Paleo-Balkan and Slavic Contributions to the Genetic … · Paleo-Balkan and Slavic Contributions to the Genetic ... (9%), mostly living in the ... Paleo-Balkan and Slavic Contributions

Paleo-Balkan and Slavic Contributions to the GeneticPool of Moldavians: Insights from the Y ChromosomeAlexander Varzari1,2,3*, Vladimir Kharkov2, Alexey G. Nikitin4, Florina Raicu5,6, Kseniya Simonova2,

Wolfgang Stephan3, Elisabeth H. Weiss3, Vadim Stepanov2,7

1 Phthisiopneumology Institute ‘‘Chiril Draganiuc’’, Kishinev, Moldova, 2 Research Institute of Medical Genetics, Russian Academy of Medical Sciences, Tomsk, Russia,

3 Department of Biology II, Ludwig Maximilians University Munich, Planegg-Martinsried, Germany, 4 Biology Department, Grand Valley State University, Allendale,

Michigan, United States of America, 5 Anthropological Research Centre ‘‘Francisc Rainer’’, Romanian Academy, Bucharest, Romania, 6 Genetics Chair, Faculty of Medicine,

‘‘Carol Davila’’ University of Medicine and Pharmacy, Bucharest, Romania, 7 Genomnaya Diagnostika Ltd., Tomsk, Russia

Abstract

Moldova has a rich historical and cultural heritage, which may be reflected in the current genetic makeup of its population.To date, no comprehensive studies exist about the population genetic structure of modern Moldavians. To bridge this gapwith respect to paternal lineages, we analyzed 37 binary and 17 multiallelic (STRs) polymorphisms on the non-recombiningportion of the Y chromosome in 125 Moldavian males. In addition, 53 Ukrainians from eastern Moldova and 54 Romaniansfrom the neighboring eastern Romania were typed using the same set of markers. In Moldavians, 19 Y chromosomehaplogroups were identified, the most common being I-M423 (20.8%), R-M17* (17.6%), R-M458 (12.8%), E-v13 (8.8%), R-M269* and R-M412* (both 7.2%). In Romanians, 14 haplogroups were found including I-M423 (40.7%), R-M17* (16.7%), R-M405 (7.4%), E-v13 and R-M412* (both 5.6%). In Ukrainians, 13 haplogroups were identified including R-M17 (34.0%), I-M423(20.8%), R-M269* (9.4%), N-M178, R-M458 and R-M73 (each 5.7%). Our results show that a significant majority of theMoldavian paternal gene pool belongs to eastern/central European and Balkan/eastern Mediterranean Y lineages.Phylogenetic and AMOVA analyses based on Y-STR loci also revealed that Moldavians are close to both eastern/centralEuropean and Balkan-Carpathian populations. The data correlate well with historical accounts and geographical location ofthe region and thus allow to hypothesize that extant Moldavian paternal genetic lineages arose from extensive recentadmixture between genetically autochthonous populations of the Balkan-Carpathian zone and neighboring Slavic groups.

Citation: Varzari A, Kharkov V, Nikitin AG, Raicu F, Simonova K, et al. (2013) Paleo-Balkan and Slavic Contributions to the Genetic Pool of Moldavians: Insights fromthe Y Chromosome. PLoS ONE 8(1): e53731. doi:10.1371/journal.pone.0053731

Editor: Manfred Kayser, Erasmus University Medical Center, The Netherlands

Received August 30, 2012; Accepted December 4, 2012; Published January 16, 2013

Copyright: � 2013 Varzari et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the Russian Ministry of Science and Education (contracts # 16.512.11.2033, 11.519.11.2036 and P321). AV was supportedby a DAAD fellowship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No additionalexternal funding was received for this study.

Competing Interests: Dr. Vadim Stepanov is an employee of a commercial company ‘‘Genomnay Diagnostika Ltd.’’ However, this does not alter the authors’adherence to all the PLOS ONE policies on sharing data and materials.

* E-mail: [email protected]

Introduction

The Republic of Moldova is located at a geographical

intersection between eastern and southeastern Europe. It shares

borders with Romania to the west and Ukraine to the north, east,

and south. The country is home to approximatly 4 million people,

69 percent of whom are ethnic Moldavians, with sizable minorities

of Ukrainians (11%) and Russians (9%), mostly living in the

eastern part of the Republic (Transnistria) and in urban areas.

Moldavians speak the Moldavian language, which belongs to the

Eastern Romance group of languages and is very close to the

Romanian.

Modern humans began to inhabit Moldova’s territory in the

Upper Paleolithic. During the Neolithic, Moldova was settled by

the Starcevo–Koros–Cris and Linear Pottery cultures, which

dominated the Balkans and central Europe in the 6th millennium

BC [1,2]. As a fusion of these and other Neolithic groups, a new

archaeological culture, the Cucuteni-Trypillia archeological com-

plex, emerged by the end of the 6th millennium BC. The culture

lasted till ca. 2750 BC and covered a vast area extending from the

Carpathian Mountains in the west to the Dnieper River in the

east, and south to the shores of the Black Sea [3]. The Kurgan

cultures expansion, triggered by the adaptation of pastoral

nomadism by peoples in the Pontic-Caspian steppes, spread into

southeastern and central Europe through the Moldovan territory

in several waves over the Eneolithic and Bronze Age periods

(440021500 BC) [4,5]. Most likely, their arrival in central and

southeastern Europe brought the Indo-European language family

to Europe. It has been proposed that Paleo-Balkan tribes, the

Thracians and Illyrians, originated from a mixture of indigenous

peoples (Danubian farmers) and Indo-European newcomers by the

end of the 2nd millennium BC [6,7].

During the Iron Age (12th c. BC –4th c. AD) the northern

Thracian tribes, the Dacians and Getae, dominated the Car-

pathian Basin including the Moldovan territory [8,9,10]. Their

closest neighbors to the east and south were nomadic and semi-

nomadic tribes of Cimmerians (11th - 7th centuries BC), succeeded

by the Scythians (7th –3rd centuries BC) and Sarmatians (3rd c. BC

–4th c. AD). Also, Bastarnae, possibly a mixed Celto-Germanic

group, settled in the southern parts of the region [11]. The

Romans who had conquered the Balkans in early years AD,

exerted political and cultural influence over the northern

PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e53731

Thracians and other ethnic groups, causing their partial Roman-

ization [8,10,11]. After the Roman Empire a number of groups

such as Goths, Huns, Avars and Bulgars passed through the

territory of Moldova, and since the 6th century the Slavs had

settled there and came into close economic and cultural contact

with the Romanized population [10,12]. Although the Slavic

contribution to the cultural and linguistic development of Daco-

Roman ethnic groups is not in doubt, the extent of their

demographic contribution to indigenous populations of Moldova

and Romania is not known.

From the 9th until the 14th century, the territory of Moldova was

repeatedly invaded by different peoples from central Asia,

including Magyars, Pechenegs, Cumans, Mongols and Tatars

[12,13]. After the collapse of the Mongol Empire, an influx of

Vlachs (a Daco-Roman ethnic community) and Rusyns (an eastern

Slavic group) to the region coincided with the formation of the

Principality of Moldova (Moldavia) in the second half of the 15th

century [10,13,14]. Throughout its 500-year history the princi-

pality has been subject to the political influence of such external

powers as the Kingdom of Hungary, the Grand Duchy of

Lithuania and the Kingdom of Poland, as well as the Ottoman,

Russian and Austro-Hungarian Empires [8]. Bessarabia, the

territory in the eastern portion of the Principality, was annexed

by the Russian Empire in the early 19th century. The majority of

the Bessarabian population continued to designate themselves as

Moldavians, whereas the ethnonym ‘‘Romanian’’ was gaining

more and more popularity throughout West Moldavia. The

Bessarabian population expanded under the Russian rule, due in

part to the influx of Russian and Ukrainian immigrants. The

Slavic influence on Bessarabia continued through its transforma-

tion into the Moldavian Soviet Socialist Republic in 1940 and

lasted until the independence of the Republic of Moldova in 1991.

Until recently, few genetic studies have been performed on

Moldavians. Classical genetic markers (blood groups and serum

proteins) indicate close genetic affinities of Moldavians with other

southeastern European groups [15]. Similarly, autosomal Alu

polymorphisms support the high degree of relatedness among

southeastern European populations, including Moldavians [16].

However, these marker systems possess low-resolution power for

assessing population structure. Compared with autosomal loci, Y-

chromosome variation tends to exhibit a higher degree of

population specificity and hence may be more informative for

tracing population history [17]. Only few studies dealing with Y-

chromosome diversity have been carried out on Moldavians

[18,19,20,21]. Furthermore, none of these previous studies focused

specifically on Moldavians and their origins. Rather, they targeted

larger geographic scales or other ethnic groups and were limited in

their sampling and genotyping.

In this paper, we evaluated the composition of Y-chromosome

lineages using the combination of 37 binary and 17 STR markers

in 125 Moldavian individuals coming from two spatially separated

settlements of the Republic of Moldova. For comparison, 53

Ukrainians from eastern Moldova (Transnistria) and 54 Roma-

nians from eastern Romania were typed using the same set of

markers. Comparisons to other published populations from nearby

regions were made to further assess the phylogenetic context of the

Moldavian Y-chromosomal pool. The results show that present-

day Moldavians share their paternal ancestry with both Balkan

and eastern/central European populations. This supports the

historical accounts that Moldavians arose from an admixture

between Vlachs and eastern Slavs.

Materials and Methods

SamplesA total of 232 unrelated male individuals were analyzed in the

present study. The sample set comprised self-designated Molda-

vians from the northern settlement of Sofia and southeastern

Figure 1. Geographical location of the samples analyzed.doi:10.1371/journal.pone.0053731.g001

Y Chromosome Variation and Moldavian Origins


settlement of Karahasani, as well as Ukrainians from the eastern

village of Rashkov in Transnistria (Republic of Moldova) and

Romanians from the towns of Piatra-Neamt and Buhusi from

eastern Romania (Figure 1). Taking into account the geographic

Table 1. PCR-RFLP protocols developed for P15, v13, U8 and M423 markers.

Marker Primers used (59-39) Ta Sizeb Digestion Fragment/s (allele)c

P15 F: GATTCTGGGTCTCTTCCCTTTTR: TGGGAATCACTTTTGCAACTTTCATCTGCCTTCATACd

58 255 BstSNI 218/37 (C) R 255 (T)

v13 F: AACAGTGGAGGACAAAGCATGTTACTGTCAGTGGCd

R: AGTGTATCAACAATGCCCAG58 320 HspAI 286/34 (G) R 320 (A)

U8 F: GGAGGTCTCCTGTGTCATTGR: TTATGATTTTTGGATTAAGGTTGCCATCAGGCTTTCd

58 311 Bpu14I 311 (T) R 274/37 (C)

M423 F: TTCACATTTTAACAGGGAACCAR: CAAAGGAATCACTTGGCTGTCACTTCCGATGATGCd

58 166 HspAI 130/36 (C) R 166 (T)

F refers to the forward primer, and R refers to the reverse primer for a particular locus.aPCR annealing temperature in Cu.bPCR product size in base pairs.cRFLP fragments in base pairs.dMismatched primer (mismatched bases are underlined).doi:10.1371/journal.pone.0053731.t001

Table 2. Sample size (N), haplogroup counts and diversity in the population groups studied.

Haplogroup namea

Karahasani(Moldavians) Sofia (Moldavians) Total Moldavians

Piatra Neamt andBuhusi (Romanians) Rashkov (Ukrainains)

N = 71 N = 54 N = 125 N = 54 N = 53

E-M78* – 2 (0.037) 2 (0.016) 1 (0.019) –

E-v13 6 (0.085) 5 (0.093) 11 (0.088) 3 (0.056) –

E-M123 3 (0.042) – 3 (0.024) – –

G-P15* – 1 (0.019) 1 (0.008) 2 (0.037) –

G-U8 – – – 1 (0.019) –

H-M52 – – – 1 (0.019) –

I-M253 2 (0.028) 4 (0.074) 6 (0.048) 2 (0.037) 2 (0.038)

I-M423 12 (0.169) 14 (0.259) 26 (0.208) 22 (0.407) 11 (0.208)

I-M223 3 (0.042) 1 (0.019) 4 (0.032) 1 (0.019) –

J-M267 4 (0.056) 1 (0.019) 5 (0.040) – 1 (0.019)

J-M172* 2 (0.028) 2 (0.037) 4 (0.032) 1 (0.019) 1 (0.019)

J-M47 – – – – 1 (0.019)

J-M67* 1 (0.014) – 1 (0.008) – –

J-M92 – – – 1 (0.019) –

J-M12 – – – 1 (0.019) 2 (0.038)

N-P43 1 (0.014) – 1 (0.008) – –

N-M178 – 1 (0.019) 1 (0.008) – 3 (0.057)

Q-M242 – 1 (0.019) 1 (0.008) – –

R-M17* 14 (0.197) 8 (0.148) 22 (0.176) 9 (0.167) 18 (0.340)

R-M458 12 (0.169) 4 (0.074) 16 (0.128) 2 (0.037) 3 (0.057)

R-M73 – – – – 3 (0.057)

R-M269* 4 (0.056) 5 (0.093) 9 (0.072) – 5 (0.094)

R-M412* 5 (0.070) 4 (0.074) 9 (0.072) 3 (0.056) 1 (0.019)

R-M405 2 (0.028) – 2 (0.016) 4 (0.074) 2 (0.038)

T-M70 – 1 (0.019) 1 (0.008) – –

H6 SD 0.891860.0167 0.888960.0247 0.891060.0128 0.802960.0466 0.833160.0363

aThe phylogeny of haplogroups is shown in Figure S1.Relative haplogroup frequencies are given within parentheses.H, haplogroup diversity; SD, standard deviation.doi:10.1371/journal.pone.0053731.t002



profile and population size of Moldova, the two Moldavian groups

sufficiently represent the whole Moldavian population. Written

informed consent was obtained from all participants in the study

and information about geographic and ethnic origins of their

parents and grandparents was recorded. The study protocol was

approved by the Ethics Committee of the Research Institute of

Medical Genetics (Tomsk, Russia). Genomic DNA was extracted

from peripheral blood lymphocytes using a salt-precipitation

method [22].

Genotyping37 binary markers known to identify specific paternal lineages

within Europe and West/Central Asia were analyzed in hierar-

chical order in agreement with the Y-chromosome phylogeny

(Figure S1). 33 of these markers were typed according to previous

reports, namely YAP [DYS287] [23], 12f2 [DYS11] [24], M17,

M89 and DYF155S2 [25], 92R7 [26], Tat [M46] [27], M9 [28],

M70, M223 and M253 [29], M52, M78 and M123 [30], P25, P37,

M172, M178, M201, M207, M242 and M269 [31], SRY-2627

[32], M12, M47, M67, M92 and M267 [33], P43 [34], M73 and

M458 [35], M405 [36], and M412 [37]. In addition, we

genotyped four polymorphisms reported previously, namely P15

[38], v13 [39], U8 [40] and M423 [41]. Primer sequences for each

of these four markers were used as previously described, or were

designed by introducing a mismatched base to produce a variable

restriction site in amplification products (Table 1). The deep-

rooting marker M9 was typed in all samples and other markers

were typed hierarchically according to their known phylogeny.

In addition, all samples were genotyped for 17 Y-chromosome

short tandem repeats (DYS19, DYS385a, DYS385b, DYS388,

DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393,

DYS426, DYS434, DYS435, DYS436, DYS437, DYS438, and

DYS439). The primers used were described by de Knijf et al. [42]

and Kayser et al. [43] to amplify DYS19, DYS389I, DYS389II,

DYS390, DYS391, DYS392, DYS393, by Buttler et al. [44] to

amplify DYS385a, DYS385b, DYS388, DYS426, DYS438, and

by Ayub et al. [45] to amplify DYS434, DYS435, DYS436,

DYS437 and DYS439. One of each primer pair was labeled with

fluorescent dye TET (green), FAM (blue) or HEX (yellow). The

amplified products were then pooled in two different multiplexes

(DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, and

DYS393) and (DYS385a, DYS385b, DYS388, DYS426, DYS434,

DYS435, DYS436, DYS437, DYS438, and DYS439) and run on

ABI Prism 310 and 3130 genetic analyzers (Applied Biosystems)

using GeneScan 500-TAMRA (red) as the internal standard. The

alleles were named according to the number of repeat units. The

number of repeat units was established through the use of

sequenced reference DNA samples as suggested by de Knijf et al.

[42]. Allele length for DYS389b was obtained by subtraction of

the DYS389I allele length from that of DYS389II. For the

duplicated microsatellite DYS385a/b, the short and long scores

are reported according to allele size.

Statistical AnalysisStatistical analyses such as haplogroup and haplotype diversity

assessments, pairwise FST (for haplogroup) and RST (for haplotype)

distance calculations, and AMOVA based on STR data were

performed using Arlequin ver. 3.5 software [46]. The statistical

significance tests for RST were performed using 1,000 permuta-

tions and for FST and AMOVA with 10,000 permutations. RST

distances among compared populations were represented in two

dimensions with multidimensional scaling (MDS) using the

STATISTICA v.6 software package (StatSoft, Inc 1995). STA-

TISTICA was also used to perform the principal component (PC)

analysis on the covariance matrix of the Y haplogroup frequencies.

Network analysis of the STR data was carried out with the

software package NETWORK version 4.6 (http://www.fluxus-

technology.com). Networks were calculated by the median-joining

method after having processed the data with the reduced median

method [47]. To score different mutation rates upon the network

construction, each STR locus was weighted proportionally to the

inverse of the repeat variance.

The DYS385a and DYS385b microsatellites were not consid-

ered in genetic distance (RST) and AMOVA analyses given their

duplicated nature and the impossibility of assigning each allele to

DYS385a or DYS385b. The DYS385a and DYS385b loci were

excluded from the construction of the phylogenetic network inside

haplogroup I-M423 for the same reason. However, the DYS385a

and DYS385b loci were included in constructing the network of

the haplogroup R-M17*, as they diverged strongly enough to

always produce two distinct peaks during sequencing. Therefore

both loci could be identified in all individuals carrying R-M17*

chromosomes and used as two independent markers. DYS385a

and DYS385b were also included in the diversity calculations,

although it may have caused slight underestimates.

Figure 2. Principal Component Analysis (PCA) plot of Ychromosome haplogroup profiles showing genetic affinitiesamong 28 populations from eastern, central and southernEurope. Original references, number of samples and name codes for allpopulations included in the analysis and their haplogroup frequenciesare listed in Table S1. Moldavian populations are indicated by stars;north Mediterranian groups by diamonds; eastern and central Europeanpopulations including Ukrainians from Moldova by circles, and northBalkan groups including Romanians by squares.doi:10.1371/journal.pone.0053731.g002



Results

Y-chromosome Haplogroup VariationHaplogroup frequencies in the two Moldavian (separate and

pooled), Romanian and Ukrainian samples are reported in

Table 2. A total of 36 of the 37 genotyped binary polymorphisms

were informative and defined 25 distinct haplogroups in our

combined collection of Y chromosomes (Table 2, Figure S1).

In Moldavian males, 19 haplogroups were identified. The most

frequent of them were I-M423 and R-M17*, comprising 20.8%

and 17.6%, respectively, of all Moldavian Y-chromosomes. These

were followed by haplogroups R-M458 (12.8%), E-v13 (8.8%), R-

M269* and R-M412* (both 7.2%). All of the remaining lineages

were present at frequencies of less than 5% in the Moldavian

paternal gene pool. The haplogroup distributions were similar in

the two Moldavian samples (Fisher exact test; P = 0.34011) and

were in agreement with those reported previously for the

Moldavian population [17,18,19,20] or neighboring populations

(Table S1).

In Romanians, 15 haplogroups were found. The most common

Y haplogroup in this population was I-M423 (40.7%). This is the

highest frequency of the I-M423 haplogroup reported so far

outside of the northwest Balkans. The next most frequent among

Romanian males was haplogroup R-M17* (16.7%), followed by

R-M405 (7.4%), E-v13 and R-M412* (both 5.6%).

In Ukrainians, 13 haplogroups were identified. The haplogroup

R-M17* was the most frequent (34.0%), followed by I-M423

(20.8%), R-M269* (9.4%), N-M178, R-M458 and R-M73 (each

5.7%). The proportions of these haplogroups were in accordance

with those observed in other Slavic populations from eastern and

central Europe [41], except for the R-M73 haplogroup, which is

characteristic for certain central Asian populations and is almost

absent in Europe [37].

No significant difference in the haplogroup frequency distribu-

tion was detected between Sofia Moldavians and other populations

from the current study (P.0.05). Pairwise comparisons of

Karahasani Moldavians showed significant differences between

them and Romanians (P = 0.00309), as well as Ukrainians

(P = 0.00432). These differences remained significant, even after

applying the Bonferroni correction for multiple testing

(P = 0.01854 and P = 0.02592, respectively). The Karahasani

population displayed a high frequency of the R-M458 haplogroup,

characteristic for eastern and central Europe. In addition, the

Karahasani Moldvians showed a lower frequency of the I-M423

chromosome than the Romanians. A significant difference in Y-

haplogroup composition was also detected between Romanians

and Ukrainians (P = 0.00376 uncorrected for multiple compari-

sons and P = 0.02256 adjusted for multiple comparisons).

Figure 3. Multidimentional Scaling Analysis (MDS) plot of RST values from Y chromosome STR haplotype frequencies showinggenetic affinities among 29 populations from eastern, central and southern Europe. The stress value for the MDS plot is 0.056. Originalreferences, number of samples and haplotypes and name codes for all populations included in the analysis are listed in Table S3. Symbol designationsare as in Figure 2. The ellipses are drawn around the clusters of east/central European (eastern and western Slavic) (I), southeast European (Balkan-Carpathian) (II) and Italian (III) populations. While the Cheg Albanian population is a genetic ‘‘outlier’’ among southeast European populations,geographically it belongs in the Balkan-Carpathian cluster (indicated by an arrow).doi:10.1371/journal.pone.0053731.g003



We used Principle Component (PC) analysis to compare the

present data with those reported for eastern, central, and southern

European populations (Table S1). These populations were

included in the comparison because of their potential contribution

to the genetic variability of Moldavians. To make comparisons

reliable, haplogroups were rooted in the same phylogenetic level in

all compared samples. Figure 2 presents the PC plot obtained.

Overall, the positions of the populations in the PC plot correspond

well to their assignments to specific regional groups. The first axis

accounted for 43.71% of the haplogroup frequency variation and

clearly separated east European populations from north Mediter-

ranean groups. The second PC encompassed 34.60% of the

observed variance and separated most of the north Balkan samples

from the rest of European samples. Vector analysis (not shown)

demonstrates that the north Mediterranean cluster is most

associated with haplogroups J-M172, E-v13 and R-M269. The

east/central European cluster was most influenced by R-M17

while the north Balkan cluster associated mostly with I-P37. The

samples analyzed did not form a tight cluster on the PC plot.

Indeed, Romanians clustered with samples from northwestern

Balkans while the Ukrainians from Moldova fell into the east/

central European cluster. Two Moldavian samples were found to

occupy a more central position on the plot, with Moldavians from

Sofia appearing closer to populations from southeastern Europe

and Moldavians from Karahasani to populations from eastern and

central Europe. These results suggest that the Moldavian Y

chromosome pool is admixed, likely as a result of interactions

between the Balkan and east/central European gene pools.

Y-chromosome Haplotype DiversityY-STR polymorphisms were analyzed to obtain a more detailed

view of Y-chromosome variation in the populations under study.

Complete Y-chromosomal STRs haplotypes were obtained from

228 individuals, among which 181 different haplotypes were

identified. In all cases but one, the chromosomes sharing a

haplotype belonged to the same haplogroup. Hence, 182

compound binary-STR haplotypes were observed, among which

148 (81.3%) were individual-specific (Table S2). STR haplotype

diversity for the 17-locus set ranged from 0.9895 in the Romanian

population to 0.9971 in the Ukrainian population (Table S2),

indicating the presence of identical haplotypes among unrelated

males in all compared populations. Pairwise RST comparison

between the Y-STR haplotypes (based on 15 STRs) in our samples

showed that haplotype distributions were very similar in the two

Moldavian samples (P = 0.28086). Yet, no significant difference

was found between Moldavian and Romanian, as well as between

Moldavian and Ukrainian samples. Of all pairwise comparisons,

the only significant difference was observed between Romanians

and Ukrainians (P = 0.01406). However, this value did not remain

significant following the Bonferroni correction (P = 0.08436).

Once the Y-STRs were reduced to ten-locus profiles (DYS19,

DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393,

DYS437, DYS438, DYS439), we were able to compare our data

to those from the published literature (Table S3). In the selection

of populations we were guided by their relevance and importance

to the population history of Moldavians. The observed haplotype

diversity values in the populations studied were comparable to

those found among the comparative data sets, with haplotype

diversity in our Romanian sample being slightly lower. The RST

genetic distances between all populations under comparison were

also obtained (Table S4) and subjected to MDS analysis at two-

dimensional levels. The compared populations clustered according

to major geographic regions on the MDS plot (Figure 3). There is

a general agreement between the MDS plot and the PC plot based

on the Y-haplogroup frequencies, although the comparison was

made by differing samplings of populations available for the two

genetic systems. Similarly, eastern European populations formed a

separate cluster, which is adjacent to the cluster encompassing the

Balkan and Romanian samples. However, unlike in the PC

analysis, the Italian populations were clearly separated from the

south Balkan populations (Greeks and Albanians), with the latter

showing greatest affinities with the north/central Balkans and

Romanians. Moldavians from Karahasani and Sofia appeared to

associate closely with each other along the inner margin of

eastern/central European and Balkan-Carpathian clusters, respec-

tively. Furthermore, the absence of a correlation between the

ethnic and genetic diversities of the populations within the Balkan-

Carpathian cluster is noteworthy. Specifically, Romanian popu-

lations appeared to be interspersed among the southern Slavic

populations.

The pairwise RST comparisons showed that northern and

southeastern Moldavians exhibit unequal ties to their neighbors.

However, this type of phylogenetic analysis is known to be

influenced by multiple-testing problems. To avoid these, AMOVA

analyses were performed by assigning the populations to five

groups: Moldavians, Romanians, Balkans, eastern/central Europe

(eastern and western Slavs), and Italians (Table 3). Our focus was

on the Moldavian and Romanian populations, due to their

presumed biological connections derived from cultural similarities.

The AMOVA showed no significant distinction between Molda-

vians and Romanians (P = 0.18851) on the one hand, as well as

between the Moldavian and Romanian groups and the Balkan

cluster on the other (P.0.05). Also, no significant difference was

observed between the Moldavian and eastern/central Slavic

Table 3. AMOVA calculation results for 10 Y-STRs.

Groupsa Among groups Among populations within groups Within populations

Moldavians vs. Romanians 1.66 (P = 0.18851) 2.20 (P = 0.00020) 96.14 (P = 0.00000)

Moldavians vs. Eastern and Western Slavs 20.11 (P = 0.62168) 1.86 (P = 0.00000) 98.24 (P = 0.00000)

Romanians vs. Eastern and Western Slavs 5.18 (P = 0.00069) 1.85 (P = 0.00000) 92.97 (P = 0.00000)

Moldavians vs. Balkans 1.57 (P = 0.16277) 3.44 (P = 0.00000) 94.99 (P = 0.00000)

Romanians vs. Balkans 20.56 (P = 0.58693) 3.50 (P = 0.00000) 97.06 (P = 0.00000)

Moldavians vs. Italians 12.07 (P = 0.04525) 2.65 (P = 0.00000) 85.28 (P = 0.00000)

Romanians vs. Italians 11.05 (P = 0.00941) 2.73 (P = 0.00000) 86.22 (P = 0.00000)

aTwenty nine populations (the same as in MDS analysis) were pooled into five groups defined according to ethnicity (Moldavians, Romanians, Eastern and Western Slavs,Italians) or geography (Balkans) (Table S3).doi:10.1371/journal.pone.0053731.t003



groups (P = 0.62168). In fact, these differences were even less

pronounced than the differences between Moldavians and

Romanians (20.11% vs. 1.66%). Noteworthy, the Romanian

versus Slavic comparison revealed a significant proportion of

intrapopulational differences (5.18%; P = 0.00069). The highest

level of population substructure was between Italians and

Moldavians (12.07%; P = 0.04525) as well as between Italians

and Romanians (11.05%; P = 0.00941).

Haplogroups I-M423 and R-M17* were found in relatively high

frequencies in Moldavians and their closest geographic neighbors,

eastern Romanians and Ukrainians. In order to explore the

genetic similarities of the I-M423 and R-M17* Moldavian

chromosomes with those from Romanian and Ukrainian popula-

tions, median-joining networks based on 15 and 17 STRs

haplotypes were generated on the background of haplogroups I-

M423 and R-M17*, respectively (Figure 4). In both networks the

Ukrainian and Romanian Y-STR haplotypes appeared to cluster

within the respective populations. For haplogroup I-M423,

Moldavian chromosomes share equal number of haplotypes with

both Romanian and Ukrainian samples. In the case of R-M17*,

the reduced median network of the Y-STR haplotypes indicated a

closer relationship of the Moldavian Y-STR haplotypes with

Ukrainian Y-STR haplotypes than with Romanian Y-STR

haplotypes. Specifically, of four haplotypes shared by Moldvians

with other populations three Moldavian haplotypes were found to

be shared with Ukrainian haplotypes and only one haplotype was

shared between Moldavians and Romanians. Pairwise RST

comparisons for Y-STR haplotypes within haplogroup R-M17*

further indicate that the Moldavian R-M17* chromosomes are

closer related to the Ukrainian R-M17* chromosomes

(RST = 0.02709; P = 0.14108) than to those of Romanians

(RST = 0.20157; P = 0.0015 adjusted for multiple testing). It should

be noted, however, that the total number of individuals from each

population used in these analyses is small. Therefore, further study

will be needed to clarify in detail the relationship of the R-M17*

chromosomes in Moldavians, Romanians and Ukrainians.

Discussion

The results of the present study show that the Moldavian

paternal gene pool presents features characteristic to those found

in east/central Europe and the Balkans. This is particularly

supported by the following observations: (i) Moldavians display

high frequencies of haplogroups I-M423 and R-M17, which are

found within the populational variation characterizing paternal

gene pools of southeastern and eastern Europe (Table S1); (ii) the

centered position of the Moladavian samples in the space of two

main components of Y-chromosomal frequencies (Figure 2); (iii)

genetic distances, which place Moldavians between east/central

Europe and the Balkans (Table S4; Figure 3), and (iv) the absence

of significant differentiation between Moldavians and the sur-

rounding ethno-geographical groups revealed by AMOVA anal-

ysis based on microsatellite haplotypes (Table 3).

The genetic relationship between Moldavians and Romanians

deserves special attention, since these two groups speak practically

the same language and share many cultural features. It is

reasonable to assume that Moldavians and Romanians inherited

genetic lineages, shared with other Balkan populations, from

Vlachs who, in turn, received them from Paleo-Balkan tribes.

However, Moldavians and Romanians do not form a cluster that

would have separated them from the neighboring populations.

Indeed, in the space of multi-dimensional scaling based on the RST

distances between STR haplotypes, Romanian populations

appeared scattered among the Balkan populations and did not

cluster with the Moldavians (Figure 3). According to the AMOVA

analysis, the degree of within-group differentiation among

Moldavian and Romanian populations was significantly greater

than genetic differences between either Romanians or Moldavians

and the group comprised of the Balkan populations (Table 3).

Moldavians and Romanians also appear dissimilar on the diagram

of binary lineages (PC plot, Figure 2). Thus, sharing nearly the

same language is not accompanied by specific genetic similarity

between Moldavians and Romanians. Furthermore, Italian

populations that share the Romance/Latin language with

Moldavians and Romanians, show little genetic similarity with

them. These results agree with previous genetic studies suggesting

that the genetic landscape of southeast Europe had been formed

Figure 4. Median-joining networks showing phylogeneticrelationships of the Moldavian, Romanian and Ukrainian Y-haplotypes within haplogroups I-M423 (A) and R-M17* (B).Networks were constructed from 17 STRs for haplogroup R-M17* and15 STRs for haplogroup I-M423 as described in Materials and Methods.For each network, the smallest circles represent a count of oneindividual. Branch lengths are proportional to the number of mutationalsteps separating two haplotypes.doi:10.1371/journal.pone.0053731.g004



long before the modern linguistic/ethnic landscape was shaped

[16,48].

In contrast to Romanians and most other Balkan populations,

Moldavians show a clear genetic similarity to western and eastern

Slavs. This is strongly implied by haplogroup R-M17, which

dominates the paternal lineages of the Slavs and is broadly

represented in Moldavians. Stefan et al. [18] have already noticed

the increased presence of R-M17 chromosomes in Moldavians and

explained it as a trait inherited from ancient (prehistoric)

population of the North Pontic Steppe. However, genetic

continuity in this scenario is not supported by archaeological

and historical records, which suggest repeated dramatic demo-

graphic changes in Moldova’s population during the 4th –14th

centuries AD. Recent admixture with Slavic neighbors appears to

be a more parsimonious explanation for the elevated R-M17

frequency in Moldavians. The noteworthy domination of R-M17

chromosomes in Moldavians compared to Romanians is due to

the R-M458 subclade. Haplogroup R-M458 likely has its roots in

western/northern Poland, where it has its greatest modern

concentration and microsatellite diversity [49]. Given the

geographical proximity of Moldova to the Polish and other Slavic

population groups and historically attested interactions between

Moldavians and Slavs [10,12,13,14], it is reasonable to assume

that an influx of Slavs helped elevate the frequency of R-M17

chromosomes among Moldavians to underscore the Moldavian-

Romanian differentiation. Furthermore, Romanians and Molda-

vians also display differences in the structure of R-M17* STR

haplotypes. Although our network analysis (Figure 4) primarily

shows homogeneity of the diversity of R-M17 haplotypes,

Moldavian R-M17 chromosomes align closer with Ukrainian

(Slavic) chromosomes than with Romanian ones, further support-

ing the contribution from Slavic neighbors to the Moldavian

paternal gene pool.

Despite repeated invasions by nomads from Asian heartlands,

only two (N-P43 and Q-M242) out of 125 Moldavian Y

chromosomes studied here belonged to haplogroups of apparently

northern/central Asian origins. These results are in good

agreement with earlier studies on Y-chromosome variation in

eastern and central Europe, asserting a minimal impact of gene

flow from Siberia/central Asia [25,41,50,51].

In conclusion, the results presented in this report allow to

hypothesize that an admixture of autochthonous populations of

the Balkan-Carpathian zone with neighboring Slavic populations

was likely the main factor that contributed to the diversity of the

Y-chromosomal genetic pool of present-day Moldavians and, in

particular, to the differences in the Y chromosomal lineage

composition between Moldavian and Romanian populations.

Analyses of mitochondrial DNA and genome-wide assessments

of haplotype sharing between Moldavians and neighboring

populations would be essential to produce a comprehensive

picture of phylogeographic origins of Moldavian genetic lineages.

Supporting Information

Figure S1 Y chromosomal haplogroups defined by the37 binary markers used. The solid lines represent hap-

logroups found in the study while the dashed lines are haplogroups

not detected in the sample.

(TIF)

Table S1 Frequencies of Y-chromosome haplogroups inthe 28 populations included in the PCA.(XLS)

Table S2 Y-STR haplotypes by haplogroups in thepopulations studied.(XLS)

Table S3 Reference populations used in the MDS andAMOVA analyses.(XLS)

Table S4 RST distances among 29 populations based onY–STR haplotypes.(XLS)

Acknowledgments

We are indebted to those who volunteered DNA samples and to Cristiana

Glavce, Ludmila Stirbu, Vladimir Calalb, Veaceslav Bicbaiev, Evgeni

Yarovoi, Irina Groza and other colleagues who facilitated their collection.

We thank Boris Joffe and Valentin Dergachev for their valuable comments.

Author Contributions

Performed the sample collection: AV FR. Discussed the results and

commented on the manuscript: AV VK AN FR KS WS EW VS.

Conceived and designed the experiments: AV VK. Performed the

experiments: AV VK KS FR. Analyzed the data: AV WS. Contributed

reagents/materials/analysis tools: VS EW. Wrote the paper: AV AN.

References

1. Renfrew AC (1987) Archaeology and Language: The Puzzle of Indo-European

Origins. London: Jonathan Cape. 368 p.

2. Larina O (2010) Inceputurile economiei productive. Neoliticul. Oranduirea

gentilico-tribala. In: Dergaciov V, editor. Istoria Moldovei: Epoca preistorica si

antica (pina in sec. V). Chisinau, Moldova: Academia de Stiinte a Moldovei.

177–218.

3. Zbenovich VG (1996) The Tripolye Culture: Centenary of Research. Journal of

World Prehistory 10: 199–241.

4. Gimbutas M (1973) The beginning of the Bronze Age in Europe and the Indo-

Europeans: 350022500 B.C. Journal of Indo-European Studies 1: 163–214.

5. Dergachev VA (2000) The Migration Theory of Marija Gimbutas. Journal of

Indo-European Studies 28: 257–339.

6. Dumitrescu VL, Bolomey A, Mogosanu F (1982) The Prehistory of Romania

from the earliest times to 1000 B.C. In: Boardman J, Edwards IES, Hammond

NGL and Sollberger E, editors. The Prehistory of the Balkans; and the Middle

East and the Aegean world, tenth to eighth centuries B.C. Cambridge:

Cambridge University Press. 1–74.

7. Garasanin M (1982) The Bronze Age in the Central Balkan Area. In: Boardman

J, Edwards IES, Hammond NGL, Sollberger E, editors. The Prehistory of the

Balkans; and the Middle East and the Aegean world, tenth to eighth centuries

B.C. Cambridge, UK: Cambridge University Press. 75–186.

8. Klepper N (2002) Romania: an illustrated history. New York: Hippocrene

Books. 298 p.

9. Kasuba M, Levitki O, Agulnicov S (2010) Prima epoca a fierului (sec. XII-VIII/

VII i. Hr.). Inceputurile relatiilor de clasa. In: Dergaciov V, editor. Istoria

Moldovei: Epoca preistorica si antica(pina in sec. V). Chisinau: Academia de

Stiinte a Moldovei. 313–413.

10. Fyodorov GB (1999) Ethno-genesis of the Vlachs, Moldovan’s ancestors,

according to the archaeological data (historiographical aspect). Stratum Plus 5:

14–74.

11. Shchukin MB (1989) Rome and the barbarians in central and eastern Europe:

1st century B.C.-1st century A.D. Oxford, UK: B.A.R. 542 p.

12. Sedov VV (2002) The Slavs. Historical and archaeological study. Moscow:

Iazyki slavianskoi kul’tury. 622 p.

13. Russev ND (1999) Moldavia in ‘‘Dark Ages’’. Materials for understanding

cultural and historical processes. Stratum Plus 5: 379–407.

14. Guboglo MN, Dergachev VA (2010) The Moldavians. Moscow: Nauka. 541 p.

15. Varsahr AM, Scheil HG, Schmidt HD (2006) Blood group and serum protein

polymorphisms in a population group of Moldavians. Anthropol Anz 64: 51–58.

16. Varzari A, Stephan W, Stepanov V, Raicu F, Cojocaru R, et al. (2007)

Population history of the Dniester-Carpathians: evidence from Alu markers.

J Hum Genet 52: 308–316.

17. Jobling MA, Tyler-Smith C (2003) The human Y chromosome: an evolutionary

marker comes of age. Nat Rev Genet 4: 598–612.

18. Stefan M, Stefanescu G, Gavrila L, Terrenato L, Jobling MA, et al. (2001) Y

chromosome analysis reveals a sharp genetic boundary in the Carpathian region.

Eur J Hum Genet 9: 27–33.



19. Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, et al. (2004) Phylogeography

of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flowin Europe. Am J Hum Genet 75: 128–137.

20. Cruciani F, La Fratta R, Trombetta B, Santolamazza P, Sellitto D, et al. (2007)

Tracing past human male movements in northern/eastern Africa and westernEurasia: new clues from Y-chromosomal haplogroups E-M78 and J-M12. Mol

Biol Evol 24: 1300–1311.21. Nasidze I, Quinque D, Udina I, Kunizheva S, Stoneking M (2007) The Gagauz,

a linguistic enclave, are not a genetic isolate. Ann Hum Genet 71: 379–389.

22. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out procedure forextracting DNA from human nucleated cells. Nucleic Acids Res 16: 1215.

23. Hammer MF, Horai S (1995) Y chromosomal DNA variation and the peoplingof Japan. Am J Hum Genet 56: 951–962.

24. Rosser ZH, Zerjal T, Hurles ME, Adojaan M, Alavantic D, et al. (2000) Y-chromosomal diversity in Europe is clinal and influenced primarily by

geography, rather than by language. Am J Hum Genet 67: 1526–1543.

25. Kharkov VN, Stepanov VA, Borinskaia SA, Kozhekbaeva ZhM, Gusar VA, etal. (2004) Gene pool structure of Eastern Ukrainians as inferred from the Y-

chromosomal haplogroups. Russ J Genet 40: 326–331.26. Mathias N, Bayes M, Tyler-Smith C (1994) Highly informative compound

haplotypes for the human Y chromosome. Hum Mol Genet 3: 115–123.

27. Zerjal T, Dashnyam B, Pandya A, Kayser M, Roewer L, et al. (1997) Geneticrelationship of Asians and Northern Europeans, revealed by Y chromosomal

DNA analysis. Am J Hum Genet 60: 1174–1183.28. Hurles ME, Irven C, Nicholson J, Taylor PG, Santos FR, et al. (1998) European

Y chromosomal lineages in Polynesia: a contrast to the population structurerevealed by mitochondrial DNA. Am J Hum Genet 63: 1793–1806.

29. Kharkov VN, Stepanov VA, Medvedeva OF, Spiridonova MG, Voevoda MI, et

al. (2007) Gene pool differences between northern and southern Altaiansinferred from the data on Y-chromosomal haplogroups. Russ J Genet 43: 675–

687.30. Flores C, Maca-Meyer N, Perez JA, Gonzalez AM, Larruga JM, et al. (2003) A

predominant European ancestry of paternal lineages from Canary Islanders.

Ann Hum Genet 67: 138–152.31. Kharkov NV, Stepanov VA, Puzyrev VP, Feschenko SP, Borinskaya SA, et al.

(2005) Frequency of Y chromosomal bi-allelic haplogroups in Belorussians.Russ J Genet 41: 938–931.

32. Hurles ME, Veitia R, Arroyo E, Armenteros M, Bertranpetit J, et al. (1999)Recent male-mediated gene flow over a linguistic barrier in Iberia, suggested by

analysis of a Y-chromosomal DNA polymorphism. Am J Hum Genet 67: 1055–

1061.33. Varzari A, Kharkov V, Stephan W, Dergachev V, Puzyrev V, et al. (2009)

Searching for the origin of Gagauzes: inferences from Y-chromosome analysis.Am J Hum Biol 21: 326–336.

34. Karafet TM, Osipova LP, Gubina MA, Posukh OL, Zegura SL, et al. (2002)

High levels of Y-chromosome differentiation among native Siberian populationsand the genetic signature of a boreal hunter-gatherer way of life. Hum Biol 74:

761–789.35. Kharkov VN, Khamina KV, Medvedeva OF, Shtygasheva OV, Stepanov VA

(2011) Genetic diversity of Khakassian gene pool: subethnic differentiation andthe structure of Y-chromosome haplogroups. Mol Biol (Mosk) 45: 446–458.

36. Myres NM, Ekins JE, Lin AA, Cavalli-Sforza LL, Woodward SR, et al. (2007) Y-

chromosome short tandem repeat DYS458.2 non-consensus alleles occur

independently in both binary haplogroups J1-M267 and R1b3-M405. Croat

Med J 48: 450–9.

37. Myres NM, Rootsi S, Lin AA, Jarve M, King RJ, et al. (2011) A major Y-

chromosome haplogroup R1b Holocene era founder effect in Central and

Western Europe. Eur J Hum Genet 19: 95–101.

38. Y Chromosome Consortium (2002) A nomenclature system for the tree of

human Y-chromosomal binary haplogroups. Genome Res 12: 339–348.

39. Cruciani F, La Fratta R, Torroni A, Underhill PA, Scozzari R (2006) Molecular

dissection of the Y chromosome haplogroup E-M78 (E3b1a): a posteriori

evaluation of a microsatellite-network-based approach through six new biallelic

markers. Hum Mutat 27: 831–832.

40. Sims LM, Garvey D, Ballantyne J (2009) Improved resolution haplogroup G

phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs.

PLoS One 4: e5792.

41. Battaglia V, Fornarino S, Al-Zahery N, Olivieri A, Pala M, et al. (2009) Y-

chromosomal evidence of the cultural diffusion of agriculture in Southeast

Europe. Eur J Hum Genet 17: 820–830.

42. de Knijff P, Kayser M, Caglia A, Corach D, Fretwell N, et al. (1997)

Chromosome Y microsatellites: population genetic and evolutionary aspects.

Int J Legal Med 110: 134–149.

43. Kayser M, Caglia A, Corach D, Fretwell N, Gehrig C, et al. (1997) Evaluation of

Y-chromosomal STRs: a multicenter study. Int J Legal Med 110: 125–133.

44. Butler JM, Schoske R, Vallone PM, Kline MC, Redd AJ, et al. (2002) A novel

multiplex for simultaneous amplification of 20 Y chromosome STR markers.

Forensic Sci Int 129: 10–24.

45. Ayub Q, Mohyuddin A, Qamar R, Mazhar K, Zerjal T, et al. (2000)

Identification and characterisation of novel human Y-chromosomal microsat-

ellites from sequence database information. Nucleic Acids Res 28: e8.

46. Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs

to perform population genetics analyses under Linux and Windows. Mol Ecol

Resour 10: 564–567.

47. Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks for inferring

intraspecific phylogenies. Mol Biol Evol 16: 37–48.

48. Bosch E, Calafell F, Gonzalez-Neira A, Flaiz C, Mateu E, et al. (2006) Paternal

and maternal lineages in the Balkans show a homogeneous landscape over

linguistic barriers, except for the isolated Aromuns. Ann Hum Genet 70: 459–

487.

49. Underhill PA, Myres NM, Rootsi S, Metspalu M, Zhivotovsky LA, et al. (2010)

Separating the post-Glacial coancestry of European and Asian Y chromosomes

within haplogroup R1a. Eur J Hum Genet 18: 479–484.

50. Balanovsky O, Rootsi S, Pshenichnov A, Kivisild T, Churnosov M, et al. (2008)

Two sources of the Russian patrilineal heritage in their Eurasian context.

Am J Hum Genet 82: 236–250.

51. Csanyi B, Bogacsi-Szabo E, Tomory G, Czibula A, Priskin K, et al. (2008) Y-

chromosome analysis of ancient Hungarian and two modern Hungarian-

speaking populations from the Carpathian Basin. Ann Hum Genet 72: 519–534.



Documents

Paleo-Balkan and Slavic Contributions to the Genetic … · Paleo-Balkan and Slavic Contributions to the Genetic ... (9%), mostly living in the ... Paleo-Balkan and Slavic Contributions