3
Search Vector Database | Search Addgene Plasmids Welcome to Vector Database! Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene. This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details. Plasmid: pET-28 a (+) Source/Vendor: EMD Biosciences Alt Name: pET28a Analyze: Sequence Plasmid Type: Bacterial Expression Expression Level: High Clone Method: Unknown Size: 5369 5' Sequencing 1 Primer: T7 Fwd 5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3' Tag 1: His (Nterm and Cterm) Bacterial Resistance: Kanamycin Notes: Nterm thrombin cleavage site; a,b,c vary by MCS; Catalog Number: 69864-3 Stable: Transient Constitutive: Constitutive Viral/Non-Viral: Nonviral pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc) http://www.addgene.org/vector-database/2565/ 1 of 3 2/13/2013 9:53 PM

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, Etc)

Embed Size (px)

Citation preview

Page 1: pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, Etc)

Search Vector Database | Search Addgene Plasmids

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a freeresource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

Plasmid: pET-28 a (+)

Source/Vendor: EMD Biosciences

Alt Name: pET28a

Analyze: Sequence

Plasmid Type: Bacterial Expression

ExpressionLevel: High

Clone Method: Unknown

Size: 5369

5' Sequencing1 Primer: T7 Fwd

5' Sequencing1 Primer

Sequence:5'd[TAATACGACTCACTATAGGG]3'

Tag 1: His (Nterm and Cterm)

BacterialResistance: Kanamycin

Notes: Nterm thrombin cleavage site; a,b,c vary by MCS;

CatalogNumber: 69864-3

Stable: Transient

Constitutive: Constitutive

Viral/Non-Viral: Nonviral

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc) http://www.addgene.org/vector-database/2565/

1 of 3 2/13/2013 9:53 PM

Page 2: pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, Etc)

Feature Name Start EndT7_terminator 129 1

T7_Terminal_primer 69 87

T7_leader 239 207

Xpress_fwd_primer 240 222

T7_transl_en_RBS 323 307

lacO 368 341

T7_promoter 386 368

tet (300 - 563) 418 681

pBRrevBam_primer 489 470

lacI 764 1855

tet (576 - 851) 1914 2189

ROP 2664 2855

pGEX_3_primer 2871 2849

pBR322_origin 3889 3270

KanR2 3995 4810

ORF Start EndORF frame 1 523 1023

ORF frame 2 896 1855

ORF frame 2 3995 4810

Enzyme Name CutXhoI 158

NotI 166

EagI 166

HindIII 173

SalI 179

SacI 190

EcoRI 192

BamHI 198

NheI 231

NdeI 238

NcoI 296

XbaI 335

BglII 401

BclI 1137

ApaI 1334

EcoRV 1573

HpaI 1629

FspI 2205

NruI 4083

ClaI 4117

XmaI 4298

pET-28 a (+)5369 bp

1343

896

448

5369

4922

4474

4027

3580

3132

2685

2238

1790

SmaI (4300)XmaI (4298)

ClaI (4117)NruI (4083)

ORF frame 2KanR2

pBR322_origin

pGEX_3_primerROP

FspI (2205)tet (576 - 851)

HpaI (1629)EcoRV (1573)

ApaI (1334)

BclI (1137)

ORF frame 2

lacI

ORF frame 1

pBRrevBam_primertet (300 - 563)

BglII (401)T7_promoterlacOXbaI (335)T7_transl_en_RBSNcoI (296)

NdeI (238)NheI (231)

Xpress_fwd_primer

T7_leaderBamHI (198)EcoRI (192)SacI (190)SalI (179)HindIII (173)EagI (166)NotI (166)XhoI (158)T7_Terminal_primerT7_terminator

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc) http://www.addgene.org/vector-database/2565/

2 of 3 2/13/2013 9:53 PM

Page 3: pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, Etc)

pET-28 a (+) - Addgene Vector Database (Plasmids, Expression Vectors, etc) http://www.addgene.org/vector-database/2565/

3 of 3 2/13/2013 9:53 PM