ORIGINAL ARTICLE

PAI-1 mRNA expression and plasma level in rheumatoid arthritis:relationship with 4G/5G PAI-1 polymorphism

Jose Francisco Munoz-Valle • Sandra Luz Ruiz-Quezada • Edith Oregon-Romero •

Rosa Elena Navarro-Hernandez • Eduardo Castaneda-Saucedo • Ulises De la Cruz-Mosso •

Berenice Illades-Aguiar • Marco Antonio Leyva-Vazquez • Natividad Castro-Alarcon •

Isela Parra-Rojas

Received: 22 July 2011 / Accepted: 10 December 2011 / Published online: 27 December 2011

� Springer-Verlag 2011

Abstract Rheumatoid arthritis (RA) is a chronic inflam-

matory disease affecting the synovial membrane, cartilage

and bone. PAI-1 is a key regulator of the fibrinolytic sys-

tem through which plasminogen is converted to plasmin.

The plasmin activates the matrix metalloproteinase system,

which is closely related with the joint damage and bone

destruction in RA. The aim of this study was to investigate

the relationship between 4G/5G PAI-1 polymorphism with

mRNA expression and PAI-1 plasma protein levels in RA

patients. 113 RA patients and 123 healthy subjects (HS)

were included in the study. The 4G/5G PAI-1 polymor-

phism was determined by polymerase chain reaction–

restriction fragment length polymorphism method; the

PAI-1 mRNA expression was determined by real-time

PCR; and the soluble PAI-1 (sPAI-1) levels were quantified

using an ELISA kit. No significant differences in the

genotype and allele frequencies of 4G/5G PAI-1 poly-

morphism were found between RA patients and HS.

However, the 5G/5G genotype was the most frequent in

both studied groups: RA (42%) and HS (44%). PAI-1

mRNA expression was slightly increased (0.67 fold) in RA

patients with respect to HS (P = 0.0001). In addition, in

RA patients, the 4G/4G genotype carriers showed

increased PAI-1 mRNA expression (3.82 fold) versus 4G/

5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-

1 plasma levels did not show significant differences. Our

results indicate that the 4G/5G PAI-1 polymorphism is not

a marker of susceptibility in the Western Mexico. How-

ever, the 4G/4G genotype is associated with high PAI-1

mRNA expression but not with the sPAI-1 levels in RA

patients.

Keywords Rheumatoid arthritis � PAI-1 �Polymorphism � Messenger RNA

Introduction

Rheumatoid arthritis (RA) is a chronic inflammatory dis-

ease whose main targets are the synovial membrane, car-

tilage and bone. It affects 1% of the population and is

associated with significant morbidity and increased mor-

tality [1]. The inflammatory synovitis is characterized by

the presence of macrophages, lymphocytes and synovial

fibroblast, which favor the release of key cytokines such as

TNFa and IL-1b, both are mediators of the innate immune

system. The release of TNFa and IL-1b enhances the

inflammatory reaction and destruction of the affected tis-

sues in various ways, mostly through effects on endothelial

cells, synovial fibroblast, osteoclast and cartilage [2]. TNFaplays a major role in the pathogenesis of RA because it

induces leukocyte and endothelial cell activation, synovial

fibroblast activation and survival, pain receptor sensitiza-

tion and angiogenesis, which together represent key path-

ological features of RA [1]. It has been reported that TNFaand ILb induced the expression of the plasminogen

J. F. Munoz-Valle (&) � S. L. Ruiz-Quezada �E. Oregon-Romero � R. E. Navarro-Hernandez

Departamento de Biologıa Molecular y Genomica,

Centro Universitario de Ciencias de la Salud, Universidad de

Guadalajara, Insurgentes 244-1, Colonia Lomas de Atemajac,

C.P. 45178 Zapopan, Jalisco, Mexico

e-mail: biologiamolecular@hotmail.com

E. Castaneda-Saucedo � U. De la Cruz-Mosso �B. Illades-Aguiar � M. A. Leyva-Vazquez � N. Castro-Alarcon �I. Parra-Rojas

Unidad Academica de Ciencias Quımico Biologicas,

Universidad Autonoma de Guerrero, Chilpancingo,

Guerrero, Mexico

123

Rheumatol Int (2012) 32:3951–3956

DOI 10.1007/s00296-011-2279-y

activator inhibitor 1 (PAI-1), a key regulator of the fibri-

nolytic system.

PAI-1 is a 50 kDa single chain glycoprotein that acts as

the primary physiological inhibitor of the two main mam-

malian plasminogen activators, tissue-type plasminogen

activator (tPa) and urokinase-type plasminogen activator

(uPa) [3]. Plasminogen activators catalyze the conversion

of plasminogen to plasmin, which in turn degrades fibrin

and other protein substrates, and activate the matrix

metalloproteinase (MMP) system, which is involved in

degrading extracellular matrix (ECM) [4], an event closely

related to the joint damage and bone destruction in RA.

The human PAI-1 gene is located on chromosome 7q22,

contains approximately 12.2 kb and is formed by 9 exons

and 8 introns. This gene has several polymorphic loci

including a 30 HindIII site, a (CA)n dinucleotide repeat in

intron 3, and a 4G/5G insertion/deletion polymorphism at

position -675 in the promoter. Among these, the most

studied is the 4G/5G insertion/deletion polymorphism. It

has been shown that plasma sPAI-1 significantly higher in

individuals homozygous for the 4G allele than in those who

are homozygous for the 5G allele [3].

The 4G/5G polymorphism has been studied in several

diseases, including: arterial thrombosis in antiphospholipid

syndrome, insulin resistance syndrome, diabetic nephrop-

athy, atherosclerosis, myocardial infarction, coronary

artery disease, venous thrombosis in factor V Leiden car-

riers and RA [5–12]. The aim of this study was to inves-

tigate the relationship between 4G/5G PAI-1

polymorphism with PAI-1 mRNA expression and plasma

protein levels in RA patients.

Methods

Patients and healthy subjects

One hundred and thirteen RA patients were enrolled from

the Hospital Civil ‘‘Fray Antonio Alcalde,’’ Rheumatology

Department. All patients fulfilled the 1987 classification

criteria for RA according to the American College of

Rheumatology. Spanish HAQ-DI and DAS28 activity and

disability indexes were applied to RA patients at the

beginning of the study [13, 14]. As a control group, 123

healthy subjects (HS) were included. The participants were

all born in Guadalajara Jalisco, Mexico, with a family

history of ancestors, at least back to the third generation.

Ethical consideration

Informed written consent was obtained from all subjects

before enrollment in the study, according to the ethical

guidelines of 2008 Declaration of Helsinki.

Laboratory assessment

Laboratory evaluation was performed in blood samples

obtained by antecubital venipuncture after overnight fast.

The following parameters were assayed: erythrocyte sedi-

mentation rate (ESR) (Westergren method), white blood

cell count (WBC), red blood cell count (RBC), platelet

count (PLT) (CELL-DYN 3700, Abbott Diagnostics),

C-reactive protein (CRP), rheumatoid factor (RF) and

fibrinogen levels (ImmageTM Immunochemistry) (Beck-

man Coulter System).

PAI-1 ELISA

Plasminogen activator inhibitor type-1 antigen levels were

measured in plasma samples from RA patients and HS by

ELISARA kit (Hyphen Biomed, Neuville-sur-Oise,

France). The assay sensitivity was 0.5 ng/mL or less, and it

was carried out according to the manufacturer’s instruc-

tions. PAI-1 plasma levels were calculated from a standard

curve using the corresponding recombinant human PAI-1.

Genotyping of 4G/5G PAI-1 polymorphism

Genomic DNA (gDNA) was extracted from leukocytes

obtained from whole blood samples, according to the Miller

method [15]. The -675 4G/5G polymorphism was screened

by the polymerase chain reaction–restriction fragment

length polymorphism (PCR–RFLP) method. PCR was car-

ried out in a final volume of 25 lL containing 1 lg of DNA,

1.25 U/lL Taq DNA polymerase, supplied buffer enzyme

19, MgCl2 1.5 and 0.1 mM of each dNTP (InvitrogenTM life

technologies) and 0.06 lM of each oligonucleotide (forward

50CACAGAGAGAGTCTGGCCACGT30 and reverse 50CC

AACAGAGGACTCTTGGTCT30) [16]. PCR was per-

formed by initial denaturation at 94�C during 3 min, 30

cycles of amplification at 94�C 30 s for denaturation, 60�C

during 30 s for annealing and 72�C during 30 s for extension.

Finally, 72�C during 1 min was used for ending extension.

The resulting PCR products were a 99 bp fragment for the

5G allele and a 98 bp fragment for the 4G allele. PCR

products were analyzed on a 6% polyacrylamide gel (Invit-

rogenTM life technologies) stained with silver nitrate.

Amplified fragments of PAI-1 promoter polymorphism were

digested for 2 h and 30 min at 55�C with 3 U of Bsl I (New

England Biolabs) restriction enzyme. Afterward, restriction

fragments were analyzed by electrophoresis in 6% poly-

acrylamide gel (InvitrogenTM life technologies) stained with

silver nitrate. Digestion fragments of 77 and 22 bp represent

wild genotype (5G/5G); fragments of 98, 77, 22 bp represent

heterozygous genotype (4G/5G); and fragment 98 bp rep-

resent homozygous genotype (4G/4G). Size of 22 bp was not

observed on the gel. To confirm the results, just a few 4G/4G,

3952 Rheumatol Int (2012) 32:3951–3956

123

4G/5G, 5G/5G PAI-1 genotypes were sequenced and PAI-1

genotyping was done in duplicate in all cases.

Real-time quantitative PCR assay

Total RNA was extracted from peripheral blood mononu-

clear cell (PBMC) and 1 lg was used for the cDNA syn-

thesis, according to procedures previously described [17].

The PAI-1 (NM_000602 GeneBank accession number;

Hs00167155_m1 Applied Biosystem ID; FAM dye) and

glyceraldehyde 3-phosphate dehydrogenase (GAP-

DH;4326317E Applied Biosystem ID; FAM dye) mRNA

expression were quantified by real-time PCR using the

TaqMan method (ABI Prism 7500 Sequence Detection

System, Applied Biosystems). Relative gene expression

was calculated using the DDCt method: mean Ct of tripli-

cate samples was used to calculate the DCt as the difference

in Ct between target and reference gene. DCt for each

sample minus DCt of the experimental reference control

was expressed as DDCt. Relative quantification was

expressed in folds of expression of the reference control

according to the formula 2�DDCt and was expressed as

relative expression units (REU).

Statistical analysis

Statistical analysis was performed using the chi-square test

(v2) (MedCalc Statistical Sofware) for the Hardy–Wein-

berg equilibrium and genotype and allele frequencies.

A Student’s t test (SPSS Software 10.0) was used for mean

value comparison in both groups. ANOVA test (STAT-

GRAPHICS Software 4.0) was used to compare the labo-

ratory assessment according to each genotype, and the

Spearman and/or Pearson correlation were performed in

order to test the relationship between PAI-1 plasma levels

and CRP levels. Results were given as mean values and

range scores. Differences were considered as significant at

P \ 0.05.

Results

Baseline characteristics

A total of 113 RA patients were included, 105 were women

and 8 men with a mean age of 45 years (range 22–84). The

average disease duration since diagnosis was 9.5 years.

The average score for clinical activity of the disease

according to DAS28 index was 5.49 and for disability

measurement by Spanish HAQ-DI, the average score was

0.86. RA patients were treated with steroidal [predni-

sone \ 8.5 mg/day (15/113)], non-steroid anti-inflamma-

tory drugs (NSAD’s, 85/113) and disease modifying

antirheumatic drugs (DMARD’s, 84/113). Respect to the

clinical assessment (painful joints, swollen joints, morning

stiffness and patient’s global assessment of disease status),

no significant differences were found in relation to the PAI-

1 4G/5G polymorphisms (data not shown).

Genotype and allele frequencies of 4G/5G PAI-1

polymorphism

Our population was in Hardy–Weinberg equilibrium

(v2 = 0.60, P = 0.43). The 5G/5G genotype was the most

frequent in both studied groups: RA (42%) and HS (44%),

however, no significant differences in the genotype and allele

frequencies of 4G/5G PAI-1 polymorphism where observed

between RA patients and HS (Table 1). When RA patients

were grouped according to the genotypes obtained (4G/4G

n = 9; 4G/5G n = 56 and 5G/5G n = 48), we observed

increased levels of C-reactive protein (CRP) in carriers of

4G/4G genotype (10.3 mg/L) versus 4G/5G and 5G/5G,

(P = 0.03; Table 2). The mean of body mass index (BMI) in

RA patients was 27.5 (range 17.4–46.9), when classified

according to 4G/5G PAI-1 genotypes, the BMI in carriers of

the 4G/4G genotype was 36.4 versus 28.41 in 4G/5G and

25.96 in 5G/5G carriers, however, these differences were no

statistically significant. The other clinical and biological

characteristics showed no significant differences.

PAI-1 polymorphism and mRNA expression

To assess the differential expression in PAI-1 gene, we

measured the mRNA levels in PBMC from RA patients

Table 1 Genotype and allele frequencies of PAI-1 4G/5G polymor-

phism in RA patients and HS

Frequency P value

RA n = 113

% (n)

HS n = 123

% (n)

Genotype 0.28

4G/4G 8 (9) 14 (17)

4G/5G 50 (56) 42 (52)

5G/5G 42 (48) 44 (54)

Allele 0.61

4G 33 (74) 35 (86)

5G 67 (152) 65 (160)

Genetic model

Do 0.82

4G/5G ? 4G/4G 58 (65) 56 (69)

5G/5G 42 (48) 44 (54)

Re 0.15

4G/4G 8 (9) 14 (17)

4G/5G ? 5G/5G 92 (104) 86 (106)

Do dominant, Re recessive

Rheumatol Int (2012) 32:3951–3956 3953

123

and HS. PAI-1 mRNA expression was significantly

increased (0.67 fold) in RA patients respect to HS

(P = 0.0001; Fig. 1, panel a). When PAI-1 mRNA

expression in RA patients was analyzed according to each

genotype, we found an association between genotype and

mRNA levels as follows: 4G/4G [ 4G/5G [ 5G/5G

(4.82 [ 1.85 [ 1.34) (P \ 0.05). These results are shown

in Fig. 1, panel b.

PAI-1 polymorphism and sPAI-1 plasma levels

The sPAI-1 plasma concentrations in RA patients and HS

were measured. No significant differences in sPAI-1 levels

were found between RA patients and HS s (18.9 and

21.1 ng/mL, respectively) (Fig. 2, panel a). The analysis of

the sPAI-1 plasma levels according to PAI-1 genotypes in

RA patients revealed no significant differences between

carriers of the three genotypes (Fig. 2, panel b).

Correlations of sPAI-1 and CRP levels

with the laboratorial and clinical assessments in RA

patients

The Spanish HAQ-DI was correlated with sPAI-1, RF,

CRP ESR, PTL and WBC, whereas the CRP levels cor-

related with ESR, PTL, WBC and fibrinogen. In addition,

the Spanish HAQ-DI index correlated with DAS28 and

clinical assessments (P \ 0.05; Table 3).

Discussion

In the present study, we found that the PAI-1 4G/4G

genotype is associated with high PAI-1 mRNA expression

but not with sPAI-1 levels in RA patients. However, 4G/5G

PAI-1 polymorphism is not a susceptibility marker in the

Western Mexico population. Further studies are needed to

corroborate this finding.

The PAI-1 gene is a highly polymorphic gene, and more

than 180 single nucleotide polymorphisms (SNPs) have been

identified. Among these polymorphisms, the 4G/5G poly-

morphism, which is characterized by a single nucleotide

guanosine nucleotide insertion/deletion at position -675 bp

at the promoter region, has been extensively studied [4]. Our

Table 2 Laboratorial assessment in RA patients according to genotype

Laboratorial assessment All patients (n = 113) 4G/4G (n = 9) 4G/5G (n = 56) 5G/5G (n = 48) P

sPAI-1, ng/mL 19.6 (2.9–61.5) 14.1 (9.31–20.7) 24.5 (12.6–61.5) 15.5 (2.9–32.3) 0.054

RF, UI/mL 495 (10–428) 351 (21–722) 484 (10–4280) 541 (12–3910) 0.743

CRP, mg/dL 6.03 (0.10–65.30) 10.3 (1.69–36.10) 7.7 (0.23–65.30) 3.1 (0.10–14.50) 0.039*

ESR, mm/h 38 (5–65) 38 (25–52) 40 (5–65) 35 (8–60) 0.167

PLT, j/lL 308 (108–638) 315 (189–403) 304 (147–638) 312 (108–537) 0.943

WBC, j/lL 6.742 (2.23–14.90) 6.8314 (5.59–8.7) 6.8569 (2.23–14.90) 6.5664 (3.26–10.30) 0.857

Fibrinogen (mg/dL) 546 (253–1,000) 465 (457–474) 536 (286–855) 564 (253–1,000) 0.619

Bold indicates statistically significant value (P \ 0.05)

RA rheumatoid arthritis, RF rheumatoid factor, ESR erythrocyte sedimentation rate, CRP C-reactive protein, PLT platelet count, WBC white

blood cells count. Data show in mean (min–max). * 4G/5G versus 5G/5G

0.0

0.5

1.0

1.5

2.0

RA HS

p=0.0001

Rel

ativ

e m

RN

A e

xpre

ssio

n (2

-ΔΔC

t )

0

2

4

6

4G/4GRA HS

4G/5GRA HS

5G/5GRA HS

p=0.0001

p=0.0001

Rel

ativ

e m

RN

A e

xpre

ssio

n (2

-ΔΔC

t )

(A)

(B)

Fig. 1 PAI-1 mRNA expression in RA and HS. a PAI-1 mRNA

expression in RA and HS. b PAI-1 mRNA expression according to

each genotype in RA patients

3954 Rheumatol Int (2012) 32:3951–3956

123

study provides evidence of lack of association of the PAI-1

4G/5G polymorphism with RA. The 5G/5G genotype was

the most frequent in both studied groups, 42% for RA and

44% for HS, whereas the less frequent genotype was the 4G/

4G genotype in both groups 8% for RA and 14% for HS.

These findings are in agreement with our previous reports in

HS from the Western Mexico, showing a high frequency of

the 5G/5G genotype (46.36%), as well as for the 5G allele

(65.9%) compared with other populations in the world,

whereas the 4G allele was less frequent (34.09%) [18]. This

difference can be explained by the peculiar characteristics of

the Mexican population. The population of the Western

Mexico is considered Mexican mestizo and has been esti-

mated that the paternal ancestry in Western Mexican mes-

tizos is mainly European (60–64%), followed by Amerindian

(25–21%) and African (15%) [19, 20]. Furthermore, Nuno-

Arana et al. [21] studied mestizos from Western Mexico and

five Mexican Amerindians groups and found a high fre-

quency of the 5G allele in these populations, suggesting an

Amerindian background.

On the other hand, we found a significant higher PAI-1

mRNA expression in RA patients carrying the 4G/4G

genotype when compared with 4G/5G and 5G/5G geno-

types. To our best knowledge, this is the first study to show

the relationship between the homozygous genotype (4G/

4G) with high mRNA expression in a cohort of RA

patients. Our results are supported by previous studies in

whole blood stimulation assay with LPS and peptidogly-

can, which showed that subjects with 4G/4G and 4G/5G

had 3.3- and 1.9-fold increase in PAI-1 expression,

respectively, when compared with the 5G/5G carriers. In

addition, it has been shown that in endothelial cells stim-

ulated with IL-1, angiotensin II and very low density

lipoprotein, the cells carrying the G allele have greater

induction of PAI-1 expression than the cells carrying the

5G allele. Furthermore, it has been suggested that the

molecular mechanism for the 4G allele-mediated higher

RA HS

0

20

40

60

80

100

PAI-

1 (n

g/m

L)

4G/4G

4G/5G

5G/5G

0

20

40

60

80

PAI-

1 (n

g/m

L)

(A)

(B)

Fig. 2 sPAI-1 levels in RA and HS. a sPAI-1 levels in RA and HS.

b sPAI-1 levels to each genotype in RA patients

Table 3 Correlations of sPAI-1

and CRP levels with the

laboratorial and clinical

assessments in RA patients

Bold values are statistically

significant (P \ 0.05)

sPAI-1 soluble plasminogen, RFrheumatoid factor, ESRerythrocyte sedimentation rate,

HAQ-DI Health Assessment

Questionnaire Disability Index

(Spanish version) (score 0–3),

DAS28 Disease Activity Score

using 28 joint counts; * Pearson

correlation, # Spearman

correlation

Mean (min–max) Spanish HAQ-DI CRP levels

Correlation

(%)

P Correlation

(%)

P

Laboratorial assessment*

sPAI-1, ng/mL 19.6 (2.9–61.5) 32.4 0.039 24.8 0.138

RF, UI/mL 495 (10–428 15.1 0.042 17.7 0.014

CRP, mg/L 6.03 (0.10–65.30) 20.1 0.007 – –

ESR, mm/h 38 (5–65) 40.7 <0.001 46.9 <0.001

PLT, j/lL 308 (108–638) 16.5 0.024 18.5 0.008

WBC, j/lL 6.742 (2.23–14.90) 23.1 0.002 13.3 0.061

Fibrinogen (mg/dL) 546 (253–1,000) 5.1 0.734 63.9 <0.001

Clinical assessment#

DAS 28 (score 0–10) 62.2 <0.001 1.0 0.698

Patient’s global assessment of

disease status (0–10 VAS)

53.5 <0.001 2.0 0.776

Swollen joints, 28 counts 34.1 <0.001 7.3 0.294

Painful joints, 28 counts 53.3 <0.001 13.4 0.052

Rheumatol Int (2012) 32:3951–3956 3955

123

PAI-1 expression is associated with greater binding of

upstream stimulatory factor-1 to the E-box adjacent to the

4G site (E-4G) than to the E-5G [4].

No significant differences in sPAI-1 where observed

when comparing subjects with each PAI-1 genotype in both

studied groups. It has been suggested that plasma sPAI-1

activity significantly higher in individuals homozygous for

the 4G allele than in those who are homozygous for the 5G

allele, although this theory remains controversial [3]. In a

previous study by our group, we analyzed the sPAI-1 levels

in relationship with -844 and HindIII PAI-1 polymor-

phisms and found no association between these polymor-

phisms and sPAI-1 levels [22].

In conclusion, the 4G/5G PAI-1 polymorphism is not a

marker of susceptibility from the western Mexico. How-

ever, the 4G/4G genotype is associated with the high PAI-1

mRNA expression but not with sPAI-1 levels in RA.

Acknowledgments This work was supported by Grant No. 69235 to

JFMV of the CONACYT (Fondo Sectorial Secretaria de Salud-IMSS-

ISSSTE CONACYT, Mexico-Universidad de Guadalajara) and Grant

No. 147778 of the Fondo Mixto CONACYT-Gobierno del Estado de

Guerrero 2010-01.

Conflict of interest The authors declare that they do not have any

conflict of interest.

References

1. McInnes IB, Schett G (2007) Cytokines in the pathogenesis of

rheumatoid arthritis. Nat Rev Immunol 7:429–442

2. Pope RM (2002) Apoptosis as a therapeutic tool in rheumatoid

arthritis. Nat Rev Immunol 2:527–535

3. Ha H, Oh EY, Lee HB (2009) The role of plasminogen activator

inhibitor 1 in renal and cardiovascular diseases. Nat Rev Nephrol

5:203–211

4. Ma Z, Paek D, Oh CK (2009) Plasminogen activator inhibitor-1

and asthma: role in the pathogenesis and molecular regulation.

Clin Exp Allergy 39:1136–1144

5. Eriksson P, Kallin PB, van’t Hooft FM et al (1995) Allele-spe-

cific increase in basal transcription of the plasminogen-activator

inhibitor 1 gene is associated with myocardial infarction. Proc

Natl Acad Sci USA 92:1851–1855

6. Wong TY, Poon P, Szeto CC et al (2000) Association of plas-

minogen activator inhibitor-1 4G/4G genotype and type 2 dia-

betic nephropathy in Chinese patients. Kidney Int 57:632–638

7. Margaglione M, Cappucci G, Colaizzo D et al (1998) The PAI-1

Gene Locus 4G/5G polymorphism is associated with a family

history of coronary artery disease. Arterioscler Thromb Vasc Biol

18:152–156

8. Margaglione M, Cappucci G, d’Addedda M et al (1998) PAI-1

plasma levels in a general population without clinical evidence of

atherosclerosis: relation to environmental and genetic determi-

nants. Arterioscler Thromb Biol 18:562–567

9. Morange PE, Henry M, Tregouet D et al (2000) The A -844 G

polymorphism in the PAI-1 gene is associated with a higher risk

of venous thrombosis in factor V Leiden Carriers. Arterioscler

Thromb Vasc Biol 20:1387–1391

10. van der Laan MH, Slagboom PE, Meulenbelt I et al (1998) A

functional polymorphism in the promotor of plasminogen acti-

vator inhibitor-1 is associated with join destruction in RA.

Arthritis Rheum 41:S60

11. Tassies D, Espinosa G, Munoz-Rodrıguez FJ et al (2000) The 4G/

5G polymorphism of the type-1 plasminogen activators inhibitor

gene and thrombosis in patients with antiphospholipid syndrome.

Arthritis Rheum 43:2349–2358

12. McCormack LJ, Nagi DK, Stickland MH et al (1996) Promoter

(4G/5G) plasminogen activator inhibitor-1 genotype in Pima

Indians: relationship to plasminogen activator inhibitor-1 levels

and features of the insulin resistance syndrome. Diabetologia

39:1512–1518

13. Cardiel MH, Abello-Banfi M, Ruiz-Mercado R et al (1993) How

the measure health status in rheumatoid arthritis in non-English

speaking patients: validation of a Spanish version of the Health

Assessment Questionnaire Disability Index (Spanish HAQ-DI).

Clin Exp Rheumatol 11:117–121

14. Prevoo ML, van ‘t Hof MA, Kuper HH et al (1995) Modified

disease activity scores that include twenty-eight-joint counts.

Development and validation in a prospective longitudinal study

of patients with rheumatoid arthritis. Arthritis Rheum 38:44–48

15. Miller SA, Dykes DD, Polesky HF (1988) A simple salting out

procedure for extracting DNA from human nucleated cells.

Nucleic Acids Res 16:1215

16. Margaglione M, Grandone E, Cappucci G et al (1997) An alter-

native method for PAI-1 promoter polymorphism (4G/5G) typ-

ing. Thromb Haemost 77:605–606

17. Munoz-Valle JF, Vazquez-Del Mercado M, Garcıa-Iglesias T et al

(2003) T(H)1/T(H)2 cytokine profile, metalloprotease-9 activity

and hormonal status in pregnant rheumatoid arthritis and systemic

lupus erythematosus patients. Clin Exp Immunol 131:377–384

18. Ruiz-Quezada S, Vazquez-Del Mercado M, Parra-Rojas I et al

(2004) Genotype and allele frequency of PAI-1 promoter poly-

morphism in healthy subjects from the west of Mexico. Associ-

ation with biochemical and hematological parameters. Ann Genet

47:155–162

19. Lisker R, Ramırez E, Gonzalez-Villalpando C et al (1995) Racial

admixture in a mestizo population from Mexico City. Am J Hum

Biol 7:213–216

20. Rangel-Villalobos H, Munoz-Valle JF, Gonzalez-Martın A et al

(2008) Genetic admixture, relatedness, and structure patterns

among Mexican populations revealed by the Y-chromosome. Am

J Phys Anthropol 135:448–461

21. Nuno-Arana I, Paez-Riberos LA, Sando-val-Ramırez L et al

(2005) High prevalence of 5G allele in Amerindian tribes and

Mestizos from Mexico at 4G/5G PAI-I gene promoter polymor-

phism. Thromb Haemost 93:1005–1007

22. Torres-Carrillo N, Magdalena Torres-Carrillo N, Vazquez-Del

Mercado M et al (2008) Distribution of–844 G/A and Hind III

C/G PAI-1 polymorphisms and plasma PAI-1 levels in Mexican

subjects: comparison of frequencies between populations. Clin

Appl Thromb Hemost 14:220–226

3956 Rheumatol Int (2012) 32:3951–3956

123