JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Nov. 1999, p. 6898–6906 Vol. 181, No. 22

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Partition of the Linear Plasmid N15: Interactions of N15Partition Functions with the sop Locus of the F Plasmid

N. RAVIN1 AND D. LANE2*

Bioengineering Centre, Russian Academy of Sciences, Moscow, 117312 Russia,1 and Laboratoire de Microbiologie etGenetique Moleculaire, 31062 Toulouse, France2

Received 26 July 1999/Accepted 1 September 1999

A locus close to one end of the linear N15 prophage closely resembles the sop operon which governs partitionof the F plasmid; the promoter region contains similar operator sites, and the two putative gene products haveextensive amino acid identity with the SopA and -B proteins of F. Our aim was to ascertain whether the N15sop homologue functions in partition, to identify the centromere site, and to examine possible interchange-ability of function with the F Sop system. When expressed at a moderate level, N15 SopA and -B proteins partlystabilize mini-F which lacks its own sop operon but retains the sopC centromere. The stabilization does notdepend on increased copy number. Likewise, an N15 mutant with most of its sop operon deleted is partlystabilized by F Sop proteins and fully stabilized by its own. Four inverted repeat sequences similar to those ofsopC were located in N15. They are distant from the sop operon and from each other. Two of these were shownto stabilize a mini-F sop deletion mutant when N15 Sop proteins were provided. Provision of the SopAhomologue to plasmids with a sopA deletion resulted in further destabilization of the plasmid. The N15 Sopproteins exert effective, but incomplete, repression at the F sop promoter. We conclude that the N15 sop locusdetermines stable inheritance of the prophage by using dispersed centromere sites. The SopB-centromere andSopA-operator interactions show partial functional overlap between N15 and F. SopA of each plasmid appearsto interact with SopB of the other, but in a way that is detrimental to plasmid maintenance.

The temperate coliphage N15 is in most respects a phage ofthe lambda type. Its DNA is similar to that of l, 46.4 kb longand double stranded, with cohesive ends (33, 35, 39). Its lyticdevelopment resembles that of l, resulting in virions withl-like morphology, and it lysogenizes at similar frequencies(33). Its head and tail genes have extensive homology withthose of l, and the elements which control transcription anddetermine prophage immunity find their homologues in therepressor, operator, and antiterminator functions of l and P22(20). But the physical state of the N15 prophage is distinctive.Whereas the l prophage is integrated into the chromosome,N15 prophage is a low-copy-number plasmid (35, 36). More-over, unlike other prophage plasmids, such as P1, N15 is alinear double-stranded DNA molecule with closed, hairpin-like ends (39), the only replicon of Escherichia coli known to bestably maintained in this state.

The nucleotide sequence of N15 was published recently (13).Comparison of this sequence with those in the sequence data-bases revealed extensive homology with temperate-phage ge-nomes, as indicated above. But perhaps the most remarkablesimilarity was that of a discrete region, close to one end of theN15 prophage, with the locus that governs partition of F plas-mid copies to daughter cells (Fig. 1). This locus, sop, containsan operon of two genes (sopA and sopB) and a centromere-likesite, sopC: all three elements are essential for stable inheri-tance of F in dividing cells (1, 28). The SopA protein binds tothe sop promoter and, together with SopB, represses transcrip-tion of the operon, which thus is autoregulated (25). The SopBprotein binds to sopC and, together with SopA and unknownhost factors, orients F plasmid siblings and impels them to-wards the centers of the new daughter cells (8, 11, 25, 27).

The sop-like sequence of N15 includes the promoter regionand two open reading frames encoding proteins similar toSopA and SopB, suggesting that the N15 sop homologue mightspecify a partition mechanism which ensures stable inheritanceof the N15 prophage. Insertion of a transposon in this locusdestabilizes plasmid maintenance (37). On the other hand, theN15 locus lacks an obvious counterpart of the 12 43-bp repeatswhich constitute the essential sopC site. Moreover, N15 wasreported to be fully compatible with F (39). It was possible,therefore, that the sop homologue might be vestigial, as ob-served for certain replication loci in the F plasmid, or that itplays a role other than partition in maintenance and propaga-tion of N15. The work reported in this paper was undertakento determine whether the sop homologue in N15 is involved inpartition and whether it interacts with the F plasmid partitionsystem. (In a recently published review article [36a], the N15sop region is referred to as par. Because the degree of homol-ogy of the proteins encoded by this region with the F Sopproteins is significantly higher than that with any other parti-tion proteins, we will continue to use sop in this article todescribe the components of the N15 partition system.)

MATERIALS AND METHODS

Bacteria and growth conditions. The strains used in this study were derivativesof Escherichia coli K-12. MC1061 (5) and DH10B (9) were the primary recipientsfor transformation with DNA ligated in vitro. Strain DLT1127 was used formeasurement of sop promoter activity: it was constructed by first preparing alysate of a strain carrying the Kanr sopP::lacZ fusion plasmid, pZC450 (42), withlRS88 (38) and then selecting a Kanr Lac1 monolysogen from MC1061 (Dlac)cells infected with the lRS88 lysate. DH10B (recA1) was the host strain forplasmid stability measurements.

Cultures were grown with aeration at 37°C in Luria-Bertani (LB) broth (24),supplemented as appropriate with chloramphenicol (20 mg/ml) or kanamycin (50mg/ml) and with 1.5% agar (Difco) for solid medium.

Plasmids. (i) Mini-F plasmids. All mini-F plasmids were derived frompDAG114 by restriction fragment-mediated deletion and/or insertion of PCRfragments (Fig. 2). pDAG114 is an essentially wild-type mini-F which carries theresD-rfsF multimer resolution determinants and a Ccd system disabled by Kle-now polymerase-mediated filling of the ApaLI site in ccdB. The N15 sop operon

* Corresponding author. Mailing address: Laboratoire de Microbi-ologie et Genetique Moleculaire, 118 Route de Narbonne, 31062 Tou-louse, France. Phone: (33) 5 61 33 59 68. Fax: (33) 5 61 33 58 86.E-mail: dave@ibcg.biotoul.fr.

6898

was amplified by PCR on N15 DNA using an upstream primer, 59-GATGTTAACCTTAACTTTGCGTTTTC (PR1), with an HpaI site (underlined) and down-stream primers with SalI sites (underlined), 59-GGCGTCGACTATTGACCCTATTTTTTCTC (PR4; the double underline indicates the sopB stop codon),TGATTGTCGACTGTTGTAAAAAGCGA (PR6), and CATGTGTCGACTCGTTACTTGTTTC (PR9), and was inserted between the Eco47III and SalI sitesof pDAG114, thus deleting the entire F sop locus and giving mini-Fs without(pDAG214) and with (pDAG216 and -219) the downstream inverted repeat. Afragment containing the IR2 sopC-like sequence was made by annealing two46-mers (TCGAATAATCTGATATCGTGCGACCATGGTCGCACGGAATAGAAAA [PR23; the inverted repeat {IR2} sequence is underlined] and CACGTTTTCTATTCCGTGCGACCATGGTCGCACGATATCAGATTAT [PR24])whose 59 ends were complementary to the bases exposed by SalI and AflIIIcleavage of pDAG219; the fragment was inserted between these sites to makepDAG215. All deletions were made, using the restriction endonucleases shownin Fig. 2, by repair of the ends with DNA polymerases and deoxynucleoside

triphosphates (Klenow and T4 for 59 and 39 extensions, respectively) followed byligation.

(ii) pZS*21 plasmids. For provision of sop function in trans, sopA and -B geneswere inserted as PCR fragments downstream from the PLtetO hybrid promoterin the low-copy-number vector pZS*21 (21). The sopABF fragment was obtainedwith the primers PR11, ATGGGGCCCATGAAACTCATGGAAACAC, andPR12, GTGGTCGACTCAGGGTGCTGGCT (underline, ApaI and SalI sites;double underline, sopA start codon and sopB stop codon); after treatment withApaI and SalI it was inserted between the corresponding sites in the vector toform pDAG221. The same procedure was used to insert sopABN15, using primersPR10 (GGAGGGCCCATGTCGTTAATTAATTTGCTG; underlines as above)and PR4 (see above), to produce pDAG222. Derivatives of these plasmids lackingthe sopB C terminus were made by deleting from the sites shown in Fig. 2 to theadjacent ClaI and SalI sites in the polylinker, and a 675-bp fragment carrying achloramphenicol resistance gene was then inserted into the HindIII site in thepolylinker of pZS*21, pDAG221, pDAG222, and the DsopB derivatives (see Fig.2) to form pDAG10, -223, -224, -227, and -228, respectively. The Kanr sequencewas deleted from pDAG223 with EagI and Ecl136II to produce pDAG241.

(iii) Other plasmids. The midi-N15 plasmid, pG54, consists of the 20.1-kbBglII fragment of the N15 phage genome (23,699 to 43,800 bp) ligated to aBamHI fragment containing a Kanr gene from pUC4K (Pharmacia) (34).pZC450, a pBR322-based plasmid carrying the sopP::lacZ fusion (42), was pro-vided by D. P. Biek.

DNA manipulations and related procedures. Restriction endonuclease diges-tions, Klenow and T4 DNA polymerase reactions, and ligations with T4 DNAligase (New England Biolabs) were carried out under conditions recommendedby the supplier. Pfu DNA polymerase (Stratagene) was used for PCR amplifi-cation. DNA fragments from agarose gels and plasmid DNAs from cultured cellswere purified using commercial kits (Qiagen). Standard procedures were usedfor agarose gel electrophoresis and for transformation with plasmid DNA.

Plasmid stability assays. All experiments were started from colonies of cellsfreshly transformed with the plasmids under test. Two procedures were used;both gave the same results. In one, fresh overnight cultures of DH10B derivativesin LB medium containing selective antibiotics were diluted 200-fold into thesame medium and grown to a cell density of 3 3 108 to 4 3 108/ml. Samples werediluted 103-fold into fresh LB medium without the antibiotic selective for theplasmid under test, and the new cultures were grown to at least the same celldensity. The dilution and regrowth was repeated to allow the cells to go through20 to 40 generations. To determine the fraction of cells that retained the plasmid,samples taken at the beginning and from each regrown culture were either platedon LB agar, followed by replica plating of the colonies to selective agar, or, wherethe fraction of plasmid-carrying cells was expected to be low, plated in parallel onnonselective and selective agar. In the other procedure, each fresh overnight

FIG. 1. N15 prophage and the locus of homology with the F plasmid sopoperon. The 46,375-bp bacteriophage sequence (13) was converted to the pro-phage form by in silico ligation of the ends followed by cutting at bp 24802 and-3. The prophage sketch is oriented following Lobocka et al. (19), with theenlargement of the sop homologue locus inverted to correspond to the usualrepresentation of F sop. The rounded ends represent telomeric structures (telLand telR). Other loci are assigned on the basis of sequence data (13) and aredrawn only approximately to scale.

FIG. 2. sop locus variants of mini-F. The pDAG114 plasmid is represented as a linear molecule; only the sop regions and restriction sites used in construction areshown below. ccdB is inactive, as indicated by square brackets. Light shading indicates genes and sites of mini-F, and dark shading indicates those of N15. Gaps showthe extent of deleted DNA. The thin double line after the N15 sop operon is a natural IR. The block labelled IR2 is an inserted IR (see Materials and Methods). ThesopB deletions at the bottom were introduced into sop operons inserted in the pZS*21 vector.

VOL. 181, 1999 N15 PLASMID PARTITION 6899

culture grown as described above was diluted to various extents (usually 103, 106,and 109) in nonselective medium, and the diluted cells were regrown as separatecultures to early stationary phase and assayed for the fraction of plasmid-bearingcells as described above. Although loss rates were determined two or three timesfor most plasmids, the data shown in Results is representative rather thanaveraged because the true number of generations at sampling varied betweenexperiments.

The percentage of plasmids lost per generation (L) was calculated from theequation L 5 1 2 (Ff/Fi)1/n 3 100, where Fi is the fraction of cells carrying theplasmid initially and Ff is the plasmid-carrying fraction after n generations ofnonselective growth.

Copy number measurement. For the first demonstration that the N15 sopoperon is involved in partition rather than replication, copy number was deter-mined by quantifying radioactive plasmid and chromosomal probe DNAs hy-bridized to total DNA. Cultures grown as for the measurement of plasmidstability were sampled after 3.5 generations of nonselective growth for assay ofthe fraction of plasmid-bearing cells, as described above, and for preparation ofDNA. DNA was extracted by lysis of the cells with lysozyme, sodium dodecylsulfate (SDS), and proteinase K, then purified by extraction with phenol andchloroform, treatment with ribonuclease A, reextraction with phenol and chlo-roform, and precipitation with isopropanol. Redissolved DNA (0.25 mg) wasdigested to completion with PflMI, and the fragments were fractionated byelectrophoresis in 0.8% agarose in Tris-borate-EDTA buffer and transferred bycapillary blotting to uncharged nylon membrane (Hybond N; Amersham). Afterfixing of the DNA by UV cross-linking, the membrane was incubated in hybrid-ization buffer consisting of 50% formamide, 0.75 M NaCl, 0.05 M sodium phos-phate (pH 6.8), 0.1% SDS, and 0.1 mg of sonicated and denatured herring spermDNA/ml at 42°C for 2 h. DNA fragments corresponding to portions of the repEgene of mini-F and the ldc gene (18) of E. coli were obtained by PCR andlabelled with 32P by random primer extension (Megaprime kit; Amersham). Thelabelled fragments were added to the hybridization buffer at $40-fold molarexcess over the expected amounts of the target sequences on the membrane.After overnight incubation at 42°C, the membrane was washed (final washsolution, 15 mM NaCl–0.05% SDS) at room temperature and exposed to a Fujiphosphorimager screen. The bands were quantitated with the TINA-PCBasprogram (Fuji Photo Film Co. Ltd.), and the figures were corrected for thefraction of cells that had lost the plasmid to give plasmid DNA per chromosomeratios. These ratios are not absolute, since the specific activities of the probeswere not determined, but they allow accurate estimation of copy number differ-ences between strains.

For subsequent estimations of copy number, total plasmid DNA was isolatedby the Qiagen miniprep procedure and samples were subjected to agarose gelelectrophoresis followed by ethidium bromide staining. The bands on the digi-tized gel image were quantitated with PCBas, and the ratios of test plasmid(mini-F or pG54) to stable coresident plasmid (pZS*21 derivative) were cor-rected for plasmid size and plasmid loss to yield relative copy numbers, asdescribed above.

Western immunoblotting. Cells grown exponentially to an optical density at600 nm (OD600) of '0.3 were centrifuged and resuspended in SDS-sample buffer(16) at 5 OD600 units/ml. The samples were incubated at 100°C for 5 min andchilled, and various volumes were applied to a 10% polyacrylamide gel in Tris-glycine buffer. The separated proteins were transferred to polyvinylidene diflu-oride membrane (Immobilon; Millipore) by electroblotting them in carbonatebuffer (7). Immunodetection was performed essentially as described previously(3), using a 1:1,000 dilution of purified anti-SopA as the primary antibody andgoat anti-rabbit immunoglobulin G (1:1,000) coupled to horseradish peroxidase(Sigma) as the secondary antibody. Bound peroxidase was detected with an ECLsystem (Amersham) and exposure to X-ray film. The digitized X-ray images werequantitated with the TINA-PCBas program. The antiserum was raised with apeptide corresponding to the C-terminal 12 amino acids of SopA (42) and waskindly provided by D. P. Biek.

Sop promoter repression assay. Derivatives of DLT1127 were grown overnightfrom single colonies in LB medium with kanamycin and the antibiotic appropri-ate for the plasmid carrying the function to be tested. The cultures were diluted100-fold into fresh medium with antibiotics and grown to an OD600 of '0.3. Theywere then sampled for determination of b-galactosidase specific activity (intriplicate) as described previously (17).

RESULTS

Sequence homology of sop with an N15 locus. The F plasmidSopA and -B proteins show strong sequence homology with thepredicted products of two open reading frames near the right-hand end of the linear N15 prophage (Fig. 1). The SopAhomologues have 75% amino acid identity, and the SopB ho-mologues have 49% (Fig. 3). The N15 open reading frames arepreceded by a sequence similar to that of the sop promoter-operator region: four copies of a CTTTG motif, oriented andspaced identically to those in F and likewise interspersed with

dA-dT runs, overlap the 235 and 210 promoter sequences.Nuclease protection experiments indicate that the CTTTGmotifs in F are recognized and bound by SopA (25). In view ofits strong homology with F sop, we use the term sop for the N15locus.

Alignment of the SopA sequences shows that the homologyis uniformly distributed throughout the protein. In particular,the motifs characteristic of the ParA/SopA family of partitionproteins, ATP I (40) and ATP II, and motifs 2 and 3 (26) arestrongly conserved in N15 SopA. In contrast, the similaritybetween the SopB sequences is strong only between residues43 and 226 of the 323-amino-acid F SopB protein. A part ofthis homologous region lies within the extended C-terminaldomain of F SopB which makes contact with DNA (10). It isnot known which part of this domain in F SopB specificallyrecognizes the sopC site.

Sequence homology between N15 and F does not extend tothe region downstream of sopB. Whereas in F this region isoccupied by sopC, in N15 the only feature identified was an IRsequence of 24 bp which bears no obvious similarity to sopC.

Lack of stabilization by the N15 sop region. To determinewhether the sop-homologous region of N15 can act as a par-tition locus, we tested its ability to stabilize a mini-F plasmidwhich lacks its own partition functions. PCR fragments (Fig. 2)containing the sequences equivalent to the sop promoter, sopAand sopB, with or without the inverted repeat sequence down-stream from the sopB open reading frame, were inserted intoa mini-F Dsop plasmid. The stabilities of these plasmids weredetermined by measuring the rate at which plasmid-free cellsaccumulated during about 30 generations of growth in theabsence of antibiotic selection. The result for the plasmid withthe longest PCR insert, pDAG219, is shown in Fig. 4a; thosefor the other plasmids, which were lost at the same rate aspDAG219, are omitted for clarity. None of the plasmids wassignificantly more stable than the mini-F Dsop vector. Thisresult indicated either that the sop open reading frames do notconfer partition functions or that the downstream sequence isnot sufficient for them to do so.

We next attempted to determine whether the N15 sop openreading frames specify partition functions by testing their abil-ity to complement the partition deficiency of mini-F plasmidswith partial sop deletions.

Complementation by the N15 sop region. To provide asource of N15 SopA and SopB proteins for complementationstudies, we placed the sopAB genes of N15 and F under controlof a modified Ptet promoter in pZS*21, a vector derived froma low-copy-number mutant of pSC101 (21, 23). This strongpromoter is normally subject to regulation by the TetR repres-sor, but we were able to obtain suitably modest levels of Sopproteins by placing the sopA ATG codon 18 bp from the vectorShine-Dalgarno sequence, thus diminishing the frequency oftranslation. The results of a Western blot analysis of extractsprepared from cells carrying these plasmids (pDAG221 [sopF]and pDAG222 [sopN15]), using antibodies raised against FSopA protein, are shown in Fig. 5. They show that the steady-state level of F SopA in cells carrying pDAG221 is about threetimes higher than that in cells carrying wild-type mini-F andthat the corresponding N15 SopA is indeed produced. Becausewe have no measure of its affinity for anti-SopA we cannotestimate its concentration, but we assume it is similar to that ofF SopA. We did not detect N15 SopB, since it does not cross-react with the anti-SopB antibody available to us.

To test the ability of N15 Sop proteins to substitute for thoseof F, we introduced pDAG221 and -222 into strain DH10Bcarrying pDAG205, a mini-F plasmid with a deletion of sopAB,and measured the stability of pDAG205 in the transformants.

6900 RAVIN AND LANE J. BACTERIOL.

The plots of plasmid loss (Fig. 4b) show that the provision ofN15 SopA and SopB proteins resulted in considerable stabili-zation of pDAG205. When accompanied only by the vector,the mini-F plasmid was lost at a rate of 5.0% per generation,

whereas in the presence of pDAG222 the loss rate dropped to0.5%. The F SopA and SopB proteins, produced frompDAG221, stabilized pDAG205 completely. To test the possi-bility that a copy number increase was responsible for the

FIG. 3. Alignment of Sop homologues of N15 and F. In sopOP, the sop promoter-operator top-strand alignment is based on pairing the 59-CTTTG SopA bindingsites (dark shading) (24), whose relative orientation is indicated by arrows; the light shading denotes promoter and Shine-Dalgarno sequences and the sopA start codon.In SopA, amino acid sequences were aligned with the Multalin program. Shading denotes identical residues. The nucleotide and Mg binding sites are labelled ATPI (Walker A box) and II, respectively. Motifs 2 and 3 are conserved in members of the SopA/ParA partition protein family (25). The underlined sequence and that inSopB below are predicted helix-turn-helix structures (6). In SopB, aligned as for SopA, minor changes in parameters alter gap positions, most notably aligning the N15C-terminal KNKEKK with the F C-terminal KELEKP. The large box (dotted outline) shows an F SopB peptide which protects sopC DNA; the small box (solid outline)indicates a C-terminal deletion which eliminates the protection (10).

VOL. 181, 1999 N15 PLASMID PARTITION 6901

observed stabilization, we determined the copy numbers ofpDAG205 per chloramphenicol-resistant cell by hybridizationof radioactive mini-F and chromosomal (ldc) probes to totalDNA extracted from cells in logarithmically growing cultures(Fig. 4c). The result showed that a slight (;10%) increase incopy number occurred in the presence of the sop genes of Fand N15. This accounts for only a small fraction of the stabi-lization (see the legend to Fig. 4), indicating that most of thestabilization results from active partition.

The only components of the F sop system remaining inpDAG205 are the promoter and sopC. Derivatives (pDAG209and -210) lacking each of these were tested for stabilization byN15 SopA and SopB, as described above. Only pDAG209,which carries sopC, was stabilized (Fig. 4d). We conclude fromthese results that the SopA and SopB proteins of N15 cansubstitute for the F partition proteins in stabilizing a plasmidcarrying sopC.

In light of these results it appeared that the N15 Sop pro-

teins might also act in concert with a sopC-like sequence else-where on the N15 prophage to ensure correct partition of theplasmid.

Stabilization of a midi-N15. To test the possibility that acentromere site similar to sopC exists in N15, distant fromsopAB, we made use of a plasmid formed by deletion from N15of a 25.5-kb fragment that includes most of the sop locus. Thisunstable plasmid, pG54, carries N15 replication functions anda kanamycin resistance gene (34) (Fig. 6a). Cells carrying pG54were transformed with mini-F carrying the N15 sop operon,pDAG216, and with the Dsop mini-F, pDAG202, and the sta-bility of pG54 in the resulting strains was tested as describedabove (Fig. 6b). In the presence of pDAG216, pG54 was stable(0.06% loss per generation), whereas when accompanied bypDAG202 it was lost at 6.4% per generation. Analysis of ex-tracted plasmid DNA by gel electrophoresis and ethidium bro-mide staining showed that the ratio of pG54 DNA (per plas-mid-carrying cell) to the mini-F vector was the same in bothstrains (data not shown); stabilization is thus not a result ofincreased copy number.

This result suggested strongly that a sequence with centro-mere function is present in the part of N15 that remains inpG54. The likelihood that this sequence resembles sopC wasincreased by the observation that the SopA and -B proteins ofF, produced from the pZS*21-based plasmid pDAG241, wereable to partly stabilize pG54 (2.1% loss per generation) (Fig.6b).

SopC-like sequences of N15. Within each 43-bp repeat ofsopC, the sequence protected by SopB binding, presumably thespecific recognition site, is an IR, 59-TGGGACCnnGGTC-CCA (n denotes variable bases). A search of the N15 genomefor sequences with at least a five-of-seven match to one arm of

FIG. 4. Ability of N15 sopAB to substitute for F sopAB. (a) Segregation of wild-type mini-F (pDAG114 [open circles]), mini-F DsopPABC (pDAG202 [solid circles]),and mini-F carrying the sop operon locus of N15 (pDAG219 [solid triangles]). (b) Segregation of mini-F DsopAB (pDAG205) from cells also carrying pDAG221(sopABF [solid triangles]), pDAG222 (sopABN15 [open triangles]), or the vector (pZS*21 [solid circles]). (c) Relative pDAG205 copy number. In an experimentduplicating that shown in panel b, samples were withdrawn from cultures after three to four generations of growth for estimation of the fraction of cells still carryingpDAG205 (fr. cells mF1) and for measurement of copy number by hybridization of radioactively labelled mini-F and chromosomal probes to Southern blots ofextracted DNA (see Materials and Methods). The PflMI site adjacent to repE is poorly cleaved (PflM), resulting in two mini-F fragments being detected; theradioactivity from both bands was summed for the calculation of miniF/chromosome ratios (mF/ldc). Correction for the fraction of each population that had lost themini-F plasmid allowed calculation of the number of mini-F plasmids per cell relative to that in the strain with no sopAB (2) [mF/cell (rel.)]. This in turn allowedcalculation of the contribution of the ;10% copy number increase to stability: assuming random distribution of the partition-defective plasmid pDAG205 to daughtercells, the observed loss rate of 5.5% corresponds to a copy number of 4.2 at division (loss rate 5 0.5copy-number), leading to an expected loss rate for the 1.1-fold-highercopy number of 4.1% in the absence of active partition. (d) Segregation of mini-F plasmids carrying sopC (pDAG209 [diamonds]) or sopP (pDAG210 [squares]) in thepresence (open symbols) or absence (solid symbols) of a plasmid (pDAG222) carrying the N15 sop operon.

FIG. 5. Western blot analysis of SopA production. Exponential cultures ofstrains harboring wild-type mini-F (pDAG114), mini-F DsopAF (pDAG206),pZS*21 carrying the sop operon of F (pDAG221) or N15 (pDAG222), or noplasmid (2) were grown in LB broth with appropriate antibiotics and sampledfor preparation of cell extracts. A series of twofold concentration increments ofeach sample was subjected to SDS-polyacrylamide gel electrophoresis and West-ern blot analysis with anti-SopA antibody. Lanes showing approximately thesame level of cross-reacting host protein(s) were chosen. The band intensity wasproportional to amounts applied to the gel for the film exposure times used.

6902 RAVIN AND LANE J. BACTERIOL.

this sequence uncovered four such IRs (IR1 to -4) (Fig. 6c).Three of these are present in pG54 (Fig. 6a). Apart from the2-bp spacers, all have the same sequence, which differs fromthe F sopC repeat by a C7G exchange at the fourth positionin each arm and by a 1-bp increase in length (2 bp if degen-eracy at the end position is allowed). The only exception is IR4,which has an A-to-T change at position 2 of one arm. Unlikethe sopC repeats, the sequences flanking the IRs have noobvious similarity, and the IRs themselves are scattered on theN15 genome.

To determine whether these sequences can confer centro-mere function, complementary oligonucleotides correspondingto IR2 were inserted downstream of the N15 sopAB operon inpDAG219 (Fig. 2) to create pDAG215, and the stabilities ofthe two plasmids were measured (Fig. 6d). The plasmid con-taining IR2 was essentially stable (0.07% loss per generation),while the parental pDAG219 remained unstable (5.0% loss).Substitution of a short fragment carrying IR3 for IR2 gave asimilar result (,0.02% loss per generation [data not shown]).We conclude that the IR2 and IR3 sopC-like sequences of N15can act as centromeres. Presumably the other two IR se-quences can as well.

These results (Fig. 6b), together with those of the reciprocalexperiments shown in Fig. 4b and d, suggest that the SopBprotein of each plasmid can interact functionally with the sopCsequences of the other. We next examined whether, in addi-tion, a functional exchange of SopA alone is possible, that is,whether SopA of one plasmid can interact productively withSopB of the other.

Stabilization and destabilization by SopA. The bulk of thesopA gene was deleted from mini-F (pDAG114) carrying thewild-type F sop locus, producing plasmid pDAG206, and from

mini-F (pDAG215) carrying the N15 sop operon and the IR2centromere sequence to yield pDAG217. Elimination of SopAfunction is expected to derepress sop operon transcription,thus raising the SopB concentration and risking direct inhibi-tion of plasmid maintenance (IncG incompatibility [15]).Therefore, we ensured that the deletions left the sopA 39 endout of phase for translation, since maximal SopB productionappears to require upstream coding capacity (43), presumablyto allow translational coupling. In the event, the stability of theDsopA plasmids (6.5 to 7% loss per generation) (Fig. 7a and c)was marginally lower than that of the equivalent DsopC plas-mids (5.5 to 6%) (Fig. 4a and 6b), indicating a moderatedegree of SopB overproduction.

The segregation of the mini-F sopA deletion derivatives inthe presence of N15 and F Sop proteins produced from coresi-dent pZS*21 derivatives is shown in Fig. 7. It is clear thatalthough the two DsopA plasmids are lost at about the samerate (;7%), they respond differently to Sop proteins suppliedin trans. Whereas provision of SopA and SopB of either F orN15 results in substantial stabilization of pDAG206 (DsopAF),the increase in pDAG217 (DsopAN15) stability is only slight(Fig. 7a and c). Providing SopA alone gave surprising results.In the case of pDAG206, F SopA alone complemented thedeletion mutant only weakly, presumably because of incom-plete compensation for SopB-induced inhibition of replication,while the heterologous SopA of N15 severely destabilized themutant (Fig. 7b). In the case of pDAG217, provision of eitherSopA protein resulted in moderate destabilization (Fig. 7c).

These results are not easy to interpret. The destabilizationby heterologous SopA is presumably not due to increasedrepression of sopB transcription, since this would not increaseplasmid loss beyond that seen for random segregation. It is

FIG. 6. Identification of sopC-like centromere sequences in N15 DNA. (a) The midi-N15 plasmid, pG54. The dashed box shows the 25.5-kb BglII deletion whichhas removed sopB and the 39 end of sopA. IR1 to -4 denote sopC-like IRs detailed in panel c. (b) Segregation of pG54 from cells also carrying the mini-Fs pDAG202[Dsop(PABC)F (solid circles)] and pDAG216 (sopPABN15 [open circles]) or the pZS*21-based plasmid pDAG241 (sopABF

1 [open squares]). (c) Comparison of N15IR sequences with the sopC IR. The underlined bases show differences from the sopC sequence. (d) Segregation of mini-F plasmids carrying the N15 sop operon without(pDAG219 [solid circles]) or with (pDAG215 [open circles]) IR2.

VOL. 181, 1999 N15 PLASMID PARTITION 6903

clear, however, that in neither case is the plasmid with sopAdeleted indifferent to the SopA protein of the other plasmid,suggesting that each SopA can interact with SopB of the otherplasmid in an aberrant manner that leads to high rates ofplasmid loss.

Sop promoter repression. The similarity of the promotersequences suggested that the N15 and F Sop proteins might beable to bind to each others’ operators to repress transcription.A fusion of the F sop promoter to the lacZ gene was integratedinto the chromosome as part of a l prophage (see Materialsand Methods), and Sop proteins were provided in trans frompZS*21 derivatives (see Materials and Methods) (Fig. 2). Theamounts of b-galactosidase made during exponential growth ofthe resulting strains were measured. The results in Table 1show that, as expected, F SopA protein has a weak repressingeffect on its own promoter but that repression is greatly en-hanced in the presence of SopB. In the presence of N15 SopAprotein, transcription is reduced just enough to indicate a veryweak interaction with the sop promoter. When N15 SopB pro-tein was also present, repression was greatly enhanced. Therepressor and corepressor properties of the N15 Sop proteinsthus appear to be equivalent to those of their F counterparts.

Our attempts to construct a fusion of the N15 sop promoterwith lacZ were unsuccessful. However, preliminary slot blothybridization experiments have shown that transcription initi-ated at the N15 sop promoter is repressed in the presence of

N15 SopA and B proteins (data not shown), indicating that thispromoter is subject to autoregulation, like sopP of F.

DISCUSSION

The main reason for undertaking this study was to exploitthe sequence differences between the very similar sop genes ofF and N15, with a view to locating determinants of specificinteractions involved in partition. However, it was importantfirst to identify all the components of the relatively unknownN15 partition system and to carry out a preliminary assessmentof the extent to which the F and N15 systems interact. This wehave now done. The results presented here show that the N15locus identified by its homology with the F plasmid sop operonis functional for partition. The partition system specified bythis locus is probably the only one capable of assuring stableinheritance of the N15 prophage, since transposon insertionsin the locus cause instability (37). We have identified centro-mere-like sites with which the products of the N15 sop genesinteract to stabilize plasmid maintenance. Results of a parallelstudy in the laboratory of M. Lobocka (Warsaw, Poland) alsosupport a role for these sites in partition (19a). In addition, wehave shown that the similarity to the F sop system is sufficientto allow some degree of functional complementation. Finally,our results show that SopA of N15 can recognize the F soppromoter and that its ability to impose effective repressiondepends on its cognate SopB.

Apart from the sequences of their IRs, the N15 and F cen-tromeres appear to be notable more for their differences thantheir similarities. The difference in the number of repeats, 4 inN15 versus 12 in F, is probably of little significance, since asingle 43-bp unit of sopC suffices to stabilize mini-F (4), as doesa single IR of N15 (Fig. 5d). A more striking difference fromthe F IR, which is embedded in a longer repeated sequence, isthe lack of extensive similarity among the sequences flankingthe N15 IRs. This suggests that the repetition or otherwise ofthe flanking sequences is of little significance for present-dayfunction, a proposal consistent with the observation of se-quence-independent wrapping of DNA by SopB (4, 22). Thepresence or absence of flanking repetitions might rather reflectdiversity in the mechanisms that originally amplified the F andN15 IRs.

FIG. 7. Effect of SopA on the stability of DsopA miniplasmids. For clarity, the rates of loss of pDAG206 (mini-F DsopAF) measured in separate experiments areshown in panels a and b, with the results for certain complementing plasmids shown in both. Note the different ranges on the ordinate of each panel. (a) Segregationof pDAG206 from cells which also carry pZS*21 (no sopAB [solid triangles]), pDAG221 (sopABF

1 [open circles]), pDAG222 (sopABN151 [open triangles]), pDAG225

(sopAF1 [open inverted triangles]), or no other plasmid (solid circles). (b) Same as panel a plus pDAG226 (sopAN15

1 [solid inverted triangles]). (c) Segregation ofpDAG217 (mini-F DsopAN15) from cells which also carry the plasmids shown in panels a and b.

TABLE 1. Repression of transcription from the F sop promotera

Plasmid sop genes b-galactosidase(normalized) (6 SD) n

pDAG10 1 3pDAG223 sopAF

1 sopBF1 0.0063 6 0.0005 4

pDAG227 sopAF1 DsopBF 0.58 6 0.04 2

pDAG224 sopAN151 sopBN15

1 0.11 6 0.01 3pDAG228 sopAN15

1 DsopBN15 0.96 6 0.03 22/no promoter ,0.0002 4

a b-Galactosidase specific activities are expressed as fractions of the activitymeasured for the unrepressed sop promoter (3,180 6 112 [standard deviation]Miller units). n, number of cultures assayed. The bottom line shows the level(essentially undetectable) in cells carrying the empty lRS88 vector prophage.

6904 RAVIN AND LANE J. BACTERIOL.

Perhaps the most remarkable difference between the sopC-like sites is their arrangement. Whereas in F the sopC centro-mere site consists of a compact series of sequence repeatsadjacent to the sop operon, in N15 the sopC-like sequencesthat function as centromeres are scattered over about 13 kb ofN15, far from the sop locus: it is possible that others, moredivergent from sopC, remain to be identified. Recent reports ofother close sequence homologues of the F sop locus suggestthat the separation and dispersal of sopC-like sites seen in N15is unusual. The sop loci of Yersinia plasmids pCD1 andpYVe227 encode gene products with the same high degree ofsimilarity to F SopAB as those of N15 (14, 30), but theirsopC-like sequences are located within longer directly repeatedsequences just downstream of sopB, as in F. Other examples ofdispersed centromere sites are known, however: in RK2, siteswhich bind KorB (the SopB analogue), some of them appar-ently defective for partition, are scattered over several kilo-bases (41), and in Bacillus subtilis eight sites situated within asegment one-fifth the size of the chromosome bind Spo0J toassure chromosome partition (19).

How did the dispersal of sites arise in the ancestry of N15?One possibility is that an initially integrated locus was split bysuccessive recombination events, possibly with the loss of someof the IRs. Alternatively, the operon may have separated fromits original centromere during the recombination event thatinserted it into an N15 ancestor, one which happened to carrysopC-like sequences that initially served other purposes. Thepresence of three of the IRs (IR1 to -3) at intergenic sites isconsistent with either scenario.

The scattered arrangement of sopC-like sites also raises thequestions of how many are normally involved in each partitionevent and of whether intramolecular coupling of partitioncomplexes can impede the intermolecular pairing supposedlyneeded for faithful partition. Although we cannot yet resolvethese issues, it is worth noting that they arise also in the case ofdicentric derivatives of the plasmids NR1 and P1 and thatthese derivatives are maintained stably (2, 31).

It is clear from the results presented here that the sopCsequences in F and N15 are sufficiently similar to allow theSopA and -B proteins of each plasmid to substitute partly forthose of the other. This interchangeability must rely primarilyon the capacity of each SopB to bind appropriately to the othersopC site, implying that the binding domains of each SopBhave several residues in common. Nevertheless, the inter-changeability is far from total. Overproduction of Sop proteinsis needed for even partial stabilization of plasmids carrying thesopC homologue (Fig. 5b), suggesting substantial differences inthe affinity of each SopB for the two sopCs. The SopB domainthat recognizes and binds to sopC has not yet been identifiedfor any protein of the SopB/ParB family. Protein modificationand protease protection experiments have indicated that mul-tiple DNA contacts are made by the C-terminal two-thirds ofF SopB (10). N15 and F SopB sequences show significantsimilarity only within the first part of this region, betweenresidues 141/139 and 228/226 (Fig. 2), suggesting that sopCrecognition specificity is located in this segment. A candidatefor this determinant might be F SopB residues 179 to 198,which were predicted by Dodd and Egan (6) to form a helix-turn-helix DNA binding structure. This motif differs from thecorresponding N15 sequence at several residues, consistentwith reduced affinity for N15 sopC, as discussed above. How-ever the role of the motif remains to be tested by direct ex-periment.

We expected that SopA produced from a coresident plasmidwould at least partly stabilize a mini-F plasmid carrying thecognate partition system with a sopA deletion. This was so for

F sop but, surprisingly, not for N15 (Fig. 7). The N15 SopAprotein actually destabilized the DsopAN15 plasmid slightly. Wecannot easily explain this behavior, since supplying both N15Sop proteins in trans resulted in moderate stabilization. Oguraet al. (29) reported that an excess of SopA destabilizes mini-F.Under our conditions, a slight excess of F SopA stabilized theDsopAF plasmid, as noted above, but it is possible that N15partition is more sensitive to an excess of its SopA protein andthat supplying it together with SopB returns the ratio of thetwo proteins to within tolerable limits. Provision of F SopAprotein to the DsopAN15 plasmid resulted in a similar slightdestabilization. In this case it is possible that SopAF forms anabnormal complex with SopBN15 which prevents replication orthe separation of paired plasmids, thus generating plasmid-freecells at a higher rate.

A phenomenon of this kind is even more likely to be in-volved in the very strong destabilization of the mini-F DsopAFby SopA of N15 (Fig. 7b). A similar situation arose during anextensive study of specificity determinants in the Par proteinsof P1 and a close relative, P7 (32). In a cell containing a hybridoperon with ParA from one plasmid and ParB from the otherit was difficult to establish a plasmid that carried the parScentromere. An inappropriate interaction that prevented dis-sociation of the partition complex and so blocked plasmidpropagation was proposed as a possible cause.

The properties of other P1-P7 hybrid proteins led Radnedgeet al. (32) to propose that amino acids within 115 residues ofthe C terminus of ParA must interact specifically with aminoacids within 28 residues of the ParB N terminus for partition toproceed. The overall homology relationships in the relevantparts of these proteins are similar to those in N15 and F SopAand -B: strongly conserved C-terminal sequences in the Aproteins and little N-terminal sequence similarity in the Bproteins. It is unlikely that the A protein C-terminal domaininteracts only with the dissimilar N termini of the B proteins.The initial contact may be with a more strongly conservedregion of the B protein and may position the proteins to allowthe highly specific interactions with the B protein N-terminaldomain that are needed for partition. If only the initial com-plex forms, as is likely when A protein finds the B proteinhomologue rather than its normal partner, it is blocked anddisrupts normal maintenance.

Although the essential tools are now available for identifyingthe determinants of specificity in partition and autoregulationof the Sop system, some modification of the approach taken byRadnedge et al. for the P1-P7 Par system will be necessary.Unlike the components of the Sop systems studied here, thoseof the Par systems are not interchangeable (12, 32). This meansthat for P1 and P7 the distinction between partition and tran-scriptional repression phenotypes is virtually absolute, allowingthe ready assignment of specificity to a given hybrid protein oroperon. Distinguishing between partial Sop phenotypes of F-N15 hybrids will require precise measurements of plasmid sta-bility and promoter repression. Inclusion of the recently re-ported Yersinia plasmid Sop systems (14, 30) may help refinethe analysis.

ACKNOWLEDGMENTS

We thank Don Biek for kindly providing the promoter fusion con-struction and antibodies, Marc Lemonnier for bringing N15 to theattention of one of us (D.L.) and for assistance with the Western blotexperiment, and the members of the group Dynamiques des repliconsbacteriens, as well as Valentin Rybchin and Malgorzata Lobocka, fortheir interest and for useful discussions.

N.R. was supported by a short-term EMBO fellowship, ASTF 9072,and by grant 96-1492 from the International Association for the Pro-

VOL. 181, 1999 N15 PLASMID PARTITION 6905

motion of Cooperation with Scientists from the New IndependentStates of the Former Soviet Union (INTAS).

REFERENCES

1. Austin, S., and A. Wierzbecki. 1983. Two mini-F encoded proteins are es-sential for equipartition. Plasmid 10:73–81.

2. Austin, S. J. 1984. Bacterial plasmids that carry two functional centromereanalogues are stable and are partitioned faithfully. J. Bacteriol. 158:742–745.

3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1989. Current protocols in molecular biology. Wiley-Interscience, New York, N.Y.

4. Biek, D. P., and J. Shi. 1994. A single 43-bp sopC repeat of plasmid mini-Fis sufficient to allow assembly of a functional nucleoprotein partition com-plex. Proc. Natl. Acad. Sci. USA 91:8027–8031.

5. Casadaban, M. J., and S. N. Cohen. 1980. Analysis of gene control signals byDNA fusion and cloning in Escherichia coli. J. Mol. Biol. 138:179–207.

6. Dodd, I. B., and J. B. Egan. 1990. Improved detection of helix-turn-helixDNA-binding motifs in protein sequences. Nucleic Acids Res. 18:5019–5026.

7. Dunn, S. D. 1986. Effects of the modification of transfer buffer compositionand the renaturation of proteins in gels on the recognition of proteins onWestern blots by monoclonal antibodies. Anal. Biochem. 157:144–153.

8. Gordon, G. S., D. Sitnikov, C. D. Webb, A. Teleman, A. Straight, R. Losick,A. W. Murray, and A. Wright. 1997. Chromosome and low copy plasmidsegregation in E. coli: visual evidence for distinct mechanisms. Cell 90:1113–1121.

9. Grant, S. G., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differentialplasmid rescue from transgenic mouse DNAs into Escherichia coli methyla-tion-restriction mutants. Proc. Natl. Acad. Sci. USA 87:4645–4649.

10. Hanai, R., R. Liu, P. Benedetti, P. R. Caron, A. S. Lynch, and J. C. Wang.1996. Molecular dissection of a protein SopB essential for Escherichia coli Fplasmid partition. J. Biol. Chem. 271:17469–17475.

11. Hayakawa, Y., T. Murotsu, and K. Matsubara. 1985. Mini-F protein thatbinds to a unique region for partition of mini-F plasmid DNA. J. Bacteriol.163:349–354.

12. Hayes, F., L. Radnedge, M. A. Davis, and S. J. Austin. 1994. The homologousoperons for P1 and P7 plasmid partition are autoregulated from dissimilaroperator sites. Mol. Microbiol. 11:249–260.

13. Hendrix, R. W., V. K. Ravin, S. R. Casjens, M. E. Ford, N. V. Ravin, and I. K.Smirnov. 1998. Bacteriophage N15 complete sequence. GenBank accessionno. AF064539.

14. Iriate, M., I. Lambermont, C. Kerbourch, and G. R. Cornelis. 1998. Yersiniaenterocolitica plasmid pYVe227, complete sequence. GenBank accession no.AF102990.

15. Kusukawa, N., H. Mori, A. Kondo, and S. Hiraga. 1987. Partitioning of theF plasmid: overproduction of an essential protein for partition inhibits plas-mid maintenance. Mol. Gen. Genet. 208:365–372.

16. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

17. Lane, D., J. Cavaille, and M. Chandler. 1994. Induction of the SOS responseby IS1 transposase. J. Mol. Biol. 242:339–350.

18. Lemonnier, M., and D. Lane. 1998. Expression of the second lysine decar-boxylase gene of Escherichia coli. Microbiology 144:751–760.

19. Lin, D. C.-H., and A. D. Grossman. 1998. Identification and characterizationof a bacterial chromosome partition site. Cell 92:675–685.

19a.Lobocka, M. Personal communication.20. Lobocka, M. B., A. N. Svarchevsky, V. N. Rybchin, and M. B. Yarmolinsky.

1996. Characterization of the primary immunity region of the Escherichia colilinear prophage N15. J. Bacteriol. 178:2902–2910.

21. Lutz, R., and H. Bujard. 1997. Independent and tight regulation of tran-scriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 25:1203–1210.

22. Lynch, A. S., and J. C. Wang. 1994. Use of an inducible site-specific recom-binase to probe the structure of protein-DNA complexes involved in F

plasmid partition in Escherichia coli. J. Mol. Biol. 236:679–684.23. Manen, D., G. Xia, and L. Caro. 1994. A locus involved in the regulation of

replication in plasmid pSC101. Mol. Microbiol. 11:875–884.24. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, N.Y.25. Mori, H., Y. Mori, C. Ichinose, H. Niki, T. Ogura, A. Kato, and S. Hiraga.

1989. Purification and characterization of SopA and SopB proteins essentialfor F plasmid partitioning. J. Biol. Chem. 264:15535–15541.

26. Motallebi-Veshareh, M., D. A. Rouch, and C. M. Thomas. 1990. A family ofATPases involved in active partitioning of diverse bacterial plasmids. Mol.Microbiol. 4:1455–1463.

27. Niki, H., and S. Hiraga. 1998. Subcellular distribution of actively partitioningF plasmid during the cell division cycle in E. coli. Cell 90:951–957.

28. Ogura, T., and S. Hiraga. 1983. Partition mechanism of F plasmid: twoplasmid gene-encoded products and a cis-acting site region are involved inpartition. Cell 32:351–360.

29. Ogura, T., H. Niki, H. Mori, H. Morita, M. Hasegawa, C. Ichinose, and S.Hiraga. 1990. Identification and characterization of gyrB mutants of Esche-richia coli that are defective in partitioning of mini-F plasmids. J. Bacteriol.172:1562–1568.

30. Perry, R. D., S. C. Straley, J. D. Fetherston, D. J. Rose, J. Gregor, and F. R.Blattner. 1998. DNA sequencing and analysis of the low-Ca21-responseplasmid pCD1 of Yersinia pestis KIM5. Infect. Immun. 66:4611–4623.

31. Peterson, B. C., H. Hashimoto, and R. H. Rownd. 1982. Cointegrate forma-tion between homologous plasmids in Escherichia coli. J. Bacteriol. 151:1086–1094.

32. Radnedge, L., B. Youngren, M. Davis, and S. Austin. 1998. Probing thestructure of complex macromolecular interactions by homolog specificityscanning: the P1 and P7 plasmid partition systems. EMBO J. 17:6076–6085.

33. Ravin, N. V., O. I. Doroshenko, and V. K. Ravin. 1998. Cos region of thetemperate bacteriophage N15. Mol. Gen. Mikrobiol. Virusol. 2:17–20. (InRussian.)

34. Ravin, N. V., and V. K. Ravin. 1994. An ultrahigh-copy plasmid based on thereplicon of the temperate bacteriophage N15. Mol. Gen. Mikrobiol. Virusol.1:37–39. (In Russian.)

35. Ravin, V. K. 1971. Lysogeny, p. 106. Nauka Press, Moscow, Russia. (InRussian.)

36. Ravin, V. K., and M. G. Shul’ga. 1970. Evidence for extrachromosomallocation of prophage N15. Virology 40:800–807.

36a.Rybchin, V. N., and A. N. Svarchevsky. 1999. The plasmid prophage N15: alinear DNA with covalently closed ends. Mol. Microbiol. 33:895–903.

37. Sankova, T. P., A. N. Svarchevsky, and V. N. Rybchin. 1992. Isolation,characterization and mapping of the N15 plasmid insertion mutations. Ge-netika 28:66–76. (In Russian.)

38. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single andmulticopy lac-based cloning vector for protein and operon fusions. Gene53:85–96.

39. Svarchevsky, A. N., and V. N. Rybchin. 1984. Characteristics of plasmidproperties of bacteriophage N15. Mol. Gen. Mikrobiol. Virusol. N4:34–39.(In Russian.)

40. Walker, J. E., M. Saraste, and N. J. Gay. 1982. E. coli F1-ATPase interactswith a membrane protein component of a proton channel. Nature 298:867–869.

41. Williams, D. R., D. P. Macartney, and C. M. Thomas. 1998. The partitioningactivity of the RK2 central control region requires only incC, korB andKorB-binding site OB3 but other KorB-binding sites form destabilizing com-plexes in the absence of OB3. Microbiology 144:3369–3378.

42. Yates, P., D. Lane, and D. P. Biek. 1999. The F plasmid centromere, sopC,is required for full repression of the sopAB operon. J. Mol. Biol. 290:627–638.

43. Yates, P. A. 1997. Studies of mutations affecting the replication and partitionof the mini-F plasmid in Escherichia coli. Ph.D. thesis. University of Ken-tucky, Lexington.

6906 RAVIN AND LANE J. BACTERIOL.