiound predominantly near telomeres may have contribiited to

inacciinite cstimates of recoiiibination nites in subtelonieric regions and inxcuratr genctic

inap locations of these rnarkers i Flint cf (11. 1995). Accurats physictil miippine of VNTRs

can disagres with miip locations dctçniiinrd by grnetic dota alone (see Chaptrr 2) .

Increased recombin:ition Iias bcsn obsenred in subtelomeric regions of

cl~romosomrs fiorn CI ther wgiinisms. The distal rezions of C. rlegcrtis chromoson~es have

highly increased reconibinotion and î'ewer genes than interna1 regions. This has lcd to the

suggestion thnr rrconibination ma- bc promoted hy the RcS5 and Cerep3 repetitivt: DNA

dements predominnnrly loiind in thesr regions. or by interstitial telomeric repcats

( C a n @ m and La Volpe. 1993). A siniilar situation wai; observed in Pl(~st~rot1irnrl

jirkiprirtrl. in wliicli the terminal 100 kb of chromosome arms is comprised of repetiti1.e

sequences. These regions contain few senes. A high rate of recombination is responsible

for the generation of length polymorphisms in these locations. and is probably also

responsiblr for antigcnic divrrsity through the remangement of the genrs cncoding ce11

surface proteins chat tire locared immediately proximal to subtelomeric repeats ide Bmin rr

cd . 1994).

1.7 OBJECTIVES

The main objective ot'this project \va3 to lociite the telomrrti rit l-lqtrr. ;uid to

determine the physicd distance of the IGH gene cluster to the telomere. A fritinework of

physical and genetic mürkrrs, including the 1.5 Mb IGH gcne cluster rit l-iq32.33.

provided an excellent entry point from which yes t artificiai chromosome contig. or putsed

field gel elrctrophoresis rnapping, coultl bc initiated. The suggestion by rnukipoint linkage

ünalysis that a VNTR rnÿrkcr (D 14S20i mapped distal to IGH. also provided 1i cniçial entry

point in the intenul to be rnüpped. Patients 1~1th nüturtilly occurring terminal deletions of

l-lq were available hi. Lise in mapping DNA probes or _ornes within the region. X niirnber

of IGH vüriable region genttnc segnicnts < VI-1 segments) wers ülso tivüilüble but had not brrn

müpped. It was nccessq to inap ttirse and dctrrminc thrir loclitions relative ro the I4q

telomsre ris well.

T h e second goal of this work was to esamine the fri'rqutincy of mriotic

reconibination in the subtelomeric region of chroiiiosomc. i-lq. In ordrr to ;icliievc this. it

wtrs necessary to devrlop highly polyiiiorphic genetic markers nex L-lqtrr. li tqion in

which n o genetic markers had prc\riously been accurately physically mapped. These

mxkers wcre then to be uscd for gcnrtic linkage analysis with existing markers located

prosimal to IGH.

CHAPTER 2.

PHYSICAL MAPPINC, OF THE TELOMERIC REGION 1Jq32.33+ L Jqter:

THE USE OF CHROMOSOkIAL DELETIONS

Incluc!es work piiblished in:

(T. Costa and R.H.A. Haslam are dinicians who provided riccess to patient samples and

perfoimed clinical assessmrnts. LE. Teshima was responsible for cyto~enetic analyses of

two patients.)

2.1 INTRODUCTION

2.1.a The rnap of subtelomeric 14q

At the outset of this work. the region adjacent to the telomere at 14q

appeared to contain a number of genetic markers. some of which could have been

useful as entry points for physical mapping and contig building distal to IGH. In

particular. a linkage study of eleven l-lq polymorphisrns, predominantly VNTRs.

placed marker D 14SIO 1 1.5 CM distal to IGH. a distance expected to correspond to

1 1.5 iMb of DNA (Nakamura et cil. 1989). This marker had been contirmeci by

PFGE mapping not to be located within IGH. suggesting its location in the region

between IGH and the telomere (Walter et cd. 1990). Some linkage maps did not

consistent ris to the locations of IGH. D11S20 and D I4S23. which was also placed

distal to IGH on one rnap (NIWCEPH Collaborative Mapping Group. 1993). The

more recent CEPH consortium linkage rnap of chromosome 14 has since placed

both D 14S2O and D Ils33 proximal to IGH (Cox er ni. 1995). in agreement with

the physical mapping results presented in tbis chapter. There were also at lrast

fifteen unmupped VH segments. residing on distinct DNA restriction fragments

totalling over 2 Mb in size. As rhcse could potentiaily map distal to the ssisting

physicnl map of IGH. i t was possible that the region between IGH and the telomere

would require large scale contig building and PFGE mapping. As a first strp. DNA

simples from patients with naturally occurring terminal deletions of 14q were used

to mrip these and other established telomeric markers. in order to determine which.

if any. would providr useful entry points for physical mapping of the region

between lGH and the 14q telomere.

2.1.b Chromosome deletions for rnapping within distal 14q

Naturally occumng chromosome deletions have been successhlly used for

the physical mapping of numerous disease genes. Chromosome deletions are

useful reagents for the localization not only of a wide variety of dominant disease

phenotypes, but for ordering of markers and genrs into intervals within a region of

a chromosome. Terminal drietions. either due to ring chromosome formation. or

found on linear chromosonies. c m be usrd to order DNA markers in the region of

the deletion breakpoints. However. as a telomere must be present to ensure

chromosome stability. apparent terrninai deletions could be either undetected

interstitial deletions or tmslocations involving a cytogeneticaiiy undetectabie region

from another telomere. Naturally occurring chromosome deletions were first iised

to refine the physical map of distal 14q. and to physicdiy rnap markers D llS20 and

D14S23. This analysis was cnpected to have the additional benrfit of fiirthcr

characterizing the rxtents of the deletions in these patients. with a view to their use

as part of the panel of chromosome 14 deletions available in this Iaboratory for the

mapping of genes and anonymous markers. The analysis was lirnited to only three

patients as very few tcrminril deletions of chromosome 14 are observed. and these

wrre t h only onss possibly having delztion breakpoints within 14q32.33. Since

the bsginnins of this work. srveral more patient samplrs hiive becoms availablr.

two of which (HSC 98 I and HSC 1658) were used to establish the positions of

novel CA repeat polymorphisms derked from the distal part of IGH (Wintle et ni..

in press Gotornics 1997: see Chapter 4. Figure 4-3).

In <i previous study (rom this lnboratory. DNA from threç patients witli

sithsr ring, termindly delered or unbatanced translocation chromosomes wns used

to ordrr DNA markers in the subtelomrric region 14q32 (HoRer et al. 1990). An

additional tliree patients are repoi-ted here. two described by cytogenetics as hüving

a terminally deleted linear chromosome 14. and one witb a ring chromosome 14.

DNA markers were used to define the deleted regions. This study demonstrated

that deletions, charactrnzed by cytogenetics to be sirnilar, can be very different.

both in their location and extent. Terminal deletions should therefore be treated

with caution when used as reagents for physical mapping of anonymous DNA

probes, genes or phenotypes. Sorne markers in the telomeric region of 14q were

not located where linkage maps originaily suggested. indicating that the existing

map of the region nenr the l-lq telomere was inadequate for the initiation of physical

mapping using YACs or PFGE. This illustrated the importance of having an

accurate. low resolution physical rnap as a frdmework pnor to further high

resolution mapping trc hniques, suc h as 1 ibrary screening or PFGE mapping .

2.l.c Terminal deletions of 14q

Terminal deletions of the long nrrn of human chromosome 14 in the absence

of ring chromosome formation have bren reported in only ü frw cases. possibly

due to their rarity of occurrence. but likrly due to difficulty in their detrction. There

are six published cases of patients with linex terminal de!etims of the long ümi of

chromosome 13 (HSC 1237. Hrcidarsson and Stambeg. 1983: Wang and

Ailanson, 1992: Miller et td. 1992: Telford er d. 1990: Masada et c d . 198% Yen el

ol. 1989). as well as one rcported from this institution I HSC 1363. Wintlr et tri.

1995: this chaptrr). Four other cases have more complex rrürrangemenrs including

a terminal deletion of chromosome 14 < Nielsen rt al. 1975: Magnani er d. 1993:

Uehara et c i l . 1993: Kousseff et cil. 1957). There is no consistent pattern of

malformations described in thex patients. iilthough psychomotor retardation. mild

facial dysmorphism and hypotonia appear as frequent featureb (Table 2- 1) . Prior to

the initiation of this work, the lack of obvious disease loci had contributed to the

relative incompleteness of physical maps in this region.

Table 2-1. Clinicai variabilitv in deietion 14q

Deletion

Growth

Psychomotor retardation

Seizure disorder

Hypotonia

Facial dysmorphism

Ocular abnormalities

Other malformations

Te 1 ford Miller et cd. HSC 1363: rr tri. 1990 1992 this work

normal IUGR. normal PNGR

iat~irrict: ble p haro- srnall orbits phimosis

Table 2-1 (continued). Clinical variabilitv in deletion 14q

Deletion

Psychomotor retardation

Seizure disorder

Hypotonia

Facial dysmorphism

Ocular abnormalities

Other malformations

Wang ruid Masada Yen et rd. Allanson. 1992 et al. 1989 1989

q32.1-lqter q32. L+qter q3 i . 1 +qter

PNGR [UGR normal

+ 'I(ear1y deütli) +

'!(eiuly death)

+

-

+

scoliosis

Table 2-1 (continued). Clinical variabilitv in deletion 14q

IUGR iritrmterine growth retardation

PNGR postnatal growth retardlition

abnorrnality absent

unknown

multiple congcnitül anomalies: craniosynostosis. esophageai

ritresidtraclieoesophage;i1 (TE) tistula. intestinal malrotation.

digitdizrd thumbs in one patient (Miller et c d . 1992): ciirdiovascular

abnornialities (patent ductus rirteriosus. abnormal origin of cuotid

and coronay anerirs). esophngeal atresia/TE tistula. hydrouretrrs.

tiypospadiris. imperlor~ite anus. scoliosis. eventrritiun of

hemidiaphrngrns and digitalized rhumbs in the second patient

( -Vasadi! cf c d . 1989)

2.1.d Ring chromosome 14

Formation of a ring chrornosonie is a rare mechünism by which DNA cm be

deleted from the ends of chromosomes (Kosztolrinyi, 19571. Ring chromosomes

are almost always observed as a heterozygous event, with one normal homoloye

and one ring present. In addition to 37 ring chromosome 14 patients reviewed by

Zelante et al. (Zelante et al. 199 1 ), there are three more published cases (Shirasaka

rr al. 1992: Cox et tri. 1983: Callen et cri. 199 1 1. as weIl as HSC 1252, who is

presented here t Wintle et c d . 1995: this chapter). Unlike linear terminal deletions.

ring chromosome 14 presençe is associated with a c haractrristic syndrome. Major

motor seizures are present in al1 cases. except one in which a smdl ring ( 14) is

present in a child who also has two normal chromosomes 14 and is trisomic for

chromosome 2 1 (Callen er d. 199 1). Seizures are a kature not consistently

observeci for other ring chromosomes. with the exception of chromosome 10

(Kosztolinyi. 1987). Clinical features of r i n ~ ( 1 4 syndrome typically also indude

prenatal and postnatal growth retardation. ps ychomotor retrirdation. persistent

respiratory infections and ii characteristic facial appearance (Zelante et rrl. 199 1 ).

2.2 NIATERIALS AND METHODS

2.2.a Pa tient materials

HSC 1282. This niale patient \vas first reported in rny work (Wintle rt d. 1995).

Clinical assessment was performed by Dr. R. Haslam. HSC 1283 presented iit nine

months of age with a jeneralized seizure disorder. which required medication until 14

years of age. Cytogenetic assessment was performed by Dr. 1. Teshima and the HSC

chroinosorne Iab to nile out suspected Prader-Wiili syndrome (PWS) at age seven and

one-half ye:us due to the patient's excessive üppetite. obesicy. mild hypotonia and

moderate developmental delay. High resolution bünding rrvealed no abnornialities

consistent with PWS. A cranid CT showed mild dilatation of the laterai ventricles and

enlarged subarachnoid spaces. The karyotype was found to be 46. XY, r ( 1 4 )

( p l3q32.33). in al1 26 PHA-rtimulated lymphocytes examined (Figure 1- 1 ). Parental

karyotypes were normal.

HSC 1237. This male patient was described previously (Hreidarsson and Stamberg.

1983). The patient had short stature. congenital hean disease. mild facial dysmorphisrn

and rnild intellectual iinpaimient. Cyto~rnsûc iuinlysis revealed (t terminal deletion of the

matemally inherited chromosome 14. with a breakpoint ar 141132.3; the karyotyps was

16. XY. del( 14) (q32.3+qter). Parental karyotypss were normal.

HSC 1363. This female patient was first reported in my work (Wintle er 01. 1993).

Clinical assessrnent was performed by Dr. T. Costa. The patient prescnted at the age of

three rnonths with dysmorphic facies. hypotonia and developrnental delay. She was the

product of a twin gestation: demiss of the other twin wüs documentcd by ultrasound in the

first trimester. Deci-crised fetal movernents were reported by the mother. She was

delivered at term without complications. Binh weight wris 4160 g. length 55 cm and iiead

circumference 36 cm. On csarnination. she had a length of 64 cm (above the 97th

percrntilr 1. wright of 5-29 kg (50th perccntile) and hrad circumference of 41 cm (+ 1

S.D.). Shr was mildlv - dvsrnorphic. - with severe ptosis bi1;iterally. mild tr1ec;inthus.

micrognathia. hi$ iil-ched piilüte and siinian crease on the left hiind. SIie had gcneralized

hypotonia. A cranial CT scan. muscle biopsy and EMG were normal. An ophthalmologic

assessrnent revealed bilateral blepharophimosis syndrome. without other ocular

abnormülities. Cytogenetic studies by Dr. 1. Teshima and the HSC chromosome lab

showcd a terminal deletion of chromosome 14. with the breakpoini at 14q32.3 (Figure 2-

1 ). The karyotype wns 46. XX. del( 14) (q37.3jqter). Parental karyotypes were normal.

She subsrquently undenvent ptosis repiiir and bimedial canthoplasties. When last seen at

Figure 2-1. Partial liaryotypes of patients HSC 1282 and HSC 1363.

Ideogram of chromosomr 14. with the G-hündrd chromosonie pair froni HSC 1282 to the

Irft. and the pair froin HSC 1363 to the right. In each pair. the normal honiolog~ie is on the

Icft. Breakpoints are indicated with arrows. This figure was provided by 1. Trshima.

the age of 2 years. she was growing well and had no health problems. There was no

history of seizures. Her head circumference had dropped to the 25th percentile, while

heiglit and weight continued above the mean (90th and 75th percentiles respectively). She

exhibited rnoderate global developmental del- and remained hy potonic.

3.2.b Genomic DNA and probes

Human genomic DNA was extracted from peripheral blood (patients. parents and

normal controls). or from an EBV trnnsformed lymphoblastoid ce11 line ( for HSC 1363 ).

as describrd (~Miller rr <rl. 1988). .-\pproximateIy 3 pg of genomic DNA was digested

with restriction enzymes. in buffers supplird by the manuficturrrs (BRL. Boehringer

Mannheim. P h m a c i a ) . Restriction enzymes used were Pst1 {for rnarkers D l 4 13.

D l l S 2 0 and D14S23), EcoRl (for D 14s 1 and IGHV3-R14). BmzHI (D 14s 19), BglII

(IGHJ) and ScicI (IGHM). DNA was electrophoresed through 0.7% agarose/lx TBE

gels at 2.7 Vlcm for 18-24 hr. except for D 1-1s 1. in which case a 0.35% agarose/ l x TAE

me1 at 1.5 V/cm for 4 . 5 ho~irs was uscd. DNA was transferred to Hybond N or N+ 2

filters ( Amersham) as recommended by the manufacturer. and DNA probes were

hybridized to the tilters ris described (Church and Gilbert. 1984. Cloned DNA

fragments used ris probes have b e n described (Table 2-2). Probes were labeled bv

rundorn prirning witti ii T7 Quickprime kit (Pliarmacia) and [&PI-~CTP ( Arnersham).

Rrriloval of probes from filiers after hpbridization was perfoimrd üccording to the

manufacturer's protocols ( Arnersharn). The D 14s 13 hybridization was pcrformed by K.

Ashbourne.

Allelc dosage of uninfom~ative polymorphic markers was drtermined by

drnsitometric scanning of autoradiogrtiphs with a Molecular Dynamics computing

densitometer. mode1 330A. and Moleciilar Dynamics ImageQuant version 3.0 software.

locatetl in the laboratory of Dr. 1. Andrulis. Mount Sinai Hospital. Toronto. Parents of

the patients. and in sorne cases an additional normal individual, were used as controls.

Results were norrnalized for the known number of doses (one or two) of the index locus

allele in the control sarnples. Allelic fragments of identical size were cornpared between

patients and controls to control for different hybridization intensities of the probes to

alIeIic fragments of difkrent sizes. The densitometric signal was divided by sisna[ tiorn

a control probinz of the s m c tiiter to correct for total DNA quantity in cach lane. Allele

dosage in patients was determined by dividing the values obtained for each patient by the

nomalized control value. Control probes used were alAT4.6. detecting eson 1 of the

u -antitrypsin srne at 14q32.1 (Cox er ( 1 1 . 1983). or pPNP 1. drtecting the n~~cleoside

phosphorylase locus (NP) at 14q 1 1.2 (Williams et cd . 1984. The pPNP 1 probe was

used as NP is loclited nt 14q 1 1.2. outside the region of a11 three deletions ( Cox et trl.

199 1 ). The u 1 A T 4 6 probe was used to control for dosage of the IGHV3-R 14

polymorphism in HSC 1282 because i t maps to I-lq32.1 iCox et d. 1991). outside the

deleted resion of this chromosome. and detects an EcoRI fragment of similar sizr to one

of the polymorphic tGHV3-RI-! fragments. Two biinds of different sizss were

quantifird for sorné pPNP 1 probings. PI typing (U 1 -antitrypsin phenotypin?) and scnim

quantitation of ui-antitrypsin lcvels were perfonned by isoelrctric focusing and

clsctroimmuno assny. respectively. as previously described (Cox et ( 1 1 . 1982b). by V.

Nsuyrn or .M. Siewertssn. 3s part of the original clinical work-up of the patients.

2.2.c Polymorphic CA repeats

PCR primers and conditions for the PI simple sequence reprat polymorphism (SSRP)

have bcen drscribed ( Byth and Cox. ICI93 ). Other SSRPs were detected as follows: 10 ng of

oenomic DNA were subjcctcd to PCR amplification in 10 yL reactions rvith 0.5 C: T M ~ C

poi yiiierass. 200 ph4 rüch of dCTP. dGTP and dTTP. 70 UM dATP plus ZpCi [3js]- ATP P. 0.3

@M rach primer and cither 0.5 miM ( D 1 4 3 1 ). 1.0 m i (D 14S65. D14S293). 1.5 miM (TCA7)

or 2 rnM (TCA 1 1 ) M$+. Reactions ufsre heated to 95'C for 4 min.. nftcr wliich poiyrnerase

was ;idded and 30 cycles of PCR psrfornwd. Cycles were as follows: D I-ISS 1. 30 sec. rcich iit

HSC HSC HSC locus probe 1282 1237 1363 probe reference

PI (PI typing) +d ( 105) +d (83) +d (80) (see text)

PI i PCR) 'ID +h ND B y th and Cox. 1993

D 14S5 1 (PCR) 'ID +h 'ID W a n ~ and Weber. 1993

D14Sl pAWlOI +h + h -h W'nrnan and White. I %O

D14S19 pHHH2OS +h +d -h Hoff et (11. . I9SS

IGHM PS +h +h ?iD Migone et tri.. 1953

IGHJ PJH +h +h 'ID Silva P I C I / . . 19S7

IGHV3-R 1-5 VH3f -d ND 'ID Walter et tif.. 1957

TCA7 W R ) U I UI UI Chaptcr 4

TCA l t (PCRi UI + 11 -h Chrimer 4

Table 2-2. Markers typed on patients with chromosome 14 deletions.

Markers are listed in order (rom centroinrre (top) &O I q t e r (bottom). +h: rnarkrr

heterozygous. +d: iiiarkes Iiomozygous. rwo doses prescnt. Numbrrs in parentheses

are serum levrls of u. 1 -antitrypsin. espresssd ils n percentüge of the level of normal

controls. -h: market- absent by allelic segregation. -d: marker absent by densitometry.

ND: not done. UI: uninformotive. Order is as suggested by multipoint linkage analyses

r Cox et cri.. 1994: Nakamiira et cd.. 1989) and physical rnapping (D.W. Cox.

unpublished results: \Val ter et cri.. 1990: Wintie er al.. in press Grnomics 1997: Chapters

3 anci 4). The relative order of D 13SS 1 and D14S65 is unknown.

94-55 and 72°C: D I4S65. 30 sec. at 94°C and 10 sec. at 55°C: D L4S293,N sec. at

94'C and 30 sec. at W C ; TCA7 and TCA 1 1 (Wintle et trl., in press Genornics. 1997:

Chapter 4). 30 sec. e x h at 94°C. 55'C (TCA7) or 58°C (TCA 1 1 ). and 71'C. Primer

sequences were as described (see Table 2-2 for references). SSRPs wrre scpuated on

sequencing gels and visualizr'd by autorüdiopraphy.

2.3 RESULTS

DYA from the threc patients was typed for different subsrts of the polymorphic

DNX markers. depending on the suspected extents of their deletions based on cytogenetic

observations (Table 2-2. Figure 2-2). PI typinc~ rrsults are iilso presentrd in Table 1-2.

Results of densitomrtry for uninformative polymorphic markers. and copy number of

markrrs in the patient's genorne. are shown in Table 1-3

Patient HSC 1251 \iras hererozygous for the irnrnunoglobulin hravy chttin joining

region (IGHJ) polymorphism (Fisure 2-23) . This patient was hemizygous for the LGH

variable region polymorphism (IGHV3-R 14) (Fisure 2-2b). IGHV markrrs TCA7 and

TCA L 1 wcre uninformative. Al1 markcrs proximal to IGHJ wrre hrterozygous. with the

exception of D 14s-3. whiçh was uninformative. but wüs found by densitomctry to br:

present in two doses ( Figure 2-2d. Table 2-3 j. Serum CA 1-üntitrypsin lrvels were within

the normal range. supportin~ the presence of a functionai PI locus from both

homologues. as ttxpected. D l4S20 was present in two doses (Figure X e . Table 2-3).

contridicting its previous locdization trlomeriç to IGH. This patient has the srnaIlest

amount of telomeric DNA deleted of the three studied.

Patient HSC 1737 \ixs heterozygoiis for the D14S 1. IGHM and IGHJ

polymorphisms (Figures 2-Sf. 2-211. ?-?a). This patient w;is in informative for D 14s 19.

D l4S30 and D 14S73 (Fig~ires X g . 2 - 3 . 1 - 7 d ) . but tliess markers wese found to br

present in two doses (Table 2-3). PI typin? \vas iilso uninformative. but seruin u 1 -

mtitrypsin levels were in i k normal range. As no markers were observed to be deleted. an

HSC 1282 HSC 1237 HSC 1363 ring (14) del (14) del (14)

index control C F M P F P F 1 P Pcr rnarker probe dose

DI4S23 pPNPlri 1.18 0.80 2.06

D 14SZ3 pPNP l b 1.76 2.43 3.48 1.93 1.86 4.2 1

DlJS19 pPNPla 2.12 2.84 5.12

D14S19 pPNP1b 0.78 0.75 1.94

D14S-0 pPNPla 0.09 0.09 0.15 0.05 O. 16 0.07 0.07 0.07

D14S20 pPNPlb 0.04 0.04 0.08 0.02 0.07 0.03 0.04 0.03

D14S20 pPNP 1 b O. 1 1 O. 14 0.30 0.1 1 0.35 0.20 0.31 O. 15

Dl-IS?O pPNPla 0.29 0.34 0.29 0.32

Table 2-3a. Densitometry results. adjusted for gel loading. Ratios of index

niarkrr sisna1 to conti-ol signal are shown. LTndrrlinr indiciites the prescnce of n single dose

in ri patient. For parents and conrrols. the value prr single dose of the dlels is given: rhr

average ol'all parents and controls for eüch markrr is shown ("per dose"). Two bands were

cluaniified for the pPNP 1 probe (pPNP 1 a and pPNP 1 b). For D 14S20. two autorcidiopphs

w r e scoreci for each pPNP I band. and both p~irents of HSC 1 363 wese nlso used ~ i s

controls. An independent autoradiogrilph was used to score D 14S20 on patienr HSC 1363

ibottom row). C: normal control . F: ftither. M: rnother. P: patient.

indes control H S C HSC HSC marker probe 1282 1237 1363

pPNPla

pPNP l b

pPNP 1 ri

pPNP 1 b

u 1 AT.F.6

pPNPla

pPNP 1 b

pPNP l b

pPNP 1 a

Table 2-3b. Dose number of DNA markers in deletion patients. Calc~i la ted

dose niimbers are stiown for cach marktr. L'nderline indicates the prrsencr of a single

dose in a patient. Two bands were quantified for the pPNP1 probe (pPNPla and

pPNP 1 b). For D 14S20. two autoradiographs were scored for each pPNP 1 b band. and

both parents of HSC 1363 were also usrd as controls. An indepsndent autoradiograph wiis

used to score DI4SIO on patient HSC 1363 (bottom row).

Figure 2-2. DNA markers typed on families of three chromosome L - l

deletion patients. Restriction fragment or molrcular wight miirker sizes are indicated

to the right. Poly morphic brinds are brtic ketrd. *: constant (non-poly rnorphic) band. c:

control. fil: father. mo: mother (of patient in adjacent lane). A: HSC 1282 and HSC

1237 are heterozygous for the IGHJ polymorphisrn. B: HSC 1257 is hrmizygous for the

IGHV3-R 14 polymorphism.

Figure 2-2 (continued). DNA markers typed on families of three

cliromosome 14 deletion patients. Restriction fragment or rnolecular weight miirker

sizes ;ire indicatcd to the right. Polyrnot-phic bands are brackrted. *: constani (non-

polymorphic) band. c: control. fa: hther. mo: mother. C: HSC 1363 is deleted for a

paternril allele of D 14S23. D: HSC 1 LSZ and HSC 1337 have two doses of D 14323.

Figure 2-2 (continued). DNA rnürkers typed on Fimilies of three

chromosome 14 deletion patients. Restriction f r a p e n t or rnolecular weight marker

sizes are indicüted to the right. Polymorphic bands are bracketed. *: constant (non-

polyrnorphic) band. c: control. Fa: frither. mo: mother. E: HSC 1363 has one dose

(top). and HSC 1282 and HSC 1137 have two doses (bottom) of D 1420.

Figure 2-2 (continued). DNA markers typed on farnilies of three

chromosome 14 cieletion patients. Restriction fragment or molecular wcight marker

sizes are indicüted to the riglit. Polymorphic bands are bracketrd. : constant (non-

polyniorphic) band. c: control. fa: hther. mo: mother. F: HSC 1282 anci HSC 1237

Lire hcterozygous. and HSC 1363 is hemizygous. for D 14s 1 . G : HSC 1282 is

heterozygous. HSC 1 237 hiis two doses. and HSC 1363 is deleted for a paternal allelr of

DILCSI9.

Figure 2-2 (continued). DNA markers typed on families of three

chromosome 14 deletion patients. Restriction fragment or rnolrcular wcight

marker sizes are indicated to the right. Polymorphic bands are brücketed. H: HSC 1282

and HSC 1237 are heterozygous for IGHRI.

additional six simple-sequence repeat polymorphisms ( D 1 .CS5 1. D 1 LCS65. D t4S293. PI.

TCA7 and TCA 1 1 ) were typed. Al1 were heterozygous. with the exception of TCA7.

whicli wris uninformative (Table 2-2). HSC 1237 has no deletion detectabIe with

markers in the distal region of 14q.

The third patient. HSC 1363. has a terminal deletion thrit LVZS cytogenetically

identical to that of parient HSC 1137. Howcrer. this patient \vas clearly deleted for a

paterna1 allcle at D 14s 1. D 14s 19. Dl4S23 (Figrires 2-22. 2 - 2 g . 2-2c) and IGH V

(TCA 1 1 : sce Chaptrr 4. Figure 4-Sa). m d was tilso hemizygous at the D 1 -IS?O locus

(Fisure 3-2e. Table 2-3). HSC 1363 hcid senim al -rintitrypsin levels within the noim;ti

range and was heterozygous iit the D IJS 13 locus (Table 1-21. The proximal boundary of

the deletion thus lies distal to D 1-1s 13. The cicietion in patient HSC 1363 is tlierefore not

the same as that of patient HSC 1237. altliough they are cytogenetically indistinguishable.

Z.4.a Marker order clarifieci by rnolecular deletion analysis

Andysis of patient HSC 1382 irirther definrd the order of markers in the

1-lq37.33 region. Multipoint linkage cinalpsis originally placrd D I4SN and

D I-CSZj distril to IGH (N;ikamurri er C I ! . 1989: NIHKEPH Callaborative Mapping

Group. 1992). suggcstins that the? rnight be usehl enrry points for mapping the

region adjacent to the tclomrre at 1 Jqter. Bccriuse IGHV3-R 14 is deleted on the

ring chromosome and both D14S30 and D14S33 are not. it is suggested that these

two mürkers are prosimal to tGHV3-R 14. D14S20 is known not to be located

within the IGH grne cluster (Walter el d. 1990). tt therefore maps proximal t o

IGH. A previous study of clirornosomc 14 drlrtions defined the proximal limit of

the region in whicli both D 1 IS20 and D 1 - I S Z must lie as beinz distal to D lilS 16

(which is locrited disial to D I-CS 1 but proximal to D 14S23) (Hot'ker Cr cri. 1990).

Most likely. a simple krrninal deletioii of 1-lq32.33 in patient HSC 1252. prioi. to

ring formation. resulted in the drletion of D I-ISIO and D IG?3. The physical

mapping results reported here, taken together with linkagr data from this laborritory

(Cox et cd . 1994). show that D 1 4 2 0 and D 14S23 are not located in the most distal

region of I?q, and therefore would not have been suitable entry points for physical

mapping of the subtelomeric region of 1Jq. Clones isolated from 1ibrx-y screens

using these probes would be lociited proximal to (GH. and therefore üt leasr 1.5 Mb

from the tslomere at Ilqter.

2.4.b The srnnllest region of distal monosomy l4q

The extent of the dclrtion of the q arm in patient HSC 1232 is at Içast liorn

l lqter to IGHV3-R1-l. and at most from I-lqter to a point just distnl to IGHJ. as the

IGHJ polyinorphism is heterozygous in HSC 1281 (Figure 2-?a). The breakpoint

of the q arm of lhis ring chromosome thus lies within an intcn.d of approsim;itsly

350 kb dsfined prosimally by IGHJ ancl distally by IGHV3-RI-!. within the

variable or diversity regions of the IGH grne cluster (Walter er (11. 1990). The

amount of DNA deleted fiom 14q of the ring chromosome is at most 1100 kb. as

the telonirric end of IGH is lociiied at the tclornere of 14q (Wintle rr trl.. in press

Gerto~,iici;. 1997: Chiiptrr 3 1. HSC 12S? thus has the most disral breakpoint in the

q a m of dl reported ring( I l i patients. :incl thmfore the srnüllttst rrsion of distal

monosomy 14q yet reported. His comparatively mild developmental dcliiy rnny bc

ci reflection of the limited estent of this deIetion.

2.4.c Ring chromosome 14 syndrome

Rinz chromosome 11 is :issociiitecl with a ctiarricteristic syndrome. the most

remarkable feiiture of whiçh is scizures. usuall y first appearinp betwren one inontli

and four yean of age (Zeliinte et trl. 199 1 ). Seizure disorciers ore not a constant

feature of other ring chromosome syndromes. Some epilepsies have been

demonstrated to be due to mutations in specific genes. and it has been estimated that

up to half of al1 epilepsies have major senetic components (reviewed in Allen and

Walsh. i996). Seizures seen in ring( 14) patients could therefore be due. not to the

presence of the ring chromosome per se. but to the absence of a locus in the

proterminal region of l-lq from one homologue ( Howard el dl . 1988).

The absence of seizures in patients with terminal Jeletions of l-lq (including

HSC 1363 1. togthsr with the obsenwion of occasional seizures in patients ~vith

other ring chromosomes. have been triken ab evicit-nce thrit the stiizure ciisorder is a

consecluence of ring chromosome instability (Telford rr trl. 1990: Pezzolo rr id.

1993). The limited extent of the deietion in HSC 1252. with seizures chrirxteristic

of ring( 14) syndrome. supports this inierpretation and may be an indication that the

seizure phenotype is not due to the loss of ciiticiil genes in the region of the

deletion. This is furtlier supponed by the finding that the telomere of chromosome

14 is immrdiately distal to IGH Khaptrr 3). prccludin~ the existence of loci

tdomsric to IGH thrit could contributs to ssizures in these patients. .Mitotic

instability of the ring chroniosonit.. rssulting in somatic mosaicism with some cells

monosoniic for chromosonir> 14. occurs in peripiieral blood 1eukocytc.s of nioïr

crises tZelrinte 41 L I / . 199 1 ). If such mosaicism were to occur in cells of the central

nsrvous system. resulting in cell death. this couid accorint for the seizure

phenotype. It is interesting to sprculüic thiit ;i locus irnportiint in rhr innintrn;incs of

CNS ce115 could be [ocriteci on chromosorne 14. leüding to ce11 death whrn it is

hrmizygous. Our patient. HSC 1252. \vos not found to be mosaic for the ring

cliromosome. Howe~rcr. ring instability miiy be markedly different in the peripheral

blood studied than in other tissucs. such ris the CNS.

2.4.d Diffeeren t deletions underl y ing similar cytogenetic findings

Two patients with linear deletions of chromosome 14 were studied.

Chromosomes from the first. HSC 1237. were initially characterized by G-. Q- and

R-banding. and were reported to be deleted for the region 14q32.3-tqter

(Hreidarsson and Stamberg. 1983). Resulrs from this chapter demonstrated that

the deletion is not terminal. as TCA I I is located in the IGH gene cluster.

approxirniitrly 90 kb from 14qter ( Wintlci et ol.. in press Grrw~iics. 1997: Chaptsrs

3 and 4,. An interstitial deletion s~ich ns q3 1.3+q32.1 misht br niistakrn for ri

terminal deletion of q32.3+qtsr. Hoawer. the PI locus SSRP. located at

I-lq32.1. and two other markers in this re~ion. D 1 JS5 1 and D 14S65. were

hcterozygous. suggesting tliat an interstitial deletion had not taken place. A cryptic

translocation event co~ild d s o explain the phenotyps. Unfortuniitely. the patient is

out of the country and i t has not been possible to loccitr him for t'urther cytopxt ic

rtssess~nrnt. The second patient. HSC !363. has molecular niarkers ddcted that rire

consistent with the cy togenetic findings. The deletion begins distal to D 1-1s 13.

Both patients were reponed ÿs having identical deletions by cytogrnetic anülysis

( 14q3?.3+Ilqter deleteci). and there were not radical enough diffrrences in

phenoiype io s~iggtlst thtit difirent delctions niight be present. Wirhout caref~il

chtiracteriztition by molcçiiloi- means. cliromosoms deletions cannot be rçli;ibly used

as tools foi* the refined physical rnripping of chrornosomal 1-rgions.

2.J.e Phenotypes of terminal deletions of 14q

There is consideriible clinical heterogeneity mong the sis cases of terniinal

deletions of I4q describeci to date (excluding HSC 1337. who wcis sliotvn not to have such

a drletion > (Table 2- 1 1. Four of these. including HSC 1363. had niild dysrnoi-phism

associaird with variable dcgrces of dt'velopmçntal drlay. No typicnl ficirs can be

recognized. Hypoionia was corninon. The other two cases (Miller et tri. 1992: iMrisada et

ni. 1989) had multiple congenital malformations: esophageal atresia/TE fistula and

abnormal thumbs in both crises. and imperforate anus. cardiov~scular anomalies and

scoliosis in one (Masada er cri. 1989). The severity of the phenotype is surprising for one

of these patients. who was mosaic for the deletion (Miller et al. 1992). However. as

shown in Our cases HSC 1737 and HSC 1363. cyto_oenetically indistinguishable deletions

rnay br diflerent at the rnolccular Icvel. The severe phenotypes seen in iMillrr and Masada's

cases could dternütivrly be rsplained by the unmasking of recessivr genes on rhe normal

cliromoson~c. or by a highrir susceptibility to thess ribnormalities due to genetic

background. Some cases may repsesriit unrecognized drlrtion/duplication syndromes or

cryptic translocations. Molecular techniques are viilunblr aids in the determinotion of both

the location ruid extent of srrch libnorm:ilities.

CHAPTER 3.

PHYSICAL MAPPING OF THE IGH GENE CLUSTER NEAR THE

TELOMERE OF 14q: THE USE OF TELOMERIC YACS

AND SOMATIC CELL HYBRIDS

Includes work published in:

Wintle RF. Nvyrinrd T, Hrrhrick JS . KvoZgy K and Cox D W (in press, Geitoinics. 1997).

Genetic poiynorph ism and wcornbincition in the subtriomeric reg ion cf chro~riosomr 14q.

(T. Nygaard carried out typing of CEPH tamilies for microsatellite marker TCA7. J.S.

Herbrick was an undergaduate student who obtained cosmids and subcloned CA repeats

from them whilst m d e r my supervision. K. Kvaloy provided telomeric YAC B 14.)

3.1 INTRODUCTION

3.l.a The physical rnap near 14qter

Physical mapping of portions of human chromosome 14 has been a long standing

interest of this laboratory. In particular. interest in a cluster of serine protease inhibitor

genes at 14q32.1 (Billingsley ef ni. 1993), and in the organization of the immunoglobulin

heavy chain gene cluster (IGH) at 13q32.33 (Walter er cri. 1990). led to efforts to

physically map the entire region from 14q37.1 to 1 Jqtrr in overlapping contigs of yeast

anificial chromosomes. and to identiQ dl transcribed sequencrs in this region. By

establishing the physical location of the 14q telomere, it was possible to provide an anchor

point for the distal end of the map.

3.1.b The human irnmunoglobulin heavy chain gene cluster

The IGH gene cluster is comprised of approximately 90 variable region (VH) grne

segments. at least 20 diversity (DH) segments. six functional joining (JH) segments. and a

constant region of nine genes and two pseudogenes. VH-DH-IH recombination during B

ceIl development results in the juxtaposition of these elements to form a mature IGH gene

that is capable of coding for n functional antihody heavy chain (Tonegawn. 1983). IGH is

located on human chromosome 14. in the subtrlomeric band 14q33.33 (Benger et ci l .

199 1). The organization of the IGH locus has been a focus of research in this taboratory

for more than ten ycars. The total size of al1 M l d and NotI DNA restriction fragments that

hybridize to constant and variable region probes was reportrd as approxirnately 2500 kb

(Berman el al. 1988: Matsuda el trl. 1988). Physical chaacterization of the IGH constant

region revealed tliat it spans 350 kb of DNA (Hofker er cil. 1989). Approximately 1 100 kb

of the IGHV region had been physicalty mapped by two-dimensional pulsed-field DNA

electrophoresis (Walter et ni. 1990), and with chromosome 14 deletions in monoclonal B

ce11 lines (Walter et cil. 199 1). suggesting ihat the total size of IGH was about 1500 kb.

Thus, there was potentially a further 1000 kb of the penome that contained VH segments.

The orientation of IGH. with the VH region most telomeric. suggested that these VH

segments mapped in a large interval between IGH and the telomere. One aim of this project

was to determine whsther these VH segments mapped distal to the existing physical map of

IGH.

3.l.c Human VH segments at other genomic locations

DNA sequences homologous to VH segments have been identified at loci physically

separated from the IGH gene cluster. hi situ hybridization located such sequences on

chromosomes 15 and 16 (Cherif and Berger. 1990). and cosrnid clones containing VH

segments were mapped to chromosome 16 by somatic ce11 hybrid panel analysis (Matsuda

et ni. 1990). A subsequent study refined these genomic locations to 15q 1 1.2 and 16p 1 1.2

(Tomlinson et cd. 1994). In a physical mapping study of the VH region. tifteen VH

segments were mapped to NotI DNA restriction fragments that could not be physiciilly

iinked to the IGH genr cluster (Walter et al. 1990). The total size of these unmapped

fragments was greater than 1000 kb. Possibly. these Notl fragments were telomeric of the

existing rnap of IGH. but still within the grne cluster. Because the distance from the IGH

gene cluster to the 14q telomere was unknown. 1 examined whethcr these segments were

located between the mapped region ol IGH and Ilqter. and whrther IGH is adjacent to the

14q telornere. In this study. two telomeric yeast anificial chromosome clones. known to

map to 14qter, were shown to contüin VH segments and to overlap with the telomeric end

of the existing IGH physical map. Humadrodent somatic hybrid ce11 lines were used to

demonstrate that at least eleven VH segments. including one previously thought to map

distal to the established physical map. are actually located on chromosomes 15 and 16. The

two telomeric YACs were demonstrated to be true representations of the location of the

telomere by the sensitivity of the most telornetic VH segment to digestion of human

genomic DNA with nuclease Bal3 1.

3.1.d Telorneric YACs from distal 14q

The telomeric YAC yRM3006 was was provided by H. Riethman. and had been

mapped to 14qter by FISH (H. Riethman. unpublished results). VH probes were

hybridized to this YAC, to detemine whether it overlapped with IGH. The observation

that VH segments located nrar the distd end of the IGH were present on the YAC lrd to the

construction of a PFGE müp of this clone. Subsequently. another telomeric YAC. B 14.

wüs also mapped to the end of the long am ot'chromosome 14 (Dietz-Band rt d. 1993).

B 14 was obtained and a PFGE map of it was also constnicted. The two telomeric YACs

were used to unambiguously locate the telomere at I4qter. and later to map novel C A repetit

polymorphisms that were cloned from the distal region of IGH (Chapter 4).

3.2 NIATERIALS AND NIETHODS

3.2.a Somatic ceil hybrids

Hybrid line HHW 890 (gift of the late J. Wsmuth). which initidly containrd

human chromosomes 5 and 14 in a hamster background, hnd been cultured in the presencc:

of sodium chromate to select against cliromosome 5 (Dana and Wasmuth. 1982). Tissue

culture was perforrncd by M.G. Biubaçher. DNA from this ce11 line had been hybridizrd

to chromosome 5 and I I speçific probes. to rnsure that only chroniosome 14 was retainrd

(W. Gibson and D.W. Cox. unpublished rcsults). This line was therefore similar to

MHR14. another subclone of HHW 890 seIected in a similar manner (itIares rr lrl. 199 1 ).

Hybrid line WEGROTH-B3 (gift of A. Guens van Kessel) (Guerts van Kessel et al. 1983)

has been shown by fluorescent chromosome painting to contain only human chromosome

14. in a mouse background (A. H. M. Guerts van Kessel. persona1 communication).

Hybrid lines NA 10567 (human chromosome 16 in a mouse background) and NA 1 141 5

(human chromosome 15 in a Chinese hamster background) were obtained tiom NIGMS.

DNA from WEHI-TG cells (murine background for WEGROTH433; gift of A. Guens van

Kessel). FUK Chinese hamster ovary cells md C57B W6 rnouse DNA (gift of R. McInnrs)

were used as controls for the rodent backgrounds of the hybrid lines.

3.2.b Genomic DNA and probes

Human grnomic DSA was extracted from normal human peripheral ùlood

Ieukocytes (bIi1ler er trl. 1988). Two donors. HSC 20 and HSC 333. had been used in a

previous physical mapping study. where the- were designated L3 and L2. respectively

(Walter et al. 1990).

DNA probes specifiç for human VH families VH 1 through VH6 have been

described (Walter er cil. 1990). VH 1 segments were also detected with VH 1 f. a 3.4 kb

HirzdIII fragment cloned from the IGH region of an S: 14 translocation from a rnyelornri cell

line (gift of K. Huebner: unpublished). The VH4 probe was prepared by PCR from

5YP2X plasrnid templnte (Schroeder r f rd. 1987) with the primers VH4-5' (5'-.4GT CGG

GCC CAG GAC TGG T) and VH4-3' WTAA GAA GAC TCT CGC ACA GTA A).

PCR conditions wçre 35 cycles of 30 seconds each at 95°C. 57'C and 72°C. Human

telomere probe. (TTAGGG J ~ . was prepiired by PCR amplification of the oligonucleotides

( T z A G ~ ) ~ and t CjTA2)4. in the absence of extraneotis template DNX. for 35 cycles of 30

seconds cnch at 95°C. -IOQC and 72°C. with a 1 second increasc per cycle of the 72°C step.

essentially as describcd (IJdo et al. 199 Ic).

Genomic DNA was digested with eithrr BgnI (for VH2. VH4, VHS and VH6

hybridizations). or EcoRI ( for VH 1. VH 1 f. VH3 and VH3P hybridizations). Gel

electrophoresis. trians kr. and probe hy bridization (Church and Gilbert. 1954) were

according to standard protocols. Final wash stringencies were O. 1 x SSCIO. 1% SDS at

either 65°C (for the VH 1. VH 1 f. VH3. VH4 and VH6 probes) or 52°C (for the VH?.

VH3f. pBR322 and ( T z A G ~ ) ~ probes). Under ihese conditions. VH probes do not cross-

hybridize to members of other VH families (Wrilter el d. 1990).

3.2.c Physical mapping of telomeric YACs

The yeast artificid chromosome yRM2006 was cloned in a library of YACs

designed to contain functional hurnan telorneres, and was mapped to 14qter by tluorescent

in sitci hybridization (Riethman el of. 1989: H.C. Riethman. unpublished results). YAC

B 14 was cloned in vector pTV2 (Brown. 1939; K. Kvalgy. D.Phil. thesis. University of

Oxford. 1993). and mapped to l-lqter by FISH (Dietz-Band er d. 1993). The GDB

designations of y RM?OO6 and B 14 are D 143308 and D llS309. respectively.

DNA from YACs. and from the cloning main AB 1380. was prepared in liquid

solution (Green and Oison. 1990) or as agarose plugs for PFGE (Schctrer and Tsui. 199 1 ) .

Single and double digests were perfornird with BssHII. S d I . SfiI and XhoI. Partial

digests were perfomed as follows: plups were washed in water for 30 min. on ice. then

equilibratrd on ice in 1 x restriction buffer for 30 min.: enzyme ( 1 LT: IO LT for dYltoI) was

added and allowed to diffuse into rhe plus for a funher 30 min.. and the reaction placed at

the digestion temperature for 30 min. Cornplete digests were performed with 20-10 U

enzyme for 4 hours. Pulsed-field gel electrophoresis was performed with a Bio-Rad

CHEF DR11 apparatus. Typically. DNX was rlectrophoresed through 1 O/c agorose/O.jx

TBE gels at 200V for 30 hours. with initial and final pulse times of 2 seconds and 20

seconds. respective1 y. S light modifications of these conditions resolved fragments

between 6.5 and 2-10 kb in size. Transfers of PFGE gels were probrd with pBR322 io

detect the YAC vector. with (TTAGGGIn to detect the telomeric end. and with VH probes.

Complete digests of liquid DNA. separated by conventioniil gel electrophoresis. wcre dso

probed with (TTAGGG)*. to compare the telomeric ends of the two YACs.

3.2.d Alir-PCR generation of probes from telomeric YACs

Alri-PCR amplification of both telomeric YACs was performed. in order to producc

additional cloned probes that would be useful in mapping the YACs. Primers that

hybridize to the extreme 5' (primer Alii jd) and 3' (primer Alic3d) ends of the Mir repeat

were designed- The primers were designed such that the most fiequent bases at the 3' and

5' ends of the primer were used, but al1 other positions included degeneracy to match

nucleotides present in 15% or more of sequenced A h elements (Kariya et cri. 1987). Scime

modifications were also introduced at the 5' ends of the primers to balance the %(G+C)

contents of the two primers. and to introduce an X h o l restriction site into Alrrjd, and a Psri

site into Ah(3d. Primer sequencrs werc as foliows:

AluSd: TATGCTCGAGCCAYYDYRCYCAGC

Alu3d: GCGACTGCAGMRACYYYRTCTCA

These primers have not been s h o w to tirnplify primate DNA specifically. as have

other Alri-PCR primrrs. However. Alir5d and Alrr3d do not arnplify the yeast genomr and

are therefore suitable for amplification of human sequences from YACs.

1 ülso used the rstablished primer AIS. because it hybridizes to the extreme 3' end

of A h elcments and thus providrs products tliat contain very littlr Alir repeat sequrnce

(Brooks-Wilson et trl. 1990). Amplimers were s~ibcloned by TA cloning (Invitrogen).

which takrs advontags of thc propçnsity of fin/ polyrntti.;isc to add an addition4 ndrnosine

residut: to the 3' end of ü DNA duplex. resuItin_o in a single base pair overhiing thiii is

complementary to a single base pair thymidine overhmg nnificiülly added to a blunt end at

the cloning site of the plasmid vector.

PCR mapping of the BA300 Ah-PCR product on a somatic hybrid ce11 mripping

panel was performed by C. Duff. Canadian Genetic Diseases Network Somatic Crll

Mapping Core Facility. locnted in Dr. R. Worton's lab. HSC. Primers B I-lfor

(TCTTAGAGGAGCCCCAGT A) md B l4rev (TGAGGGAAAT AACACAGTGA) were

designed from sequence of the BMOO product. PCR was performed for 35 cycles of 30

seconds at 95'C. 30 seconds at W C . and ?O seconds at 72'C. in buffer consisting of ( IOx

concentration): 67 mM Tris pH 8.5.6.7 mM MgCl?_, 10 mM fbmercüptoethanol. 16.6

mM (NHJ)zSO~, 6.8 pM EDTA. 170 pg/mL BSA. 1.5 rnM each dNTP and 109 DMSO.

3.2.e VH segment nomenclature

For this study. VH segments were initially named with a nomenclature systern

developed in this laboratory (Walter el c d . 1990). as modified for the Eleventh International

Workshop on Human Gene Mapping (Col rr d. 199 1 ). Human VH segments are grouped

into seven families. named VH 1 through VH7. bnsed on DNA homolog (Berman et of.

1988; Buluwela and Rabbitts. 1988; Lee et al. 1987; Schroeder et al. 1987: Kirkhrim ef cil.

1992). VH segments are identified according to their tàmily number (VH 1 through VH6)

and size of restriction fragments in RglII (VH?, VH4. VHS) or EcoRI (VH 1. VH3, digests

of genomic DNA. Nomenclature for the VH7 genes had no< been establishrd. The ietter B

(BgiII) or R ( EcoRI) is incorporated into the sene sesrnent name. Subsequenily.

publication of YAC contig rnaps. and srquencing of dl VH segments that could be

identitied by hybridization to VH probes. allowed the development of a systematic

nomenclature system based on genornic position and VH fmily ( Matsuda ri c d . 1993 ).

Where possible. the two nomenclature systems were reconciled.

3.2.f Nuclease Bu131 digestion of genomic DNA

Agarose plugs contüining Iiigh molecular weight DNA from normal kmalr

lympl~oblüstoid crll line 3638 (gift of K ~Michalickovi) were washed for 30 min. in water.

on ice. thrn equilibratrd on ice for 30 min. in 1 mL of lx Ba13 1 buffer with 25 U of

enzyme (New England Bioliibs). Digestion wm started by placing the reaction at 30'C.

Two plugs werr removed for ecich tirnepoint (O. 30.60.90 and 110 min.) and placed in 1

rnL of ice cold TE. An additional 25 LI of enzyme was addrd at each of the first four time

points. Pluys were individually rinsed in water for 30 min. on ice. equilibrated in 100 pL

restriction buffer with enzyme (BglII or BssHII). and digested overnight prior to

electrophoresis. Gel t r a d e r s were probed with VH2 (BgnI) or VH4 (BssHII) probes.

The BgCLI filter was then stripped and probed with lTAGGGn to detect telomenc

fragmrn ts.

3.2.g Two-dimensional DNA electrophoresis

The two-dimensional DNA transfcr wüs prepared by M. Walter. as described

(Walter and Col. 1989). Briefiy. high molecular weight DNA in an asarose plug wtls

digested with .Votl. and n in out on low-mrlting point agnrosr CHEF prilsed-field gel.

The gel was stained with ethidiurn bromide. and the lane containing the digested DNX

was excised, equilibrated in restriction buffer. and digested with EcoRI. The lane was then

rmbedded in a second gel. perpendicular to the direction of electrophoresis. and subjected

to conventional electrophoresis to resolve low molecular weisht fragments. DNA was

transkrred to a Hybond nylon filtrr according to the manufacturer's protocol (Amershan-).

The resul ting filtrr contains EcoRI fragments sepürated vrrtically. that are used to identib

individual VH segments. Tlic EcoRI Irapents are disperscd horizontally in positions

corresponding to the sizes of the !Vorl kagmsnts from which they were drrived.

3.2.h Chromosomal iiz situ mapping of VH2 probe

ln sirir hybridization mapping of tlie V H I probe wüs perfotmed by L. Anderson. in

the NCE 01 s i r u hybridization core fücility lab of Dr. A..V.V. Duncan. esscntidly as

described (Wintk rr d. 1990). Brietly. the probe was oligolabelled with [ 3 ~ ] - ~ T T P and

HI-~CTP, to a specific activity of 7 s 107 cprn/pg DNA. Metaphase chromosomes from

BrdU synchronized peripheral blood lrukocytes were denatured for 2 min. at 70°C in 709

deionized forrnamidrl7x SSC. Slides were thcn dehydrated with ethanol. Hybridization

mixture (50% ddrionized formamide. 10% dextran sulfate. 7x SSC (pH 6.0). 0.2 pgIrnL

probe DNA. 20 pg/mL sonicated salmon sperm DNA) was denatured at 70°C for 5 min.,

and 50 pL üpplied to rüch slide. Probe w;is hybridized ovemight at 37'C. in a mois[

chamber. Slides were washed three times in 50% fomamidel2x SSC for 3 min. each. then

five times in 2x SSC for 3 min. each. Following rthanol deliydration. slides were dippsd

in Kodak NTBIî emulsion and exposed for four weeks at 4'C. Chromosomes wcre

stained and positions of silver grains directly over or touching well-banded metaphase

chromosomes were mapped to an ISCN idio, oram.

3.3 RESULTS

3.3.a In situ hybridization of V H 2 probe to metaphase chromosomes

The VH2 probe. VH2EB 1.2. was initiaily mapped by in sirii hybridization. in order

to determine if it would detsct loci on chromosomes 15 or 16. The VH2 probe hybridized

to a single location on chromosome 14 (Figure 3- 1). 50 of 300 silver p i n s mapped to

l l q 3 1+32. with 47 of thrse witliin l-lq32. The only other remarkable site wu: ar 9q34

which had 5 grains over it. The lsvel of hybridization to this chromosonie 9 locus is no(

significant.

3.3.b The VH region of chromosome 14 hybrid cell lines

The single VH6 segment (IGHV6i is the most centromrric VH segment in the IGH

locus (Schroeder rr (ri. 1988 1. Whrthcr V(D)J rearrangemsnts had taken place within the

IGH locus of the chromosomes in the hybrids was tested. Re:~rranzement of ~i VH

segment to a DH segment C delrtes IGHV6. Altemativçly. rearrangement to the IGHV6

segment alters rhr size of the restriction fragment containing IGHV6. Both hybrids contain

the gerrnline 6.6 kb BgnI fragment. indicating chat no VH segments have been deleted in

these chromosoriics hie to V( D 1.J rearr;ingements ( Fisure 3-2 i.

Figure 3-1. Ill situ hybridization of VH2 probe to human chromosomes.

Data were provided by L. Anderson and A.M.V. Duncan. Canadian Genetic Diseases

Network of Centres of Excellenctt iri sifit hybridizarion core facility. Positions of silver

grains scored are indicatrd over ü standard ISCN idiogram.

Chromosome NotI fragment Gene segments present size (kb)

. -

[GHV I -RS

IGHV 1 -R6

IGHVI-R 15

( 15) IGHV-LBG

Table 3-1. VH segments on NotI fragments not in the IGH physical map.

Noti fragment sizes are as 1-eported (Waiter er ut.. 1990). (15) Shown in tliis study to rnap

to chromosome 15. (16) Shown in this study to rnap to chromosome 16.

3.3.c VH segments on chromosomes 15 and 16

Results from hybridizations to the somatic hybnd ce11 lines are summarized in Table

3- 1. Two VH 1 segments mapped to chromosome 16. IGHV 1 -R2 1 lies on a 1.8 kb EcoRI

fragment in the chroniosorne 16 hybrid ceil line NA 10567. Both IGHV 1-R12 and IGHV I -

R13 lie on non-identical 1.6 kb EcoRI tiagments which CO-migrate. IGHV 1-R33 hüs b e n

shown to map within the IGH cluster on chromosome 14 (Walter er al. 1990): thus. the 1.6

kb EcoRI fragment observed in NA10567 is due to IGHV 1-R27 (Figure 3-3a). Similürly.

the 1.5 kb EcoRI fragment containing VH3 segment IGHV3-R37 maps to chromosome 16.

since the CO-migrritins segrnent IGHV3-R2S \vas ~ilready known to map within the

chromosoms 14 locus (Figure 3-3b). Since al1 three of these segments (IGHV I -R2 1.

IGHV I -R21 and IGHV3-R27) miip to a 230 kb !Votl restriction fragment (Table 3- 1 ).

which also contains segments IGHV3-R 1 and IGHV3-R3. I conchde thrit these fwe

segments map to chromosome 16.

The 9.4 kb BgnI fragment. containing V H I segment IGHV3-B3. was detected in

the chromosome 16 hybrid line ( Figure 3-3c ). This segment hüd previously bsen mtipped

within the IGH loctis based on two deletions occurring in nionoclond B ce11 lines. ris the

result of VH-( D)JH secombination of the IGH locus (Walter er cri. 199 1 ). My results show

that IGHV2-B3 does not reside on chromosome 14, and rire not consistent with the

previous assignment (see Discussion. section 3.4.b).

The VH3 segment IGHV3f-RS maps to chromosome 15. on the basis of the

detection of its 3.2 kb Ec-oRI fragment in DNA from the ce11 line NA1 14LS (Figure 3-Se).

The 7.0 kb BglII fragment that contains the VH4 family sene segment IGHV4-B6 aIsv

maps to chromosoms 15 (Figure 3-30. This suggests thrit the IGHV 1 -R5. IGHV 1 -R6 and

IGHV 1 -R 15 segments. which share a 520 kb NotI fragment with IGHV4-B6. are on

chromosonie 15 (Table 3- 1 ).

Figure 3-3. Somatic cell hybrid mapping of VH segments. *: polymorphic

segment. Sizes are s h o w on the right: alternative aileles are srparated by a slash. 0: no

alielic couiiterpürt exists (insertion/drlztion polymorphism). HSC 17, HSC 20, HSC 533:

human controls. RJK: hamster. WEHI-TG: mouse. HHW 890: hamster/chr( II)

hybrid. WEGROTWB3: mouse/chr( 14) Iiybrid. NA 1 14 18: hamster/chr( 15) hybrid.

NA 10567: mouse/chr( 16) hybrid. A: L 6 o R I d i p t s . IGHV I -R? 1 and IGHV I -R22

rnap to chromosome 16. B: EcoRI digests. IGHV3-R77 maps to chromosome 16.

Figure 3-3 (continued). Somatic ceIl hybrid mapping of VH segments.

:? polymorphic segment. Sizss are shown on the right: altrmiitivr alleles are srpüratrd by

ri slasli. 0: no ailtilic counterpart exists (insertioddeletion polyniorphism). HSC t 7. HSC

20, HSC 533: human controls. RJK: hamster. WEHI-TG: mouse. HHW 890:

hrimster/chr( 14) hy brid. WEGROTH-B3: mouse/chr( 14) hybrid. NA 1 14 1 S:

hamstrr/chr(l5) hybrid. NA 10567: mouse/chr(16) hybrid. C: BglII digests. IGHV2-

B3 maps to chromosome 16.

Figure 3-3 (continued). Somatic cell hybrid mapping of VH segments.

*: polymorphic segment. Sizes are shown on the nght: alternative alleles are srpiirited by

a slash. 0: no allelic counterpart exists (insertion/deletion polymorphism). HSC 17. HSC

20, HSC 533: liuman controls. RJK: hamster. WEHI-TG: rnouse. HHW 890:

hrimster/chr( 14) hybrid. WEGROTH-B3: mouse/chr( 14) hybrid. N A 1 14 18:

hamster/chr( 15) hybrid. NA 10567: motise/chr( 16) hybrid. D: B,qIII digests. [GHV4-

B7.5 maps to chromosomc 14. E: EcoRl disests. IGHV3f-R5 maps to chsurnosorne 13.

Figure 3-3 (continueci). Somatic ce11 hybrid mapping of VH segments.

: polymorphic srgincnt. Sizss are shown on the right: alternative alleles iue separiitsd by

a slash. 0: no allelic countcrpart esists (insertion/deletion polymorphism). HSC 17. HSC

30, HSC 533: humrin controls. RJK: hamster. WEHI-TG: rnouse. HHW 390:

hamster/chr( 14) hybrid. WEGROTH-B3: rnouse/chr( 14) hybrid. NA 1 14 18:

harnster/chr( 1 5 ) hybrid. N A 10567: mouse/chr( 16) hybrid. F: BgllI digests. IGHV4-

B6 mrips to ~hrornosome i j .

3.3.d The IGHV4-B7.5 gene segment on chromosome 14

The IGHV4-B 15 gene segment is located on a 5.8 kb BgnI fragment (Walter and

Cox, 199 1 ). 1 renamed it IGHV4-B7.5. consistent with the ordering of fragment sizes.

The fragment is polymorphic. and was absent frorn the DNA used for the physical mapping

study of Walter et cri.. 1990. It therefore \vas not localized to a iVorI fragment. 1GHV-l-

87.5 is present in hybrid line WEGROTH-B3 ( Figure 3-3d). indiciiting that it maps to

chromosome 14. The band is absent in the human control and chromosome 14 hybrid

HHW 890. due to the previously describrd insrrtionldeletion polymorphism (Walter and

Cox, 199 1 ). M y assignrnent is consistent with another study. in which IGHV4-B7.5

(there cnlltid VH4 band 8) wns mapprd to a 200 kb SjiI fragment lying nppii~ximately 690

kb telomrric of the JH segments. in the rniddle of the V H region (Willrrns van Dijk er d.

1993-a).

3.3.e 2D-DE mapping of the V H l f probe

The VH 1 f probe drtected EcnRI fragments of 6.7 and 6.0 kb. which were both

pi-esent on a 650 kb Nor1 fragment (Figure 3-4). This !VorI t i a y x n r h a bern pre\.iously

sliown to contain se\wal VH 1 sesments: IGHV 1-R 1. 4. S. 9. 10. 16. 19. and 20 i Walter

et (il. 1990). Tlie probe hj'br-idized to fragments known to contain VH segments IGHV 1 -

RY and lGHV 1-R9. which are located in the dista1 region of IGH (Waiter (11. 1990).

3.3.f Alrr-PCR clone generation

Alti-PCR was ~isttd to ümplifp products froni the hunian insens of tiic ielomeric

YACs. Initially. primers AIif3d and Alirjd wrre used tosether. A single discrete product

of 0.3 kb was arnplified froni botli yR.M2006 and B 14. Products of 0.5 kb and 1.5 kb

wcre amplified only froin B I-i. The 0.3 kb and 1 -5 kb products were repeti~iw in the

human genome and were not studied fiirther. The 0.5 kb product did not detect a signal on

two chromosome 14 sonintic hybi-id ceIl lines and was also not studied further.

I I I

Ir,

Figure 3-1. Two-dimensional PFGE mapping of VH If probe. Nor 1

fragments. separated by PFGE. are separated from left to t-ight. CZ: compression zone.

The 630 kb Nor1 fragment containing segments IGHV 1-R8 and IGHV 1 -R9 is indicated.

EcoRl fragments are sepürated from top to bottom. Size markers are indicüted to the right.

EcoRl and EcoRIINotl double digests of DNA separated only by conventional

electrophoresis rire inciiclitecl.

A 0.4 kb product was specifically arnplified from YAC B 14 with primer A 1 S (see

Figure 3-9d). The product was cloned and named BA400. Because it did not hybridize to

DNA from two different chromosome 14 sornatic hybrid ce11 lines, BAJOO was mapped by

PCR on a sornatic hybrid panel. There wa5 no amplification of three different lines that

contained ri chromosome 14. Hy brids from two sources i BIOS and the Coriell Instituts l

showed amplification îiom chromosome 10. There kvas inconsistent amplificiition from

chromosome 21).

3.3.g VH segments within telomeric YAC yRMî006

D N A fragments containing VH segments IGHV2-8 1. IGHV-I-B4 and IGHVS-B 1

mapped to y RMZOO6 hy hybridization i Figure 3-5: Table 3-1 1. The VH 1 f probe

hybridized to a 7.0 kb EcoR 1 fragment thiit was slightly larger than either of the srynrnts

(IGHV 1-US. IGHV 1-R9) that are detected in genornic DNA by this probe (Figure 34 ) .

This fragment represents one of thçse two segments (see Discussion. section 3 .4 .~) . The

VH2 probe also detected a B g m fragment of approximately 3.0 kb in size chat was present

on the YAC (Figure 3-jb 1. This I'rapcnt hüd not previously been mapped. probübly due

to its werik hybridization to genomic DYA. The weak sisna1 from this band did not

complicate PFGE rnnpping of the IGHV2-B 1 segment on the telorneric YXCs. Filters wrre

probrd with pBR332 to snsure that no signals from the VH probes were dur. t« cross-

hybridization of contaminating plasmici to YXC vector srqiiencrs inot shown ). The VH

gene segments detectcd on this YXC ;ire located in the 5' (telomeric) end of IGH. and their

order and positions on the YAC are consistent with the existing physical map of genornic

DNA (Cook et [ri. 1994: Wintle iind COL 1994).

3.3.h PFGE mapping of two telorneric YACs

Separniion of chromosomes by PFGE of the YAC strains yRM2006 and B 14

showed thnt the nrtificial chromosomes are 210 kb and 170 kb in size. respectively.

probe B 14 vRM2006

V H l f + ( 1-69)

VH2 + (2-70)

VH3 SD + ( rniiny segments )

VH3f -

VH4 + (4-80) + (4-80)

VH5 + (5-78) + (5-75)

D 14SZO ND

D 14S23 hiD -

pVIyRiM2006 - +

BA400 + -

Table 3-2. Probes hybridized to telomeric YACs. IGH probes are described:

VH segments present are ntlmed üccorcling to Cook rr cri. 1994. pVIyRM2006 is a

vector:inssrt junction from Y AC y RM2OO6 ( H. Riethman. unpublished). D 14S33 was

scored by PCR. +: mlirker present. -: mrirkcr absent. ND: not donc.

A VHlf U3

Figure 3-5. VH segments on telorneric YAC yRMZ006. Four V H segments

niap to YAC yRMZ006. .Alleles are labellrd as in Figure 3-3- HSC 17. HSC 20. HSC

1081. HSC 122 1 : human controls. AB 1380: yeast conrrol. A: EcoRI d i p t s . VH 1 f

probe. The fragment detected on the YAC may be either IGHV 1-RS or IGHV 1-R9 (sse

Discussion. section 3 . 4 3 ) . B: BgIII digests. VH2 probe. A novel 3.0 kb BgIII fragment

is shown with :in arrow.

Figure 3-5 (continued). VH segments on telomeric YAC yRMZ006. Four

VH segments map to YAC yRM2006. Alleles are labelied as in Figure 3-3. HSC 17.

HSC 10. HSC 1084. HSC 122 1 : human controls. AB 1380: yeast control. C: B,qiII

digests. VH4 probe. D: &III digests. VH5 probe.

yRM2006:

probe BssHII ScrcII S f i I Xlzo 1

pBR372 26.100.1 15 75.73.150 96. IOO. 145.170 X3

(TTAGGG)n 1.5 3 5 10

VH 1 f 75.YS.lOO. 1 15 3.7S.110.150 96.100.145 32

VH2 7 5 . 8 s . 100. I 15 150 96.100.145 3 2

VH4 1 1.60.70 ;O > 3 cl 4 -a -

vH5 65.70.SO.94 30.1 15 35-95 94.100

probe Bs.sHIIISacll B.s:;HIIISfrI B.ssHIIIXlloI ScicII/.YllnI Sf ï I IX l tn I

V H l f 7 O h( 1

VH2 2-1 70 60

VH4 20 25

VH5 11 2 7 6 2 30 25

B 14:

probe B.cs H 1 I SmAI SfïI ~ l i 1

pBR322 60.95 i 2.135 5 5 . ~ 0 . 130 16.1 S.Sj.hi

VH4 1-3.76.~5.1do -70 35 1o.1 1 5 . 1 5

vH5 SO.Y5.130 30 35 113.125

B A 4 0 60.S0.95 170. 135 55.W. 130 25.30.40.55.63.1 40. 150

Table 3-3. Sumrnary of PFGE fragments from telomeric YACs. Fragment

sizes are shown in kilobases. Data presented here are cornpiled from several hybridizations

that resolved complets and partial fragments in different size ranges.

X 6 Sa Sf 8 BlSf X 8 SfB( X X Sa 1 I l (vector)

(telomere) 81 4/Al S 400

.IO kt,, y RA42006 (2 1 0 kb)

8 X B Sa Sf 8 BIS1 Sf X Sa Sa B

(teiornere) 1 I r 1 I (vector)

4-80 5-78 2-70 1-69 pVlyRM2006

Figure 3-6. PFGE maps of two telomeric YACs. B: BssHII. Sa: S d l . Sf:

S'iI. X: XlioI. The most centroineric restriction sites in cornnion between the turo YACs

are marked (arrow üt top). The region of B 14 to the right of the m o w is no[ Jerived from

chromosome 14. The discontinuity represents a 45 kb region in both YACs in which no

restriction sites were detected. and contains D13S826 (Pandit et al.. 1995). Positions of

cosmids containing TCA7 and TCA11 are shown as bus; deduced locations of TCA7 and

TCAI 1 are indicated (solid portions: sce Figure 3-9a and Chapter 4). VH segments 4-80.

5-78. 2-70 and 1-69. du -PCR probe BA400 and endclone pVIyRM2006 are marked

(hashed boxes). pVIyRM2006 is it vector: inssrt junction from YAC RM2OO6 (D 112 12:

H. Riethman. unpublished). which did not hybridize to YAC B 14 .

Restriction enzymes BssHII. Sm-II. SjïI and XhoI were used to digest YACs to

completion. Partial digests were probed with pBF.322 and (TTAGGG)n to detect each end

of the YACs. Conventional gel efectrophoresis was uscd to demonstrate that ü BssHII site

is 1.5 kb, and that an X/mI site is LO kb. from the telomeric repeats of yRM1006 (Figures

3-7 and 3-8). and thtit the VH 1 f probe detects ü 3.0 kb S d I fragment. Probes VH 1 f.

VH3. VH4 and VH5 were usrd to locate VH segments IGHV 1 -R%R9 (see Discussion.

section 3.4.a). IGHVî-B 1. IGHV-I-B4 and IGHVS-B 1. respecti\-ely. and to order

restriction sites within the YAC. Sizes of PFGE restriction fragments of the YACs are in

Table 3-3. Physiciil maps derived from the PFGE fragements are s h o w in Fisure 3-6.

YAC yRiM?006 ( y IgH6) appears to bc collinear with genomic DNA ovsr its entire

lsnsth (Cook et ci/ . 1994: Wintle and Cox. 1994). YAC B 14 is chirneric. as the Alri-PCR

probe BA400 frorn its proximal region failsd to müp to chromosome 14 somatic ce11

hybricls. either by hybridizotion or by PCR. This is further supportrd by PFGE restriçiioii

rnaps of the YACs which are identical only ovsr their teiomeric 95 kb (Figure 3-6). The

YACs are identical to within less than 1 kb of thrir telomeric ends by conventional

elcctrophoresis (Fipires 3-7. 3-8). Both YACs hyhridizrd to the telornere probe.

(TTAGGG)n. The rnost terminal BssHII site present in yRM2006 wos drtectcd in B 14

only os a vrry ftiint. disperse srnrnr of Iiybridization signtil.

3.3.i Nuclease Ba13 1 sensitivity

The 13.5 kb BssHII fragment of the YACs. containing VH segment 4-80. was also

presrnt in genomic DNA ( Fisure 3- 10 i. Ir was sensitive to digestion with nuclease B d 3 1

( Figure 3- 1 1 a). The 1i-agment decreasrd in s i x by about 2.0 kb iifter 60 minutes of

digestion. The 14Lb B,$II fragment contnining VH segment 2-70 wtis not sensitive.

indicating that the change in size of the BssHII fragment wüs not due to non-specific

nuclrase üctivity (Figure 3- 1 1 b). 45.111 tragmrnts that hybridized to telomere repeats

Figure 3-7. Two telomeric YACs are identical at their telomeric ends. YAC

DNA hybridized to human telornere probe. (TTAGGG)n. Restriction enzymes used are

indicated above the 1:ines. Left panel: YAC B 14. 12 day exposure. Risht panel: YAC

yRM1006.4 day esposure.

I ,8$8 TEL +$"'

a I I I I I I I I I I I ---L-**-

I / \ I \ \ \ \ 1 1 13.75 102 16.0 / I \ kb 1.55 1.7 2.0 2.6 4.0 4.6 4.65 5.6 6.5 7.1 r 0.0 18.0 18.5 (19.1)

Figure 3-8. Restriction rnap of the 1Jq telomere. Restriction map from

complete and partial digests of YACs 8 14 and yRM2006. Restriction sites are shown

above the line, and their distances in kb from the teIomere below the line. TEL: teiomeric

end of YACs. The position of the BgfII site at coordinate 19.1 was inferred from the

hybridization of 4-80 to a 9.1 kb BglII fracgment. Restriction fragments that hybridized to

the VH4 probe are shown as bars below the restriction map. The deduced location of 4-80

is indicated with a tllled bar.

Figure 3-9. PCR amplification of markers from telomeric YACs. P C R

mapping of markers on telonieric YACs. Probe names are given to the Irft. amplimer sizes

to the right. hurnün: human peripheral blood leukocyte DNA. ysast: S. cera*isicir

AB 1380 DNA. A: D 14S816 and TCA 1 1 are arnplified from both telomeric YACs. B:

TCA7 is amplitied oniy from yRM2006. C: VH2 product is arnplified only îi-om

yRM2006. D: BA400 is amplifieci only from B 14.

Figure 3-10. The 13.5 kb BssHII fragment containing VHJ segment 4-80.

BssHII digesred DNA. The 13.5 kb fragment detected by the VH4 probe is indicated.

Human: liuman peripheral blood leukocyte DNA. AB 1380: yrast cloning stiriin DNA.

B 14. yRbIZ006: teloincric YAC DNA.

Figure 3-11. Nuclease Ba131 digestion of human genornic DNA. Timc of

B d 3 1 digestion. in minutes. is indicated. A: BssHII digests probrd with VH4. The 13.5

kb frqinent containing V H segnient 4-80 is markcd. B: BglII digests probed with VH2.

The 14 kb fragment contüining V H segment 2-70 is marked. C: B,ylII digests probed witli

(TTAGGG)n.

decreased in size from an average of 10.5 kb to an average of about 6.5 kb after 30 minutes

of digestion. and were alrnost undetectable after 60 minutes (Figure 3-1 lc).

3.4 DISCUSSION

3.4.a IGH segments located near the 14q telomere

The 5' end of the IGH genr cl~istrr is orientrd toward the telcnirre of Ilq i Erikson

et cil. 1982). YACs haw becn ussd to map the crntromeric 800 kb of this locus (Matsoda

et cil. 19% 1. The VH q n i e n t s that wcre mapped to telomeric YAC yRLM2006 are al1

located within the esti-emr telomeric end of the E H physical rnap ( Walter et cd. 1990 1. Tlie

EcoRt frqment detectrd on yRM2006 by the VH 1 f probe does not exactly correspond to

either the IGHV 1 -RS or IGHV 1 -R9 sene segments: however, this probe is specific for

these two gene segments (Figure 34 ) . The location of the VH 1 f signal within the PFGE

map of yRiM2006 precludcs it being altered in size as the result of a vector:insrn juncrion

fragment. Since eîther segment could potrntidly be within the YAC. this locus wcis

referred to as IGHV 1 -RS/R9. Observation of another map of y RM2OO6. mndc at the samc

tirne IS the mapping cxperimsnis presrntrd here. susgests that this segment is identical to

segment 1-69 (Cook et cil. 1994). Probubly. the traernsnt on the YXC differs in s i x Irom

the genomic fragment dur tu an insenion/deletion polymorphism neor 1-69 ( Cook and

Tomlinson. 1995). The other VH sesments on yR.342006 can similarly be idcntified with

the nomenclature of Cook QI.: IGHV2-B 1 is identical to 2-70. IGHVI-B4 to 4-80 and

IGHVS-B 1 to 5-78. The VH segments mapped to yRM2006 are located in a region that

cnn be encompassed by a YAC of this size ( 2 10 kb), IGHVLC-B4 is the most telomeric in

both the grnomic and YAC maps. and the othrr three VH segments are present in an order

consistent with the genomic map. The YAC tlierefore is collinear with genomic DNA in

this rqion. The location of this telomeric YAC rit the 5' (telomeric) end of IGH. and the

results showing that alrnost aII othrr VH genes rnap to chromosomes 15 and 16, suggest

that the total size of the IGH locus on chromosome 14 is 1500 kb as previously reponrd.

including approximatrly 1 100 kb of the VH re,' 010n.

3.4.b VH segments on chromosomes 15 and 16

There are approximately 90 VH segments within the chromosome 14 IGH locus.

although this numbrr varies from haploty pz to haplotype. duc to insertion/delction

polyrnorphisms. None of the fifteen segments of Table 3- 1 have been found to be

polymorphic (Walter et al. 1990): howcvrr. it is still possible thiit any of thrse segments are

associated with rare insertioddeletion polymorphisms. Absence of hybridization signal on

chromosome 14 hybrids wiis therefore not sufficient evidrnce to state that a segment did

not map to chromosome 14.

Initially. the VH2 probe was mopped by in sirrl hybridization. in order to determine

if i t wiu: likely to detect YAC or cosmid clones containing loci from other chromosomrs.

III sitlr hybridization did not reveal any signal from chromosomes 15 and 16 (Figure 3- 1 ).

.A previous report hüd s h o w that a different VH2 probe hy bridized to c hrornosomr 16

(Cherif and Berger. 1990). Our probe. V H î E B 1.2. dçtrçts IGHVZB3 less strongly [han

it dors two other VH2 sepmrnts thnt rnap to chromosome II. which cxplains our fail~ire tc i

detect the chromosomr 16 locus by N i sitri hybridization. PCR primers that I designrd

[rom the VH2EB 1.2 plasmid sequrnce also detected only the chromosomr 13 locus whrn a

somatic hy brid ce11 linc mapping panel was amplified.

Many VH segments CO-migrate with others of the sarne family in a BgZII or EcoRI

digest. Prcviously. these segments wsre separated by two-dimensional DNA

elec<rophoresis (2D-DE) and assigned to individual Nor1 restriction fragments (Walter and

Cox. 1989: Walter et cil. l5)OO). This technique was not used. as DNA methy lation wiis

expçcted to differ between the hybrids and the hydatidifom mole DNA used in the original

7D-DE study. resulting in DNA fra,oments of different sizes that would makc comparison

of new and existing maps difficult.

Somatic remangement of the IGH locus of chromosomes 14 from B cclls can

detete large amounts of the VH region (Walter er ai. 199 1). Because hybrid lines

WEGROTH-B3 and HHW 890 were constructed from human leukocytes fused to rodent

recipient cells (Guerts van Kessel et cri. 1983: Dana and Wasrnuth. 1982 1. it was possible

thiit some VH segments woiild be absent in these hybrids as a result of V(D1.J

recombination. Hoaever. IGHV6. the most 3' V U segment. was present in ~erm-lins

configuration in both hybrids. indiçating thüt no remangement into the VH region had

triken place (Figure 3-2).

Three gene segments from the 230 kb ~Vott fragment were esümined. Results for

IGHV 1 -R2.1. IGHV 1 - R X and IGHV3-R27 were consistent. indicating that this fragment

is locatcd on chromosortie 16. Matsucl:i rr tri. dsscribed a 60 kb region on chromosome 16.

named VH-F. that carries two VH 1 pseudo~enes and two potsntirilly fiinction;il VH3

segments (Matsuda el trl. 1990). This cluster is similar to the 230 kb Nor1 fragment. which

contains two VH 1 and three VH3 segments. The EcoRI restriction map of the VH-F

reg ion suggests tliat the ylV65- 1 of that study may correspond to IGHV 1 -R22: similarly.

yV65-3 may be IGHV 1 -R? 1 and V65-4 mny represent IGHV3-R17. The Vtj j-7 gene is

on an EcnRI fragment of rippro.uiin:itely 1 .S kb. This size does not correspond to iiny of

the VH? gznes on the six No11 fragments. Howevrr. polymorphism of &CORI restriction

sites between the DNA sources ~ised by Mütsuda rr ci l . and in our studira may account for

this discrepancy. Either IGHV3-Ri or IGHV3-R3 mny correspond to V 6 5 - 3 with the

other located within 170 kb of the VH-F region.

I mapped the IGHV2-B3 segment to chromosome 16. In a previous B cell deletion

analysis. this sesment w s dslered on iwo chromosomes of 26 B ce11 iinrs. representing 32

different ViD)J recombination events (Walter et trl. 199 1 ) . One of the two events. in crll

line T4B3 of that study. is iin expected reorrangcment. in which al1 VH segments 3' of the

rearrangrd one are deleted. The other. in line 6G8. seems to be the result of a non-linear

joining, with some VH segments retained even though IGHV2-B3. presumed to be farther

5'. was deleted. Donors of these B cell lines both carried two copies of the IGHV2433. so

rhese B cell lines may have lost one homologue of chromosome 16 during culture. In a

similar study. the IGHV2-B3 grne segment was found to consist of turo BalIl frngnieiits of

very similar sizes (Schutte et cil. 1992 ). The more stronply-hybridizing fragment. thrre

called VH2-3.2. was presumed to be equivalrnt to the IGHV2-B3 gene sesment of Walter

er cil. The presence o t this fragment in a11 cell lines of Schutte ri d. is not inconsisrcnt with

its üssignment to chromosome 16. The weaker-hybridizing fragment. called VHI-3.1. W ~ L Ï

mapped by Schutte rt (il. within the IGHV region. based on ils absence in one ce11 line.

However. it rnay be polymorphic. which could explain why this band was not scored in

our analyses.

1~ silu hybridization had previously s h o w thet sequences homologous to VH 1.

VH2 and VH3 gene segments map to chromosomes 15 and L6 (Cherif and Berger. 1990).

The VH2 probe used in that study includes DH and JH sequences. as well as a substantial

ainount of flanking seqiisnce. and detects Iiomolopus scqiiences on both chromosomes.

Hybridizations of DNA probes dcriwd from intergeenic regions of VH to somatic cd1

hybrids also suggt-st thrit al1 VH sequaices are found either on chromosomes 14. 15 or 16.

and are coiisistent wirh my i-esults (Matsuni~ira et (11. 1994). Four Nor1 fragments. of a

total s i x of I 150 kb. were mapped to chromosomes 15 and 16. Two additional Nor1

fragments i220 kb. 670 kb). not mapprd within the major cluster of IGHV gene segments

(Walter et cil. 1990). could not be localized in this study. due to the presence of multiple

homologous bands in rodent genomes that would have obscured hurnan VH signals in the

chromosome 15 and 16 hybrids.

The functional si_onifïcance of VH segments located outside of IGH is unknown. It

has been suggested thrit interchromosoma1 V( D).i recombination events cm occur. or that

oene conversion couid play a role in the maintenance of VH segments on other z

chromosomes ( Matsuda et trl. 1990). In view of my localization of IGHV2-B3 to ri locus

on chromosome 16. i t is inieresting to speculate that the apparently non-linear

rearran,oements of the IGH locus observed in monoclonal B ceil Iines (Walter ct cil. 199 1)

might be the result of interchromosornai recombination events. An IGH diversity region

elernent (IGHDY?) hits also been shown to map to 15ql 1-ql2. in the samr region as the

VH genes mapped by in sirir hybridization (Chung et cil. 1984). Either a cluster of IGH

oene segments including IGHDY? could be present cit this location. or par< of the 15q locus C

çoufd be a processed pseuoclogens tiom a rearranged IGH locus.

Alternatively. interchromosorna1 tmnslocations involvins VH slements on

chromosomes 15 and 16 could predispose to neoplasias. similar ro the vxiçty of Irukemiiis

caused by rranslocntions involvin_o the IGH locus at 1 Jq32.33. No translocations

involving 15q 1 1 have been reportsd in neoplasias (Mitelman rr d. 199 1 ). T~inslocations

between 16p 1 1 and 2 1q22 have rtireiy been reponed in cases of xiitr myeloici leukemia.

and some cases of mysoid liposarcoma involve translocations between 12q 13 and 16p 1 1 .

However. the chromosome 16 locus involveci is the FUS gene. rather than the VH

segments (Panagopoulos et [il. 1995).

It \vas dernonstrated that the map of Walter et al . 1990 cün be used to identify

specitïc VH gene segments in humanhodent somatic hybrid ce11 Iines. A similar approach

can be used for clonecl DNA. Phase. cosmid or YAC clones can br digestrd with the

appropriate restriction rnzyiiir (EmRI or BgIII). to establish the exact VH grne content of

such clones. YACs c m easily be localized within IGH and alisned with respect to eüch

other and the genomic physical niap. Subcloning and sequence analysis of the genomic

copies of VH segments idzntified in thc physical map allows sqments cloned by other

groups to he correlated with their genoinic counterparts within the framtiwork of the

existing physical map of IGH (Cook rr cd. 1994: also. see Chapter 4).

3.4.c Two VH segments detected by the V H l f probe

Because most probes derived from the VH region hybridize to many DNA

fragments. i t was important to use probes that detected as few loci as possible. The VH lf

probe was thought to hybridize to flanking regions of only two VH 1 segments (K.

Huebner. unpublished). 1 hybridized i t to a two-dimensional PFGE DNA gel transfer.

originülly used for physical mapping of IGH. in order to unambiguously identify thesr

fragments (Figure 3-4). VH 1 f hybridized to fragments known to contain the IGHV 1 -RS

and IGHV 1 -R9 segments. located within a frw hundred kb of the end of the rxisting IGH

physical map. This probe u x thrrefore usehi for mapping of telomeric YACs. and is the

only probe near 14qter that hybridizes to as few as two loci on chromosome 14.

3.4.d YhCs representing the telumere of 1Jq

Thç first telomrric YXC describeci for 14q was yRM2006 (also cdled yIgH6)

(Cook cr ol. 1994: Wintle and Cox. 1994). Rather than repressnting the telomrre at I4q. i t

could have arisen from repüir by tlie ywst cloning strain of an interstitial sequence of

telomrriç DNA rctpe~its. Such interstiticil reprats exist in humiins. predominnntly close to

true telomeres (see Chaptrr 1. section 1.2.d). The description herr of a second telomeric

YAC. B 14. identicai to yRh.12006 at i ts telomeric end. strengthens the argument thiit these

truly represent tlir 14q tclonisre. iinmcdiately adjacent to tlie 5' end of IGH.

Thc Aili-PCR prodiict. BA-lOO. diJ not hybridize to two srparcite chroiiiosomc. 14

hybrid çrll lines. This probe was rniipprci by PCR amplification of a panel of sornatic

hybrid ceIl lines. containing limited nurnbers of humnn chromosomes in a rodent

background. Thrre wcis no amplification of three different lines that contained a

chromosome 14. and hybrids from two sources showrd amplification from clii~omosome

10. Topl ier with the divergence of restriction maps of the proximal regions of y RM?OO6

and B 14. thesc data demonstrate that B 1 1 is chimeric. with only its most distal part derived

from chroiiiosome 14. The observation that YAC B 14 is chimeric was unexpected. as the

insert DNX was dephosphorylated and should therefore not have co-ligated during cloniny.

Another YAC fram thix libriiry. represcnting the XqlYq psrudoautosomal region. was also

chimeric (Kvaloy et cd. 1994). as are at least tifteen percent of clones from this library (K.

Kvalgy, personal communicütion).

A critical test for telorneric 1oc:ition of a sequence is its sensitivity to digestion by

nuclease Ba13 1 (Brown et al. 1 !BO). 1 demonstrated that VH segment 4-80 detects a

restriction fragment in the human genome that is sensitive to digestion with nudease B d 3 i

(Figure 3- 1 1 ). 4-80 is npproximatcly 15 kb from the teiorneric end of YAC yRiM1006

(Cook rr (il. 1994: Mrintle rr oL. in press Gerzornics 1997: Figure 3-8). Trlomrric YACs

undego inincation of the human telornrric repeats dunng the çloning procrss. typicülly

retaining only a few kilobiises of TTAGGG repeüts (Brown et cd. 1990). The telornrric

BgAI restriction fragments of ce11 Iine 3638 average approximately 10.5 kb in size c Figure

3-1 Ic). 4-80 is therefore approxirnatrl 25 kb from the end of the chroinosoiiie 14 in this

ceIl line, a distance thiit incltides about 10.5 kb of telomeric repeats.

The telonirric repsnts are almost al1 digrsted by nuclease &r13 1 within 60 minutes

(Figure 3- 1 lc). The size change of the 13.5 kb BssHII fragment containing VH segment

4-80 is apparent sven otter 30 minutes of digestion. This is probably due to the

hrterogeneity in lrngth of terminal restriction tiagrnents such that somr of the BssHIl

fragments are di=estrd eveii üfter 30 minutes. and to the nuclsiise Bol3 I digesting at an

inconsistent rate, [t is known that this nuclt3;ise contains two distinct ;ictivities wi th

difkring rates of digestion. The slower form is a degradation product of the fister fom

and is presrnt in al1 prttporntions of the enzyme. In addition. nucleüsr 8113 1 digests

telorneric i-epeat DNA laster than adjacent subtrlornsric sequences.

3.4.e The IGH gene cluster at l4qter

Ttie IGH gene clustcr is Iocüted with its 5' end immediately adjacent to the trlornere

of the long arm of cliroinosome I I . Ttie most 5' VU segment, 4-80. is about 15 kb from

the start of the trlomcric TTAGGG repeats. By ünalogy with stlidies from yeast. location

so close to a telornese migtii inhibit transcriptian of this VH segment (section 1.4.c).

However. not d l VH segments are used in antibody production; about half of VH se, men ts

are truncated, lack an open reading frame or recombination signal sequences. or are nrver

seen in productive V(D)J rearrangements. even thoujh by sequence criteria alone they

appear to be functional (Cook and Tomlinson. 1995). The most distal VH segment used in

heavy chain production. 3-74. is Iocatcd about 60 kb frorn the TTAGGG repeats. No

tnsertion/deletion polymorphisms involving VH segments in the r q i o n brtwscn 3-74 and

the telornrre have been described. One intsrpretrition is thrit t h m must bs ri minimum

distance from the telomere to VH segments that are used in V(D)J joining. .i\ltrmativrly.

there may be srquenccs other than functional VH segments near the telomere tliat connot be

iost due to terminal deletion. There is. however. no evidence for other genes within IGH.

as has been reported for trypsinogen genes èmbedded within the humm T-ceIl recrptor P

locus ( Rowen t.r c i l . 1996 1 .

With the rstciblishnicnt of ihr location of the telomere of 14q. and the cornpletion of

the IGH physic;il ninp. it wns now possible to isolate and map senetic markers neür I-lqtrr.

in order to study grneiic recornbincition in this subtelomeric rqion.

CHAPTER 4.

GENETIC RECOMBINATION AND POLYMORPHIC MARKERS IN THE

llqter SUBTELO-MERIC REGION

Includes work from:

Wirztlr R FI Nygncrrcl T, Herbrick JS, Kvalmy K m ~ d Cox D W (in press. Ge~iomics. 1 99 7).

Geizetic polymorpiiistn and recotnbincrtion itz the siibtrlo~nrric region of clirotnosonrr

1441.

(T. Nygaard carried out typing of CEPH families for microsatellite marker TCA7. J.

Herbrick was an undergraduate student who obtained cosmids and subcloned CA reprats

Rom them whilst under my supervision. K. Kvalpy provided telomeric YAC B 14.)

4.1 INTRODUCTION

4.1.a Recornbination in human subtelomeric regions

Human subtelomeric regions differ in their meiotic behaviour frorn other

chromosomal regions. with higher average recombination rates per Mb of DSA. and a

higher ratio of male to female recombination. Preferential initiation of pairing at

telorneres during the zygotene stage of male rnsiosis is one explanation that has bbren

offered to explain this increase (Rouyer rr c d . 1990). A recent study demonstrated that

the subtelomeric region of chromosome 2 lq hüd only male recombination events

observed in its most telomeric 2.3 Mb (Blouin es c d . 1995). With the physical

characterization of the distal part of the immunoglobulin hravy chain gene cluster (IGH)

at 14q32.33 now completed (Chapter 3), it was now possible to study recombination in

the terminal part of chromosome I4q.

4.l.b Linkage maps of chromosome 11

The Centre d'Etudes du Polyrnorphism Humain (CEPH) consortium map of

chromosome I I identified IGH as its most trlomeric genetic marker. although the order

of IGH and other D N A markers in this region had been controversial (reviewed in Cox rr

c i 1995). Subsequently. identification of a iriicrosatellite isCAW 1 ) within the VH region

YAC. yRM2006. esrablis hrd D 1 G826 as the most telomeric genetic marksr for 14q

(Pandit et cd . 1995). Two new polymorphic CA repeats were cloned from the VH region.

and localized these npproximately 90 kb and 200 kb from the 14q terminus. These

markers were used to investigate meiotic recombination across the most telomeric 1.0 Mb

of 14q. An increase in recombination was observed in this interval. However. there was

no statistical support for an increased rna1e:female recombination ratio in this region.

These data support the existence of a previously described hot spot for recombination

within IGH (Benger et cd . 199 1 ) .

The long arm of chromosome 14 contains an extensive region of homology with

mouse chromosome 12. extcnding from the PYGL locus at I4q2 1 to the IGH locus at

14q32.33 (Edwards et (11. 1995). The IGH homologue in the mouse. Igh. is in t hr same

orientation relative to the telomere. with its variable region (IgIi-V) distal to its consrant

region (Iglz-C) (Mouse Genome Informatics Project: information available on the World

Wide Web at http://www.info~~natics.j;~~.org/encyclo.html). Murine linkage maps place

severltl anonyrnous markers and the iv locus (sitru irzvers~ls mutation locus IV) distal to

Igh (de Mreus rr al. 1992: Khan rr al. 1994). suggesting that there is a region of murine

chromosome 12 distal [O (qlr that does not correspond to part of human chromosome 14.

The development of accurately müpprd polymorphic markers close to the telomere of

human 14q is necessary in order to anchor genetic maps at this telomere. A highly

polymorphic telomeric marker system will be valuable for mapping phenotypes or genes

in humans that may correspond to loci on the distal pan of mouse chromosome 12.

4.2 NIATERIALS AND METHODS

4.2.a Isolation of microsatellite markers

A portion of a chromosome 14 specific cosmid library (L. Deaven. Los Alamos).

comprising approximately 4.5 fold coverage of the chromosome. was screened with VH 1

and VH4 family specific probes (VH 1: 5 1 P 1 J. Schroeder ef r d . 1987: VHI: 5SPZX PCR

probe (Wintle and Cox. 1991: Chapter 3)). Positive clones that also hybridired to a

poly-dCdA probe (Phiirmacia) were subcloned using either EcoRI or Pst[. This work wiis

perforrned by J. Herbrick. iinder my supervision. I obtained sequence flanking the

repeats by using primers homologous to CA repeats (Browne and Litt. 1992). 1 then

amplified and subcloned VH segments from cosmids yielding polymorphic repeats (TA

cloning kit, Invitrogrn). I designed VH 1 primers that were shortened versions of VH 1

FR 1 ( 17-12) (TTWCRGYGARRRTY WCCTGC), and VH 1 HEPT,

(CTSTGGKTTYTCACACTGTG). of Tomlinson et al. 1992. VH4 primers were as

reported (Wintle and Cox, 1994; see section 3.2.b). I sequenced and compared srven

independent clones of each VH segment to known VU germline sequences with the

BLASTN program (Altschul et cd. 1990). or alipned thern with those in the V-BASE

database (LM. Tomlinson. unpublished).

3.2. b PCR amplification of microsa tellite markers

Primer sequences were ris follows:

TCAl l primer 490: TGTTTGAAGAAGGGAGTCGT

primer 49 1 : CCCACTCCATGTCTTCTGTT

TC47 primer 193: T.4GGGACAGGCAGTTGATTA

primer 502: CAATTAATGTAAAAATTXGCCA

primer IGH- ITF: GGGCCAATTAATGTAAAAAT

primer lGH- 1TR: AGGTGCATGTGGATAGA.4GT

D llSS26 primer 749: XTAACCC.4GXTACCCAAAC

primer 750: TTGCATCTATATTTACCAGGA

For initial tests, and CEPH genotyping with the 490/49 1 and 493/502 primer sets.

genornic DNA (IO ng) was arnplifïed in 10 pL reactions containing 50 mM KCl, 20 rnM

TRIS-CI pH8.6, 0.1 mg/mL BSA. 200 pM each of dCTP. dGTP and dTTP. 20 yiM dATP

and 2 pCi C ~ ~ ~ S I - ~ A T P . 50 ng each primer. 0.5 U Amplitaq (Perkin-Elmer). and 7.0

mM (TCA 1 1 ) or 1.5 mM (TCA7. D 14S526) MgCl?. Reactions were incubated for 4

min. at 95'C before enzyme addition and 30 cycles of 30 sec. each at 95°C. 58°C

(TCA 1 1). 55°C (TCA7) or W C (D 11S826). and 72°C. Large-scale typing of CEPH

DNAs for TCA7 was performed in the Iab of T. Nygaard. Columbia University, with

primer pair IGH-1TF/IGH- ITR as follows: in each well of a microtitre plate. one primer

was end-labelled with [ y - 3 2 ~ ] - d ~ ~ ~ in a 0.5 pL volume. including 10 mM MgCl?_:

othrrwise. the protocol was according to the manutiiicturer of the polynucirotide kinase

(New England Biolabs). Each PCR reaction included 1.0 yiM each primer. 100 FM each

dNTP. 2.0 mM total MgCl?, 80 ng genomic DNA template. and 0.5 U Tcq polyrnerase

(Boehringer Mannheim) in a 10 pL volume. A "touch-down" PCR protocol was used: 5

min. at 95'C, followed by cycles of 95'C. 60'C (decreasing by 1'C per cycle until 50GC).

and 7 T C . followed by 20 cycles with S O T annealing and a final 12 min. extension at

72'C to increase product yield. Most CEPH genotypes were also typed for TCA7 by

mysrl f, with the 493/502 primer set. in order to determine if there were differencss in the

data tiom the two lübs ca~ised by systematic errors. Allele sizes were determineci relative

to CEPH parents used as standards and to the sequenced cloned repeats (Table 4-1 ).

4.2.c Linkage analyses

Existing data were used for the IGH constant region BsrEII polymorphism

detected by probe p24BRH (Cox et trl. 1995). In order to extract the maximum ümount

of information from the telomeric markers. I constructed haplotypes of CA repeats TCA7

and TCA 1 1 (Table 4-3; Appendix B). In seven families where there was at least one

parent not informative for rither CA reprat. D 148826 genotypes were also used. rither

newly generated or from the CEPH dritabase (version 7.1; marker sCAW 1 (Pandit et ( I I .

1995)). Haplotypes were çoded numerically for each family (Appendix Cl. and were

sntered into the CEPH database program. Coded haplotypes will be submitted to CEPH.

Output from the CEPH program was converted to CRI-MAP format with the

LNKGFRMT and LINKTOCRI utilitirs (K . Buetow. unpublished). Linkage analysis was

performed with CRI-MAP (P. Green. unpublished) using the "twopoint" option. Two-

point linkage analyses were also performed with the LINKAGE package. which gave

identical results.

4.2.d Typing of IGH constant region markers

Two IGH constant region markers were re-typed in families previously described

ris having a child with a recombination event within IGH. An XbaI RFLP located near

the IGH 6 gene segment (IGHD) was drtected by hybridization with pCW IO 1. a clone

containing a 2.7 kb PsrllBtritiH1 insert from the 3' tlanking region of IGHD ( Benger cr d.

199 1 ) . G3m allotypes b or g were determinrd with a PCR assay (2.-Q. Chen. G.

Billingsley. R.F. Wintle. L.L. Field and D.W. Col. manuscript in preparation). 50 ng of

genomic DNA was ümplified with oligonucleotides G3CH3F (CCC GAG GTC CAG

TTC AAG) and G3CH2R (AGG GCA GAG GGT GGG TCA). After an initial

denaturation of 4 minutes at 95°C. amplification was for 30 cycles of 30 seconds each ai

95°C. 62'C and 72'C. 20 U of Scrc-II were rtdded to each reriction. and these were

incubated nt 37'C for one hour. Products wsre resolved on 3 6 agarose &. A 123 bp

fragment is sprcific for the G3m(gI) allele. and one of 15 1 bp is specific for the G3m( b 1 )

allele.

4.3 RESULTS

4.3.a Polymorphic CA repeats at the telomere of I l q

Nine cosmids positive for IGH variable genr segment VH 1 or VH4 probes were

recovered from a chromosoine 14 specific cosmid library. Seven of these hybridized to a

poly-dCdA probe. and positive subclonrs were isolated for fivr of these. Among these.

one was apparently highly reamnged and another did not yield readable sequence

tliinking the CA repeat. These were not studied further. The clone cos7.1- i contained an

(AC) 1 - repeat. cos 1 1.1 - 1 containrd a (CA)dAA(CA)3G(AC)g element and cos3.5- 17

TCA3 GATC

TCA11 C T A G

Figure 4-1. Sequences of [GHV CA repeats. A: The (CA)JGA(CA)~GA(CA) 13

repeat of TCA3. B: The t AC) 12 repeüt of TCA7. C: The ( C A ) J A A ( C A ) ~ G ( A C ) ~

repeat of TCA 1 I . Bases are s h o w above the lanes.

Figure 4-2. Sarnples of CA repeat amplifications from CEPH individuals.

Genotypes of markers are shown beneath each individual. Allrle numbers are indicated

to the right. Genotypes for a11 CEPH individuals typed are given in Appendix A. Family

rnembers 1329 1- 1. -3 iind -9 failed to yield detectable PCR products.

marker allele size freauencv n heterozv~ositv

TCA 1 1

Table 4-1. .411ele frequencies and sizes of microsatellite markers. Allele sizes of

TCA7 are given for the 393/502 primer pair. n: number of chromosomes typed. CEPH

individuals ~ised as rekrence standards: TCA7: 2-0 1. 4 5 ; 3-02. 23: 1332-01, 1/5.

TCA 1 1 : 1332- 14. 3 5 ; l3U- 13.5/8: 1 333- 1 1 . 819. Markers have been assigned GDB

identities G00-652-4 16, D 14s 14 19 (TCA7) and G00-682-4 12. D 14s 1420 (TCA 1 1 ).

TCA7 TCAll D14S826 haplotype allele allele allele

1 3 B

3 - 3 G

9 - 5 H

3 1 K

3 3 2 L

3 5 L M

3 9 3 o r 5 O, 03 .05

4 3 Q

4 5 3 R

4 9 1 .30r5 T, T 1. T2, TS

5 3 - 7 v 5 5 I , 2 , 4 o r 5 W, WI , W2. W4, W5

5 8 X

5 9 -1.3 or 5 Y. Y-1. Y3. Y5

Table 4-2. Haplotypes of IGH CA repeat polymorphisms observed in CEPH

families. Haplotypes for CEPH individuals are given in Appendix B. Haplotypes are

named in alphabetical order according to the 25 possible combinations of TCA7 and

TCA 1 1 alleles. The D llS826 allele number was apprnded when necessary. to

distinguish otherwise identical haplotypes within a family . Only haplotypes observed in

unrelated CEPH grandparents or parents are Iisted. Haplotypes were numerically coded

within each farnily to minimize the number of alleles in the linkage analysis (Appendix

C). Observed heterozygosity of the basic haplotype was 0.78 (n = 105 individuals): when

D 14SS26 was included the heterozygosity increased to 0.9 1 (n = 44).

contained a (CA ) 3GA(CA)3GA(CA) 1 3 element (Figure 3- 1 ). These were tes ted in eight

unrelated individuals. Four allelrs of the cos% 1 - 1 repeat (TCA7). three alleles of the

cos 1 1 . 1 - 1 repeat (TCA 1 1 ). but only one nllele of the cos3.5- 12 repeat (TCA3) were

detectrd. The 40 CEPH families were therefore genotyped only with TCA7 and TCX 1 1 .

1 obsrrved n total of tive alleles for ecich. Allele frequencies and obsei-ved

heterozygosities from CEPH parents are s h o w in Table 4- 1. Enamples of CA repetit

amplifications are s h o w in Figure 4-7. Genotypes for CEPH individuals are given in

Appendix A.

4.3.b Analysis and physical mapping of CA repeat clones at the telomere of 1Jq

VH segments cloned from cos7.1- 1 and cos 1 1. I - 1 were compared to known

sequences frorn IGH. contained in the V-base database (LM Tomlinson. unpublished).

Cosï. 1 - 1 sequence was identical over 740 bp to the VH4 segment 4-59 ialso called DP-

7 1 ) in a11 seven clones. excrpt for the single C residue at nucleotide 4 1. which wns

missing in every clone. The nexr most clossly related sequence. 4-6 1. had an additional

5 mismatches. a 1 base insertion and a 7 base drletion in the samr 740 bp. Cos 1 1 . 1 - 1

srqurnce was identiccil. over 277 bp. to VH I gene segment 1-69 ( nlso called DP- 1 O). with

the exception of three nuclrotides that gave ambipous rçsults for al1 s rv rn clones.

Alipnent to other. closely relater! VY 1 segments revealed numerous mismatches.

insertions and deletioiis. The orientation of these sequences is ( 14qter) - 150kb - ( 1-69) -

70 kb - (4-59) - 880 kb - (IGH constant region) (Cook er (11. 1994).

TCA7 was amplifieci frorn yRM3006. but not from B 14. suggesting thrit it is in

the proximal portion of yRiM2006. between 95 and 2 10 kb frorn the telomere. The

further localization of TCA7 to the most proximal segment of yRM2006 can be inferred

frorn the presence of VH segment 4-59 on the cosmid from which TCA7 was cloned:

previous work rnapped 4-59 just centsomeric to the end of yRM2006 (Cook et a/ . 1994).

TCAl 1 w;is arnplified frorn both YACs. Iocalizing it to the distül 95 kb of 1lq thrit thrsr

Figure 1-3. Deletion mapping of IGH CA repeats. Lslt panel. TCA 1 1. Right panel.

TCA7. Families are identified with numbers. Allele numbers are indicated to the right.

In each case the child ca rq ing an unbnlünced deletion of chromosome 14 is indicated

with a filled symbol. and failed to inhrrit an allele from one parent. mouse: rnurine

myeloma DNA WEHI-TG. parental line for liybrid WEGROTH-B3. IUmouse: sornatic

ceIl hybrid WEGROTH-B3. containing only human chromosome 14 (Guerts van Kessel

et cd.. 1983).

YACs share (see Figure 3-6). This agrees with physicül müpping of VH sesment 1-69.

which is present in the cosmid from whic h TCA 1 1 was cloned (Cook et al. 1994). To

control for possible contamination of the YAC DNAs. I amplitïed the Y ACs with BA400.

VH2 prirnrrs and D I4S826. Only B 14 was positive for BX4OO. only yRiM2006 was

positive for VH?. but both were positive for DI4SS26. ris cxpected (sse Figure 3-9)-

As additional confirmation of their localization to 1 Jqter. 1 tested TCX7 and

K A 1 1 i n four nuclear hrnilies with children prwiously identified to have i delçtion of

one homologue of distal 14q (Benger et tri. 199 1 : Wang and Allanson. L992: Wintle rr < i l .

1995: Chapter 2 ) (Figure 4-3). TCA 1 1 was hemizygous in the genornes of three

individuals known to possess small. de riovo 14q terminal deletions (HSC 1658. HSC

98 1 and HSC 1363) . TCA7 was uninformative for these three Fimilies. but was

hemizy,oous in HSC 12 1. who carries ;i paternal deletion of 14q32.32-114qtrr. secondary

to an unbalanced translocation. Thesr results confirm that both CA repeats are Iocated

within distd 14q. and not in the clustrrs of V H segments round on chromosomes 15 and

16 (Wintle and Cos. 1994: ' laqoka et cil. 1994: Tomlinson et cil . 1994; Chapter 3 ).

4.3.c Linküge Analyses

Two-point linkrige cinalyses using haplotypes of TCA7. TC.4 1 1 and D 1 JSSIO.

and the 1GHC probe p24BRH (Bech-Hansen e f al. 1953; Johnson et cri. 1956), arcr

summarizrd in Table 4-3. Hnplotypes and their numerical coding are given in

Appendices B and C. resprstively. Families that were informative for the p24BRH

BstEII polymorphisni are stiown in Table 4-1. In four cases. a marker was reduced to

homozygosity (two for TCA7. one each for TCA 1 1 and D 14SS26). These wrre

presurnribly the result of tissue culture artifacts from the CEPH DNAs. In four crises,

there were apparent recombinants between D 143826 and TCA I 1; however. as there is no

marker distal to D14S826 thrse events could not be verified. There was one apparent

rccombinrint between TCA7 and TC.4 1 1. which also could be due to a reduction to

fernale 0.1 1 15.19 0.04 - 0.24

mde 0.04 15.19 0.C1 - 0.13

rive rriged 0.07 14.35 0.04 - 0.14

Table 4-3. Linkage results between p2lBRH BstEII and IGHV coded haplotypes.

Linkage anülysis was performed betwcen the IGH constant region (p24BRH BsrEII

polymorphism) and haplotypes of IGHV CA repeats. LOD scores for varying 8 values

were graphed and the 95% confidence interval (C.I.) for 0 estimated from the (Zmax-1 )

intercepts of the curve. Zfand Zm are fernale and male LOD scores. respectively.

m

family r

2 1 ...........................

33 ......................... "

35 ......................... -

45 ......................... "

66 ...........................

102 ...........................

133 1 ...........................

1333 ...........................

1341 ...........................

1345 ...........................

1347 ...........................

1350

TCA 1 L rneioses

notes:

no data for SS26 .............................................

no datri for S836 ............................................

no datri t'or SS26 .............................................

Pandit et d. 1 995 ............................................

no data for SS36 .............................................

no data for SS36 .............................................

no data for S826 .............................................

no datri for S S X -- - -- - -. - -

TOTALS

Table 4-4. CEPH farnilies informative for p24BRH. Families informative for the

p24BRH BsrEII polymorphism. D 14S816 wss typed for families uninformative for rithcr

TCA7 or TCA 1 1. rxcrpt wliere data already cxisted (Pandit cr trl. 1995). The numbsr of

informative ineioses reflects al1 meioses in a family for ivhich at least one of the three

inicrosatellite m<irkers wüs intormatiw. O: frimily informative. m: male. f: fernale. P:

paternal. hl: maternai. KI: not informative.

homozygosity at TCA7. These observations are consistent with other studies of CA

repeats in the CEPH pedigrees (Weber and Wong. 1993). and did not hinder haplotype

identitication. To increase the number of inhimative meioses rivailable for evriluation. 1

perfomed a two-point analysis betwern telomeric haplotypes and IGHC. This y ielded a

sen-averqed recombination rate of emax = 0.07 with a maximal LOD score of 14.85.

over a physical distance of approximatsly 1.0 Mb. Fernale and male rates were 0.1 1 and

0.04 respectively. with a maximal LOD score of 15.19. Recombinants were confirmed

by exümination of proxirniil flan king markers from existing linkage maps (Cox rr al.

1995: Pandit et ai. 1995 1. where possible. I obsenled a significant devirition irom

expected frrquencies for individunl haplotypes ( Appendix D ).

4.3.d Re-typing of known IGH recornhinant families

lt was not possible ro re-type the ftimily of HSC 12 1. as no DNA samples w r e

:ivailnble from the materna1 grandparents. and the recombination in HSC 12 1 is materna1

in origin.

G3m genotypes of the fiimily of HSC 694 agreed with those previously

estriblished through serological typing. The mother of HSC 694 was not informative for

TCA 1 1. TC47 and D 14SS76 phenotypes inclicntrd thiit n second recombinaiion event

had occurred distal to the one reported betwren G3m and G x / , ~ ~ (Figure 4-4 1. Thc

siinplest esplanation of this double recombinant was that the 6x1~~~1 polymorphisni.

originally scored as a 13/13 homozygoie. had bern mis-typed. Howrver. repeated trsting

rigreed with the original typing (Fisure 4-6). [t appears that there are two recornbination

rvents on this chromosornr. one between the G3m polymorphism of the '13 gene segment

and the 6xbtr1 polymorphism. and one in the interval brtween the 6Lyb,i~ polymorphism

and TCA7 ( Figure 4-6 ).

The fathsr of HSC 674 was not informative for the telomeric tnarkers TCA7.

TCA 1 1 or D 14S826. The recombinant individual. HSC 674, was heterozygous

Figure 4-4. Known IGH recombinant families. Family of HSC 674. Markers are

listed in order from centromere (top) to telomere (bottom). y 1 : G 1 m serological typing.

y3: G3m scrological typing. confirmed by G3m PCR. O: confirmed by hybridization.

A: orisjnaily serologically typed as b/b. 6Tcrql: polyrnorphism of the lGHD sesrnent

( Benger el ( i l . 199 1 ).

f

b R

13 0

2 . 4 1 R

7

7

3

mat

Figure 4-4 (continued). Known IGH recombinant families. Family of HSC 694.

Markers rire listed in ordcr from centromere (top) to telomere (bottom). -11: G ln1

serologicül typing. y3: G3m serologicül iypins. : confirmed by G3m PCR. O:

confirmed by hybridizütion. mat: maternai chromosome. R: recombinaiion evcnt.

8 ~ ~ ~ ~ ~ 1 : polymorphisni of the IGHD segment (Benger et r d . 199 1).

1 2-7 I

mat

1 TCAll

a

9 ' 17

2.4

2.2

3 ) (phase not determined)

Figure 4-4 (continued). Known IGH recombinant families. Farnily of HSC 12 1.

Markers ore listed in order from centromere (top) to telomere (bottom). yl: G lm

serological typing. '/3: G3m serological typing. : polymorphism of the IGHM

srgmcnt. O: cont'irmed by G3m PCR. mat: materna1 chromosome. R: recombination

event.

Figure 4-5. G3m re-typing by PCR of IGH recombinant families. DNA sample

nurnbsrs of individuals typcd are shown above the lanes. SucII fragments of the PCR

product corresponding to the b and g iilleles of G3m are indicatcci to the left. Sizrs are

~ i v e n in base pairs. A: sslscted individuals from families of HSC 696 and HSC 674. B: - family of HSC 12 1.

Figure 4-6. Fxbal polymorphism re-typed on IGH recombinant families. X l m l

digests of genotnic DNA. hybridizrd witli pCW 10 1 probe. The 13 kb and 17 kb idleles

of the 6,y/J<i1 polymorphism are indicnted to the right.

(genotype 13/17) for the G x h n ~ RFLP. confirrning the previous result (Figure 4-41.

However. this individual wris clearly heterozygous for the G3m marker (genotype b/g).

contriidicting the previous result (Figure 4-51. The new genotype eliminatrs the

recombination event betwrrn the G3m pclymorphism of the 73 pcne segment and the

6/yba[ pol y morphism previously observed on this chromosome i Figure 4-4 1. A

recombination event betwsen y1 and y3 is still still possible. but thrre is no reliablr PCR

assay for alleles of the G 1 ni polymorphism. and I was therefore unable to re-type G 1 m.

G3m and &ho[ grnotypes were confirmed for the three sibs of HSC 674.

4.4 DISCUSSION

4.4.a Increased recom bination near l-iqter

It has been widely observed thiit recombination is elevated near the telorneres of

human chromosornea. The possibility that increased recombination in subtelomeric DNA

is due to localized recombinntion hotspots hns been s u p p t e d t Blouin et cri. 1995 1.

Within IGH. a rq ion of reduced association was prsviously identiîïird between the 6

(IGHD) and 73 (IGHG3) genes of the constant region (Brnzer and Cox. 1989).

Subsequently, this was identifieci as a hotspot throush the observation of three

recombinants between polymorphisrns separated by only 60 kb (Benger et cri. 9 1 . A

sccond iirea of reducrd association had also bern described within IGHV. approximatsly

800 kb from the telomere (Walter and Cox. 199 1 ). 1 performed linkage analyses with

markrrs thüt fhnk thrse regions of reduced association. the IGHV haplotypes to the

telomeric side and the p24BRH BsrEiI polymorphism to the centromeric side. 1 wiis

limited to the use of this latter two allele RFLP due to the lack of more polymorphic

markcrs that are locûlized proximal to IGH. A large. unclonable Sap separates IGH froni

niore crntrornrric markers that have bcrn placed on a YAC contig thnt starta at the PI

locus at 1 4qX. 1. and extends approximatsly 5 Mb t o w r d s the trlomcre ( D.W. Cox.

unpublished results). This gap is due at least in part to a region of 20 bp tandem repents

that are iocated immediately proximal to IGH, and are refractory to cloning in phage.

cosmids or YACs (Kang and Cox. 1996). Numerous individuals in this laboratory and

rlse where have attempted to isolate highl y polymorphic microsatellite m u k m from the

proximal wgion of [CH. with no succsss. Nevertheless. 1 observed increrised

recombination within IGH that is consistent with the presence of recombination hotspots.

Recently. increased malci recombinütion was reponsd near 14qter ( Pandit et c d . .

1995). In that study. only male reconibination was obserlird betwsen D l l S S 2 6 and the

next proximal marker. D I-IS543. Howriw. D 14S543 was on1 y rnappetl by linkiigr

rinalysis. and its physical lociition reniains unknown. M y study drtected femüle

recombinations in the distril part of 14q. within the Iast 1.0 bIb of the chromosome.

Possibly. the region anlilyzed by Pandit rr al. could be rnuch larser, rxtending several Mb

towürd the centromers. The possibility thiit male recornbination is more frequent

proxinial tu IGH. and was tlierefore not detected by my linkage analyses. cannot br nilcd

out. The fernale events I obsewed were not detectt-d in the analysis of Pandit et l r [ . . sithsr

due to different families bring informative. or to double recombinations betwcen

D l l S543 and D 14SS76. wtiich could occur in this region. whcre recombination is

frequent.

4.4.b The recombiiiation hotspot within the IGH constant region

The existence of a hot spot for recombiniition within the constant region of IGH

wlis first established witli RFLPs and srrologicai typing of iillotyprs of the y gene

1 segments (Gm typins). My

recombination within IGH.

the three families previously

inkage data supports the existence of a hot spot for

1 tested telomeric markers TCA7. TCA 1 1 and D 14S826 on

reported to have recornbinations within IGH (Benger et c d .

199 11. The presence of a recornbination event on the rnaternal chromosome of HSC 12 1

could not be verifizd. as pndpnrental DNA samples were no longer available. A

recombination event was verified on the materna1 chromosome of HSC 694.

Unexpsctedly, o second recornbination event was identified. distal to the 6xljn~

polymorphism. The possibility remains thrit loss of one ailele at this polymorphism has

resultcd in the scoring of HSC 694 as ri 13/13 homozygote. I f the truc genotype were

Wf 7. nrither recornbination event would rsist. However. it seerns unliksly that a

deletion of this locus is the reason. as DNA from peripheral blood leukocytes was usrd.

The percentage of crlls having undergone delrtion of this locus due to isotype switching

is rxpected to be very low. More likely. tliis represents a true double recombinant. an

svent that might be expected to occur ocçasionally in a region with a high recornbination

frequencp.

The recombinütion event originally observed on the paternal chromosome of HSC

674 appears to have been duc to the original mis-typing of this individual ns a G3m(b/b)

homozygote. Unfortunütely. it has not bren possible to dsvelop an accunite PCR

protocol for typing of the G 1 rn allotypes. f and z. which were aiso originally typed in this

individual. Without information from tliis or another mürker flankinz the recornbination

on the prosimal sidc. il renuins in doubt whether the recornbination rvent on this

clirornosome is true or not.

1.4.c CA repeat polymorphisms near llqter

1 established the accuratç physical placement of the novel CA repeat

polyniorphisins based on the detailed YXC contig map of the IGH region (Cook cr d.

1994). TCA 1 1 rnaps in the distal half of ttlomeric YAC yRiM1006. 1 çonsidcred the

possibility that it was identical to D 11S826. iinother CA repeat drrivec! from this region

(Pandit er al. 1995). This is not the case. as 1 ) D l 6 8 2 6 is reported to rnap 50-60 kb

from the telomeric end of the YAC. rather than 90 kb for TCA 1 1. 2) the srquence from

which TCA 1 1 is derived doçs not overlap witli that kom D 143826. and 3) CEPH

genotypes do not correspond for the two markers.

Increased recombination near the I4q telornere was originally proposed from

linkage data using VNTR polyrnorphisms. A higher rate in males than in fernales was

initially observed iii distrl 14q (Nakamura rr ni. 1989). Subsequent linkape maps have

suggested that this may not be the case. as alternate marker orders were reported in

subsequent studies (Cox r f tri. 1995: Buetow et ai. 1994: NIHICEPH Collaborative

Mapping Group. 1993). Further. physicnl mappins reveüled that the apparent locations of

some of thé VNTRs os determined by linkage analysis were not accurate ( Wintle er ul.

1995; Chapter 2). VNTRs can bs also be unreliable d~ ie to allele Ioss in cultured cells. or

to extreme variability in cillele sizes tlint results in smüll aIlelss not beins detccted (Flint

et 1 . 1 With the isolation of these CA repeats. I was able to examine recombination

in a well drfined subtelorneric region for which a complete physicril map sxists. By

haplotypinp rhree markers. I could use as rnany mriosrs as possible. and idrntify

oenotype srrors of individual markers. 1 observed higher îëmale recombination than C

male, which has not been the trend in linkage analyses of human subtelorneric resions

(Blouin cr al. 1995: Rouyrr et cil. 1990). Xlthough confidence intervals for niaie and

fernale rates overlap (Table 4-31 and chue is no statistical support for differing male iind

fernale ratcs (Appendix D). It is howsvsr unlikrly that the male rate is higher than

fernale. as has bsen obssrwd in othrr wbtelorneric regions. Seqcence from VH se, ~men t s

present on cosmids containing CA repars. as well ils detailed physical n~i ips of the

telomsriç YACs. allowsd nie to position these mürkrrs accunitrly on the physiciil rniip.

prior to performine linkage nnalysis. 'luclrase B d 3 1 digestion of _ornomic DNA showrd

that thesr markers ;ire truly near the l-lq rtilonirre. The telomsric CA LePrlits. a n d the

highly polymorphic system formed by haplotypes with D 14S826. are valuable rragents

for genome scans. definition of terminal deletions of l l q (Wintle er cil. 1995: Chapter 2).

or the detection of cryptic cliromosomal abnormalities (Wilkie. 1993: Flint er al. 1995).

CHAPTER 5.

SUNI!W4RY AND FUTURE DIRECTIONS

5.1 THESIS SUNINIARY

5.1.a. Genetic rnarkers distal to IGH actually map in proximal locations.

Three patients with naturally occurring deletions of distal I4q were iinalyzrd. in

order to use the deleted chromosomes to map rnarkers near 14qter. Markers D 14S20 and

D lrlS23 were unarnbiguously located proximal to IGH, contradicting their locations in

some linkoge maps. Possibly. D 14S20 and D 14S23 map within a large unclonable gap

located just proximal to IGH. These markers were therefore not pursued further for

mapping the region adjacent to the telomere at 14qter.

5.l.b. The IGH gene cluster is located imrnediately adjacent to the

telornere at 1Jqter.

Sornatic hybrid ce11 lines were used to locate almost al1 previously unmapped VH

segments to loci on chromosomes 15 iind 16. These segments had previously been

assumai to lie distal to the cstablished physical rnap of IGH. Two telomeric YACs were

then usrd to derive an accurate restriction rnap of the subtelomeric region of 1 -lq, and ro

dernonsuüte that a VH segment at the 5' end of IGH w u immediately adjacent to the

apparent location of the telomere. Nuclease Ba13 1 digestion of genornic DNA was then

used to demonstrate that this VH segment. 4-80, is located within 25 kb of the telomere on

chroniosomes [rom periphernl blood Irukocytes.

l c A highly polymorphic systern of two haplotyped CA repeats is

located near 14qter.

CA repeüts TCA7 and TCAI1 were cloned from a chromosome 14 cosmid library

and mapped within the distül region of IGH. The physical maps of the telomeric YACs

wrre used to place TCA7 and TCA 1 1 tipproximately 90 kb and 200 kb from the telomere.

These repeats were typed in 40 large. predominantly three-generrition pedigrees (Appendix

A). The resulting haplotyped system is highly informative, particularly so when combined

with a third. existing marker (D14S826) ('4ppendices B and C).

1 Recombination is elevated near the telomere at 14qter.

Genetic linkage ünalysis was perforrned with the telomeric hüplotypss and an

sxisting marker within the constant reeion of IGH. approximately 1 Mb from the haplotype

system. Increased recombination. relative to the average for the genome. was o b s e ~ e d .

iMale reccmbination did not ~ I P C ~ I to be in rvcrss of fernale. indicating thnt the 14q

subtelomeric region differs lrom others previously studied.

5.2 FUTURE DIRECTIONS

1 showed that the telomere of 1 Jq. previously thought to lie at least several million

base pairs distal to the imm~mo;lobuIin heavy chain gene cluster. is in fact located

irnmediately adjacent to the 5' end of this cluster. A VH4 segment. 4-80. is located

approximately 25 kb from the q terminus of chromosome 14 from penphrral blood

leukocytes. As this segment has not bren sequenced. it is not possible to tell if it is a

funciional VH segment. Attçmpts by myself and others to clone this VH4 segment have

failed. probably because the PCR primers used. although dçsigned to ampli- dl V H 4

segments. do not hybndize to 4-80. The resolution of this question may have to await the

complete sequencing of IGH. Gcnomic sequence from 4-80 will make it possible to

detemine if this segment. located only 75 kb frorn the telomere in peripheral blood

leukocytes. can be productively rearranged in B cells. and encode a functional antibody

heavy c h a h

Most physical maps of human subtelomeric regions have been constructed with the

aid of a probe that hybridizes to subtelomeric repeat DNA located immediately adjacent to

the teloxcre ili question. No subtelomeric DNA clones had previously been described at

IJqter, with the exception of one cosmid fragment thüt hybridized to 14qter in DNA from

sorne individurils (JJdo et d. 1993; J. IJdo. personai communication). I testd this

fragment. c8. la. on DNA from the two rnonochromosomal somütic hybrid ceIl Iines we

had available. There was no signal from either line. As this clone hybndizes to a wide

variety of human telorneres (Table 1- 1) . it was not possible to use it for PFGE mapping.

either with human jenornic DNA. or with DNA of hybrid lines containing chromosome 14

as weli as other human chromosomes.

I attempted to clone subtelorneric DNA sequencrs from the rrlomeric YXCs by n

variety of anchored PCR striitegies. Al1 attempts resulted in the cloning of subtelomeric

material from yeast chromosomes. A likely explmation is that the human telomere primer I

used nnneiiled to TTAGGG sequences present within sorne yeast subtrlomeric DNA

sequences. One possible alternative to anchcred PCR or conventional cloning from the

YACs is io constmct deletion derivatives of the telomeric YACs. by re-cloning total DNA

from the YAC clones into a telornsric YAC vector. Very shon clones coiild be grnercited.

using restriction enzymes thüt cut close to the telomere (lis in the restriction rnap of Figure

3-8). Such short YAC clones should transform yeast quite sfficiently and would be

relatively easy to recover. In the event that a shon enough clone were recovered (for

example, one cloned at the BssHII site approximately 1.5 kb fom the end of YAC

yRM2006). DNA sc-quencing from the vectoi- mm towards the telomere would reveal

telomere adjacent scquences.

RARE was rinother option for determining whether the ends of the telomeric YACs

were faithful representations of the telomere in genomic DNA. This proceduie relies on the

inaccessibility of artificially meihy lated DN A to a restriction endonuclease. and results in

the identification of a DNA fragment between two known sequences (Ferrin and Carnerini-

Otero. 1994). RARE does not rely on the presence of recognition sites for restriction

enzymes usually usrd for PFGE mapping, and is thus a useful alternative for rrgions that

are difficult to map by PFGE. This was attempted by H. Riethman for chromosome 14.

using the vector:insert junction fra,gnent from yRM2006. However, this probe (D 142 12)

identifies several loci in the genome. only one of which is on chromosome 14. and a

corresponding nurnbrr of RARE fragments (H. Riethman. personal communiçation). The

lack of m y single-copy probes within the VH region would sirnilady tend to hampcr effort';

at RARE cleavage m;ipping of the 14q telomere. although it could perhaps br atternpted

with the VH 1 f probe. which dctects only two loci that arc: located within the distal region of

IGH (Chaptrr 3 ). Rrcentl y. i t has been reponed that D 142 12 detects a 100 kb RARE

fragment. presumably from ii chi-ornosorne 14 somatic hybrid ce11 line i 'iationd Institutes

of Health and Institute of Molecular Medicine Collaboration. 1996). This observation

confirms my results that demonstrated that the 14q tzlornere is in tact located in the genome

at exactly the same position suggested by telomeric YACs B 14 and yRM2006.

The potential for the use of free or cxtended chromatin FISH mapping of the IGH

oene cluster has not been explored. Most genes in the 14q32.3 region have been cnidely V

müpped by FISH to metaphase chromosomes. but await finer physical mapping ac YAC

contigs are constructrd acmss this region. Higher ïcsolution FISH mapping with the

aforementioned techniques may prove to be an invaluüble aid in positioning genes near the

IGH sene cluster.

Tlic presencr on murine linkags maps of a locus for situs inversus. ir. and some

anonymous DNA markers. distal to IGH. is intriguing (de Meeus er trl. 1992: Kh;in el cil.

1994). The long arm of humm chromosome 14 is homologous to mouse chromosome 12

(Edwards et cd. 1995). My studies demonstrnted that the Ilq telomrre is irnrnediately

adjacent to IGH. precluding the location of any genes located distally. The possibility

remains that the iv locus is within a sniall region of mouse chromosome 12. distal to

murine I g I i . that is homologous to a different region of the human genome. The rrsolution

of this question will probably have to avait rhe cloning of the gene containing the iv

mutation.

The availability of g e d i n e sequences of ülrnost al1 VH segments aided in the

positioninc~ of the cosmids from which polymorphic CA repeats TCA7 and TCA I 1 were

subcloned. Eventudlp. the cornplete IGH locus will be sequenced. now that i t is cloned

into a contig of YACs. and rffons are undenvay to complete a cosmid contig 3s wrll. A

serious problern facing the cornplete sequencing of IGH is the presence of unclonable

regions within the constant region. At least two of these are due to arrays of 10 bp repeats.

located 3' of the a 1 and a2 gene sqments of the constant region (Kan: and Cox. 1996).

Some types of repetitive DNA are notoriously difficult to cione in YACs. Probably. these

and similar repeats are responsible for n gap between the [GH YAC contig and a l q e

contig that stms near the u 1 -antitrysin gene at 14q32.1. and extends approximately 5 .Mb

toward the telomere at 14qtrr. PFGE mapping has not yet been successful in bridging this

cap. RARE cleavage mappinp may prove to be a successful alternative. U

5.3 CONCLUSION: TELQMERES AND NIAPPING OF THE HUMAN

GENONIE

The unmbiguous location of a human telomere. relative to known markers thar arc

physically mapped. is not trivial. I t is necrssnry to prove. preferably by severnl methods.

that a cloned telomere is a t'ÿithful reprrsentation of the "true" situation in genomic DNA.

Only witli a well-chwacterized and accurately positioned telomere cm genetic maps of

subielomerk regions be constructeci with confidence. Often. linkage maps have bren used

to suggrst that incrcaïed reçombination occurs in certain intervals of the genome.

However. in many cases the markers used for these analyses were themselves first

positioned on these miips via multipoint linkage analysis. This lrads to a circular argument

about the presence or Iack of increased recombination at any particular location. Accurate

physicd mapping of markers used for these analyses is time-consuming and c m be

difficult; however. the results obtained can be treated with much more confidence than

those from maps consrnicted mainly from genetic data. Only with the unambiguous

location of al1 human telorneres. and the development of genetic markers close to them. can

genomr scans for disrase loci be perfonned with confidence of complete coverrige of the

genome.

APPENDIX A: Raw ~enotvpes of IGHV markers

CA repeat genotypes of individuals from the CEPH reference families. as read from polyacrylamide gels. are listed below. See Figure 4-2 for examples. Data follous CEPH database textout format. Columns represent ( frorn Ieft to right ):

1 ) Farnily number. Al1 individuals from a given family are grouped together. 2) DNA smple ID (an arbitras, reference ID number). 3) Individual number within family. Number 1 is always the father. 2 the mother. 4) Individual's male parent's number within family (O implies the individuai's parent was not studied. i.e. that the individuai is either a grandparent of a three-generation family. or a parent of a two-generation frirnily .) 5 ) Individual's fernale parent's number within family. 6) Sex ( l=rnale. 2=fernde). 7 ) Genotype of CA repeat. Alleies are sepiirateci by ri comma. Alleles are listeci in iiscending numerical order. and phase is not implied.

TCA I I

APPENDIX B: IGHV ~ ~ D I O ~ V D ~ S of TCA7 and TCAll

TCA7 allele TCA 1 1 aIIeIe D 1 JS826 allele haplotvpe

Allele freauencies for telomeric CA reaeat ~o~vrnor~hisms:

allele observed freauencv

1 1 O . 0048

2 7 o. 0333

3 27 O. 1286

4 39 O. 1857

5 l36 O . 6476

allele observed freauency

Observed heterozygosity: 53 / 105 = 0.50 Observed heterozygosity: 63 / 105 = 0.60

Hadotvpe freauencies from CEPH erand~arents or ~arents:

ha~lotvpe observed e x ~ e c t e d observed % expected 70

B 1 O. 1 0.5 0.1

G 6 1.0 2.8 O. 4

H 1 1.8 O S 0.9

K 2 0.2 0.9 0.1

L, 10 3 -7 4.8 1.8

M 1 0.9 0.5 3.3

O 14 15.7 6.7 7.5

Q 2 5.4 O. 9 2.6

R 10 10.1 4.8 4.8

T 27 22.6 12.8 10.8

V 9 18.8 4.3 8.9

bl 43 34.9 20.5 16.6

X 3 1.9 1.4 0.9

Y 81 79.0 38.6 37.6

Observed heterozygosity: 81- / !O5 = 0.78. Only haplotypes observed in unrelated individuals

t'rom the CEPH reference families are listcd.

Genotvpes ornitted durin haplotv~e construction:

phase problem

redundant

NG

NG

redundant

NG

NG

NG

NG: used i 4 13- 1.2 (parents) instead

NG

NG

redundant

redundant

NG: no srnotype was obtained for either TCA7. TCA 1 1. or both. Some individuals f ron~ the

CEPH refrrence families are related. and wsre therefore omitted during determination of allele

frequencies (mnrked "redundant" ). The parents of family 14 13 were usrd as no grandparental

sampirs were available. Femily 38 w3s omittrd rntirely from the analysis. as multiple

recombinations were observed in the children for a11 parental phases tested.

APPENDIX C: Numerical codiny of IGHV ha~ lo tv~es in CEPH families

family haplotypes numerical coding

G, O. Y* R

L. T. W. Y

L, T. W

TI.T2. W. Y

O, V. W. Y

T. W, Y

G. W, Y

T, V, W4. W5. Y3. YS. R

L, W. Y

L. V. W. Y. Q

L. O. V. W. Y

L, O.T, W. W5. Y

T, W, Y. 8

T. W. X, Y. G

o. T. Y , R. Q

O. T. W. Y. R

W, X. Y

O, T. W, Y- 1. Y3, R

O, T, W. X, Y3, Y5, R

L. W. Y3. YS

T. W. Y. Y3. Y5

G. T. V, W. Y. R

famil y haplotypes numerical coding

Haplotypes were assigned numerical values in order to minimize the number of alleles

required for the linkase iinalysis. The greatest possible nurnber of alleies is thus eight

( two each for four grandparents of a family). rather than the twenty-five thai would have

bcen required to uniquely identify each of the TCA7/TCA 1 1 hüplotyprs ( A through Y).

IGHV coded ha~iotvpe eenotvoes for CEPH individuals

Data format is as in Appendix A. and follows CEPH database textout format.

APPENDIX D: StatisticaI analvses

D.1 Signifiant difference between male and female recombination rates

The statistical test required to show chat two recombination rates are significantly

different from each other is a Likelihood Ratio Test (Ott. 1985). This test exploits the tàct

that the overdl confidence an estimate of recombination distance is closely related to the

maximal lod score corresponding to that estimate. To perforrn the likelihood ratio test.

Omar values were obtained for two rcrnarios: the first with linkage perfomed under a

model with varying sex difference. in which the male rate 8ma?i,m and the fernale rate

Omax,f are assumed to be different. The second model fixed male mid female

recombination rates ris equril. and yielded different Bmax and maximal Lod scores.

Terrns were defined as foIIows:

Zmm 1 is the maximal lod score corresponding to the maximal 0 values 8max,m and

Bmax,f from the varying sex difference mode1

ZmaK7 - is the maximal lod score correspondinj to Bmÿx for the sex-squül recombination

model

The likelihood ratio test was then performed to obtain a chi-squared statistic with one

degree of freedom:

For recombination betwren p24BRH and the IGHV haplotypes, the values for Zmax1 and

ZmU2 were 15.19 and 14.85. respectively (see Table 4-3). The value for X' was

calculated to be 1.56. which is not significant (p = 0.22) (Hollander and Wolfe, 1973).

If the male and fernale estimates are identicai, the maximal LOD scores for the sex-

equal and varying sex difference models will also be identical. It is apparent tiom equation

[ I l that in this case. the statistic assumes a value of zero. Conversely. the greater the

likelihood that a varying sex difference mode1 is supported. the greater the value of x'. and

the more statisticai support there is for iinequal male and krnaie recombination rates.

D.2 Deviations of haplotype frequencies from their expected values

In order to determine if haplotypes of TCA7 and TCAI 1 were pressnt in the

CEPH population at significantiy different frequencies than would be predicted by the allele

frequencies of the individual markers. a chi-squared test was used (McClave and Dietrich.

1985). The allrle frequencies reponed in Appendix B were used to cülculate the expectrd

frequency of each of the 25 possible haplotypes (A through Y), in the set of 2 10

chromosomes from 105 unrelated CEPH individuais. As the chi-squared test is only valid

for cells containing five or greater observations. al1 haplotypes with expected values of lrss

than tive were grouped into a category labelled "other". This was done without

considenng the observed values. Grouping the low-frequency haplotypes has the addrd

brnefit of reducing the number of degrces of freedorn in the linalysis.

Observed and expected values were as reported below:

ce11 (il ha~lotvpe observed e x ~ e c t e d ~ a i r w i s e x2 o-value

1 M 1 6.9 5 .O4 < 0.025

3 - O 14 15.7 0.05

3 Q - 3 5.4 2.14

4 R 10 10.0 O

5 T 27 23.6 0.86

6 V 9 18.S 5.1 1

7 W 33 35.0 1.53

S Y 8 1 79 .O 0.05

9 17 otl-iers 23 16.6 2.47

For the entire data set. a chi-squared test was then performed with k- 1 degrees of freedorn.

where k is the number of cells (in this case. 9. so there were 8 drgrees of freedom). The

chi-squared statistic was obtained with equation [ 3 ] :

where: oi is the observed number of haplotypes for crll i. and

ei is the calculated sxpected number of haplotypes for ceIl i.

In this case. X- = 17.68. significünt for 8 degrers of freedorn. with p - 0.024, indicating

that there is o significant deviation of observed haplotype frequencies from expected.

REFERENCES

Adam RD. Nash TE and Wellerns TE ( 199 1 ) Telomeric location of Ginrdio rDNA senes.

Mol Ce21 Bi01 1 l:3326-3330

Allen KM and Walsh C ( 1996) S haking dow n new epilepsy genes. k f w r i\.lrdicinr

2(5):5 16-5 L 8

Allshire RC, Gosden JR. Cross SH, Cranston G. Rout D, Sugawara N. Szostak JW.

Fantes PA and Hastie ND ( 1988) Telomeric repeat from T. thennophiln cross hybridizes

with human telorneres. Nature 332:656-659

Allshire RC. Dempster M and Hastie ND ( 1989) Human telorneres contain at 1rast three

types of G-rich repeat distributed non-randornly. N l ~ l Acids Res 17% 1 1-4627

Allsopp RC. Vaziri H, Patterson C. Goldstein S. Younglai EV. Futcher AB. Greider CW

and Hürley CB ( 1992) Telomere Iength predicts replicative capacity of human fibroblasts.

Proc Nat1 Acad Sci USA 89: 10 1 13- 10 1 1 S

Altherr MR, Smith B. MacDonald ME. Hall L and Wasmuth JJ ( 1989) Isolation of a novel

mildly repetitive DNA sequence that is predominantly located at the terminus of the shon

arm of chromosome 4 near the Huntingon disease gene. Genornics 5 5 8 1-588

Altschul SF. Gish W. Miller W. Myers EW and Lipman DJ (1990) Basic local di, unment

searc h tool. J Mol Biol215:403-4 10

AsNey T and Ward DC ( 1993) A "hot spot" of recombination coincides with an interstitial

telomeric sequence in the Amienian hamster. Cytogener Ceil Genet 62: 169- 17 1

Ashley T, Lieman J and Ward DC (1995) Multicolor FISH with a telomere repeat and Sq

sequences shows that S u ISex reversril) in the mouse is a new type of chromosome

remangement. Cytogenet Cell Grwi 7 1 2 17-223

Bates GP, MacDonald ME. Baxendale S. Sedlacek 2. Youngman S. Romano D. Whaley

WL. Allitto BA. Poustka A. Gusella IF and Lehrach H ( 1990) A yeast arti ficial

chromosome telomere clone spanning a possible location of the Huntington disease gene.

Airi J H~iirz Genet 46:762-775

Bech-Hansen NT. Linsley PS and Cox DW ( 1983) Restriction fragment Irngth

polymorphisms associated with immunoglobulin Cy genes reveal linkage disequilibrium

and genomic organization. Pmc N d Acnd Sci USA 805952-6956

Benger JC and Cox DW ( 1989) Polymorphisrns of the immunoglobulin heavy-chain delta

gene and association with other constant-region genes. Alil J Huru Genet 45606-6 14

Benger JC. Teshima 1. Walter MA. Bnibacher MG. Daouk GH and Cox DW ( 199 1 )

Localizütion and genetic linkage of the human immunoglobulin heavy chain genes and the

creatine kinase brain (CKB) gene: identification of a hot spot for recombination. Geiiuiriics

9:6 14-622

Bengtsson U, Altherr MR, Wasmuth JJ and Winokur ST (1994) High resolution

fluorescence in situ hybridization to linearly extended DNA visually maps a tandem repeat

associated with facioscripulohumer;i1 rnuscular dystrophy immediately adjacent to the

telomere of Iq. Hiun Molrc Genet 3: 180 1 - 1805

Berman JE, ~Mellis SJ. Pollock R. Smith CL. Suh H. Heinke B. Kowal C. Surti U. Chess

L. Cantor CR and Alt FW ( 1988) Content and orgmizatian of the humün tg VH locus:

definition of three new VH tirnilies and linkage to the tg CH locus. EMBO J 71727-738

Bertoni L, Attolini C. Tessera L, Mucciolo E and Giulotto E ( 1994) TeIomeric and

nontelomeric (1TAGGG)* sequences in gene amplification and chromosome stability .

Gerro~?tics 2453-62

Billingslry GD, Walter MA. Hammond GL and Cox DW ( 1993) Physical rnapping of four

serpin genes: cx 1 -antitrypsin. u 1 -antichymotrypsin. corticosteroid-binding globulin. and

protein C inhibitor. within a 280-kb region on chromosomr 1 JqX. 1 . Airi J Hriin Geiwr

52:343-353

Blouin J-L. Christie DH. Gos A. Lynn A. -Morris MA. Ledbetter DH. Chakravarti A and

Antonarakis SE ( 1995) A new dinucleotidr repeat polymorphism at the telomere of

chromosome 2 lq reveals a significant difference between male and female rates of

recombinrition. Am J Htim Genet 57:355-394

Broccoli D. Miller OJ -and Miller DA ( 1992) Isolation and chwacterization of a mouse

subtelomeric sequence. Cltrornosonrrr 101:W247

Brooks-Wilson AR, Goodfellow PN. Povey S, Nevanlinna HA, de Jong PJ and

Goodfellow PJ ( 1990) Rapid cloning and characterization of new chroiiiosome 10 DNA

markers by Ahr element-mediated PCR. Genomics 7514-620

Brown WRA ( 1988) A physical rnap of the human pseudoautosomal region. EMBO J

7:2377-2385

Brown WRA ( 1989) Molrcular cloning of hunian telorneres in yeüst. ~ V ~ l i t - r 338:774-776

Brown WRA. ~MacKinnon PJ. Villasanté A. Spurr N, Buckie VJ and Dobson iMJ (1990)

Structure and polymorphism of humm telomere-nssociated DNA. C d 63: 1 13- 131

Browne DL and Litt M ( 1992) Characterization of (CA)* microsatellites ~ ~ i t h degenerate

sequencing primers. Nicl Acids Res 20: 14 1 - 140

Browne DL. Smith E.4, Dietz-Band J. Riethmann HC, Phromchotikul T and Litt !vI ( 1995)

Dinuclrotide repeat polymorphism at the human chromosome 1 i p telomere (D 1 15207 1 1.

Grrlnnzics 35:600-60 1

Bryan TM. Englezou A. Gupta J. Bacchetti S and Reddrl RR ( 1995) Telomrrr elongation

in imrnonal human cells without detectüble telornerase activity. EMBO J 1J:J210-4248

Buetow KH. Weber JL. Ludwigsen S. Scherpbier-Heddema T. Duyk GM. Sheffield VC.

Wang Z and Murray JC ( 1994) Integrated human genome-wide maps constructed usinz the

CEPH reference panel. ~ V m r r e Genet 6:39 1-393

Buluwela L. Albertson DG. Shemngton P. Rabbitts PH. Spurr N and Rabbitts TH ( 1988)

The use of chromosomal translocations to study human immunoglobulin gene orgmization:

rnapping DH segments within 35 kb of the Cp gene and identification of a new DH locus.

EMBO J 7:SOO3-?O 10

Burmeister M. Kim S. Price ER. de Lange T. Tantravahi Li. Myers Rh4 and Cux DR

( 199 1 1 A map of the dista! region of the long ;um of human chrornosornr 2 1 constmcted by

radiation hybnd mapping and pulsed-field gel slectrophoresis. Geriomics 9: 19-30

Butler DK ( 1992) Ribosomai DNA is a site of chromosome breakage in aneuploid strriins

of Neurospora. Geiietics 131:58 1-592

Byth BC and Cox DW ( 1993) A (CA)n repeat at the 5' end of the al-antitrvpsin gene.

Hrm ItIolec Genet 2: 1752- 1750

Callen DF. Eyre HJ. Ringenbergs ML. Freemantle CJ, Woodrofft: P and Ham EA ( 199 1)

Chroinosomal origin of smüll ring marker chromosomes in man: characterization by

molecular genetics. .41tr J Hirm Gerzrr 48:769-782

Cangiano G and La Volpe A ( 1993) Repetitive DNA sequences located in the terminal

ponion of the Caertorlzabriitis rlegcins chromosomes. N~ic l Acids Res 21: 1 133- 1 139

Cheng J-F. Smith CL and Cantor CR ( 1989) Isolation and characterization of a human

telomere. iVricl Acitls Res 175 109-6 127

Cheng J-F. Smith CL and Cantor CR ( 199 1 ) Structural and transcriptional analysis of a

hiiman su bteiomeric repeat. Nucl Acids Xes 19: 149- 153

Cherif D and Berger R ( 1990) New localizations of VH sequences by in sitri hybridization

with biotinylated probes. Genrs. Cliro~n Cmcrr 2: 103- 108

Chong L. van Steensel B, Broccoli D. Erdjument-Bromage H, Hanish J, Tempst P and de

Lange T ( 1995) A human telomeric protein. Nat~îm 270: 1663- 1667

Chuns JH. Siebenlist U. Morton CC and Ledsr P ( 1984) Mapping and charactctrization of a

transposed human irnmunoglobulin D gene segment. Frd Proc 43: 1486- 1480

Church GM and Gilbert W ( 1984) Genomic sequencing. Proc N d Accid Sci USA

81:1991-1995

Collins A. Forabosco P. Lawrence S and .Morton NE ( 1995) An integrated map of

chromosome 9. Arw Hrrrn Genet 59393-402

Cook GP and Tomlinson IM ( 1995) The human immunoglobulin VH repenoire. I r r z ~ ~ z .

Tud~iji 16:237-342.

Cook GP. Tomlinson IM. Walter G. Riethman H. Carter NP. Buluwela L. Winter G and

Rabbitts TH ( 1994) A rnap of the human immunoglobulin VH locus completed by analysis

of the telomeric region of chromosome l-lq. N m t m Genet 7: 162-168

Cooke HJ. Brown WRA and Rappold GA ( 1985) Hypervaritible telomeric sequences from

the human sex chromosomtts are pseudoautosornal. Nlrfiu-r 317:687-692

Counter CM. Avilion 4A. LrFeuvre CE. Stewart NG. Greider CW. Harley CB and

Bacchetti S ( 1992) Telornere shortening associated with chromosome instability is arrested

in imrnortal cells which express telornerase activity. EMBO / 11: 192 1 - 1929

Cox DW. Markovic VD and Teshima IE ( 198%) Genes for immunoglobulin heavy chains

and for u I-antitrypsin are localized to specific regions of chromosome 14q. N l l f w e

297:425-430

Cox DW. Smyth S and Billingsley G ( 1982b) Three new rare variants of ul-üntitrypsin.

Hirrn Genet 61: 123- 126

Cox DW. Woo SLC and Mansfield T ( 1985) DNA restriction fragments associated with

alpha I -antitrypsin indicüte a single ongin for deficiency nllele PI Z. Nat~tre (Londurl)

316:79-8 1

Cox DW. Nakamura Y and Gedde-Dahl T. Jr. ( 199 1 ) Report of the cornmittee on the

genetic constitution of chromosome 14. Humnn Gene Mapping 1 1 ( 199 1 ). Cgngenrr Ce11

Genet 58:605-623

Cox DW. Billingsley G and Nguyen VTT (1994) A linkage map of hiiman chromosome

14, including 13 gene loci. Gerrornics 23:330-337

Cox DW. Billingsley GD. Bale AE. Coopentive Humm Linkage Center . Donis-Keller H,

Edwards JH. Litt M. ,McBride W. Persichctti F. Spurr NK. Weber IL. Weissenbüch J and

White RL ( 1993) CEPH consortium map of cliromosom<: 13. Qrotqoiet CeIl Gemr

69: 175- 178

Cross S . Lindsey J, Fantes J. McKay S. KcGill N and Cooke H ( 199 1 ) The structure of a

su bterminal repeated sequence presen t on many hurnan chromosomes. Nricl Acids Rrs

18:6649-6657

Cross SH. Allshire RC. McKay SJ. McGiIl NI and Cooke HJ ( 1989) Cloning of humün

telorneres by cornplementation in yrast. Nc~ttrre 338:77 1-774

Dana S and Wasrnuth JJ ( 1982) Linkage of the leuS. errirl'. and chi- genes on chromosomr

5 in humans and expression of human senes rncoding protein synthetic components in

human-Chinese hamster hybrids. So,?l~ir Ce11 Gerret 8245-264

Daniel A ( i 985) The Y ize of prometaphase chromosome segments. Clin Grriel 28:2 16-224

de Bruin D. Lanzer NI and Ravetch JV ( 1992) Characterization of yçast artificiiil

chromosomes from Plc~si~iotii~ci~ifiilcipcinun: construction of a stable, representativr library

and cloning of telomeric DNA fragments. Genornics 14:332-339

de Bniin D. Lanzer M and Ravetch JV ( 1994) The polymorphic subtelomeric regions of

Pl~rsrrrodiirin ji.dcipci~-~~~n chromosomes çontain arrays of repetitive sequence elr mrnts. Proc

Nari Accrcl Sci USA 9 1 :6 19-633

de Lange T. Shiue L. .Myers RM. Cox DR. Naylor SL. Killery AM and Varnius HE

( 1990) Stnici~ire and vüriability of humün chromosome ends. Mol Cd1 Biof 105 18-527

de L a q r T ( 1992) Humün telorneres are üttached to the nuclear matrix. ElCIBO J

11(2):7 17-724

de Meeus A. Alonso S. Demaille J and Bouvrignet P ( 1992) A detailed linkage map of

subtelorneric rnurine chromosome 12 region including the situs inversus mutation locus IV.

Mmirrrui Gerrolrre 3:637-643

Dietz-Band J. Ferneyhough DG. Rabinovich N. Airhart S. Shook D. Kvaloy K. Riethmon

H, Ledbetter D and George J ( 1993) Chromosome-specific telomeric probes for clinical

applications and cytosenetic rnapping utilizing tluorescencr N i sitri hybridization (FISHI.

.41n J H~otr Grrirt 53 suppl.:Aj-ll

Diffley JFX ( 1992) Global regdators of chromosome function in yeast. Aritoriir ~~m

Leerrriw/ioek 6 2 3 - 3 3

Edwards JH. Cox DW and Craig SP ( 1995) Report of the second international workshop

on human chromosome 14 niapping 1994. Cj*iogrrzet Ceil Grirrr 69: 159- 1 74

Eicher EM. Lee BK. Washburn LL. Hale DW and King TR (1992) Telomere-relritcd

markers for the pseudoautosomlil rqion of the mouse genoms. Proc N d Ac-clcl Sci USA

89:2 160-2 164

Elliot RW and Pazik 1 ( 1996) An interstitial tciomere array ncar H l h on mouse chr I 1 is a

candidate for the homolog of the telomere at human 16p. Gatoniics 2 7 2 17-2 18

Elliott RW and Yen C-H ( 199 1 ) DBA variants with telornere probe enable geeneetic mapping

of ends of mouse chromosomes. iVImi111~d Grliume 1: 1 18- 132

Erikson J. Finian J. Nowell PC and Croce CM (1982) Translocation of immunoglobufin

VH genes in Burkitt Iymphoma. Proc I V ~ Accrd Sci USA 7956 1 1-56 15

Fang G and Cech TR ( 199 1 ) Molecuiar cloning of telomere-binding protein geries from

Shlorzychia rnyilis. Nucl Acids Res 1955 15-55 18

Feng J, Funk WD, Wang S-S. Weinrich SL. Avilion AA. Chiu C-P. Adams RR. Chang

E, Allsopp RC, Yu J. Le S, West MD. Harley CB. Andrews WH. Greider CW and

Villeponteau B ( 1993) The RNA component of human telornerase. Science 269: 1236- 124 1

Femn LJ and Camerini-Otrro RD ( 1994) Long-range mapping ofgaps and telomeres witli

RrcA-assisted restriction endonucleasr (RARE) cleavage. iV~innr~-r Grrler 6:379-353

Flint J. Wilkie AOM. Buckle VJ. Winter RM. Holland Ai and McDermid HE ( 1995) The

detection of subtelorneric chrornosomal rearrangernents in idiopathic mentd retardation.

iVcrrrtr-e Geîzer 9: 1 32- 140

Gottschling DE. Aparicio OM. Billington BL and Zakian VA ( 1990) Position rffrct at S.

cereiri~icre telomeres: reversible repression of Pol II transcription. Ceil 63:75 1-76?

Gray JT. Celander DW. Price CM and Cech TR ( 199 1) Cloning and expression of penes

for the O-tp-icltcr telomrre-binding protrin: specific subunit interactions in the telomeric

cornplex. Col1 67307-8 1 1

Green ED and Olson .MV ( 1990) Systrmaric screening of yeast mificial-chromosome

librarics by lise of the polyinerasc chiiin reaction. PI-uc N d Accid Sci USA 87: 12 13- 12 17

Greider CW ( 1993) TeIomere chromatin and sene expression. Ciirrrrzr Bi01 262-64

Guens van Kessel AHM. Tetteroo PAT, von dem Borne AEG, Hajemeijer A and Bootsma

D ( 1983) Expression of human myeloid-associated surface antigens in human-mouse

rnyeloid ce11 hybrids. Proc i V d Accrd Sci USA 80:3738-3757

Gyapay G. Morissettr J. Vignal A. Dib C. Fizames C. iMi1lasseau P. Marc S. Bernardi G.

Lathrop M and Weissenbach 1 (1991) The 1993-94 Généthon human genetic linkage rnap.

Ncrturr. Genet 7(special issue): 246-3 39

Harley CB. Vaziri H. Counter CM rind Allsopp RC ( 1992) The telornere hypothesis of

cellular aging. Exp Ge>vritol27:375-382

Harris PC and Thomas S ( 1992) Length polymorphisrn of the subtelomeric regions of both

the short (p) and long arms (q) of chromosome 16. Cvrp~r)zrt Cell Grrzef 60: 1 7 1 - 172

Hastie ND and Alishire RC ( 1989) Human telorneres: hision and interstitial sites. Tt-wrds

Genet 5336-33 1

Hastis ND. Dempstrr M. Dunlop LMG. Thompson AM. Green DK and Allshire RC ( 1990)

Tclomere reduction in human co1orect;il carcinoma and with ageing. Nanit-r 346366-865

Heclit F rind Hecht B K ( 199 1 ) The teloiiiere in cancer: dl's not well that doesn't end well.

Cmcer Gmrr Cytogrrirt 54:115-246

Hem JM. Tommenip N. Ssrenson FB. Henriques UV. Nielsen A and Therkelsen AJ

( 1995) Partial deletion 1 lq: report of a case with a large terminal delerion 1 lq? 1-qter

without Ioss of telomeric sequences. and review of the literature. Clin Gmrt 4723 1-235

Hewitt JE. Lyle R. Clark LN. Valleley E. Wright TJ. Wijmenga C. van Deutekom JCT.

Francis F. Sharpe PT. Hofker M. Frants UR and Williamson R ( 1994) Analysis of the

tandem rcpeat locus D U 4 associated with Facioscapulohumeral muscuiar dystrophy. Hturi

Molec. Gerrer 3(8): 1 3 7 - 1295

Hoff M. Nakamura Y. Holm T. O'Connel1 P. Leppert M. Lathrop GM. Lalouel J-M and

White R ( 1988) Isolation and mapping of a polymorphic DNA sequence (pHHH208) on

chromosome 14 [D 14s 191. N i r d Acids Res 16: 10400

Hotker MH. Walter !MA and Cox DW ( 1989) Complete physical map of the human

immunoglobulin heavy chain constant reg ion gene cornpiex. froc N d Accitf Sci USA

86:5567-557 1

Hoker MH. Smith S. Nakiimurri Y. Tsshirna 1. White R and Cox DW ( 1990) Physîcril

müpping of probes within 14q32. a subtelomeric region shoiving a hish reconibinütion

frequency. Genornics 6:33-38

HoIlander LM and Wolfe DA ( 1973) Nr~rrp~rmrlretric Strrtisrics. John WiIey & Sons. Inc.

Howard PJ. Clark D and Dearlovr J ( 1988) Rstinal/macular pigmentation in conjunction

with ring 14 chromosome. Hloii Gerzer 80: 140- 112

Hseidnrsson SJ and Stamberg J ( 1983) Distül monosomy 14 not associated with ring

torrnarion. J M d Gcirier 9: 147- 1.59

IJdo JW, Baldini A. Ward DC, Rerders ST and Wells RA ( 199la) Origin of human

chromosome 3: an ancestral telomere-telomere fusion, Proc N d Acacl Sci USA 88:905 1 -

9055

IJdo JW, Baldini A. Wells RA. Ward DC and Reeders ST ( I991b) FRA2B is distinct from

inverted telomere repeat arrays at 2q 13. Grrzoinks 12933-Y35

IJdo JW. Wells RA. Baldini A and Reèders ST ( 199 1c) Improved telomere drtection iisins

a telornere repeat probe (TTAGGG)n gcnerared by PCR. I V ~ Acids Res 19:4780

IJdo JW. Lindsay EA. WeIIs RA and Baldini A ( 19%) Multiple variants in subtelomeric

regions of normal karyotypes. Getzotlzics 14: 10 1 9- 1025

Jarman AP and Wells RA ( 1989) Hypervariable minisatellites: recombinators or innocent

by standers? Tre~zds G m e t 5367-37 1

Johnson MJ. de Lange G and Cavalli-Sforza LL ( 1986) 19 gamma restriction fmgment

lengtli polymorphisms indicnte an ~incient separation of caucasim hriplotypcs. A r 1 1 J Huin

Gerzer 38:6 17-640

Kang HK and Cox DW ( 1996) Tandem repeats 3' of the IGHA genrs in the human

irnmunoglobulin heavy chain gene cluster. Getzo>i,ics 35: 189- 195

Katinka MD and Bourgain FM ( 1992) Interstitial telorneres are hotspots for illrgitiinate

recombination with DNA molecules injecteci into the macronucleus of Parunzecirrrri

priinnrtrelirr. EhlBO J 11:725-732

Khan F. Clarke V luid D'Eustachio P ( 1994) Refinernent of the DNA marksr rnaps of

mouse chromosome 12. Geriornics 21: 138- 137

Kim NW. Piatyszek MA. Prowse KR. Harley CB, West MD, Ho PLC. CoviclIo GhI.

Wright WE. Weinrich SL itnd Shay W ( 1994) Spsci fic association of hurnan telomrrüsr

activity with irnmortal cells and cancer. ScCierzct, 26620 1 1-20 15

ffipline D and Cook H ( 1990) Hypervariable ultra-long telorneres in mice. Ntrtirrr

317:400-402

Kiplins D. Ackford HE. Taylor BA and C o o k HJ ( 199 1 ) iMouse rninor satellite DNA

oeneticÿlly rnaps to the centromere and is physicdly linked to the proximal telomere. 2

Gerzornics 1 1 :235-24 1

Kiplinz D. Wilson HE. Thomson EJ and Cookr HJ ( 1995) YAC cloning M m i?irr.sc~r/~is

rclomeric D N A : physical. srnetic. iii si~ir and STS markrrs for the distal telornere of

chrornosonie 10. H r m ~ W ) l ~ c Getzer 1: 1 107- IO 14

Kirkham PM, Mortari F. Newton JA and Schroeder HW. Jr. (1992) Immunoglobulin VH

clan and fainily identiy prrdicts variable domriin structure and may influence rintigen

binding. EMBO J 12603-609

Kombers RD and Lorch Y ( 1995) Interplay between chrotnatin structure and transcription.

Ciirr-ëiit Op Cell Biol7:37 1-375

Kosztol5nyi G (1387) Does "ring syndrome" rxist? An anülysis of 707 case reports on

patients w ith a ring autosome. Hrtrlr Geriet 75: 174- 179

Kousseff BG, Nichols P. Essig Y-P, Miller K. Weiss A and Tedesco TA ( 1987) Complex

chromosome rearrangements and congenital anornaiies. Am J Med Genet 2 6 7 7 1-78?

Kvaloy K. Galvagni F and Brown WRA ( 1991) The sequence organization of the Ions arm

pseudoaurosornal region of the human sex chromosomes. Hmr ~Vlolec Gctzet 3:77 1-778

Kyrion G. Boakye KA and Lustig AJ ( 1992) C-terminal truncation of RAPI results in the

deregdation of telornre size. stability. and function in S ~ ~ c c l i a r n i ~ r ~ e s crrrrisic~r. iNd Cd1

Bi02 12(11):5 159-5 173

Lamb .i. Hruris PC. Wilkie AOM. Wood WG. Dauwersr JG and Higgs DR (1993) Dr

tiovo truncation of chromosome 16p and healing wirh (TTAGGG)n in the a-

thalassemidmental retardation syndrome (ATR- 16). Arn J Hum Geizet 52668-676

Lee KH. Matsuda F. Kinashi T. Kodaira M and Honjo T ( 1987) A novel family of variable

region genes of the human immuno~lobulin heavy chliin. J Mol Biol 19576 1-765

Lee C. Sasi R and Lin CC ( i Y93 I Interstitial localization of telomeric DNA sequences in the

Indian muntjac chromosomes: further widence for tandem chromosome fusions in the

karyotypiç svolution of the Asian muntjacs. Cyfugriw? Cd1 Geirer 63: 156- 159

Lindsey J. :VcGill Nt. Lindsey LA. Green D K and Cooke HJ ( 199 1 ) hi ~ i i w loss of

telomeric repeats with age in humans. Mrrt Res 256:45-48

Luke S and V e m a RS ( 1992: Origin of human chromosome 2. Nature Ge~zrt 2: 1 1

Lundblad V and Blackburn EH ( 1993) An alternative pathtvay for yeast telomere

maintenance rescues est 1- senescense. CeII 73:347-360

Macina RA. Negorev DG. S p i s C. Ruthig LA. Hu X-L and Riethrnon HC ( 1994

Sequence organization of the hurnan cliromo?;ome Iq telomere. Hiirrz i ~ l o [ r c Gmer 3: 1 W7-

t 853

Macina RA and Riethman HC ( 1994) iMapping vector-adjacent DNA from a 7q human

teiorneric Y AC using RARE. Mmtnrd Grrzorrtc 5596

Macina RA. Morii K. Hu XL. Nsgorev DG. S p i s C. Ruthig LX and Riethmiin HC ( 1995)

Molecular cloning and RARE clravage mapping of human 2p. 6q. Sq. 12q. and 18q

telorneres. Gètzorrie Res 5 2 2 5 - 2 3 2

Magnani 1. Sacchi N. Drirtler M. Yisson PE, Tornaghi R and Furman-Conti ALM ( 1993)

Identification of the cliromosoms 14 origin of a C-negativr markrr associated with a l-lq32

deletion by chromosome painting. ClNl Ge~rrr 43: ISO- 185

Mares A h . . Ledbetter SA. Ledbrtter DH. Roberts R imd Hejtmancik IF ( 199 1 ) Isolation

of a humün chromosome i-l-only somntic ce11 hybrid: analysis using Alir and LME-based

PCR. Gerrot~iics 11:3 15-3 18

Martin-Gallardo A. Lamerciin I. Sopapan P. Friedman C. Fertitra AL. Garcia E, Cürrano

A. Negorev D. Macine RA. Trask BJ and Rirthman HC ( 1995) Molecular annlysis of a

novel subtelomeric rcpeat with polyrnorphic çhromosomal distribution. C~rogrrier Cd[

Gmer 71:2S9-295

Masada CT. Haskins Olney A, Fordyce R and Sanger WG (1989) Partial deletion of 14q

and p&artial duplication of 14q in sibs: testicular mosaicism for t(14q; 14q) as a common

mechanism. Am J Med Grrzet 34528-534

Mason JM and Birssrnann H ( 1995) The unusual telorneres of Drosopliih. TI-ericls Gerrer

1 l:58-62

Matsuda F. Lee KH. Sakai S. Sato T. Kodaira M. Zong SQ. Ohno H. Fukuhara S and

Honjo T ( 1988) Dispersed localization of D segments in the human immunoglobulin heüvy-

chain locus. EMBO J 7: 1047- 105 1

Matsuda F. Shin EK. Hirabayashi Y. Nagüoka H. Yoshida MC. Zong SQ and Honjo T

( I W O ) Organization of variable region segments of the human immunoglobulin heavy

chriin: duplication of the DS cluster within the locus and interchromosomal trmslocation of

variable region segments. EMBO J 9250 1-2506

Matsuda F. Shin EK. Nagtioka H. Maisuriiura R. Haino M. Fukitii Y. Taka-ishi S. [mai T.

Riley JH. Anand R. Soeda E and Honjo T ( 1993) Structure and physical map of 6-1

variable segments in the 3' 0.8-rnsgabase region of the human immunoglobitlin hstivy-

chain locus. N c i t l u - ~ ' Gmet 3:88-94

Matsumura R. Matsiida F. Yagaokü H. Fujikura J. Shin EK. Fukita Y. Haino M and

Honjo T ( 1994) Stnictural analysis of the human VH locus using nonreprtitive intergenic

probes and repetiti ve sequrnce probes. J Iirirmnol 152:660-666

iMcClave JT and Dietrich FH ( 1985) Sfciristics. Dellen Ptiblishing Company.

blcKay SI and Cooke H ( 1992) A protein which specificülly binds to single stranded

TTAGGGn repeats. i V ~ c l Acids RËS 20: 1387- 139 1

Meltzer PS. Guan X-Y and Trent JM ( 1993) Tzlomere capture stabilizrs chromosome

breakage. ~Vatrrre Geiiet 4252-255

Meyne J. Baker RJ. Hobart HH. Hsu TC. Ryder OA. Ward OG. Wiley JE. Wurster-Hill

DH. k'iites TL and Moyzis RK ( 1990) Distribution of non-telomeric sites of the

(TAGGG)* telomeric sequeiice in vertebrate chromosomes. r~rroinosomi 9 9 5 1 0

Migone N. Feder J. Cann H. van West B. Hwang J. Takahashi N. Honjo T, Piazza A and

Cavalli-Sforza L-L ( 1953) Multiple DNA fragment polymorphisms associated with

immunoglobulin mu chain switch-iike regions in man. Proc Nmi Acud Sci (USA) 80:467-

Miller BA. Jriyrikar P and Cap6 H ( 1992) Chiid with cxltiple congenital anomalies and

mosaicism 46.XW46.XX. del ( 14) (q32.3). d - b ~ l J ~Med Gerier 44635637

Miller SA. Dykes DD and Polesky HF ( 1988) A simple salting out procedure for extracting

DNA from hiiman nuclerited cells. A k - 1 Acids Res 16: 12 15- 13 10

Mitelman F. Keneko Y and Trent J ( 199 1 ) Report of the cornmittee on chromosome

changes in neoplasia. Cyto.qriret. Cr11 Genet. 58: 1053- 1079.

M m i n GB ( 1989) Thc human telomere terminal trrinsferase enzyme is a ribonucleoprotein

that synthesizes TTAGGG repeats. C d 5952 1-529

Morton NE ( 199 1 ) Parameters of the human genome. froc Nail Acnd Sci (L'SA) 88:7174-

7476

Moyzis RK. Buckingham JM. Crnrn LS. Dani M. Deaven LL. Jones MD. Meyne J. Ratliff

RL and Wu J-R ( 1988) A highly conserved repetitive DNA sequence. (TTAGGG)n.

present at the telorneres of human chromosomes. Pruc Xc i r l ACLU/ Sui USA 85:6633-6636

Nagüoka H. Ozawa K. Matsuda F. Hliyashida H. Matsumura R. Haino M. Shin EK.

Fukita Y. Irnüi T. Annnd R. Yokoyiima K. Eki T. Soeda E and Honjo T ( 1994) Recent

trrinslocation of variable and diversity segments of the human immunoglobulin heavy c hain

t'rom chromosome 14 to chromosomes 1 5 and 16, G ~ O I I I ~ C S 22: 1 59- 1 97

Nakamura Y . Carlson M. Fujimoto E. O'Connel1 P. Leppert M. Lathrop GM. Ldouel J-.LI

and White R (1988a) Isolation and mapping of a polymorphic DNA srquence (.pMCOC 12)

on chromosome 14 [D 14S70J. Nrrcl Acicis Res 16:6257-6250

Nakamura Y . Culver :M. GilI J. O'Connel1 P. Leppert M. Lathrop GM. Llilour.1 J-hl and

White R ( 19SSb) Isolation and mapping of a polymorphic DNA sequence pMLJ1-I on

chrornosonie 14 [D 14s 131. iV rd .-Icic/.~ Res 16:3S 1-380

Nakamura Y. Krapcho K. Biillard L. O'Connrll P. Leppert M. Lathrop GiM. Ldouel J-M

and Wliits R t 1 9 8 5 ~ ) Isolation and mapping of a polymorphic DNA sequencr (cKKA39)

on chromosome 14 [D 14S231. Nucl itcids RL'S 16:3 120

Nakamura Y. Lathrop M. O'Connel1 P. Leppert M. Kamboh MI. Lalouel J-M and White R

( 1989) Frequent secombination is observed in the distal end of the long arm of

chromosome 14. Ge11 mrrics 4: 76-8 L

Narayrin D. Desai T, Banks A. Paranjüli SR. Ravikumar TS and Ward DC ( 1994)

Localization of the human cytoplasmic dynein heavy chain (DNECL) to l4qter by

fluorescence in sitlr hybridizrition. Grtlotilics 22:660-66 1

National Institutes of Health and tnstitu te of bIolecu1ar Medicine Collaboration ( 1996) A

complrte set of human telomeric probes and tlieir clinical application. iVtitio-r Genet 14:56-

89

Negorrv DG. Macina RA. Spais C. Ruthig LA. Hu X-L and Riethman HC ( 1994)

Physical analysis or the terminal 270 kb of DNA from humiin chromosome I q. Gerzouiics

22:569-575

'iielsrn J. Homma A. Rasmussen K. Ried E. SXqXrsnsen K and SaIdafia-Garcia P

( 1978 ) Deletion 14q and pericentric inversion 14. J ~ M e d Getirt 15236-238

NIHKEPH Collaborativr Mtipping Group ( 1992 ) A cornprehensive genetic linkagc map

of the human genome. Sc-irucr 258:67-76

Ott. J ( 19S5) Amibis (,fli~u?rtrrr aetzrtic I N i k q y . The Johns Hopkins University Press.

Panagopoirlos 1, Mandahi N. Mitrlman F 2nd Aman P (1995) Two distinct FUS breakpoint

clusters in myxoid liposarcoma and ücute myeloid leukemia with the translocations t( 12: 16)

and t( !6:2 1 ). Oïlco,qeize 11: 1 133- 1 137

Pandit SD. Wang JC. Veile RA. Mishrri SK. Warlick A and Donis-Keller H ( 1995) Indes.

comprehensive microsatellite. and unified linkage mmnps of hurnan chrornosomr 14 with

cytogenetic tie points and n ielomere microsatellite marker. Grtioinics 29:653-664

Park VM. Gustashaw KM and Wathen TM ( L 992) The presence of interstitial tzlomenc

sequences in constitutional chromosome abnomalities. Am J Hrurt Grnef 50:9 14-923

Pezzolo A. Gimelli G. Cohen A. Liivaggetto A. Romano C. Fogu G and Zufhrdi 0 ( 1993)

Presence of telomeric and subtelorneric sequences at the fusion points of ring chromosomt.s

indicatss that the ring syndrome is caused by ring instübility. H L ~ Z Grrirt 9223-27

Price CM. Skopp R. Kmegrr J and Williams D ( 1993) DNA recognition md binding by

the E~rplorcs telomere protein. Biocltei~iisrn 3 1: 10835- IO843

Rappold GA and Lehrach H ( 1985) A long range restriction map of the pseudoautosornal

region by partial digest PFGE analysis lrom the telomere. cVitcl Acids Res l6:536 1-5376

Reiknyder C. Lowell 1. Clarke A and Pillus L ( 1996) Ycast SAS silencing _ornes and

human genes associnted with AML and HIV- I Tat interüctions are homologous with

xe ty ltrrinsfernses. iVmtw Genrr 1442-49

Reston JT. Hu X-L. Macina RA. S p i s C and Riethman HC i 1995) Structure of the

terminrd 300 kb of DNA Tsorn humün chromosome 3 lq. Gcilottrics L6:3 1-35

Richards EJ and Ausubel FM ( 1988) Isolation of a higher rukqotic telomere trom

.Ji-~~bi~Iup.si.~ tlldimu. Cd1 53: 127- 136

Riethmün HC. Moyzis RK. Mrynr 1. Burke DT and Olson MV (1939) Cloning hiimiiri

telorneric DNA fragments into S~icclzctroiiryces crrr visicir us ing a. yeast-artificial-

chromosome vector. Proc N d Accrd Sci USA 86:6240-6244

Riethman HC. Spais C. Buckingham J. Grady D and Moyzis RK ( 1993) Physical analysis

of the terminal 240 kb of DNA from human chromosome 7q. Geriornics 17:75-33-

Rounds D. Bmecknrr Evl and Ward DC i 1995) Isolation of murine telomrre-proximal

sequrnces by ciffinity capture and PCR. Gcrzoinics D : 6 16-62?

Rouycr F. de la Chapelle A. Andersson M and Weissenbacli 5 ( 1990) .An inrrrspersed

repeated srquence specitïc for human ubtelomeric regions. EMBO J 9505-5 14

Rowen L. Koop BF and Hood L ( 1996). The complete 685-kilobase DNA sequence of the

human beta T ce11 recrptor locus. Scirrice 272: 1733- 1762

Roy le NJ ( 1995 1 The proterminal regions and telorneres of human chromosomes. .4rk

Gerzei 32:273-3 15

Roylr NJ. Clarkson RE. Wong Z and Jeffreys .4J ( 1988) Clustcrin_o of hypervariablr

minisatellites in the proterminal regions of hiiman autosomes. Gerroirlics 3:352-360

Roy le NJ. Hill MC and Jeffreys AJ ( 1997) Isolation of tclomrre junction iriiginenis by

anchored polymerase chriin reaction. Proc R S Lomlorz B - Biol Sci 24757-6 1

Royle NJ. Baird DM and Jeffreys AJ ( 1994) A subterminai satellite located adjacent to

trlomeres in chimpanzees is absent from the human genome. Nutiu-e Goirt 652-56

Schechtman MG ( 1989) Srgregation patterns of Ne~rrospoi-cr chromosome ends: müpping

chromosome tips. F~rngal Ceriet 36:7 1-73

Scherer S and Tsui L-C ( 199 1) Cloning and ünalysis of large DNA molecules. In: Adolph

KW (ed } Advanced techniques in chromosome research. -Marcel Dekker.lnc.. New York.

pp 33-72

Scherf A and Mnttei D ( 1992) Cloning and characterization of chromosome breakpoints 01'

P/nsrrioclilri1rfiiicipc1rt~17~: breakage and new telomere formation occun frequently and

randoiniy in subtelorneric genes. N d Acih Res 20: 139 1 - 1496

Schrosder HW.Jr.. Hillson JL and Perlrnutter R M ( 1987) Early restriction of the human

rintibody repertoire. Sc-imct. 238: 79 1-793

Schroeder HW.Jr.. WaIter .MA. Hotker MH. Ebrns A. Willems van Dijk K. Liao LC. Cox

DW. Milner ECB iind Perlmutter RU ( 19%) Physical linkage of a human immuno~lobulin

hcüvy chah variable region gene segment to diversity and joining region rlrrnrnts. Proc

Nciti Accu/ Sci USA 8518 196-8300

Schubert 1. Schrisver-Schwrmmer G. Werner T and Adler 1-D ( 1992) Telomeric signüls in

Robertsonian fusion and fission chromosomes: implications for the origin of

pseudoaneuploidy. Cyro,qmer C d Gerirr 5916-9

Schutte MEM. Ebelino + SB. .-\kkermnns-Koohs KE and Logtenberg T ( 1992) Deletion

mapping of Ig VH scne segments rxprcssed in human CDS B ceIl lines. J Irwiuorol

149:3953-3960

Secchiero P. Nicholas J. Deng H. Xiaoprng T. van Loon N. Ruvolo VR. Bememan ZN.

Reitz MS.Jr. and Dewhurst S ( 1993) Identification of human telomeric repeat motifs at the

genome termini of human herpesvirus 7: structural ;uinlysis and heterogeneity. J Virol C

69:804 1-8045

Shirasaka Y, Ito M. Okuno T. Fujii T. Nozaki K and Mikawa H ( 1992) Ring L 4

chromosome with cornplex partial seizures: a case report. B r h Dei- 14257-160

Shore D ( 1994) RAP 1 : a protean re_oulator in yeast. Trends Geiirt 10:40S-4 13

Silva AJ. Johnson JP and White RL ( 1957) Characterization of a highly polymorphic

region 5' to JH in the human irnrnunoglobulin heavy chain. Nitcl Acids Rrs 1538-15-3856

Simmler M-C. Rouyer F. Vergnaud G. Nystrom-Lahti bI. Ngo KY. de la Chapelle A and

Weissenbiich J ( 1985) Pseudoautosomnl DNA srquences in the pairing region of the

human sex chromosomes. ivat~lr-ci 317:692-697

Starling JA. M a d e J. Hastie ND and Allshire RC (1990) Extensive trlomere repeat arrciys

in mouse are hy pervariable. M d Acid.s Res 18:685 1 -6858

Steiner BR. Hidaka K and Futcher B ( 1996) Association of the Est 1 protein with

telornerase activity in yeast. Proc Natl Accrd Sci USA 9328 17-182 1

Suzuki K. Yamagiwa Y, Matsui T and Yoshida K ( 1994) Restriction enzyme-resistmt high

molecular weight telomeric DNA fragments in tobacco. DIVA REs 1: 129-138

Tebbs RS. Zhao Y. Tucker JD, Scheerer JB. Siciliano MJ. Hwang M. Liu N. Legerski RJ

and Thompson LH ( 1995) Correction of chromosomal instability and sensitivity to diverse

mutagens by a cloned cDNA of the XRCC3 DNA repair gene. Pmc i V d Acrrd Sci USA

92:6354-6358

Telford N. Thomson DAG. Griffiths MJ. Ilett S and Watt JL ( 1990) Terminal deletion

( 14)(q32.3): a new case. J Med Grnrr 27:26 1-263

Tomlinson IM. Walter G. Marks JD. Llrwelyn MB and Winter G ( 1992) The repttnoire of

human germline VH sequences reveals about fifiy groups of VH xgrnents with different

hypervariable loops. J Moi Biol227:776-798

Tomlinson IM. Cook GP. Carter NP. Elaswarapu R. S mirh S. Walter G. Buluwela L.

Rabbitts TH and Winter G ( 1993) Human immunoglobulin VH and D se, =melm on

chroniosomes 1 Sq 1 1.7 and 16p l 1 - 2 . Hwzi ~ W o k G m r i 3:Sj3-560

Tonepawa S ( 1983) Somatic generation of antibody diversity. .N~rtrrrr 302575-5s 1

Uehara S. Akai Y. Takeyama Y, 0karnur.î K. Takabayashi T. Yajima A. Natsui M and

Ntikai H ( 1993) A case of a krnale infiant with simultaneous occurrence of de 11oi.o terminal

deletions on chromosome I-lq and 20p. Clin Gerirr 13:28-33

Undenvood AP. Louis EJ. Bons RH and Wakefield AE ( 1994) A technique for cloning the

telorneres and subtelomeric regions from Przetrniocystis cru-inii. J Ertkqvot Microb

41: 1 13s

Vermeesch JR. De Meunchy W. Van Den Berghr H, Marynen P and Petit P ( 1996)

Differences in the distribution and nature of the interstitial telomerîc (ïTAGGG)*

sequcnces in the chromosomes of the Giraffidae. okapi (Okupicr jolinsroiii). and giraffe

(Girafici cri~rlelopcir(/(iiis): evidence for ances:;d telorneres rit the okapi polymorphic

rob(426) hision site. C~togener Cd2 Genet 72:3 10-3 15

Wada M and Niikaniura Y i 1996) Unique telomeric expression site of major-surface-

glycoprots in genes of Pwirriioq*sris ctirirîii. D1VA REs 355-64

Walter MA. Linsley PS and Cox DW ( 1987) A p d polymorphisrn of a human

immunoglobulin VH3 subclass locus. Nuci Acids Res 154697-4690

Walter MA and COX DW ( 1989) A method [or two-dimensional DNA electrophoresis (2D-

DE): application to the immunoglobulin heavy chah variable region. Griiomics 9- 157- 159

Walter MA. Surti U. Hoflrer MH and Cox DW ( 1990) The physical organization of the

human immunoglobulin heavy c h a h gene complex. EMBO J 913303-33 13

Walter iMA and Con DW ( 199 1 ) Nonuniform linkage disequilibrium within a 1.500-kb

region of the human immunoglobulin hetivy-chain complex. Aiiz J Hltt~i Gerier 49:9 17-93 1

Walter MA. Dosch HM and Cox DW ( 199 1 ) A deletion map of the human immunoglobulin

heavy chain variable region. J Ekp Med 174:335-349

Wang HS and Allanson JE ( 1993) A further case of terminal delrtion ( 14) (q32.2) in a

çiiild with mild clysmorphic katures. Ali11 Gc'ud 35: 17 1 - 173

Wang M. Champion LE. Biessmann H and Mason JM (1994) Mapping a rnutator. mii2,

which increases the frequency of terminal deletions in D~-(~sophiki tnelar~ogasrer. Molec Getz

Genet 245: 598-607

Wang S-S and Zakian VA ( 1990) Telomere-telomere recombination provides an express

pathway for telornere acquisition. Nnture 345356458

Wang Z and Weber JL ( 1997,) Continuous linkage map of human chromosornt. 14 short

tandem repeat polymorphisms. Grtiomics 1 3 5 3 2 4 3 6

Weber B. Collins C. Robbins C. .Magenis RE. Delaney AD. Gray JW and Hayden MU

( 1990) Characterizütion and organization of DNA sequences adjacent to the human telomere

associateci 1-eperit (TTXGGG ln. Nucl .-\ci& RCS I8:3353-336 L

Weber B. Allen L. ,Magenis RE. Goodkllow P.J. Smith L and Hayden MR ( 199 l a )

Intrachromosornal location of the telomeric repeat ('TTAGGG)n. Mclrrinml Gemme 1 2 1 1 -

216

Weber B. Allen L. itlasenis RE and Hayden MR ( 199 Lb) A low-copy repsat located in

subtelomeric regions of 14 different hurnan chromosomaI termini. Cjrogrilet Ceif Gmer

57: 179- 183

Weber JL and Wong C ( 1993) Mutation of human short tandem repeats. f i l m !Moic.c Gewr

2:1123-1128

Weissenbach J, Gyapay G. Dib C, Vignal A, -%lorissette J , Millasseau P. Vaysseix G and

Lathrop M ( 1992) A second-generation linkage map of the human genome. iVur«re

(Lovdorr) 359:794-50 1

Wells RA. Gerrnino GG. Krishna S. Buckle VJ and Reeders ST ( 1990) Telornere-reirited

sequences at inrerstitial sites in the humün genorne. Grrroi~iics 8:699-704

Wijrneng;~ C. Wright TJ. Biiün MJ. Padbsrg GW. Williamson R. van Omrnen G-JB.

Hswitt JE. Hoikcr Y1i-i and Frants RR i 1993) Physical mapping and YAC-cloning

connects four _oeneticdly distinct 4qter loci (D4S 163. DJS 139. DJF35S 1 and D4FlOJS 1 )

in the FSHD gene-region. H L ~ itlolec Gmct 2: 1667- 1672

Wiley JE. Meynr J. Little iML and Stout JC ( 1997) Interstitial hybndization sites of the

(TTAGGGln telomeric sequence on the chromosomes of sorne North Arnericrin hylid

frogs. ~*r(<qrrzer Cr11 Geirer 61:55-57

Wilkis AOiLf. Lamb J. Harris PC. Finney RD and Higgs DR i 1990) A truncatcd humün

chromosome 16 rissociated with U. thdasssmia is stabilizsd by addition of trlomeric repsrii

(TTAGGG )n. N~itrrrc. 346:SGg-87 1

WiIkir .40M. Higgs DR. Rack KA. Buckle VJ. Spurr NK. Fischrl-Ghodsian N.

Ceccherini 1. Brown WRA iind Harris PC ( 199 1 ) Stable length polyrnorphism of up :O 260

kb at the tip of the short arm of human chromosome 16. C d 64595-606

Wilkie AOiM ( 1993) Detection ofcryptic cliromosornal abnomialitirs in iinexplaincd mental

rctardation: a general strategy using hypervariable subtelomeric DNA polyrnorphisrns. At?(

J Htiru Gerirt 53:688-70 1

Willems van Dijk K, Milner LA and Nlilner ECB ( 1992) Mapping of human H chain V

region genes ( V H ~ ) using deletional analysis and pulsed field gel electrophoresis. J

It~rnirrtzol 148:2933-293 1

Williams SR, Goddard JM and Martin DW ( 1984) Human purine nucleoside

phospliorylase cDNA sequence and genomic clone characterization. N i d Acids Res

12:5779-5757

Wintie RF. Kisilcvskp R. Noonan D and Duncan AMV ( 1990) hl situ hybridization to

human chromosome 1 of a cDNA probe for the gene encoding the basement membrane

heparan su1 fate pro teoglycan (HSPG 1. CytoCqenet C d Gcrier 5460-6 1

Wintlc RF and Cox DW ( 1994) Mnpping of human immuno,olobulin heavy chain variable

oene segments outside the major IGH locus. Geumiics 23: 13 1 - 157 C

Wintle RF. Costa T. Hasliirn RHA. Teshima IE and Cox DW ( 1995) Moleculür analysis

redefines three human chromosome 14 deletions. Hunt Gellet 95495500

Wintle RF. Nygaürd T. Hcrbrick JS. Kvaluy K and COX DW ( 19971. Genetiç

polyrnorphism and recombination in the subtelomsric rrgion of chromosome I4q.

Ge~zornics. in press.

Wyman A and White R ( 1980) A highly poiyrnorphic locus in human DNA. Proc i V d

.4cud Sci USA 77:6754-675s

Yen F-S. Podmch PE and Weisskopf B ( 1989) A terminal deletion ( 14)(q3 1.1) in a child

with microcephaly. narrow palate, gingival hyperuophy, protuberant ears. and rnild mental

retardation. J Mecl Genet 26: 130- 133

Youngmün S. Bates GP. Williams S. McClatchry AI. Baxendale S. Sedlacek Z. Altherr

M. Wtismuth JJ. MacDonald ME, Guselt~i JF. Sheer D and Lehrach H ( 1992) The

tclomeric 60 kb of chromosom<: iirm 4p is homologous to trlomeric regions on 13p. 15p.

2 1 p. and ?p. Geilorilics 14350-356

Zd&n VA ( 1995) Telorneres: beginning to linderstand the end. Scirtzce 270: 160 1- 1607

Zelante L. Torricelli F. Calvano S. MingareIli R and Dallapiccola B ( 199 1 ) Ring

chromosome 14 syndrome. Atz~ Gt;nGt 34:93-97

IMAGE EVALUATION TEST TARGET (QA-3)

APPLIED A IN1AGE. lnc - = 1653 East Main Street - -. . - Rochester, NY 14609 USA -- --= Phone: i l W402-0300 -- = Fa: 71 W88-5989

Q 1993. Appiied image. Inc.. Ail R@ts Reserved