PACAP is essential for the adaptive thermogenic response of brown

JournalofEndocrinology

ResearchA DIANE, N NIKOLIC, A P RUDECKI

and othersRole of PACAP inthermoregulation

222 :3 327–339

PACAP is essential for the adaptivethermogenic response of brownadipose tissue to cold exposure

Abdoulaye Diane, Nikolina Nikolic*, Alexander P Rudecki*, Shannon M King,

Drew J Bowie and Sarah L Gray

Northern Medical Program, University of Northern British Columbia, 3333 University Way,

Prince George, British Columbia, Canada V2N 4Z9*(N Nikolic and A P Rudecki contributed equally to this work)

http://joe.endocrinology-journals.org � 2014 Society for EndocrinologyDOI: 10.1530/JOE-14-0316 Printed in Great Britain

Published by Bioscientifica Ltd.

Correspondence

should be addressed

to S L Gray

Email

[email protected]

Abstract

Pituitary adenylate cyclase-activating polypeptide (PACAP) is a widely distributed neuro-

peptide that acts as a neurotransmitter, neuromodulator, neurotropic factor, neuroprotectant,

secretagogue, and neurohormone. Owing to its pleiotropic biological actions, knockout of

Pacap (Adcyap1) has been shown to induce several abnormalities in mice such as impaired

thermoregulation. However, the underlying physiological and molecular mechanisms remain

unclear. A previous report has shown that cold-exposed Pacap null mice cannot supply

appropriate levels of norepinephrine (NE) to brown adipocytes. Therefore, we hypothesized

that exogenous NE would rescue the impaired thermogenic response of Pacap null mice

during cold exposure. We compared the adaptive thermogenic capacity of PacapK/K to

PacapC/C mice in response to NE when housed at room temperature (24 8C) and after a

3.5-week cold exposure (4 8C). Biochemical parameters, expression of thermogenic genes, and

morphological properties of brown adipose tissue (BAT) and white adipose tissue (WAT) were

also characterized. Results showed that there was a significant effect of temperature, but no

effect of genotype, on the resting metabolic rate in conscious, unrestrained mice. However,

the normal cold-induced increase in the basal metabolic rate and NE-induced increase in

thermogenesis were severely blunted in cold-exposed PacapK/K mice. These changes were

associated with altered substrate utilization, reduced b3-adrenergic receptor (b3-Ar (Adrb3))

and hormone-sensitive lipase (Hsl (Lipe)) gene expression, and increased fibroblast growth

factor 2 (Fgf2) gene expression in BAT. Interestingly, PacapK/Kmice had depletedWAT depots,

associated with upregulated uncoupling protein 1 expression in inguinal WATs. These results

suggest that the impairment of adaptive thermogenesis in Pacap null mice cannot be rescued

by exogenous NE perhaps in part due to decreased b3-Ar-mediated BAT activation.

Key Words

" PACAP

" thermogenesis

" cold

" gene expression

" mice

Journal of Endocrinology

(2014) 222, 327–339

Introduction

All mammals, including humans, are homeotherms – they

maintain euthermia regardless of environmental tempera-

ture by hormonal and neuronal control of heat pro-

duction and dissipation. This essential task is mainly

performed by the adipose tissues (Cannon & Nedergaard

2004, Cypess et al. 2009, Ouellet et al. 2011) although

skeletal muscle can also contribute to increasing heat

production via shivering thermogenesis in mammals

http://joe.endocrinology-journals.org

http://dx.doi.org/10.1530/JOE-14-0316


Research A DIANE, N NIKOLIC, A P RUDECKI


222 :3 328

(Dubois-Ferriere and Chinet 1981). The adipose tissue pool

in mammals is composed of at least two functionally

different types of fat: white adipose tissue (WAT) and

brown adipose tissue (BAT). WAT is the primary site of

energy storage and releases hormones and cytokines that

modulate whole-body metabolism (Richard & Picard

2011). BAT, on the other hand, contributes to overall

energy expenditure in small mammals and neonates

through the process of non-shivering, adaptive thermo-

genesis. In the last few years, several studies have reported

the existence of a third type of adipose cell, the brown in

white (‘brite’) or ‘beige’ adipocyte. As in canonical BAT,

the recruitment of brite adipocytes or ‘browning’ of WATs

is induced by thermogenic stimuli such as cold as well as

by pharmacological treatments such as b-adrenergic

agonists or thiazolidinediones (Ohno et al. 2012, Wu

et al. 2012, Schulz & Tseng 2013). Brite adipocytes not only

present gene expression signatures similar to those of

canonical brown adipocytes (i.e. uncoupling protein 1

(Ucp1)) but also express unique genes such as Hoxc9,

Tmem26, and Tbx1 (Walden et al. 2012, Wu et al. 2012).

In rodents, BAT generates heat for two principal

reasons: i) to protect against cold exposure and ii) to

burn off excess calories in response to excess caloric intake

(Lowell et al. 1993, Ghorbani et al. 1997, Guerra et al. 1998,

Clapham & Arch 2011). The exceptional thermogenic

capacity of BAT relies on its numerous, densely packed

mitochondria containing the BAT-specific inner mito-

chondrial membrane protein UCP1. BAT is highly

vascularized and richly innervated by postganglionic

nerve terminals of the sympathetic nervous system (SNS;

Baron et al. 2012, Vaughan et al. 2014). Thermoregulatory

pathways are induced by chemical messengers of the SNS,

the catecholamines (Thomas & Palmiter 1997); although

circulating thyroid hormones (thyroxine (T4)) as well as

bone morphogenetic protein 8B are also known to

regulate or enhance obligatory thermogenesis by acting

centrally to increase sympathetic output to BAT (Ricquier

et al. 2000, Lopez et al. 2010, Whittle et al. 2012). Over the

past 7 years, a number of molecules including fibroblast

growth factor 21 (FGF21) and brain natriuretic peptides

(BNPs) have also been shown to activate thermogenic

machinery in BAT, independent of adrenergic receptors

(ARs) (Tseng et al. 2008, Hondares et al. 2010).

The hypothalamus responds to afferent signals from

cutaneous and core thermoreceptors to detect cold and

then activates adaptive thermogenesis contributing to the

maintenance of body temperature (Perkins et al. 1981,

Cannon & Nedergaard 2004). Cumulative evidence has

shown various hypothalamic neuropeptides to be


important regulators of BAT thermogenesis through the

SNS (Bi & Li 2013, Zengin et al. 2013). The hypothalamic

neuropeptide pituitary adenylate cyclase-activating poly-

peptide (PACAP) is known to regulate sympathetic nerve

activity, yet its role in adaptive thermogenesis requires

further characterization.

PACAP belongs to the secretin/glucagon/vasoactive

intestinal (VIP) family (Miyata et al. 1989, Vaudry et al.

2009) and has been implicated in the regulation of energy

homeostasis including both appetite and thermogenesis

(Gray et al. 2001, Mounien et al. 2009, Inglott et al. 2011).

Hypothalamic nuclei such as the arcuate nucleus, para-

ventricular nucleus, and ventromedial nucleus highly

express PACAP (ADCYAP1) and PACAP receptors (Segal

et al. 2010, Kohno & Yada 2012, Resch et al. 2013),

suggesting that PACAP may be critical for the regulation

of energy balance. Consistently, i.c.v. injection of PACAP

decreased food intake and increased core body temperature

in rodents (Mounien et al. 2009) with a concurrent increase

in BAT UCP1 expression (Resch et al. 2013). In parallel, mice

lacking PACAP showed decreased BAT thermogenic

capacity and reduced sympathetic outflow to this organ

(Gray et al. 2001, 2002). These studies are supported by the

temperature-sensitive phenotype of Pacapnull pups, which

display reduced survival at a lower housing temperature

(Gray et al. 2002); however, the underlying mechanisms by

whichPacapnull mice are cold intolerant remain unknown.

A previous report (Gray et al. 2002) has shown that during

cold exposure, adult Pacap null mice cannot supply

appropriate levels of norepinephrine (NE) to BAT. NE

released from sympathetic nerves innervating BAT binds

b3-ARs increasing cAMP and hormone-sensitive lipase

(HSL)-mediated lipolysis. Free fatty acids are oxidized in

the mitochondria where UCP1 uncouples ATP production

releasing oxidative energy as heat (Enerback et al. 1997,

Lowell & Spiegelman 2000, Matthias et al. 2000, Cannon &

Nedergaard 2004, Inokuma et al. 2006). Interestingly, due to

the substantial demand for nutrients and oxygen by BAT

during cold exposure (Golozoubova et al. 2004, Walden

et al. 2012), extensive angiogenesis occurs within BAT to

provide sufficient blood supply (Xue et al. 2009). As PACAP

is known as a non-classical regulator of angiogenesis

(Castorina et al. 2010), the highly cold-sensitive phenotype

of Pacap-deficient mice may be related to decreased

vascularization in adipose tissues.

To determine the mechanism by which PACAP

regulates thermogenesis, we hypothesized that adminis-

tration of exogenous NE would rescue the impaired

thermogenic response of Pacap null mice to cold exposure.

We also hypothesized that reduced browning of WATs







222 :3 329

(as a consequence of inappropriate NE release) as well as

diminished vascularization in BATs and WATs during

chronic cold exposure would contribute to the impaired

adaptive thermogenic response of Pacap-deficient mice.

Materials and methods

Animals

Cohorts of young–adult (8-week-old) PacapK/K and

PacapC/C male or female littermate mice were generated

from the breeding colony at the University of Northern

British Columbia. Mice used in this study are derived from

the Pacap null line generated by Gray et al. (2001) and have

been backcrossed by more than ten times onto a C57/BL6

background. Mice were housed at a density of two per cage

with sterile corncob bedding and placed on a normal 12 h

light:12 h darkness cycle (lights on 0700–1900 h).

Throughout the experiment, animals had free access to

water and standard rodent chow diet (LabDiet 5001,

LabDiet, Inc., Brentwood, Leduc, AB, Canada; metaboliz-

able energyZ3.02 kcal/g). Measures of body weight (g)

were taken weekly. Care and treatment of mice was in

accordance with the guidelines of the Canadian Council

on Animal Care, and protocols for the study were

approved by the University of Northern British Colum-

bia’s Animal Care and Use Committee.

Experimental procedures

NE-induced thermogenesis in PacapK/K mice PacapK/K

and PacapC/C mice were paired and housed together

according to age and gender. Resting and maximal

metabolic rates (MMR) were measured in 8-week-old

mice reared at 24 8C. These mice were then acclimated at

18 8C for 1 week before being housed at 4 8C for 3.5 weeks.

After 3.5 weeks of housing at 4 8C, resting and MMR were

measured again in the same mice.

Metabolic rates of mice were measured via oxygen

consumption (ml O2/min) in an open circuit, indirect

calorimeter (Oxymax machine, Columbus Instruments,

Columbus, OH, USA). Body weights were not different

between genotypes. A standard Oxymax housing chamber

(2625 ml) was allowed to equilibrate for 20 min before the

resting metabolic rate (RMR) was measured in conscious,

unrestrained animals for 4–5 h at room temperature

(24 8C). The RMR was defined as the mean oxygen

consumption during the last 3 h of the experiment.

Basal metabolic rate (BMR) and MMR were measured

in anesthetized mice (sodium pentobarbital, 60–65 mg/kg)


in 10 s intervals, during the light phase of the cycle, before

and after s.c. injection of NE (1 mg/kg) into interscapular

BAT (iBAT). NE injection was administered via cannulae to

avoid opening and disequilibrium of the chamber during

NE administration (protocol adapted from Golozoubova

et al. (2006) and Virtue & Vidal-Puig (2013)). During BMR

and MMR measurements, a heating pad was placed under

the smaller metabolic chamber (260 ml) to maintain the

chamber at 30 8C. BMR was defined as the mean oxygen

consumption 5 min before the NE injection; while MMR

was the mean of the five highest oxygen consumption

values after NE administration. Additionally, the relative

exchange ratio or RER, which is the ratio of CO2 produced

to O2 consumed, was calculated.

Molecular mechanisms of impaired adaptive thermo-

genesis in Pacap-deficient mice following cold

exposure Molecular experiments were performed only

on male mice, as estrous cycle patterns and sexual

hormones in female rodents are known to impact

thermoregulatory responses (Bu & Lephart 2005, Uchida

et al. 2010). This experiment was conducted in two

independent batches of male PacapK/K and PacapC/C

mice. Within each genotype, 9-week-old mice

were randomly assigned to four experimental groups:

PacapK/K and PacapC/C mice housed at 24 8C (PacapK/K,

24 8C and PacapC/C, 24 8C) and PacapK/K and PacapC/C

mice housed at 4 8C for 3.5 weeks after they have been

acclimatized for 1 week at 18 8C (PacapK/K, 4 8C and

PacapC/C, 4 8C) as described above.

Postmortem analysis Mice (non-fasted) were killed with

Euthanyl. Blood was taken by cardiac puncture, from

which plasma was isolated and stored at K20 8C until

analysis. The following tissues were collected and

weighed: brain, liver, heart, spleen, lung, pancreas, iBAT,

inguinal WAT (ingWAT), and gonadal WAT (gWAT). For

each BAT and WAT depot, half was flash frozen in liquid

nitrogen and stored at K80 8C for RNA extractions, and

the other half was fixed in 10% formalin for histological

analysis.

Extraction of RNA and generation of cDNA iBAT

(w50 mg) was homogenized in TRIzol (Life Technologies)

and RNA was extracted according to the manufacturer’s

protocol. DNA contamination was removed by treating

iBAT RNA with TURBO DNase (Life Technologies) accor-

ding to the manufacturer’s protocol. RNA from ingWAT

and gWAT was extracted using an RNeasy Kit (Qiagen),

which included DNase treatment. Concentration and







222 :3 330

purity of RNA were assessed by spectrophotometry

(Nanodrop ND-1000; Thermo Scientific, Rockford, IL,

USA), while RNA integrity was assessed by visualizing

intact 18S and 28S rRNA bands on native 1.5% agarose gel.

RNA (500 ng) was reverse transcribed into cDNA (Super-

script III; Invitrogen) according to the manufacturer’s

protocol.

Quantitative real-time PCR

Expression levels of thermogenic genes (Ucp1, Hsl (Lipe),

b1-Ar (Adrb1), b2-Ar (Adrb2), b3-Ar (Adrb3), Fgf2, homeobox

C9 (Hoxc9), and vascular endothelial growth factor A

(Vegfa)) in each fat depot from mice housed at 24 and 4 8C

were assessed using quantitative real-time PCR (qPCR)

(Table 1). Reference gene stability across treatments and

genotypes was assessed via geNorm experiments, and a

maximum number of stable reference genes were used for

each gene expression analysis. Fold change in thermo-

genic gene expression from 24 to 4 8C samples was

calculated for each genotype.

Primers and probes (IDT, Coralville, IA, USA) were

either designed using the Beacon Designer Software

Table 1 List of the endogenous control (*) and target genes analyz

each gene were optimized using SYBR Green chemistry or TaqMan

Genes Gene abbreviat

18S rRNA 18S*

Glyceraldehyde 3-phosphate dehydrogenase Gapdh*

b-actin b-actin*

TATA-binding protein Tbp*

Ribosomal protein L19 Rpl19*

b1-adrenergic receptor b1-Ar



Hormone-sensitive lipase Hsl

Uncoupling protein 1 Ucp1

Fibroblast growth factor 2 Fgf2

Vascular endothelial growth factor A Vegfa

Homeobox C9 Hoxc9


(Premier Biosoft, Palo Alto, CA, USA) or taken from the

literature (sequences available upon request). An iQ5

thermocycler (Bio-Rad Laboratories) was used to conduct

25 ml reactions, which contained forward and reverse

primers (300 nM; Sigma), nuclease-free H2O, and 1/10

cDNA (3 ml). For genes utilizing SYBR Green chemistry, iQ

SYBR Green Supermix (1!) was included, while those using

the TaqMan method included iQ Supermix (1!) and probe

(150 nM). Primers and probes were optimized before qPCR

experiments, which conformed to the Minimum Infor-

mation for Publication of Quantitative Real-time PCR

Experiments (MIQEs) guidelines (Bustin et al. 2009).

Morphometric analysis

Formalin-fixed iBAT, ingWAT, and gWAT from PacapK/K

(nZ5) and PacapC/C (nZ6) mice were sent to Wax-it

Histology Services (Vancouver, BC, Canada) for paraffin

embedding, slide fixation (5 mm thick), and hematoxylin

and eosin staining.

Ten representative micrographs at 60! magnification

were taken (Olympus BX61) per hematoxylin and eosin-

stained iBAT slide. Using the CellSens Software (Olympus),

ed by qPCR in adipose depots. Primer and primer/probe sets for

respectively

ion Primer sequences (5 0–3 0)

F-CGGCTACCACATCCAAGGAAR-GCTGGAATTACCGCGGCTF-TGCACCACCAACTGCTTAGR-GGATGCAGGGATGATGTTCF-GCTCTGGCTCCTAGCACCATR-GCCACCGATCCACACAGAGTF-CACCAATGACTCCTATGAR-CCAAGATTCACGGTAGATAP-/5FAM/CCTATCACTCCTGCCACACCA/31ABkFQ/F-GAAGCTGATCAAGGATGGR-CTTCCCTATGCCCATATGP-/56FAM/CATCCGCAAGCCTGTGACTG/31ABkFQ/F-GTCGTCTCCTTCTACGTGR-GCTGTCGATCTTCTTTACCF-GTTCGAGCGACTACAAACR-TAGGCCCATGACTAGATCF-CAACCCGGTCATCTACTGR-ACCGTAGCTACACAGAAGF-GGAGCACTACAAACGCAACGAR-TCGGCCACCGGTAAAGAGF-CCTGGCAGATATCATCACR-TCACCTTGGATCTGAAGGF-AACCGGTACCTTGCTATGAAGR-GTTCGTTTCAGTGCCACATACF-AGACAGAACAAAGCCAGAAATCACR-CACGTCTGCGGATCTTGGACF-GCAGCAAGCACAAAGAGGAR-CGTCTGGTACTTGGTGTAGGG







222 :3 331

bright-field images were converted into gray scale. An

intensity threshold (gray channel: minZ145 and maxZ

256) was set that best represented lipid droplets (white area)

in iBAT sections, and these areas were quantified. Theses

areas were normalized to their respective image areas.

24 °CFemales

P=0.09 P=0.2

RM

Rsu

mpt

ion;

ml/m

in)

4

3

2

4 °C

Immunohistochemistry

Sections of iBAT and ingWAT (paraffin, 5 mm thick;

nZ5/group, Wax-it Histological Services) were deparaf-

finized and rehydrated as described previously (Riedel

2010). Antigen retrieval was completed in Tris–EDTA

buffer (pH 9) for 20 min at 95 8C. Sections were blocked

with serum-free solution (DAKO, Burlington, ON, Canada)

before being incubated at 4 8C overnight with a rabbit

anti-CD31 primary antibody (1:100; ab28364; Abcam,

Toronto, ON, Canada). Sections were then incubated for

an hour with the Alexa Fluor 594 donkey anti-rabbit

antibody (1:1000; A21207; Invitrogen) and fixed using

VECTRASHIELD Hardset Mounting Medium with DAPI

(Vector Labs, Burlington, ON, Canada). Samples were

visualized using a fluorescent light microscope (Olympus

BX61) and images for iBAT were analyzed using the

CellSens Software (Olympus).

Vasculature was quantified in CD31-stained iBAT

by taking nine representative micrographs at 20!

magnification for each sample. An average proportion of

CD31-positive area was quantified using the automatic

threshold option in CellSens (Olympus).

* P=0.1

Pacap+/+

Males

Pacap–/–

(O2

con

min

)

1

0

4

3

24 °C

4 °C

Plasma biochemical analysis

Total plasma free fatty acid concentrations were measured

using direct colorimetric enzymatic reactions (Cell

Biolabs, Inc., San Diego, CA, USA). Plasma BNPs and

T4 were measured using specific ELISA (Elabscience

Biotechnology Co. Ltd, Beijing, China) kits for mice.

Pacap+/+ Pacap–/–

RM

R(O

2 co

nsum

ptio

n; m

l/

2

1

0

Figure 1

Resting metabolic rate (RMR) in conscious, unrestrained PacapC/C

(females, nZ10 and males, nZ8) and PacapK/K (females, nZ8 and males,

nZ6) mice housed at 24 and 4 8C. Data are expressed as meanGS.E.M.

*P!0.05 indicates a temperature effect (24 vs 4 8C).

Statistical analysis

Results are expressed as meanGS.E.M. Two-way ANOVA to

test interaction effects and one-way ANOVA for

comparison of groups with post-hoc Tukey’s test for

pairwise comparison of means were performed.

Differences in CD31 immunoreactivity, lipid droplet

area, and gene expression data were deduced by t-tests.

All tests and comparisons with P!0.05 were

considered statistically significant using the GraphPad

Prism Software (version 5.0a) or IBM SPSS Statistics

Software, version 21.


Results

RMR was not altered in conscious PacapK/K mice

To test the hypothesis that hypothalamic neuropeptides

are implicated in energy homeostasis (Zengin et al.

2013), we evaluated the role of PACAP in cold-stimulated

RMR. In both sexes, there was a significant effect of

temperature on RMR, but no genotype effect (Fig. 1).

ANOVA showed that both PacapK/K and PacapC/C mice

housed at 4 8C displayed higher O2 consumption

compared with animals housed at 24 8C (P!0.001). At

both 24 and 4 8C, O2 consumption did not differ

significantly between PacapK/K and PacapC/C mice,

indicating no effect of genotype on RMR in conscious,

unrestrained mice (Fig. 1).

Impaired NE-induced thermogenesis in

mice lacking PACAP

Thermogenic activity of BAT in response to cold is

regulated by the SNS; thus, differences in NE release or




0.0

0.5

1.0

1.5

2.0

2.5Pacap–/–, 24 °CPacap–/–, 4 °CPacap+/+, 24 °CPacap+/+, 4 °C

Pacap–/–, 24 °CPacap–/–, 4 °CPacap+/+, 24 °CPacap+/+, 4 °C

NE injection

Females

**

Time (min)

O2

cons

umpt

ion

(ml/m

in)

O2

cons

umpt

ion

(ml/m

in)

Males

2 10 20 30 40 50 60 70

2 10 20 30 40 50 60 700.0

0.5

1.0

1.5

2.0

2.5

NE injection *

*

Time (min)

Figure 3

Norepinephrine-induced thermogenesis in PacapC/C (females, nZ8 and

males, nZ4) and PacapK/K (females, nZ5 and males, nZ2) mice housed at

24 and 4 8C. Data are expressed as meanGS.E.M. *P!0.05 and **P!0.01

indicate a temperature effect (24 vs 4 8C within the same genotype).

Females

24 °C 4 °C 24 °C 4 °C

24 °C 4 °C 24 °C 4 °C

0.0

0.4

0.8

1.2

1.6

2.0

2.4BMR

MMR

BMR

MMR

*

**

P=0.4

P=0.57

P=0.07



O2

cons

umpt

ion

(ml/m

in)

O2

cons

umpt

ion

(ml/m

in)

Males

0.0

0.4

0.8

1.2

1.6

2.0

2.4

*

**

**

Figure 2

Basal metabolic rate (BMR) and norepinephrine-induced maximal

metabolic rate (MMR) under anesthesia in PacapC/C (females, nZ8

and males, nZ7) and PacapK/K (females, nZ5 and males, nZ3) mice

housed at 24 and 4 8C. Data are expressed as meanGS.E.M. *P!0.05

and **P!0.01 indicate a temperature effect (24 vs 4 8C within the

same genotype).




222 :3 332

b-adrenergic signaling could contribute to impaired

adaptive thermogenesis. To determine whether the

impaired thermogenesis of PacapK/K mice was due to

inadequate NE supply to iBAT, we assessed metabolic rates

before (BMR) and after (MMR) administration of exo-

genous NE to iBAT of PacapK/K and PacapC/C mice housed

at 24 8C and after cold acclimation (3.5 weeks housing at

4 8C). As shown in Fig. 2, in both sexes, the normal,

expected cold-induced increase in BMR is impaired in

PacapK/K mice, as we observed no significant difference

in BMR of PacapK/K mice housed at 24 and 4 8C. However,

in PacapC/C mice, BMR was significantly increased in mice

housed at 4 8C compared with those housed at 24 8C for

both sexes (Fig. 2; upper and lower panels).


NE-induced thermogenesis was severely blunted in

PacapK/K mice after a 3.5-week cold challenge at 4 8C. In

both male and female PacapC/C cold-exposed mice, NE

injection induced a significant increase in O2 consumption,

while in PacapK/K mice NE administration had no

significant effect on O2 consumption (Fig. 3). These

findings suggest that exogenous NE cannot rescue the

impaired thermogenesis observed in PacapK/K mice.

Additionally, measurement of the RER, an index of what

macronutrient is preferentially metabolized to produce

energy, revealed that, in both sexes of PacapK/K mice

housed at 4 8C, NE injection induced a significant increase

in RER values (from 0.7 to 0.9), indicating preferential

oxidation of carbohydrates over lipids as fuels after NE

injection (Fig. 4). The PacapC/C mice (housed at both

24 and 4 8C) and PacapK/K mice housed at 24 8C main-

tained constant RER values after NE injection (Fig. 4).




0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

1.1

1.2

NE injection

Females

*

Time (min)

RE

R, V

CO

2/V

O2

RE

R, V

CO

2/V

O2

Males

10 20 30 40

10 20 30 400.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

1.1

1.2

NE injection

*

Time (min)



Figure 4

Relative exchange ratio (RER) at 24 8C and after 3.5 weeks of cold exposure

(4 8C) in PacapC/C (females, nZ8 and males, nZ4) and PacapK/K (females,

nZ5 and males, nZ2) mice. Data are expressed as meanGS.E.M. *P!0.05

indicates a temperature effect (24 vs 4 8C within the same genotype).

Table 2 Body composition and plasma circulating factors of

male PacapC/C (nZ9) and PacapK/K (nZ8) mice after 3.5-week

cold challenge. Data are expressed as meanGS.E.M.

PacapC/C PacapK/K

Body weight (g) 26.86G0.68 26.93G0.59iBAT (g) 0.10G0.01 0.09G0.001




222 :3 333

Cold exposure did not induce changes in body weight or

fat histology but significantly reduced s.c. and

intra-abdominal WAT depots in mice lacking PACAP

Body composition was assessed in PacapK/K and PacapC/C

male mice after 3.5 weeks of cold exposure. There were no

significant differences in body weight, and iBAT, pancreas,

and liver weights between the two genotypes. However,

ingWAT and gWAT depots were significantly lower in

cold-exposed PacapK/K mice compared with PacapC/C

mice (P!0.05; Table 2).

ingWAT (g) 0.21G0.02 0.16G0.01*gWAT (g) 0.21G0.02 0.12G0.02*Liver (g) 1.66G0.08 1.60G0.05Pancreas (g) 0.38G0.04 0.35G0.03Glucose (mmol/l) 10.11G0.71 7.92G1.29Free fatty acids (mM/ml) 154.34G32.12 222.15G55.73BNP (ng/ml) 31.99G1.24 34.60G1.46T4 (ng/ml) 1.91G0.33 1.83G0.28

*P!0.05 indicates a genotype effect (PacapC/C vs PacapK/K).

Lipid content is unaltered in iBAT of

cold-exposed PacapK/K mice

To determine if impaired BAT thermogenesis was due to,

or caused, alterations in lipid stores, intracellular lipid was

quantified in BAT as described above. Lipid droplets

appeared smaller and less prevalent in PacapK/K BAT,


but quantification yielded no statistical difference in lipid

content between the genotypes (Fig. 5A). Such analyses

could not be performed on ingWAT or gWAT due to

heterogeneity of sections, although the morphology

looked similar for both genotypes (Fig. 6).

Increased angiogenesis in iBAT of cold-exposed

PacapK/K mice

iBAT from cold-exposedPacapK/Kmice showed significantly

increased immunoreactivity for the angiogenic marker,

CD31, compared with iBAT from PacapC/C control mice

(P!0.05; Fig. 5B). Visually, we did not detect a difference in

CD31 immunoreactivity in PacapK/K ingWAT sections

comparedwithPacapC/C ingWATsections (datanot shown).

No change in circulating factors associated with

thermoregulation in PacapK/K mice

Assessment of a number of circulating factors in the

plasma known to affect thermogenesis, such as free fatty

acids, T4, and BNPs, showed no difference between the two

genotypes after 3.5 weeks of cold exposure (Table 2).

Altered expression of thermogenic genes in

cold-exposed PacapK/K mice

To evaluate the contribution of PACAP to energy

metabolism, we compared the mRNA levels of thermo-

genic genes in BATs and WATs of male PacapK/K and

PacapC/C mice. In iBAT (Fig. 7), Hsl and b3-Ar mRNA levels

were significantly decreased in PacapK/K mice compared

with their PacapC/C littermates (P!0.05). Ucp1 mRNA

expression did not differ between PacapK/K mice and




0.00

0.05

0.10

0.15

0.20

0.25 *

0.00

0.20

0.40

0.60 P =0.139Pacap+/+

A

B

Pacap–/–



Pacap–/–

CD31

Pacap+/+

Lipi

d dr

ople

t are

a/to

tal a

rea

CD

31+

are

a/to

tal a

rea

Figure 5

Morphometric analysis of iBAT from PacapC/C (nZ6) and PacapK/K (nZ5)

mice following 3.5 weeks of cold exposure. (A) Hematoxylin and eosin-

stained iBAT sections visualized at 60! magnification, along with their

areal lipid proportions. (B) Visualization of vasculature in iBAT by

fluorescence microscopy, along with vasculature quantification for both

genotypes. *P!0.05 indicates a genotype effect (PacapC/C vs PacapK/K).

Pacap+/+

A

B

Pacap–/–





222 :3 334

PacapC/C controls (PZ0.11). VEGFA expression, a known

angiogenic factor involved in blood vessel formation, did

not differ between the two genotypes, but FGF2 expression

in the iBAT, another potent angiogenic factor, was

significantly higher in cold-exposed PacapK/K mice

compared with PacapC/C controls (P!0.05). In gWAT

(Fig. 8, upper panel), UCP1 was significantly down-

regulated in PacapK/K mice compared with PacapC/C mice

(P!0.05), while b3-AR level was decreased by w42%

although it did not reach statistical significance

(PZ0.056). Unlike what was found in gWAT and iBAT,

cold exposure significantly increased UCP1 expression in

the ingWAT depot (Fig. 8, lower panel) of the PacapK/K

mice compared with the PacapC/C mice (P!0.05).

However, Pacap deletion had no significant effect on

b3-Ar and Hsl expression in the ingWAT, as the two

genotypes had similar expression levels after 3.5-week cold

exposure. The Hoxc9 expression, one of the specific gene

signatures of the ‘brite’ adipocytes, also did not differ

between the two genotypes in the gWAT and ingWAT

depots (Fig. 8, upper and lower panels).

Figure 6

Representative images of hematoxylin and eosin-stained (A) gonadal

(gWAT), 20! magnification and (B) inguinal ingWAT, 60! magnification,

from PacapC/C (nZ6) and PacapK/K (nZ5) mice following 3.5 weeks of

cold exposure.

Altered induction of thermogenic genes in

PacapK/K mice housed at 24 vs 4 8C

The fold change of thermogenic gene expression was

assessed in iBAT, ingWAT, and gWAT isolated from mice

housed at 24 8C and those housed at 4 8C for both

genotypes. Upon cold stress, we observed significant

upregulation of b3-AR in iBAT of PacapC/C mice housed

at 4 8C compared with those housed at 24 8C, an induction


that was not observed in PacapK/K mice (Table 3).

Additionally, there was a significant increase in UCP1

expression in all fat depots except gWAT, which had

nearlyundetectable levelsofUcp1gene expression (Table 3).

The fold increase in ingWAT UCP1 was much greater in

PacapK/K mice, corresponding to its higher expression at

4 8C in PacapK/K mice compared with WT controls (Fig. 8

and Table 3). Hoxc9, a marker of ‘browning’, was also

significantly upregulated in both WAT depots (Table 3).

Discussion

Thermogenesis, an essential component of the homeostatic

repertoire to maintain body temperature during cold

exposure, is controlled by both endocrine and neural

inputs (Cannon & Nedergaard 2004). Defects in any one

of these neuroendocrine factors have been shown to have a

negative impact on thermogenesis (Morrison et al. 2012).

Centrally, hypothalamic orexigenic and anorexigenic

neuropeptides have been demonstrated to exhibit a

critical role in BAT thermogenesis and energy expenditure

(Bi & Li 2013, Zengin et al. 2013) by controlling the

sympathetic outflow to BAT. Our results show that the

neuropeptide PACAP (Mounien et al. 2009) is an important

regulator of adaptive thermogenesis during cold exposure.

These results first demonstrated that deletion of Pacap

had no significant effect on RMR of conscious, unstrained

PacapK/K mice housed at either 24 or 4 8C when compared




gWAT

β3-Ar0.0

0.5

1.0

1.5

2.0

2.5

Pacap+/+

Pacap–/–

Pacap+/+

Pacap–/–

*

P=0.056

mR

NA

exp

ress

ion

(fol

d ch

ange

)

ingWAT

Hsl Ucp1 Fgf2 Vegfa Hoxc9

β3-Ar Hsl Ucp1 Fgf2 Vegfa Hoxc90.0

0.5

1.0

1.5

2.0

2.5

*

mR

NA

exp

ress

ion

(fol

d ch

ange

)

Figure 8

Gene expression in gonadal white adipose tissue (gWAT) and inguinal

white adipose tissue (ingWAT) of male PacapC/C (nZ9) and PacapK/K

(nZ8) mice after 3.5-week cold challenge. Target gene expression was

normalized to three reference genes (18S (Rn18s), b-actin (Actb), and

Gapdh). Data are expressed as meanGS.E.M. *P!0.05 indicates a genotype

effect (PacapC/C vs PacapK/K).

iBAT

β 1-A

rβ 2

-Ar

β 3-A

rHsl

Ucp1

Fgf2

Vegfa

0.0

0.5

1.0

1.5

2.0Pacap+/+

Pacap–/– *

* *

mR

NA

exp

ress

ion

(fol

d ch

ange

)

Figure 7

Gene expression in iBATof male PacapC/C (nZ9) and PacapK/K (nZ8) mice

after 3.5-week cold challenge. Target gene expressionwasnormalized to three

reference genes (18S (Rn18s), b-actin (Actb), andGapdh). Data are expressedas

meanGS.E.M. *P!0.05 indicates a genotype effect (PacapC/C vs PacapK/K).




222 :3 335

with PacapC/C mice as evidenced by similar O2 consump-

tion. This finding is at odds with previous reports

demonstrating that administration of pharmacological

PACAP (6–38), a PAC1 receptor antagonist, reduced energy

expenditure (Tachibana et al. 2007, Inglott et al. 2011).

Failure to detect a RMR difference between PacapK/K and

PacapC/C mice may relate to our experimental approach,

which measured oxygen consumption in conscious, unrest-

rained mice that were housed below thermoneutrality

(28–30 8C). While the low BAT thermogenic capacity of

PacapK/K mice would have predicted reduced RMR at 4 8C,

a hyperactive phenotype has previously been reported in

another line of PacapK/K mice (Kawaguchi et al. 2010), and

thus a subtle increase in physical activity may maintain

a normal RMR in PacapK/K mice. During cold exposure,

BAT contributes w65% of the total heat production in

rodents (Foster & Frydman 1978) and, therefore, in

mammals with normal BAT, skeletal muscle is generally

not considered to be the principal tissue involved in

adaptive thermogenesis (Colquhoun et al. 1990). However,

when BAT is absent or functionally deficient, whole-animal

responses to a cold challenge draw primarily on muscle

oxidative capacity (Schaeffer et al. 2003).

To circumvent the influence of physical activity or

muscle oxidative capacity on RMR, we then performed

BMR measures in anesthetized (restrained) animals.

Unlike the expected cold-induced increase in BMR

observed in PacapC/C mice housed at 4 vs 24 8C, this

response was blunted in PacapK/K mice. This result

suggests a potential defect in the activation of adaptive

thermogenesis in the Pacap null animals and supports our


idea that physical activity-induced energy production

is compensating for defective BAT thermogenic activity

in RMR measurements made in conscious, unrestrained

PacapK/K mice.

Impaired cold-induced thermogenesis in PacapK/K

mice has been previously shown to be associated with

decreased NE in BAT (Gray et al. 2001). In the current

study, we evaluated the adaptive thermogenic response of

PacapK/K mice to a bolus of exogenous NE before and after

3.5 weeks of cold exposure. Our results showed that the

BAT of both PacapK/K male and female mice was

thermogenically inactive as NE-induced metabolic rate

was not greater after cold exposure. Despite the dramatic

impairment in NE-induced metabolic rate in PacapK/K

mice, the mass and histological appearance of BAT were

normal when compared with BAT from PacapC/C mice.

The lower thermogenic response in the PacapK/K mice

after NE injection could be related to the reduced WAT




Table 3 Fold change in iBAT, ingWAT, and gWAT gene expression from 24 8C housed to 4 8C housed PacapC/C and PacapK/K mice

(PacapC/C, 24 8C (nZ5); PacapK/K, 24 8C (nZ5); PacapC/C, 4 8C (nZ9); and PacapK/K, 4 8C (nZ8)). mRNA expression data were

normalized to reference genes that remained stable across treatments and genotypes for BAT (b-actin (Actb)), ingWAT (18S (Rn18s),

b-actin, and Gapdh), and gWAT (Tbp and b-actin)

Genes

iBAT ingWAT gWAT

PacapC/C PacapK/K PacapC/C PacapK/K PacapC/C PacapK/K

b1-Ar 0.95 1.02 NA NA NA NAb2-Ar 0.60 0.87 NA NA NA NAb3-Ar 3.34** 1.43 1.53 0.70 0.22*** 0.25*Hsl 1.57 1.38 1.07 0.68 0.19*** 0.22*Ucp1 2.83** 2.37** 169.65** 755.54*** 1.99 2.29Fgf2 6.48** 6.31** 0.54* 0.29*** 0.14*** 0.15**Vegfa 1.63** 1.45 0.88 0.66* 0.35*** 0.43*Hoxc9 NA NA 3.35*** 2.16** 3.68** 5.04**

Significant differences betweenmRNA expression in 24 and 4 8C samples for each genotype are denoted by *P!0.05, **P!0.0, or ***P!0.001. NA, gene notmeasured.




222 :3 336

found in these mice after cold exposure as a similar

thermogenic pattern has been previously reported in

A-ZIP/F-1 lipodystrophic mice (Gavrilova et al. 2000).

Differential use of physiological fuels (carbohydrates,

fat, and protein) is another strategy to adapt and survive

during challenge of low environmental temperature

(Doubt 1991, Schaeffer et al. 2003). Following 3.5 weeks of

cold exposure (4 8C), RER increased from 0.7 to 0.9 in

PacapK/K mice, but not PacapC/C mice, after NE injection,

indicating a preferential use of carbohydrates to produce

energy by the Pacap null mice. This switch from fat to

carbohydrate utilization in cold-exposed PacapK/K mice

could indicate the impairment of mechanisms of lipid

mobilization from adipose tissue during cold exposure

(Doubt 1991) or a physiological adaptation to withstand

the high energy demands associated with NE infusion, as

oxidation of carbohydrates produces more energy per mole

of oxygen than fat oxidation (Virtue & Vidal-Puig 2013).

The capacity for NE-induced thermogenesis in BAT will

be influenced by the level of b3-AR available for NE binding

on brown adipocytes to regulate the expression and activity

of HSL and UCP1 (Cannon & Nedergaard 2004). Gene

expression data revealed a significant reduction in b3-Ar

mRNA in PacapK/K BAT compared with PacapC/C BAT

isolated from cold-exposed mice. Comparison of expression

levels of b3-Ar mRNA in mice housed at 24 vs 4 8C revealed

that b3-Ar mRNA is not induced in the BAT of PacapK/K

mice in response to cold, unlike WT mice where it is

induced significantly. The failure to observe increased O2

consumption after NE injection may be associated with an

inability to upregulate b3-Ar mRNA in PacapK/K BAT. The

fundamental role of b3-AR in BAT thermogenic machinery

is well substantiated (Tachibana et al. 2003, Ueta et al. 2012)


and these results demonstrate for the first time that PACAP

plays an important role in regulating the expression of

b3-AR during cold exposure. PACAP deficiency has been

previously shown to reduce endogenous levels of NE in

BAT. The tonic suppression of NE in PacapK/K BAT may

suppress b3-AR expression in BAT, contributing to the

impaired NE-induced metabolic rate in cold-exposed Pacap

null mice. Subsequent studies either measuring the b3-AR

protein levels from the BAT of the two genotypes after cold

exposure or using b3-AR agonists to stimulate metabolic

rate should be performed to support this finding.

Despite the lower b3-AR expression within the

canonical BAT, the adult male PacapK/K mice survived a

3.5-week period of cold exposure and were able to induce

Ucp1 gene expression in BAT. This suggests that other

mechanisms to activate the thermogenic machinery,

independent of ARs, also exist. In addition to increased

physical activity, this may include the recruitment of ‘brite’

adipocytes into WAT depots as evidenced by the higher

induction of Ucp1 gene expression in ingWAT of PacapK/K

mice compared with PacapC/C animals. The disparate

expression of thermogenic genes in iBAT and ingWAT

depots of PacapC/C and PacapK/K mice suggests that PACAP

may differentially regulate the central innervation of these

depots. Future studies using retrograde viral transneuronal

tract tracers to label neuronal circuits that originate in the

hypothalamus and terminate in brown and WAT depots

will help to clarify as to how PACAP mediates these effects

in different adipose tissue depots.

In addition to sympathetic innervation of brown fat,

thermoregulation of BAT is made possible by extensive

vascularization enabling rapid access of circulating metab-

olites to the brown adipocytes (Asano et al. 1999). As basic







222 :3 337

FGF (or FGF2) is shown to induce mitogenic activity in

endothelial cells in vitro and angiogenesis in vivo

(Montesano et al. 1986, Gualandris et al. 1996), it is quite

likely that FGF2 is involved in the blood vessel formation

associated with the cold-induced BAT growth. Our results

showed that mRNA expression of Fgf2, as well as CD31

immunoreactivity, was higher in BAT of cold-exposed

PacapK/K mice compared with PacapC/C mice. This

heightened angiogenic induction in BAT of PacapK/K

mice, despite their low thermogenic capacity, may indicate

a physiological adaptive response that attempts to increase

the supply of nutrients and oxygen to boost thermogenesis.

This adaptation, along with the above-mentioned

mechanisms might be an attempt to activate thermogenic

machinery independent of ARs as a compensatory

approach for survival during chronic cold exposure.

In conclusion, our data show for the first time that

exogenous NE administration cannot rescue the impaired

adaptive thermogenesis in PacapK/K mice and the reduced

induction of b3-AR expression in BAT in response to cold

may contribute to the impaired sympathetic-induced

adaptive thermogenesis in these mice. These results

contribute to our understanding of the basic mechanisms

regulating energy metabolism, demonstrating PACAP as

an important neuroendocrine mediator of the sym-

pathetic regulation of adaptive thermogenesis. The

PacapK/K mouse is thus a suitable model for further

studies investigating the molecular and neuroendocrine

mechanisms involved in thermoregulation.

Declaration of interest

The authors declare that there is no conflict of interest that could be

perceived as prejudicing the impartiality of the research reported.

Funding

This study was funded by a grant from the Natural Sciences and

Engineering Research Council of Canada (NSERC) to Dr S L G.

Acknowledgements

The authors thank Lydia Troc, Dee Jones, and K-Lynn Hogh for their

exceptional technical assistance and dedication to the care and mainten-

ance of our PACAP null mouse colony.

References

Asano A, Kimura K & Saito M 1999 Cold-induced mRNA expression of

angiogenic factors in rat brown adipose tissue. Journal of Veterinary

Medical Science 61 403–409. (doi:10.1292/jvms.61.403)


Baron DM, Clerte M, Brouckaert P, Raher MJ, Flynn AW, Zhang H, Carter EA,

Picard MH, Bloch KD, Buys ES et al. 2012 In vivo noninvasive

characterization of brown adipose tissue blood flow by contrast

ultrasound in mice. Circulation. Cardiovascular Imaging 5 652–659.

(doi:10.1161/CIRCIMAGING.112.975607)

Bi S & Li L 2013 Browning of white adipose tissue: role of hypothalamic

signaling. Annals of the New York Academy of Sciences 1302 30–34.

(doi:10.1111/nyas.12258)

Bu LH & Lephart ED 2005 Effects of dietary phytoestrogens on core body

temperature during the estrous cycle and pregnancy. Brain Research

Bulletin 65 219–223. (doi:10.1016/j.brainresbull.2005.01.008)

Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R,

Nolan T, Pfaffl MW, Shipley GL et al. 2009 The MIQE guidelines:

minimum information for publication of quantitative real-time PCR

experiments. Clinical Chemistry 55 611–622. (doi:10.1373/clinchem.

2008.112797)

Cannon B & Nedergaard J 2004 Brown adipose tissue: function and

physiological significance. Physiological Reviews 84 277–359.

(doi:10.1152/physrev.00015.2003)

Castorina A, Giunta S, Mazzone V, Cardile V & D’Agata V 2010 Effects of

PACAP and VIP on hyperglycemia-induced proliferation in murine

microvascular endothelial cells. Peptides 31 2276–2283. (doi:10.1016/j.

peptides.2010.08.013)

Clapham JC & Arch JR 2011 Targeting thermogenesis and related pathways

in anti-obesity drug discovery. Pharmacology & Therapeutics 131

295–308. (doi:10.1016/j.pharmthera.2011.04.004)

Colquhoun EQ, Hettiarachchi M, Ye JM, Rattigan S & Clark MG 1990

Inhibition by vasodilators of noradrenaline and vasoconstrictor-mediated,

butnot skeletalmuscle contraction-inducedoxygen uptake inthe perfused

rat hindlimb; implications for non-shivering thermogenesis in muscle

tissue. General Pharmacology 21 141–148.

Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC,

Palmer EL, Tseng YH, Doria A et al. 2009 Identification and importance

of brown adipose tissue in adult humans. New England Journal of

Medicine 360 1509–1517. (doi:10.1056/NEJMoa0810780)

Doubt TJ 1991 Physiology of exercise in the cold. Sports Medicine 1 367–381.

(doi:10.2165/00007256-199111060-00003)

Dubois-Ferriere R & Chinet AE 1981 Contribution of skeletal muscle to the

regulatory non-shivering thermogenesis in small mammals. Pflugers

Archiv: European Journal of Physiology 390 224–229. (doi:10.1007/

BF00658266)

Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME

& Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are

cold-sensitive but not obese. Nature 387 90–94. (doi:10.1038/

387090a0)

Foster DO & Frydman ML 1978 Brown adipose tissue: the dominant site of

nonshivering thermogenesis in the rat. Experientia. Supplementum 32

147–151.

Gavrilova O, Marcus-Samuels B & Reitman ML 2000 Lack of responses to a

b3-adrenergic agonist in lipoatrophic A-ZIP/F-1 mice. Diabetes 49

1910–1916. (doi:10.2337/diabetes.49.11.1910)

Ghorbani M, Claus TH & Himms-Hagen J 1997 Hypertrophy of brown

adipocytes in brown and white adipose tissues and reversal of

diet-induced obesity in rats treated with a b3-adrenoceptor agonist.

Biochemical Pharmacology 54 121–131. (doi:10.1016/S0006-

2952(97)00162-7)

Golozoubova V, Gullberg H, Matthias A, Cannon B, Vennstrom B &

Nedergaard J 2004 Depressed thermogenesis but competent brown

adipose tissue recruitment in mice devoid of all hormone-binding

thyroid hormone receptors. Molecular Endocrinology 18 384–401.

(doi:10.1210/me.2003-0267)

Golozoubova V, Cannon B & Nedergaard J 2006 UCP1 is essential for

adaptive adrenergic nonshivering thermogenesis. American Journal of

Physiology. Endocrinology and Metabolism 291 E350–E357. (doi:10.1152/

ajpendo.00387.2005)


http://dx.doi.org/10.1292/jvms.61.403

http://dx.doi.org/10.1161/CIRCIMAGING.112.975607

http://dx.doi.org/10.1111/nyas.12258

http://dx.doi.org/10.1016/j.brainresbull.2005.01.008

http://dx.doi.org/10.1373/clinchem.2008.112797

http://dx.doi.org/10.1373/clinchem.2008.112797

http://dx.doi.org/10.1152/physrev.00015.2003

http://dx.doi.org/10.1016/j.peptides.2010.08.013

http://dx.doi.org/10.1016/j.peptides.2010.08.013

http://dx.doi.org/10.1016/j.pharmthera.2011.04.004

http://dx.doi.org/10.1056/NEJMoa0810780

http://dx.doi.org/10.2165/00007256-199111060-00003

http://dx.doi.org/10.1007/BF00658266

http://dx.doi.org/10.1007/BF00658266

http://dx.doi.org/10.1038/387090a0

http://dx.doi.org/10.1038/387090a0

http://dx.doi.org/10.2337/diabetes.49.11.1910

http://dx.doi.org/10.1016/S0006-2952(97)00162-7

http://dx.doi.org/10.1016/S0006-2952(97)00162-7

http://dx.doi.org/10.1210/me.2003-0267

http://dx.doi.org/10.1152/ajpendo.00387.2005







222 :3 338

Gray SL, Cummings KJ, Jirik FR & Sherwood NM 2001 Targeted disruption

of the pituitary adenylate cyclase-activating polypeptide gene results in

early postnatal death associated with dysfunction of lipid and

carbohydrate metabolism. Molecular Endocrinology 15 1739–1747.

(doi:10.1210/mend.15.10.0705)

Gray SL, Yamaguchi N, Vencova P & Sherwood NM 2002 Temperature-

sensitive phenotype in mice lacking pituitary adenylate cyclase-

activating polypeptide. Endocrinology 143 3946–3954. (doi:10.1210/en.

2002-220401)

Gualandris A, Rusnati M, Belleri M, Nelli EE, Bastaki M, Molinari-Tosatti MP,

Bonardi F, Parolini S, Albini A, Morbidelli L et al. 1996 Basic fibroblast

growth factor overexpression in endothelial cells: an autocrine

mechanism for angiogenesis and angioproliferative diseases. Cell

Growth & Differentiation 7 147–160.

Guerra C, Koza RA, Yamashita H, Walsh K & Kozak LP 1998 Emergence of

brown adipocytes in white fat in mice is under genetic control. Effects

on body weight and adiposity. Journal of Clinical Investigation 102

412–420. (doi:10.1172/JCI3155)

Hondares E, Rosell M, Gonzalez FJ, Giralt M, Iglesias R & Villarroya F 2010

Hepatic FGF21 expression is induced at birth via PPARa in response

to milk intake and contributes to thermogenic activation of neonatal

brown fat. Cell Metabolism 11 206–212. (doi:10.1016/j.cmet.

2010.02.001)

Inglott MA, Farnham MM & Pilowsky PM 2011 Intrathecal PACAP-38

causes prolonged widespread sympathoexcitation via a spinally

mediated mechanism and increases in basal metabolic rate in

anesthetized rat. American Journal of Physiology. Heart and Circulatory

Physiology 300 H2300–H2307.

Inokuma K, Okamatsu-Ogura Y, Omachi A, Matsushita Y, Kimura K,

Yamashita H & Saito M 2006 Indispensable role of mitochondrial UCP1

for antiobesity effect of b3-adrenergic stimulation. American Journal of

Physiology. Endocrinology and Metabolism 290 E1014–E1021. (doi:10.

1152/ajpendo.00105.2005)

Kawaguchi C, Isojima Y, Shintani N, Hatanaka M, Guo X, Okumura N,

Nagai K, Hashimoto H & Baba A 2010 PACAP-deficient mice exhibit

light parameter-dependent abnormalities on nonvisual photoreception

and early activity onset. PLoS ONE 5 e9286. (doi:10.1371/journal.pone.

0009286)

Kohno D & Yada T 2012 Arcuate NPY neurons sense and integrate

peripheral metabolic signals to control feeding. Neuropeptides 46

315–319. (doi:10.1016/j.npep.2012.09.004)

Lopez M, Varela L, Vazquez MJ, Rodrıguez-Cuenca S, Gonzalez CR,

Velagapudi VR, Morgan DA, Schoenmakers E, Agassandian K, Lage R

et al. 2010 Hypothalamic AMPK and fatty acid metabolism mediate

thyroid regulation of energy balance. Nature Medicine 16 1001–1008.

(doi:10.1038/nm.2207)

Lowell BB & Spiegelman BM 2000 Towards a molecular understanding of

adaptive thermogenesis. Nature 404 652–660.

Lowell BB, S-Susulic V, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB,

Kozak LP & Flier JS 1993 Development of obesity in transgenic mice

after genetic ablation of brown adipose tissue. Nature 366 740–742.

(doi:10.1038/366740a0)

Matthias A, Ohlson KB, Fredriksson JM, Jacobsson A, Nedergaard J &

Cannon B 2000 Thermogenic responses in brown fat cells are fully

UCP1-dependent. UCP2 or UCP3 do not substitute for UCP1 in

adrenergically or fatty acid-induced thermogenesis. Journal of Biological

Chemistry 275 25073–25081. (doi:10.1074/jbc.M000547200)

Miyata A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD

& Coy DH 1989 Isolation of a novel 38 residue-hypothalamic

polypeptide which stimulates adenylate cyclase in pituitary cells.

Biochemical and Biophysical Research Communications 164 567–574.

(doi:10.1016/0006-291X(89)91757-9)

Montesano R, Vassalli JD, Baird A, Guillemin R & Orci L 1986 Basic

fibroblast growth factor induces angiogenesis in vitro. PNAS 83

7297–7301. (doi:10.1073/pnas.83.19.7297)


Morrison SF, Madden CJ & Tupone D 2012 Central control of brown

adipose tissue thermogenesis. Frontiers in Endocrinology 3 pii: 00005.

(doi:10.3389/fendo.2012.00005)

Mounien L, Do Rego JC, Bizet P, Boutelet I, Gourcerol G, Fournier A, Brabet P,

Costentin J, Vaudry H & Jegou S 2009 Pituitary adenylate cyclase-

activating polypeptide inhibits food intake in mice through activation

of the hypothalamic melanocortin system. Neuropsychopharmacology 34

424–435. (doi:10.1038/npp.2008.73)

Ohno H, Shinoda K, Spiegelman BM & Kajimura S 2012 PPARg agonists

induce a white-to-brown fat conversion through stabilization of

PRDM16 protein. Cell Metabolism 15 395–404. (doi:10.1016/j.cmet.

2012.01.019)

Ouellet V, Routhier-Labadie A, Bellemare W, Lakhal-Chaieb L, Turcotte E,

Carpentier AC & Richard D 2011 Outdoor temperature, age, sex, body

mass index, and diabetic status determine the prevalence, mass, and

glucose-uptake activity of 18F-FDG-detected BAT in humans. Journal of

Clinical Endocrinology and Metabolism 96 192–199. (doi:10.1210/jc.

2010-0989)

Perkins MN, Rothwell NJ, Stock MJ & Stone TW 1981 Activation of brown

adipose tissue thermogenesis by the ventromedial hypothalamus.

Nature 289 401–402. (doi:10.1038/289401a0)

Resch JM, Maunze B, Gerhardt AK, Magnuson SK, Phillips KA & Choi S

2013 Intrahypothalamic pituitary adenylate cyclase-activating poly-

peptide regulates energy balance via site-specific actions on feeding and

metabolism. American Journal of Physiology. Endocrinology and

Metabolism 305 E1452–E1463. (doi:10.1152/ajpendo.00293.2013)

Richard D & Picard F 2011 Brown fat biology and thermogenesis. Frontiers

in Bioscience 16 1233–1260. (doi:10.2741/3786)

Ricquier D, Miroux B, Larose M, Cassard-Doulcier AM & Bouillaud F 2000

Endocrine regulation of uncoupling proteins and energy expenditure.

International Journal of Obesity and Related Metabolic Disorders 24

S86–S88. (doi:10.1038/sj.ijo.0801286)

Riedel D 2010 Single molecule manipulation at low temperature and laser

scanning tunnelling photo-induced processes analysis through time-

resolved studies. Journal of Physics. Condensed Matter 22 264009.

(doi:10.1088/0953-8984/22/26/264009)

Schaeffer PJ, Villarin JJ & Lindstedt SL 2003 Chronic cold exposure

increases skeletal muscle oxidative structure and function in

Monodelphis domestica, a marsupial lacking brown adipose tissue.

Physiological and Biochemical Zoology 76 877–887. (doi:10.1086/378916)

Schulz TJ & Tseng YH 2013 Systemic control of brown fat thermogenesis:

integration of peripheral and central signals. Annals of the New York

Academy of Sciences 1302 35–41. (doi:10.1111/nyas.12277)

Segal JP, Stallings NR, Lee CE, Liping Z, Socci N, Viale A, Harris TM,

Soares MB, Childs G, Elmquist JK et al. 2010 Use of laser-capture

microdissection for the identification of marker genes for the

ventromedial hypothalamic nucleus. Journal of Neuroscience 25

4181–4188. (doi:10.1523/JNEUROSCI.0158-05.2005)

Tachibana T, Takagi T, Saito ES, Tomonaga S, Zhang R, Koga Y, Kido Y,

Michael Denbow D & Furuse M 2003 b3-Adrenergic receptor is involved

in feeding regulation in chicks. Comparative Biochemistry and Physiology.

Part A, Molecular & Integrative Physiology 135 403–409.

Tachibana T, Oikawa D, Adachi N, Boswell T & Furuse M 2007 Central

administration of vasoactive intestinal peptide and pituitary adenylate

cyclase-activating polypeptide differentially regulates energy metab-

olism in chicks. Comparative Biochemistry and Physiology. Part A,

Molecular & Integrative Physiology 147 156–164.

Thomas SA & Palmiter RD 1997 Thermoregulatory and metabolic

phenotypes of mice lacking noradrenaline and adrenaline. Nature 387

94–97. (doi:10.1038/387094a0)

Tseng YH, Kokkotou E, Schulz TJ, Huang TL, Winnay JN, Taniguchi CM,

Tran TT, Suzuki R, Espinoza DO, Yamamoto Y et al. 2008 New role of

bone morphogenetic protein 7 in brown adipogenesis and energy

expenditure. Nature 454 1000–1004. (doi:10.1038/nature07221)

Uchida Y, Kano M, Yasuhara S, Kobayashi A, Tokizawa K & Nagashima K

2010 Estrogen modulates central and peripheral responses to cold in


http://dx.doi.org/10.1210/mend.15.10.0705

http://dx.doi.org/10.1210/en.2002-220401

http://dx.doi.org/10.1210/en.2002-220401

http://dx.doi.org/10.1172/JCI3155

http://dx.doi.org/10.1016/j.cmet.2010.02.001




http://dx.doi.org/10.1371/journal.pone.0009286

http://dx.doi.org/10.1371/journal.pone.0009286

http://dx.doi.org/10.1016/j.npep.2012.09.004

http://dx.doi.org/10.1038/nm.2207

http://dx.doi.org/10.1038/366740a0

http://dx.doi.org/10.1074/jbc.M000547200

http://dx.doi.org/10.1016/0006-291X(89)91757-9

http://dx.doi.org/10.1073/pnas.83.19.7297

http://dx.doi.org/10.3389/fendo.2012.00005

http://dx.doi.org/10.1038/npp.2008.73



http://dx.doi.org/10.1210/jc.2010-0989

http://dx.doi.org/10.1210/jc.2010-0989

http://dx.doi.org/10.1038/289401a0


http://dx.doi.org/10.2741/3786

http://dx.doi.org/10.1038/sj.ijo.0801286

http://dx.doi.org/10.1088/0953-8984/22/26/264009

http://dx.doi.org/10.1086/378916

http://dx.doi.org/10.1111/nyas.12277

http://dx.doi.org/10.1523/JNEUROSCI.0158-05.2005

http://dx.doi.org/10.1038/387094a0

http://dx.doi.org/10.1038/nature07221






222 :3 339

female rats. Journal of Physiological Sciences 60 151–160. (doi:10.1007/

s12576-009-0079-x)

Ueta CB, Fernandes GW, Capelo LP, Fonseca TL, Maculan FD, Gouveia CH,

Brum PC, Christoffolete MA, Aoki MS, Lancellotti CL et al. 2012 b(1)

Adrenergic receptor is key to cold- and diet-induced thermogenesis in

mice. Journal of Endocrinology 214 359–365. (doi:10.1530/JOE-12-0155)

Vaudry D, Falluel-Morel A, Bourgault S, Basille M, Burel D, Wurtz O,

Fournier A, Chow BK, Hashimoto H, Galas L et al. 2009 Pituitary

adenylate cyclase-activating polypeptide and its receptors: 20 years

after the discovery. Pharmacological Reviews 61 283–357. (doi:10.1124/

pr.109.001370)

Vaughan CH, Zarebidaki E, Ehlen JC & Bartness TJ 2014 Analysis and

measurement of the sympathetic and sensory innervation of white and

brown adipose tissue. Methods in Enzymology 537 199–225.

Virtue S & Vidal-Puig A 2013 Assessment of brown adipose tissue function.

Frontiers in Physiology 4 128–156. (doi:10.3389/fphys.2013.00128)

Walden TB, Hansen IR, Timmons JA, Cannon B & Nedergaard J 2012

Recruited vs. nonrecruited molecular signatures of brown, “brite”, and


white adipose tissues. American Journal of Physiology. Endocrinology and

Metabolism 302 E19–E31. (doi:10.1152/ajpendo.00249.2011)

Whittle AJ, Carobbio S, Martins L, Slawik M, Hondares E, Vazquez MJ,

Morgan D, Csikasz RI, Gallego R, Rodriguez-Cuenca S et al. 2012 BMP8B

increases brown adipose tissue thermogenesis through both central and

peripheral actions. Cell 149 871–885. (doi:10.1016/j.cell.2012.02.066)

Wu J, Bostrom P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M,

Virtanen KA, Nuutila P, Schaart G et al. 2012 Beige adipocytes are a

distinct type of thermogenic fat cell in mouse and human. Cell 150

366–376. (doi:10.1016/j.cell.2012.05.016)

Xue Y, Petrovic N, Cao R, Larsson O, Lim S, Chen S, Feldmann HM, Liang Z,

Zhu Z, Nedergaard J et al. 2009 Hypoxia-independent angiogenesis in

adipose tissues during cold acclimation. Cell Metabolism 9 99–109.

(doi:10.1016/j.cmet.2008.11.009)

Zengin A, Nguyen AD, Wong IP, Zhang L, Enriquez RF, Eisman JA, Herzog H,

Baldock PA & Sainsbury A 2013 Neuropeptide Y mediates the short-

term hypometabolic effect of estrogen deficiency in mice. International

Journal of Obesity 37 390–398. (doi:10.1038/ijo.2012.71)

Received in final form 11 July 2014Accepted 22 July 2014Accepted Preprint published online 23 July 2014


http://dx.doi.org/10.1007/s12576-009-0079-x

http://dx.doi.org/10.1007/s12576-009-0079-x


http://dx.doi.org/10.1124/pr.109.001370

http://dx.doi.org/10.1124/pr.109.001370

http://dx.doi.org/10.3389/fphys.2013.00128


http://dx.doi.org/10.1016/j.cell.2012.02.066

http://dx.doi.org/10.1016/j.cell.2012.05.016


http://dx.doi.org/10.1038/ijo.2012.71



Documents

PACAP is essential for the adaptive thermogenic response of brown