Pea leafminer Liriomyza huidobrensis€¦ · ornamental crops in Java, Sumatra and Sulawesi. It has become widely established on both cultivated and weed hosts. L. huidobrensis is

DEPARTMENT OFDEPARTMENT OFDEPARTMENT OFDEPARTMENT OF

PRIMARY INDUSTRIESPRIMARY INDUSTRIESPRIMARY INDUSTRIESPRIMARY INDUSTRIES

Pea leafminerPea leafminerPea leafminerPea leafminerLiriomyza huidobrensisLiriomyza huidobrensisLiriomyza huidobrensisLiriomyza huidobrensis (Blanchard) (Blanchard) (Blanchard) (Blanchard)

Liriomyza huidobrensis Draft Diagnostic Recommendations and Literature Review

2

Liriomyza huidobrensis Liriomyza huidobrensis Liriomyza huidobrensis Liriomyza huidobrensis (Blanchard)(Blanchard)(Blanchard)(Blanchard)

Bonny Rowles-van Rijswijk

Dr Mali Malipatil

Department of Primary Industries, Knoxfield

Private Bag 15

Ferntree Gully Delivery Centre

Victoria 3156

Australia

Published by Primary Industries Research Victoria

Department of Primary Industries

Knoxfield

June 2005

© Copyright State of Victoria 2005© Copyright State of Victoria 2005© Copyright State of Victoria 2005© Copyright State of Victoria 2005


3

This publication is copyright. No part may be reproduced by any process except in

accordance with the provisions of the Copyright Act 1968.

Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.Authorised by the Victorian Government, 1 Treasury Place, East Melbourne.

ISBN XXXXXXXISBN XXXXXXXISBN XXXXXXXISBN XXXXXXX

This publication may be of assistance to you but the State of Victoria and its

employees do not guarantee that the publication is without flaw of any kind or is

wholly appropriate for your particular purposes and therefore disclaims all liability

for any error, loss or other consequence which may arise from you relying on any

information in this publication.

For more information about DPI visit the website at www.dpi.vic.gov.au

or call the Customer Service Centre on 136 186.


4

Table of Contents

1. Leafminer; Liriomyza huidobrensis (Blanchard) __________________5

2. Distribution ________________________________________________6

3. Host Range and Feeding Damage ______________________________8

4. Life cycle _________________________________________________10

5. Control ___________________________________________________14

6. Threat to Australia _________________________________________14

7. Visual Identification ________________________________________16

8. Identification through Protein Electrophoresis __________________18

9. Molecular techniques used to distinguish Liriomyza _____________20

References _________________________________________________21

Related Articles______________________________________________23

Appendix 1. Plant hosts of Liriomyza huidobrensis.________________24

Appendix 2. A taxonomic description of Liriomyza huidobrensis, as

provided by Shiao & Wu (2000): ________________________________25

Appendix 3. An assay to separate the three leafminer species L.

huidobrensis, L. bryoniae and L. strigata, by means of protein

electrophoresis (Collins, 1996)._________________________________26


5

Liriomyza huidobrensis (Blanchard) Literature Review

1. Liriomyza huidobrensis (Blanchard)

The larvae of several families of flies and moths, that mine leaves of

horticultural crops (fig. 1), are collectively known as leafminers. The most

common and damaging species are small flies from the family Agromyzidae,

especially the Liriomyza species (WA, 2003).

Figure 1. Leafminer mines on a spinach leaf, making the produce unsaleable(© Ohio Sate University).

The pea leafminer, Liriomyza huidobrensis (Blanchard), was described

originally as Agromyza huidobrensis from South America (Blanchard, 1926).

Since that time, L. huidobrensis has undergone numerous name changes due

to changes in taxonomy;

L. cucumifoliae Blanchard

Agromyza huidobrensis Blanchard

L. dianthi Frick

L. langei Frick (WA, 2003).

This species has been further separated using molecular techniques, after it

was noted that populations of L. huidobrensis in different areas appeared to

prefer different plant hosts and exhibited varying levels of insecticide


6

resistance. Flies from California and Hawaii formed one clade, whilst

specimens from South and Central America formed another clade (Scheffer,

2000; Scheffer & Lewis, 2001).

Subsequently, the name L. huidobrensis (Blanchard) became restricted to flies

belonging to the South American clade, which includes all L. huidobrensis in

Central and South America and all introduced populations of L. huidobrensis.

The name L. langei Frick has been resurrected for the Californian clade of L.

huidobrensis-like flies found in California and Hawaii. It is estimated that the

South American and Californian clades diverged approximately 2 million years

ago. Although the two species have been separated using DNA sequence

data, they unfortunately can not be separated morphologically (Scheffer, 2000;

Scheffer & Lewis, 2001).

L. huidobrensis, in South and Central America, was under natural biological

control until it was secondarily subjected to massive amounts of insecticides

in the 1970s directed at a lepidopterean pest in potatoes (Chavez and Raman,

1987). This exposure to insecticides bred resistance, causing the leafminer to

develop into an economically important pest. At present, the only effective

insecticides are translaminar insecticides (abamectin, cyromazine, neem and

spinosad), which penetrate the leaves to affect the leafminer larvae

(Weintraub, 2002).

2. Distribution

Although endemic to South and Central America, L. huidobrensis was only

considered a minor pest. In the coastal areas of Peru it was generally kept in

check by a large complex of hymenopteran parasitoids. However, since the

early 1980s there has been a dramatic increase in damage to vegetables,

especially potatoes, due to over-use of insecticides, leading to the

development of insecticide-resist leafminers, and the elimination of it’s natural

enemies (Shephard et al., 1998).

During the past decade (1990-2000), L. huidobrensis has become globally

invasive and can now be found in many greenhouses and vegetable and flower


7

growing areas of Europe, Asia, Africa, and the Middle East (Scheffer & Lewis,

2001).

Insecticide-resistant L. huidobrensis was first detected in Europe in 1987 on

glasshouse- lettuces, grown in the Netherlands. The EPPO presumed that the

leafminer was imported directly from South America. Within the EPPO region

it has spread to Austria, Belgium, Cyprus, Czech Republic (Vlk, 1999), France,

Israel, Italy (including Sicily), Malta, Netherlands, Portugal, Spain (including

Canary Islands), and the UK (England, Northern Ireland, Scotland). L.

huidobrensis has been intercepted, or has occurred and been eradicated, in

Denmark, Finland, Germany, Ireland and Sweden. The leafminer remains

absent from a significant number of countries in Central and Eastern Europe

(Source:

http://www.eppo.org/QUARANTINE/insects/Liriomyza_huidobrensis/LIRIHU_ds.

pdf).

Subsequent to the leafminers’ spread throughout Europe, it was introduced

into Israel. The first outbreak in Israel occurred in February 1992 in the Jordan

Valley, when chrysanthemum growers encountered a leafminer that could not

be chemically controlled. It is thought that L. huidobrensis had probably

entered Israel 1-2 years prior to this sighting (Weintraub and Horowitz, 1995).

L. huidobrensis has been reported in Asia, within India, Thailand (Source:

http://www.eppo.org/QUARANTINE/insects/Liriomyza_huidobrensis/LIRIHU_ds.

pdf), China (He et al., 2002), Taiwan (Shiao & Wu, 2000), and Indonesia

(Shephard et al., 1998).

The pea leafminer was first found in Taiwan in 1999, most likely on smuggled

in on plant material or entered due quarantine failure. It is now a widespread

and dominant pest species on some vegetable crops (Cucurbitaceae, legumes

and composites) (Shiao & Wu, 2000). Shortly thereafter, there were outbreaks

of L. huidobrensis in China, which were proven to originate from the South

American clade after phylogenetic analysis (sequenced mitochondrial

cytochrome oxidase II gene) (He et al., 2002).

The greatest threat to the Australian potato industry comes from Indonesia. L.

huidobrensis was first reported in potatoes, in Java, in 1994. Since then L.

huidobrensis has rapidly spread and can be found on many vegetable and


8

ornamental crops in Java, Sumatra and Sulawesi. It has become widely

established on both cultivated and weed hosts. L. huidobrensis is thought to

have been introduced into Indonesia on cut flowers from Europe or North

America (Shephard et al., 1998).

L. huidobrensis has established because cooler temperatures, such as in the

highland vegetable production areas of Indonesia, favour feeding and

oviposition. Severe damage occurs on potato, shallots, tomato, beans, and

other crops, ornamentals and weeds at high elevations in Sumatra and Java

(Shephard et al., 1998). It should be noted “that potato was especially

susceptible to attack by L. huidobrensis, and severely damaged fields were

common. On occasion estimated yield losses were 75%. Farmers mentioned

that no pesticide was effective against the leafminer in potato, and some

growers were abandoning potato cultivation in favour of sweet potato. In the

Alahan Panjang area of West Sumatra, it was estimated that about 40% of the

usual potato-growing area was now planted to other crops due to devastating

attacks by L. huidobrensis” (Shephard et al., 1998).

3. Host Range and Feeding Damage

L. huidobrensis, along with two other leafminers of economic importance, L.

sativae and L. trifolii, is on the EPPO A1/A2 quarantine list (Shiao, 2004), in part

due to the breadth of its plant host range. Unlike most species of

Agromyzidae, L. huidobrensis is highly polyphagous, with 14 plant families

recorded as hosts. This leafminer has no clear preference for any particular

family; hosts include numerous vegetable and flower crops (appendix 1)

(Scheffer & Lewis, 2001; WA, 2003).

The larvae of L. huidobrensis tunnel in the chloroplast-containing spongy

mesophyll layers, disrupting photosynthesis (Shephard et al., 1998). The

larvae leave winding trails (mines) as they feed inside leaves and other plant

parts. The mines are easily visible (fig. 1-4), and when the larvae are in large

numbers this feeding damage can cause substantial economic losses (Arnold,

2002).


9

Figure 2. Damage to celery typical of Liriomyza huidobrensis(Source: Ministry of Agriculture and Food Ontario, Canada. © Queen's Printer for

Ontario).

Figure 3. Mines on snap-beans caused by feeding larvae(© J. Lotz, Division of Plant Industry University of Florida).

Figure 4. Mines on potato caused by feeding larvae (© REDEPAPA-CORPOICA).

The typical feeding habits and symptoms of adult and larval leafminers are

listed below (WA, 2003):

• Adult leafminer feeding punctures appear as white speckles 0.13-0.15 mm

in diameter,

• Oviposition punctures are smaller (0.05 mm diameter), more uniformly

round, and difficult to detect with the naked eye,


10

• The larvae feed primarily within the leaf tissues, with the exception of peas,

where larvae may also feed on the outer surface of young seed-pods,

• Larval mines are usually white with dampened black and dried brown areas,

and are commonly associated with the midrib and lateral leaf veins,

• Mines are serpentine, tightly coiled and of irregular shape, increasing in

width as larvae mature,

• If several larvae are feeding on a single leaf, the damage may produce a

secondary ‘blotch’ mine type and leaf wilt may occur.

Symptoms produced specifically in potato are listed below:

• ‘Feeding punctures can often be seen all over the growing plant, giving the

impression that a generalised outbreak of larval infestation is in process,

• The development of the larval damage follows a fixed pattern, somewhat

different from that of the adult fly population,

• Firstly, the initial larval infestation and corresponding damage occur in the

lower third of the plant, moving upwards to the top of the plant. At this time,

practically the whole aboveground part of the plant becomes necrotic and

dies,

• Larval damage is consistently less severe during vegetative growth stages

than when the plant the plant is full-grown, which may be explained by the

occurrence of egg extrusion in the growing leaves’ (WA, 2003).

4. Life cycle

Female L. huidobrensis puncture leaves to lay eggs within the leaf tissue, and

feed on plant sap. Eggs are inserted just below the leaf surface (fig. 5), and the

number of eggs laid varies according to temperature and plant host; eggs are

0.2-0.3 mm x 0.10-0.15 mm, off-white in colour, and slightly translucent. It

should be noted that approximately 15% of the punctures made by L. trifolii

and L. sativae (two very closely related leafminer species) contain viable eggs

(WA, 2003).


11

Figure 5. L. huidobrensis egg excised from under plant leaf surface(©UC Statewide IPM Project Jack Kelly Clark)

Feeding punctures cause the destruction of a large number of cells and are

more clearly visible to the naked eye than punctures caused by oviposition

(fig. 6). Male L. huidobrensis are unable to puncture leaves, but have been

observed feeding at punctures produced by females. Both male and female

leafminers take nectar from flowers (WA, 2003).

Figure 6. Feeding and oviposition punctures on cauliflower leaves by the pealeafminer, Liriomyza huidobrensis (© J. Lotz, Division of Plant Industry University of

Florida).

Eggs hatch in 2-5 days, according to temperature, producing larva that are tiny

cream or pale yellow maggots about 2 mm long. The headless maggots grow

up to 3.25 mm in length (fig. 7). The first-instar are colourless on hatching,

turning pale yellow-orange, with later instars being yellow-orange in colour.

The posterior spiracle (respiratory aperture) forms a crescent with 6 to 9

mounted spores (WA, 2003).


12

Figure 7. Leafminer larva excised from mine (© UC Statewide IPM Project Jack KellyClark).

Larval development is generally 4-7 days at mean temperatures above 24oC,

however, at higher temperatures larval development can be stunted, as shown

in California, when reductions in population levels of L. huidobrensis were

seen once daily maximum temperatures reached 40oC (WA, 2003).

L. huidobrensis pupates within the leaf, whereas other species of leafminer

usually pupate externally either on the foliage or in the soil just beneath the

surface. High humidity and drought adversely affect pupation. The pupa is

oval, slightly flattened ventrally (ventral - abdominal segment of an insect), 1.3-

2.3 x 0.5-0.75 mm, and variable colour. The pupae can look like shiny tan or

brown grains of rice (fig. 8). Adult leafminers (fig. 9) emerge 7-14 days after

pupation when the temperature is 20-30oC; at lower temperatures emergence is

delayed (WA, 2003).

Figure 8. Leafminer pupa (© UC Statewide IPM Project Jack Kelly Clark).


13

Figure 9. Adult Liriomyza huidobrensis (© UC Statewide IPM Project Jack Kelly Clark).

Peak emergence of adults occurs before midday, with male leafminers usually

emerging before females. Mating takes place 24 hours after emergence, and a

single mating is sufficient to fertilise all eggs laid (WA, 2003).

The adults generally live for 15-30 days, with females living longer than males.

The adult is small, greyish-black, compact-bodied, 1.3-2.3 mm in both body

length and wing length. Female adults are slightly larger than males. In

general, any agromyzid of this size with a bright-yellow central area of the

scutellum and bright yellow areas of the head and pleura, belongs to the genus

Liriomyza, which makes it difficult to distinguish between species (WA, 2003).

To give an example of the length of each life stage; in Peru the life cycle is as

follows: egg stage (3-4 days), 1st instar larva (3-4 days), 2nd instar larva (2-3

days), 3rd instar (3-4 days), pupal stage (12-18 days), with females having an

average longevity of 3-28 days, and males 2-6 days. The mean number of eggs

laid per female in winter is 117, and spring 161 (WA, 2003).

In Southern USA, the endemic leafminers’ life cycle is most probably

continuous throughout the year, although there is a noticeable first generation,

which reaches a peak in April, with the lifecycle completed in 17-30 days

during summer, and 50-65 days in winter. In the Netherlands and Czech

Republic, the leafminer is mainly a glasshouse pest, but a proportion of the

pupae can survive outdoors during an average Dutch winter, proving how

adaptable this pest is (Vlk, 1999; WA, 2003).


14

5. Control

Apart from quarantine regulations imposed, there are no control methods for L.

huidobrensis. Researchers are looking at alternative pesticides and plant

breeding programs to develop methods of control for leafminer populations.

In Israel, Weintraub and Horowitz (1997) have studied the effects of a neem-

based larvicide, in an effort to expand the spectrum of pesticides available

against L. huidobrensis. Laboratory bean plants were treated with soil

drenches and by dipping leaves in insecticidal solutions. It was found that

‘treating the plants with the neem insecticide before exposure to egg-laying

adults had a greater effect on inhibiting the development of pupae and adult

eclosion than treatment at the 1st-instar larval stage. The systemic effects from

a soil drench had a greater adverse effect on pupation and adult eclosion than

leaf dipping’ (Weintraub & Horowitz, 1997).

In China, the host feeding and oviposition selection of 47 plant species by the

female leafminer was studied. After studying 15 leaf tissue structure

characteristics, it was found that the host feeding selection positively

correlated with the percentage moisture content of leaves, and negatively with

thickness of the epidermis wall, the densities of the palisade and spongy

tissues of leaves. Thickness of epidermis wall, densities of the palisade and

spongy tissues can act as a physical barrier to female oviposition, and hence,

leafminer larvae activity. The three traits could be selected in future plant

breeding programs (Wei et al., 2000).

6. Threat to Australia

The West Australian Government has assessed the risk of entry, establishment

and spread of L. huidobrensis in Australia. In each case it was found to be high

Current quarantine and phytosanitary measures rely on cold storage and

inspections to prevent the insect from entering Australia. It is known that all

life stages of L. huidobrensis are killed within a few weeks by cold storage at


15

0oC, with the exception of newly laid eggs. Therefore, cuttings of infested

plants are maintained under normal glasshouse conditions for 3-4 days after

lifting, to allow eggs to hatch, and then subsequently stored at 0oC for 1-2

weeks to kill the leafminer larvae (WA, 2003).

For the importation of fresh vegetables and cut flowers, storage at 0oC is not

an option, so inspections of produce are required. For Apium, Capsicum,

carnations, chrysanthemums, Cucumis, Gerbera, Gypsophila, lettuces,

Senecio and tomatoes from countries where the pest occurs, it is

recommended that propagating material (except seeds) of must be inspected

at least every month, and found to be pest-free during the previous three

months. And a phytosanitary certificate is required for all imports of cut

flowers and vegetables with leaves (WA, 2003).

Although there are phytosanitary measures in place, intercepts of insects and

other invertebrates occur, mostly on cutflower imports from African countries

(South Africa, Zimbabwe and Kenya), India, Singapore and to a lesser extent

China. These intercepts are a cause for concern, as the Australian climate, and

wide range of host plants both in glasshouses and outside provides ideal

conditions for establishment for L. huidobrensis. Once established, the

economic impact would be high, and spread rapid, due to the frequent

movement of produce between nurseries and markets in the cutflower and

other horticultural industries (WA, 2003).

Dispersal within crops by L. huidobrensis is by flight, but movement is

restricted as they are weak fliers, with peak flight times only at 8:00-10:00 and

18:00-20:00. Human aided dispersal is of far greater concern, such as when

plant material is moved from propagating nurseries, to other commercial

premises. As an example, in South Africa virtually the whole country was

infested within 3 years due to human aided dispersal (WA, 2003).


16

7. Visual Identification

Shiao (2004) found that the use of abdominal colour patterns for rapid, easy

species identification was only suitable for use on adult males, and that to

distinguish between Liriomyza species required the use of boiled up male

genitalia. A range of morphological features needs to be used to identify a

species of Liriomyza, but the depth of knowledge needs to be increased,

especially as L. huidobrensis can easily confused with L. bryoniae, not only

from external morphology but also from male genitalia (Shiao, 2004; Shiao &

Wu, 2000).

Shiao & Wu (2000) found that in general, L. huidobrensis adults have a larger

body size and darker body colour when compared with other Liriomyza pests,

and that the male genitalia (especially the phallus), is undoubtedly the most

characteristic. Careful examination of male genitalia from both from lateral and

ventral aspects is needed, to prevent mis-identification with similar, closely

related species. Appendix 2 contains a description to aid in the identification of

L. huidobrensis (Shiao & Wu, 2000).

In Israel, the emphasis is on distinguishing L. huidobrensis from L. trifolii, both

major agromyzid pests, causing similar damage to crops by oviposition and

feeding. In general, L. trifolii is smaller and distinctly yellowish in appearance;

whereas the overall appearance of L. huidobrensis is dark. See the diagram

below (fig.10) for specific differences (Weintraub, 2002).


17

Figure 10. Colour Differences Between Liriomyza huidobrensis and L.trifolii.A1, B1, C1 - L. trifolii; A2-3, B2-3, C2 - L. huidobrensisA. Fly head showing background coloration,B. B. Body side (mesopleuron),C. Back (mesonotum and scutellum)(© Gilat Research Center).

In 2003, the Western Australian Department of Agriculture released a datasheet

for the cutflower industry on how to distinguish L. huidobrensis from L. trifolii

and L. bryoniae (WA, 2003). A set of simple characters, listed below, is used

for initial identification.

- L. huidobrensis has inner vertical setae usually on a dark ground (yellow

mixed with black) and outer vertical setae standing on a black ground, and the

prescutum and scutum are shiny black.

- L. trifolii and L. bryoniae have inner and outer vertical setae on a yellow

ground, whereas L. sativae has inner vertical setae on a yellow ground (WA,

2003).

A comprehensive protocol produced by the Central Science Laboratory, UK,

presents visual methodologies by which the identity of L. huidobrensis can be

confirmed from larvae, pupae, or adult

flies.(http://www.csl.gov.uk/science/organ/ph/diagpro/liriomyza.pdf).


18

The EPPO Protocol for the detection of L. huidobrensis, L. bryoniae, and L.

sativae concludes that identification based on morphological differences

outlined by Spencer (1973) and Knodel-Montz & Poe (1982) is slow compared

to protein electrophoresis (Anon, 1992). The EPPO protocol, although

recognising that differences exist between the types of mines produced by the

larvae of different Liriomyza species, finds that mines are not a reliable

diagnostic as these differences depend very much on the host species (Anon,

1992).

8. Identification through Protein Electrophoresis

Menken and Ulenberg (1986) developed a diagnostic protocol to separate the

Liriomyza pest species, L. bryoniae, L. huidobrensis, L. sativae and L. trifolii,

listed in the EC legislation, including the pre-adult stages, which are

morphologically difficult to separate. This last point is particularly important,

as larvae and pupae are usually the life stages intercepted by European

quarantine.

This protocol is able to identify each species at all three stages of the life

cycle. The techniques of specimen preparation, horizontal starch gel

electrophoresis and enzymatic staining are described in Menken (1982) and

Menken & Ulenberg (1983), with specific buffer formulations described below.

Although individuals can be used, it is recommended to use 2-5 individuals of

the same life stage, as individual insects can show low activity over the range

of enzymes studied. The biochemical key (key 1) below describes how to

interpret the results.

The specific buffer systems used for each enzyme assay were as follows:

I. Electrode buffer: 0.23 M Tris and 0.086 M Citric acid; pH 6.3

Gel buffer: 0.008 M Tris and 0.003 M Citric acid; pH 6.7; 6 h at 12 V/cm

II. Electrode buffer: 0.01 M EDTA, 0.25 M Boric acid and 0.45 M Tris; pH 8.7

Gel buffer: 1/20 diluted electrode buffer; 5 h at 20 V/cm

III. Electrode buffer: 0.3 M Boric acid and o.o5 M NaOH; pH 8.65

Gel buffer: 0.076 M Tris and 0.005 M Citric acid; pH 8.65; 6.5 h at 20V/cm


19

Key 1. Biochemical key to the species of Liriomyza (L. bryoniae is used as

standard).

1. 6-Phosphogluconate dehydrogenase. – Mobility same as or slower than

standard 1

-. 6-Phosphogluconate dehydrogenase. – Mobility faster than standard

2

2. Isocitrate dehydrogenase. – Mobility same as standard

bryoniae

-. Isocitrate dehydrogenase. – Mobility slower than standard huidobrensis

3. Isocitrate dehydrogenase. – Mobility same as standard. Malic enzyme. –

Mobility notably slower than standard

trifolii

-. Isocitrate dehydrogenase. – Mobility faster than standard. Malic enzyme. –

Mobility same or somewhat slower than standard

sativae

The EPPO quarantine procedure recommends the process described by

Menken & Ulenberg (1983, 1986), as once prepared, the method can provide an

unequivocal identification within 24 hours, after the specimen has been

identified to belong to one of four species, L. bryoniae, L. huidobrensis, L.

sativae, L. trifolii (Anon, 1992).

Collins (1996) developed an assay to separate the three leafminer species L.

huidobrensis, L. bryoniae and L. strigata, by means of protein electrophoresis

on a cellulose acetate membrane. The protocol involves staining for 2

enzymes, glucose-6-phosphate dehydrogenase (G6PDH) and leucine-glycine

peotidase (PEP). The effect of parasitism on L. huidobrensis by Dacnusa

sibirica was investigated and shown unlikely to cause mis-identification of the

leafminer host. The protocol is described in appendix 3.


20

9. Molecular techniques used to distinguish Liriomyza

Although there are no polymerase chain reaction (PCR) primer pairs specific

for the detection of L. huidobrensis, DNA fragments have been amplified from

this leafminer species, as described in the three protocols below.

Scheffer (2000) used PCR and DNA sequencing of amplicons to show that what

was previously believed to be L. huidobrensis were actually two distinct

clades, L. huidobrensis and L. langei. The method used is outlined below.

Adult L. huidobrensis were stored in 95-100% ethanol prior to testing. Each

specimen was ground for DNA extraction in 180 µl of phosphate-buffered

saline. Subsequent DNA extraction followed the Blood and Body Fluid Protocol

of the QIAmp Blood Kit. Each extract was subjected to PCR using two sets of

primers. The first primer set, C1-J-2797 (5’-cctcgacgttattcagattacc) and TK-N-

3785 (5’-gtttaagagaccagtacttg) amplified a 987 bp product spanning portions of

the mitochondrial cytochrome oxidase I and II genes and all of the leucine

tRNA. The second primer set C2-J-3279 (5’-ggacaacttattgaaataatttgaac) and

C2-N-3389 (5’-tcataacttcagtatcattg) was used to generate a product suitable for

sequencing.

Because the primer sets were not specific to Liriomyza, or L. huidobrensis,

Scheffer et al. (2001) developed a restriction fragment length polymorphism-

PCR (RFLP-PCR). The amplicon generated by the primer pair C1-J-2797 and

TK-N-3785 was digested with the restriction enzymes EcoRV and SpeI to

differentiate between L. huidobrensis and L. langei. After digestion, the two

species could be distinguished, as amplicons generated by L. langei were

broken into 611 bp and 420 bp components by SpeI, and 1031 bp by EcoRV.

Whereas amplicons from L. huidobrensis were cut into 1031 bp pieces by SpeI

and 856 bp and 175 bp by EcoRV. The RFLP-PCR was not expanded to include

other Liriomyza species.


21

Kox et al. (2005) developed an RFLP-PCR assay to distinguish between four

economically important Liriomyza species; L. huidobrensis (includes L.

langei), L. bryoniae, L. sativae and L. trifolii. The protocol developed was

found to be robust enough to generate results from specimens stored at –80oC

for more than a decade and samples kept in 70% ethanol for over two years.

However, the primer pair, TL2-J-3037 (atggcagattagtgcaatgg) and TK-N-3785Lir

(gtt(a/t)aagagaccatt(a/g)cttg), used to generate a 790 bp product spanning the

mitochondrial COII gene, is not specific for Liriomyza, as products can also be

amplified from other insect species. And there were discrepancies in the

restriction digestions (using the enzymes DdeI, HinfI, SspI and TaqI) for L.

sativae and L. trifolii due to unexpected sequence differences, owing to

geographical origin.

References

Anon (1992) Quarantine procedure. Identification of Liriomyza spp. Bulletin

OEPP/EPPO 22, 235-238.

Arnold J (2002) Leafminers identified faster - molecular structure differentiates

two pests - Brief article.

http://www.findarticles.com/p/articles/mi_m3741/is_7_50/ai_90117989/print

July, 1-3.

Blanchard E (1926) A dipterous leaf-miner on Cineraria, new to science. Review

of Social Entomology Argentina 1,10-11.

Collins DW (1996) The separation of Liriomyza huidobrensis (Diptera:

Agromyzidae) from related indigenous and non-indigenous species

encountered in the United Kingdom using cellulose acetate electrophoresis.

Annals of Applied Biology 128, 387-398.

He L, Zhang Y, Xiao N, Wei J and Kuang R (2002) Liriomyza huidobrensis in

Yunnan, China: current distribution and genetic structure of a recently

established population. Entomolgia Experimentalis et Applicata 102(3), 213-

219.


22

Kox LFF, van den Beld HE, Lindhout BI and de Goffau LJW (2005) Identification

of economically important Liriomyza species by PCR-RFLP analysis. Bulletin

OEPP/EPPO Bulletin 35, 79-85.

Menken SBJ (1982) Biochemical genetics and systematics of small ermine

moths (Lepidoptera, Yponomeutidae). Zeitschrift fur zoologischen Systematik

und Evolutionsforschung 20, 131-143.

Menken SBJ and Ulenberg SA (1983) Diagnosis of the agromyzids Liriomyza

bryoniae and L. trifolii by means of starch gel electrophoresis. Entomologia

experimentalis et applicata 34, 205-208.

Menken SBJ and Ulenberg SA (1986) Allozymatic diagnosis of four

economically important Liriomyza species (Diptera: Agromyzidae). Annals of

Applied Biology 109, 41-47.

Scheffer SJ (2000) Molecular evidence of cryptic species within Liriomyza

huidobrensis (Dipter: Agromyzidae). Journal of Economic Entomology 93(4),

1146-1151.

Scheffer SJ and Lewis ML (2001) Two nuclear genes confirm mitochondrial

evidence of cryptic species within Liriomyza huidobrensis (Diptera:

Agromyzidae). Annals of the Entomological Society of America 94(5), 648-653.

Scheffer SJ, Wijesekara A, Visser D and Hallett RH (2001) Polymerase chain

reaction-restriction fragment-length polymorphism method to distinguish

Liriomyza huidobrensis from L. langei (Diptera: Agromyzidae) applied to three

recent leafminer invasions. Journal of Economic Entomology 94(5), 1177-1182.

Shepherd BM, Samsudin and Braun AR (1998) Seasonal incidence of Liriomyza

huidobrensis (Diptera: Agromyzidae) and its parasitoids on vegetables in

Indonesia. International Journal of Pest Management 44(1), 43-47.

Shiao SF (2004) Morphological diagnosis of six Liriomyza species (Diptera:

Agromyzidae) of quarantine importance in Taiwan. Applied Entomology and

Zoology 39(1), 27-39.


23

Shiao SF and Wu WJ (2000) Liriomyza huidobrensis (Blanchard), a newly

invaded insect of economic importance to Taiwan (Diptera: Agromyzidae).

Plant Protection Bulletin 42, 249-254.

Vlk R (1999) Distribution of quarantine leafminers Liriomyza spp. In the Czech

Republic, especially their occurrence and overwintering outside glasshouses.

Bulletin OEPP/EPPO 29, 85-89.

WA (2003) Hortguard Threat Data Sheet for the Cutflower Industry in WA.

Common Name (Scientific Name): Liriomyza huidobrensis (Blanchard)) &

Liriomyza trifolii Burgess, 1880)). Department of Agriculture, Western Australia,

October, 1-28.

Wei J, Zou L, Kuang R and He L (2000) Influence of leaf tissue structure on

host feeding selection by pea leafminer Liriomyza huidobrensis (Diptera:

Agromyzidae). Zoological Studies 39(4), 295-300.

Weintraub P (2002) The Pea Leafminer, Liriomyza huidobrensis, in Israel.

http://www.agri.gov.il/gilat-molcho/leafminer_english.html

Weintraub, P.G. and Horowitz, A.R. 1995. The newest leafminer pest in Israel,

Liriomyza huidobrensis. Phytoparasitica 23,177-184.

Related Articles

Morgan DJW, Reitz SR, Atkinson PW and Trumble JT (2000) The resolution of

Californian populations of Liriomyza trifolii (Diptera: Agromyzidae) using PCR.

Heredity 85, 53-61.

Trumble JT & Quiros CF (1988) Antixenotic and antibiotic resistance in Apium

species to Liriomyza trifolii (Diptera: Agromyzidae). Journal of Economic

Entomology 81(2), 602-607.

Zhao YX and Kang L (2003) Olfactory responses of the leafminer Liriomyza

sativae (Dipt., Agromyzidae) to the odours of host and non-host plants. Journal

of Applied Entomology 127, 80-84.


24

Appendix 1. Plant hosts of Liriomyza huidobrensis.

Botanical Name Common Name Botanical Name Common Name

Primary hosts:

Allium cepa onion Allium sativa garlic

Apium graveolens celery Chrysanthemum

x morifolium

(chrysanthemum

(flortists’))

Cucurbita peo ornamental gourd Lactuca sativa (lettuce)

Phaseolus

vulgaris

bean

Secondary hosts:

Amaranthus grain amaranth Amaranthus

retroflexus

redroot, Prince of

Wales

Aster Beta vulgaris beetroot

Calendula marigolds Capsicum annum bell pepper

Cucumis melo melon Cucumis sativa cucumber

Datura Galinsoga

Gerbera Baberton’s daisy Gypsophila

paniculata

babysbreath

Lathyrus vetchling Linum

Lycopersicum

esculentum

tomato Medicago sativa lucerne, alfalfa

Melilotus melilots Petunia Petunia

Pisum sativum

var. arvense

Austrian winter

pea

Solanum

melongena

aubergine

Solanum

tuberosum

potato Spinacia oleracea spinach

Tagetes marigold Tropaeolum nasturtium

Vicia faba broad bean

Wild hosts:

Bidens pilosa spanish needle Emilia sonchifolia consumption

weed

Galinsoga

parviflora

gallant soldier Portulaca

oleracea

pigweed

Sonchus sowthistle Oxalis wood sorrels


25

(WA, 2003).

Appendix 2. A taxonomic description of Liriomyza huidobrensis, as provided

by Shiao & Wu (2000):

Adult:

- Medium-sized species; wing length 1.7 mm in male, 2.0 mm in female

- Frons yellow, about 1.5 times as wide as eye

- Gena and postgena bright yellow; vertical angle, ocellar triangle, and

occiput dark brown to black

- Antenna yellow with 3rd segment rounded laterally, arista dark brown and

pubescent Orbital bristles 4 pairs; upper 2 pairs directed upwards, lower 2

pairs obviously inclinate

- Both inner and outer vertical bristles on brown ground

- Dorsocentral bristles 1 + 3 type

- Acrostichals in about 4 irregular rows

- Halter yellow

- Costa extending to M1+2; M1+2 near to wing tip; proportion of 2nd to 4th

costal sections, 5.2: 1: 1.3

- Squama brown with long dark fringes

- Male terminalia: Surstylus bearing 1 stout spine and 4-5 sensory hairs on

posteroventral tip

- Cercus covered with long hairs

- Sperm pump elongated with larger basal bulb

- Phallus length about 0.17 mm; distiphallus paired and sac-shaped from

ventral view, mesophallus well-developed with obvious long membranous

process, membranous area obviously divide the distiphallus and

mesophallus, basiphallus short but highly sclerotized

- Female terminalia: 9th sternite with 4 pairs of marginal setae

- Cercus with 7 setae and 6 tactile sensilla.

Larva:

- Fully-developed third instar about 2.5 mm in length

- Mandible with 2 teeth

- Posterior spiracle with 6 to 9 pores; anterior spiracle with 5 pores


26

Appendix 3. An assay to separate the three leafminer species L.

huidobrensis, L. bryoniae and L. strigata, by means of protein

electrophoresis (Collins, 1996).

1. All equipment used during sample preparation and the electrophoretic run

was manufactured by Helena Laboratories (UK). The basic components were

an electrophoretic chamber (UK Cat # 1283) and an applicator kit (UK Cat #

4093), the latter made up of the applicator itself, a sample well plate and an

aligning base for the electrophoretic plates.

2. Each well was filled with 5 µl of a NADP grinding buffer solution (10 mg

NADP in 1 ml sdH2O). Specimens to be assayed were either fresh or frozen at –

80oC and applied as individual larvae or puparia to each well. They were then

crushed using the end of a heat sealed pasteur pipette.

3. Electrophoresis was carried out using 94 x 76 mm cellulose acetate plates

(Titan III: Cat # 3024). The applicator was used to load the homogenate onto 2

plates. These were run simultaneously at 200V (approx. 2 mA per plate) in a 25

mM Tris Glycine, pH 8.5, gel/electrode buffer (with 50 mg NADP added per litre

of buffer).

4. After 20 min one plate was removed from the electrophoretic chamber and

stained for glucose-6-phosphate dehydrogenase (G6PDH) (EC 1.1.1.49).

5. The second plate was run for a further 20 min before removal and staining

for leucine-glycine peptidase (PEP) (EC 3.4.22 or 13).

6. Plates were stained for these specific enzymes following the staining

schedules outlined in the Helena Laboratories Handbook (Herbert & Beaton,

1989).

7. Interpretation of the band patterns of unknown samples was made by direct

comparison with those from pupae taken from the laboratory cultures of L.

huidobrensis and L. bryoniae and run on the same plate.

This comparative approach was essential as proteins on a cellulose acetate

plate are subject to the phenomenon of evaporative drift, whereby their

movement through the gel matrix is not at a constant rate. As a result, the

position of a protein cannot be predicted simply by reference to previous runs.

Documents

Pea leafminer Liriomyza huidobrensis€¦ · ornamental crops in Java, Sumatra and Sulawesi. It has become widely established on both cultivated and weed hosts. L. huidobrensis is