PACAP and VIP Modulation of Neuroexcitability in Rat

University of South Florida University of South Florida

Scholar Commons Scholar Commons

Graduate Theses and Dissertations Graduate School

2005

PACAP and VIP Modulation of Neuroexcitability in Rat PACAP and VIP Modulation of Neuroexcitability in Rat

Intracardiac Neurons Intracardiac Neurons

Wayne I. DeHaven University of South Florida

Follow this and additional works at: https://scholarcommons.usf.edu/etd

Part of the American Studies Commons

Scholar Commons Citation Scholar Commons Citation DeHaven, Wayne I., "PACAP and VIP Modulation of Neuroexcitability in Rat Intracardiac Neurons" (2005). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/2852

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected].

http://scholarcommons.usf.edu/

http://scholarcommons.usf.edu/

https://scholarcommons.usf.edu/

https://scholarcommons.usf.edu/etd

https://scholarcommons.usf.edu/grad

https://scholarcommons.usf.edu/etd?utm_source=scholarcommons.usf.edu%2Fetd%2F2852&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/439?utm_source=scholarcommons.usf.edu%2Fetd%2F2852&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

PACAP and VIP Modulation of Neuroexcitability in Rat Intracardiac Neurons

by

Wayne I. DeHaven

A dissertation submitted in partial fulfillment of the requirements for the degree of

Doctor of Philosophy Department of Pharmacology and Therapeutics

College of Medicine University of South Florida

Major Professor: Javier Cuevas, Ph.D. David Morgan, Ph.D.

Paul E. Gottschall, Ph.D. Eric S. Bennett, Ph.D.

Keith R. Pennypacker, Ph.D.

Date of Approval: February 22, 2005

Keywords: Intracardiac ganglia, PACAP, VIP, VPAC2, PAC1, Calcium

© Copyright 2005, Wayne I. DeHaven

ACKNOWLEDGEMENTS

This dissertation would not have been completed without the love and

support from my family. I would like to give special thanks to my wife, Courtney,

for always supporting me in my scientific career, and reminding me of life outside

of the laboratory. I would like to thank my daughter, Eve, for always putting a

smile on my face. I would like to thank Mom and Dad for giving me the

opportunity to succeed. I would also like to thank my in-laws, Tom and Dennie

Masterson, for always lending a helping hand.

I would like to thank my mentor, Dr. Javier Cuevas, for giving me the

appropriate environment to grow as a scientist. I would also like to thank

Hongling Zhang for her scientific help and knowledge, and Crystal Reed and

Yolmari Cruz for maintaining the laboratory, and for putting up with sports radio

all of the time. I would like to thank my external reviewer, Dr. Rodney L.

Parsons, for taking the time to chair my dissertation committee. Finally, I would

like to thank the other members of my committee: Drs. David Morgan, Paul E.

Gottschall, Eric S. Bennett and Keith R. Pennypacker for their excellent scientific

advice.

i

TABLE OF CONTENTS

List of Tables

……………………………………………………………………

v

List of Figures

………………………………………………………………….

vi

Abstract

…………………………………………………………………………..

xi

Chapter 1 Background and Significance ………………………………….. 1

Mammalian Intracardiac Ganglia ……………………………………… 1

PACAP and VIP effects on the Heart …………………………………. 4

PACAP and VIP receptors ……………………………………………... 6

PACAP and VIP relevance to cardiac function ……………………….

7

Chapter 2

Heterogeneity of PACAP and VIP receptors in rat intrinsic

cardiac neurons …………………………………………………. 12

Introduction ……………………………………………………………… 12

Methods ………………………………………………………………….. 15

Cell culture ………………………………………………………… 15

RT-PCR ……………………………………………………………. 16

Cytoplasm harvest of individual neurons ………………………. 17

ii

Results …………………………………………………………………… 18

PAC1 receptor mRNA isoforms detected in cardiac tissue …... 18

PAC1 mRNA expression in isolated rat intracardiac neurons … 19

VPAC1 and VPAC2 receptor transcripts detected in cardiac

tissue ……………………………………………………………….. 20

VPAC mRNA expression in isolated rat intracardiac neurons .. 21

Individual intracardiac neuron expression pattern of PAC1 and

VPAC mRNA ………………………………………………………. 22

Discussion ………………………………………………………………..

31

Chapter 3 VPAC receptor modulation of neuroexcitability in intracardiac

neurons: dependence on intracellular Ca2+ mobilization and

synergistic enhancement by PAC1 receptor activation ……… 33

Introduction ………………………………………………………………. 33

Methods ………………………………………………………………….. 37

Microfluorometric measurements ……………………………….. 37

Electrophysiology …………………………………………………. 38

Reagents and statistical analysis ……………………………….. 40

Results …………………………………………………………………… 41

PACAP and VIP directly increase free [Ca2+]i …………………... 41

Increases in free [Ca2+]i evoked by PACAP and VIP are

mediated by a VPAC receptor …………………………………... 42

PACAP and VIP mobilize Ca2+ from intracellular stores and

evoke Ca2+ entry through the plasma membrane ……………... 44

PACAP induces mobilization of [Ca2+]i from caffeine- and

ryanodine-sensitive stores ……………………………………….. 46

PACAP and VIP Induced Excitability in Rat Intracardiac

Neurons ……………………………………………………………. 49

iii

Increases in neuroexcitability evoked by PACAP and VIP are in

part mediated by a VPAC receptor ……………………………… 52

Effects of Ca2+-free extracellular conditions on PACAP-induced

intracardiac neuroexcitability …………………………………….. 54

Effects of Ryanodine on PACAP-induced intracardiac

neuroexcitability …………………………………………………… 56

Discussion ………………………………………………………………..

80

Chapter 4 Repetitive VPAC2 receptor-mediated calcium elevations in

intracardiac neurons is dependent on Ca2+, cADPR and store-

operated calcium (SOC) entry …………………………………. 87

Introduction ………………………………………………………………. 87

Methods ………………………………………………………………….. 92

Cell culture …………………………………………………………. 92

Microfluorometric measurements ……………………………….. 92


Results …………………………………………………………………… 95

VPAC2 receptors mediate PACAP-induced elevations in free

[Ca2+]i. ……………………………………………………………….. 95

Forskolin does not increase [Ca2+]i in intracardiac neurons ….. 96

Role for cADP-ribose in the PACAP-elicited signal transduction

cascade …………………………………………………………….. 96

Effects of menthol and capsaicin on [Ca2+]i ……………………... 98

La3+ blocks VPAC2 mediated Ca2+ elevations and TRPC

channels in intracardiac neurons ………………………………... 99

PACAP evoked Ca2+ influx through store-operated channels

(SOC) ……………………………………………………………….

101

iv

The SOC channel component of the PACAP-induced Ca2+

response is blocked by 2-APB …………………………………... 103

2-APB blocks VPAC2 receptor mediated repetitive Ca2+

responses ………………………………………………………….. 104

Discussion ………………………………………………………………..

125

Chapter 5 Canonical transient receptor potential (TRPC) channels

regulate neuroexcitability in rat intracardiac neurons ……….. 132

Introduction ………………………………………………………………. 132

Methods ………………………………………………………………….. 135

Electrophysiology …………………………………………………. 135


Results …………………………………………………………………… 138

2-APB decreases action potential (AP) firing in rat intracardiac

neurons …………………………………………………………….. 138

2-APB evoked changes in the single action potential waveform.. 139

Membrane currents underlying the 2-APB-elicited changes in

action potential properties ……………………………………….. 141

Discussion ………………………………………………………………..

151

Chapter 6 Summary …………………………………………………………. 155

Conclusion ………………………………………………………..

167

Works Cited

……………………………………………………………………... 170

About the author ………………………………………………………… End Page

v

LIST OF TABLES

Table 2.1 Sequences of oligonucleotide primers to detect PAC1

isoforms, as well as VPAC receptor transcripts in rat

intracardiac neurons ………………………………………...

25

Table 3.1 Effects of extracellular Ca2+ conditions and various

inhibitors on the PACAP-induced changes in

neuroexcitability in response to a 150 pA current pulse ... 79

vi

LIST OF FIGURES

Figure 1.1 Schematic representation of the connectivity among various

neurons involved in maintaining cardiac homeostasis ……...

9

Figure 1.2 Morphologically distinct intrinsic cardiac neurons identified in

vitro …………………………………………………………........

10

Figure 1.3 Schematic representation of the two neuropeptides, PACAP

and VIP, binding to their associated G-protein coupled PAC1,

VPAC1 and VPAC2 receptors ……………………………..…...

11

Figure 2.1 Expression of PAC1 receptor isoforms in cardiac tissue …….

26

Figure 2.2 Detection of PAC1 receptor isoforms in single intracardiac

neurons ……………………………………………………..…....

27

Figure 2.3 Expression of VPAC1 and VPAC2 receptor isoforms in cardiac

tissue ………………………………………………………….…..

28

Figure 2.4 Detection of VPAC receptor transcripts in single intracardiac

neurons ……………………………………………………..…....

29

Figure 2.5 Expression pattern of PAC1 isoforms and VPAC transcripts in

intracardiac neurons ………………………………………...….. 30

vii

Figure 3.1 PACAP and VIP, but not maxadilan, reversibly increase [Ca2+]i

in rat intracardiac neurons …………………………………......

59

Figure 3.2 PACAP-induced mobilization of [Ca2+]i in intracardiac neurons

is via VPAC receptor activation ………………………..……....

61

Figure 3.3 The transient, but not the sustained, component of the

PACAP-induced increase in [Ca2+]i is dependent on

extracellular Ca2+ …………………………………...…………...

63

Figure 3.4 PACAP evokes a rapid transient elevation of [Ca2+]i in

intracardiac neurons by releasing Ca2+ from

caffeine/ryanodine-sensitive internal stores ………...………..

65

Figure 3.5 The sustained, but not the transient, component of the

PACAP-induced increase in [Ca2+]i is blocked by 2-APB …...

67

Figure 3.6 PACAP increases neuroexcitability in neonatal rat intracardiac

neurons …………………………………………………………..

69

Figure 3.7 VIP-induced changes in neuroexcitability within neonatal rat

intracardiac neurons ………………………………………...…..

71

viii

Figure 3.8 PACAP-evoked changes in intracardiac neuroexcitability are

inhibited by the VPAC antagonist [N-Ac-Tyr1, D-Phe2]-GRF

(1-29) …………………………………………………………...

73

Figure 3.9 PACAP-induced changes in intracardiac neuroexcitability

are blocked by the removal of extracellular Ca2+ and

depletion of internal stores …………………………………...

75

Figure 3.10 PACAP-induced changes in intracardiac neuron excitability

are blocked by ryanodine ……………………………………..

77

Figure 4.1 PACAP-evoked mobilization of [Ca2+]i in rat intracardiac

neurons is via VPAC2 receptor activation …………………..

108

Figure 4.2 Forskolin does not increase free cytosolic calcium

concentrations in rat intracardiac neurons ………………….

110

Figure 4.3 The putative ryanodine receptor activator, cADP ribose, is

involved in the PACAP-elicited signal transduction cascade..

112

Figure 4.4 Neither menthol nor capsaicin increase free intracellular

Ca2+ concentrations in isolated rat intracardiac neurons ….

114

ix

Figure 4.5 La3+ blocks VPAC2 mediated Ca2+ elevations in intracardiac

neurons and the sustained component of the caffeine- and

muscarine-induced increase in [Ca2+]i ……………………....

116

Figure 4.6 The TRPC agonist, 1-oleoyl-2-acetyl-sn-glycerol (OAG),

does not increase [Ca2+]i in neonatal rat intracardiac

neurons ………………………………………………………....

118

Figure 4.7 Internal store depletion by PACAP or caffeine activates

store-operated Ca2+ (SOC) entry in intracardiac neurons ...

120

Figure 4.8 SOC channel activation by PACAP is inhibited by 2-APB ..

122

Figure 4.9 Repetitive elevations of [Ca2+]i mediated by VPAC2 receptor

activations are blocked by 2-APB …………………………...

124

Figure 5.1 2-APB effects on action potential firing in isolated intrinsic

cardiac neurons ………………………………………………..

144

Figure 5.2 The effects of 2-APB on the single action potential waveform

parameters ……………………………………………………..

146

Figure 5.3 Effects of the Ca2+-activated K+ inhibitors TEA, paxilline and

apamin, and the Ca2+ channel blocker Cd2+ on the action

potential and afterhyperpolarization …………………………

148

x

Figure 5.4 Inhibition of peak K+ channel currents in rat intracardiac

neurons by the TRP channel antagonist, 2-APB …………..

150

Figure 6.1 Schematic representation of the expression pattern of PAC1

receptor isoforms and VPAC transcripts in individual

intracardiac neurons …………………………………………..

164

Figure 6.2 Schematic diagram showing the effects of PACAP and VIP

on intracardiac neurons ………………………………………. 166

xi

PACAP and VIP Modulation of Neuroexcitability in Rat Intracardiac Neurons

Wayne I. DeHaven

ABSTRACT

Autonomic control of cardiac function depends on the coordinated activity

generated by neurons within the intracardiac ganglia, and intrinsic feedback

loops within the ganglia provide precise control of cardiac function. Both pituitary

adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal

polypeptide (VIP) are important regulators of cell-to-cell signaling within the

intracardiac ganglia, and PACAP and VIP action on these ganglia, mediated

through associated receptors, play an important role in the regulation of coronary

blood flow, cardiac contraction, relaxation, and heart rate. Results reported here

using PACAP and VIP provide direct evidence of some of the complex signaling

which occurs in neurons of the rat intracardiac ganglia.

The expression of PACAP and VIP receptors was investigated using

single-cell RT-PCR. Individual neurons were shown to express multiple isoforms

of the PACAP-selective receptor, PAC1, including the -short, -HOP1 and -HOP2

variants. These splice variants affect ligand binding, G-protein coupling and

xii

selectivity. Intracardiac neurons also express the non-selective receptors,

VPAC1 and VPAC2, with VPAC2 being found in greater proportion of cells. These

results demonstrate heterogeneity of PAC1 and VPAC receptors expressed in

intracardiac neurons, which has significant implications on the effects of PACAP

and VIP on cellular function.

Calcium imaging and electrophysiology were used to examine the

physiological effects of PACAP and VIP on isolated intracardiac neurons. Both

neuropeptides, through the activation of VPAC2 receptors, evoked rapid

increases in cytosolic calcium concentrations ([Ca2+]i) that exhibited both

transient and sustained components. The transient increases in [Ca2+]i were

mediated through the activation of ryanodine receptors, whereas the sustained

[Ca2+]i elevations were dependent on extracellular Ca2+ and pharmacologically

resembled canonical transient receptor potential (TRPC) channels.

PACAP and VIP also depolarized intracardiac neurons, and PACAP was

further shown to augment action potential firing in these cells. The depolarization

was dependent on activation of VPAC2 receptors and the concomitant increases

in [Ca2+]i, while PAC1 receptor stimulation potentiated the VPAC2 receptor-

induced depolarizations. Pharmacological evidence suggest TRPC channels

mediate this link between neuropeptide evoked changes in membrane properties

and [Ca2+]i. Thus, these results give insight into the complex PACAP and VIP

signaling which occurs in the intracardiac ganglia.

1

CHAPTER 1

BACKGROUND AND SIGNIFICANCE

Mammalian Intracardiac Ganglia

Parasympathetic influences on cardiac function are mediated through the

vagus nerve (CN X), and stimulation of this nerve results in multiple cardiac

effects, including bradycardia, atrioventricular (AV) block, and reduced

myocardial contractility. Intracardiac ganglia form the final pathway for

autonomic modulation of cardiac function, and in the classical view of

parasympathetic innervation of the heart, intracardiac neurons are considered

exclusively postganglionic efferent neurons. However, an increasing body of

data has supported the hypothesis that neurons within the intracardiac ganglia do

not serve as simple relays between the central nervous system (CNS) and heart

(Gray et al., 2004); but, instead, individual cardiac ganglia serve as complex

integrative centers within which processing of autonomic signals can occur.

These data have resulted in the proposal of the organization of the intrinsic

cardiac nervous system which includes parasympathetic efferent neurons,

sensory afferent neurons, intraganglionic and interganglionic neurons,

2

sympathetic neurons, as well as the terminals of cardiac neurons projecting from

higher centers (Gray et al., 2004; Ardell, 1994; Armour, 1994) (Fig 1.1).

Mammalian intracardiac ganglia are anatomically located in various fat

pads associated with the heart, and each distinct cluster of neurons

predominantly innervates different regions of the heart. For example, the

sinoatrial (SA) ganglion, located in a fat pad near the junction of the right atrium

and the superior vena cava, mediates a negative chronotropic effect (King and

Coakley, 1958; Gatti et al., 1995; Massari et al., 1996; Massari et al., 1994).

Similarly, the atrioventricular (AV) ganglion, found in a fat pad between the left

atrium and the inferior vena cava, potently reduces the AV conduction rate (Gatti

et al., 1995; Massari et al., 1995; Massari et al., 1996). The cranioventricular

(CV) ganglion, located at the cranial margin of the left ventricle, has been found

to contain neurons that selectively mediate negative inotropic effects on the left

ventricle, without influencing cardiac rate or AV conduction (Dickerson et al.,

1998; Gatti et al., 1997). In addition, there are numerous ganglia found

throughout the heart for which no functional roles have been described (Ardell,

1994; Armour, 1994; Calaresu et al, 1967; Johnson et al., 2004).

Morphologically, at least three distinct functional types of neurons exist

within these intrinsic cardiac ganglia. The first group of neurons is the

parasympathetic efferent postganglionic neurons (Jacobowitz et al, 1967, Xi-Moy

et al, 1993), innervating the coronary vasculature, cardiac myocytes, SA and AV

nodes. The second group of neurons is interneurons (Jacobowitz et al, 1967;

3

Armour and Hopkins, 1990; Randall and Wurster, 1994), which regulate the other

neurons of the ganglia. The third group of neurons is the small intensely

fluorescent cells (SIF cells), so named based on their high glyoxylate

fluorescence indicative of catecholamines (Seabrook et al., 1990). SIF cells do

not have processes; rather, SIF cells are small oval shaped cells which may have

paracrine function. Previous morphological studies describe principle

parasympathetic neurons as being monopolar or multipolar with long axons,

whereas interneurons display a dipolar or pseudodipolar arrangement (Edwards

et al, 1995). The axons of the interneurons appear to be shorter, with small

branches that terminate near other ganglion cells. Intracardiac neurons are also

morphologically differentiated on the basis of soma diameter with interneurons >

principle parasympathetic neurons >> SIF cells (Edwards et al., 1995; Allen and

Burnstock, 1990; Seabrook et al., 1990). In our isolated neuron preparation we

are able to identify various neuron types, including unipolar, bipolar and

multipolar neurons that correspond well to observations in intrinsic cardiac

neurons in situ (Edwards et al., 1995) (Fig 1.2)

Though some of the neuroanatomical and functional characteristics of

these intracardiac neurons are identified, little is known about how neural activity

is generated and coordinated within the intrinsic cardiac nervous system. Along

with the structural complexity of the intracardiac ganglia, a neurochemical

complexity exists which allows for a wide range of responses and ultimately

maintains cardiac homeostasis. Although acetylcholine is the primary

4

neurotransmitter in the mammalian heart, an expanded view of intracardiac

neurotransmission has evolved to include instances where substances other than

acetylcholine are localized and released and function as cotransmitters,

neuromodulators, or primary neurotransmitters themselves (Rubino et al, 1996).

Two such neurotransmitters with potent cardiovascular effects are pituitary

adenylate-cyclase activating polypeptide (PACAP) and vasoactive intestinal

polypeptide (VIP).

PACAP and VIP effects on the Heart

PACAP and VIP are pleiotropic neuropeptides that belong to the

secretin/glucagon/growth hormone-releasing factor family of peptides (Warren et

al, 1991; Ishizuka et al, 1992; Basler et al, 1995; Champion et al, 1996; Cardell et

al, 1997). These neuropeptides have a broad spectrum of effects in both the

central nervous system (CNS) and peripheral nervous system (PNS), including

the autonomic nervous system (Vaudry et al., 2000; Arimura, 1998). For

example, in the CNS, PACAP is involved in oxytocin and vasopressin release

(Murase et al., 1993; Seki et al., 1995), rhythmicity of melatonin production in the

pineal gland (Fukuhara et al., 1998), control of appetite and feeding behavior

(Christophe, 1998), inhibition of cell death and promotion of neurite outgrowth

during ontogenesis (Gonzalez et al., 1997; Cavallaro et al., 1996), synaptic

plasticity and learning in mice (Hashimoto et al., 2002) and mobilization of Ca2+

in astroglial cells (Tatsuno and Arimura, 1994). In the PNS, PACAP and VIP

5

appear to play a major role in the autonomic regulation of the cardiovascular

system, and the neuropeptides have been immunocytochemically identified in

nerve fibers and cell bodies within the heart, coronary vessels and cardiac

parasympathetic ganglia (Della et al., 1983; Weihe et al., 1984; Seabrook et al.,

1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et al., 2000).

PACAP and VIP are extremely effective in dilating vascular beds,

including the coronary vessels that supply the heart (Fahrenkrug, 1993; Nillson,

1994). The vasodilatory effects of VIP on arteries are much greater than those

on veins because of the greater density of VIP receptors in arterial vessels (Luu

et al, 1993). Low concentrations of VIP can increase epicardial coronary artery

cross-sectional area by 27%, decrease coronary vascular resistance by 46%,

and increase coronary artery blood flow by 200% (Brum et al, 1986; Popma et al,

1990). PACAP has similar effects on coronary vasculature, except PACAP is

more efficacious than VIP as a vasodilator (Nillson, 1994). PACAP has also

been shown to modulate neuronal activity in canine intrinsic cardiac neurons in

situ and alter heart rate (Armour et al, 1993). These in situ experiments on

canine neurons suggest that not only do these neuropeptides enhance neuronal

activity, but also in some neurons, PACAP and VIP stimulation actually depress

neuronal activity. These neuropeptides have also been shown to increase sinus

rate and cardiac output (Karasawa et al, 1990; Poth et al, 1997; Sreedharan et

al, 1995), to initiate positive inotropic effects (Franco-Cereceda et al, 1987;

Henning et al, 2000), and to increase cardiac contractility (Henning, 1992). It is

6

our theory that this variability in response is the result of heterogeneity of

VIP/PACAP receptors in intracardiac ganglia.

PACAP and VIP receptors

The cellular effects of PACAP and VIP are mediated through G-protein

coupled receptors, and two main classes of PACAP and VIP receptors have

been categorized based on binding and in vitro functional data (Christophe,

1993; Shivers et al, 1991). The PAC1 receptors bind PACAP-27 and PACAP-38

with equal high affinity, but VIP with much lower affinity (Gourlet et al, 1995) (Fig

1.3). Thus, PAC1 receptors are known as PACAP-selective receptors. VIP

(VPAC1 and VPAC2) receptors recognize PACAP-27, PACAP-38 and VIP with

similar high affinity, and these are known as the non-selective VIP receptors.

At least seven isoforms of the PAC1 receptor exist due to alternative

splicing of the mRNA (PAC1-short, -very short, -HIP, -HOP1, -HOP2, -HIPHOP,

and TM4). Based on cloning experiments, the two major forms in mammals are

the normal (short) PACAP receptor and the -HOP1 PACAP receptor, which

contains a cassette insert in the third cytoplasmic loop (Spengler et al, 1993;

Svoboda, 1993). The original VPAC receptor was cloned from rat lung (Isihara et

al, 1992) and from human colon cells (Sreedharan et al, 1993). Presently known

as the VPAC1 receptor, this peptide may be considered the classical VIP

receptor described in lung, intestine, pancreas, and liver. A second VPAC

7

receptor was cloned from rat brain (Lutz et al, 1993) and was called the VPAC2

receptor. No splice variants of VPAC1 and VPAC2 are presently known to exist.

PACAP and VIP relevance to cardiac function

The intrinsic cardiac nerve plexus acts as much more than a simple relay

center for parasympathetic innervation to the heart. Rather, it functions as a

local integrative neural network capable of modulating extrinsic inputs to the

heart and in mediating local cardiac reflexes. The neuropeptides, PACAP and

VIP are important regulators of cell-to-cell signaling within the intracardial

ganglia, and PACAP and VIP action on these ganglia, mediated through the

associated receptors, play an important neuromodulatory role in the regulation of

coronary blood flow, cardiac contraction, relaxation, and heart rate. Even more

interesting are the possible roles these peptides play in different pathological

states. Despite many of the advances made in the research of PACAP and VIP

effects on the mammalian heart, the physiological and pathological roles of these

neuropeptides remain unclear and incomplete. The studies proposed here will

use novel approaches to give insight into the actions of PACAP and VIP in

intracardiac ganglia. Ultimately, this knowledge may contribute to the discovery

of new clinical tools used for diagnosing and treating diseased states such as

congestive heart failure (CHF), arrhythmias, hypertension and ischemic

conditions. The present study attempts to further the understanding of PACAP

and VIP regulation of intracardiac neurons. Considering this primary objective,

8

four specific aims were established: (1) Investigate whether individual rat

intracardiac ganglion neurons express the PAC1, VPAC1 and/or VPAC2 receptors

using the single-cell RT-PCR method. (2) Use whole-cell patch-clamp

techniques to determine both the passive and active membrane properties of

isolated intracardiac neurons in the absence and presence of PAC1, VPAC1

and/or VPAC2 stimulation. (3) Determine whether PACAP and/or VIP increase

[Ca2+]i in intracardiac neurons by using microfluorometric fura-2 Ca2+-imaging

techniques. (4) Characterize which Ca2+-activated ion channels are linked to

PACAP and/or VIP receptors.

The following chapters of this dissertation were written in manuscript form

and each chapter addresses a specific topic which relates to the aims of the

dissertation proposal.

9

FIGURE 1.1: Schematic representation of the connectivity among various

neurons involved in maintaining cardiac homeostasis. DRG, dorsal root ganglia;

MCG, middle cervical ganglia; SCG, superior cervical ganglia; ICG, intracardiac

ganglia; β1, adrenergic receptors; M1, muscarinic receptors (adapted from

Armour et al., 1998).

10

FIGURE 1.2: Morphologically distinct intrinsic cardiac neurons identified in vitro.

Unipolar (A), multipolar (B) and dipolar (C) neurons isolated from neonatal rat

intracardiac ganglia and cultured for 48 hr. Note that in addition to the difference

in the number of processes, the unipolar neuron (A) has a smaller soma than the

multipolar and dipolar neurons (B,C). (A) and (B) represent principle

parasympathetic neurons, whereas (C) is an interneuron. SIF cells, with an

average soma diameter of ~10 µm (Allen and Burnstock, 1987; Seabrook et al,

1990), are also observed in our preparation. Scale bars = 50 µm.

11

FIGURE 1.3: Schematic representation of the two neuropeptides, PACAP and

VIP, binding to their associated G-protein coupled PAC1, VPAC1 and VPAC2

receptors. While PACAP has similar affinities to both PAC1 and VPAC receptors,

VIP only binds to VPAC receptors with high affinity.

12

CHAPTER 2

HETEROGENEITY OF PACAP AND VIP RECEPTORS IN RAT INTRINSIC

CARDIAC NEURONS

INTRODUCTION

Mammalian intracardiac ganglia serve as integration centers for

parasympathetic, sympathetic and afferent signaling pathways in the heart

(Ardell, 1994). The structural complexity of the ganglia is complemented by a

neurochemical diversity that permits sophisticated processing of signals, and

ultimately allows proper control of cardiac function. While acetylcholine is the

primary parasympathetic neurotransmitter mediating intrinsic and extrinsic

innervation of the heart, other non-cholinergic, non-adrenergic neurotransmitters

have been found in cell bodies and nerve fibers within the ganglia (Weihe et al.,

1984; Rigel, 1998). These endogenous neurotransmitters often regulate

neuronal excitability, and thus facilitate the processing of information provided by

the diverse inputs. Two such neuromodulators are pituitary adenylate cyclase-

activating polypeptide (PACAP) and vasoactive intestinal polypeptide (VIP), both

of which have been identified by immunocytochemistry in nerve fibers innervating

13

the heart, coronary vasculature and cardiac parasympathetic ganglia (Della et al,

1983; Braas et al., 1998; Seabrook et al., 1990; Weihe et al., 1984). PACAP

and VIP have been shown to modulate neuronal activity in canine intrinsic

cardiac neurons in situ and alter heart rate (Armour et al., 1993). These

neuropeptides have also been shown to increase sinus rate, cardiac contractility

and cardiac output (Henning, 1992; Rigel, 1998; Karasawa et al., 1990; Ross-

Ascuitto et al., 1993), and to induce vasodilation in coronary arteries (Feliciano

and Henning, 1998; Ross-Ascuitto et al., 1993).

VIP and PACAP can directly affect cardiac muscle and coronary blood

vessels (Hirose et al., 1997; Warren et al., 1984); however, there appears to be a

significant neural component to the cardiovascular effects of these neuropeptides

(Hirose et al., 1997). The cellular mechanisms by which PACAP and VIP

modulate cell-to-cell signaling in intracardiac ganglia and cardiac function are

poorly understood. Furthermore, conflicting data exists as to the subtype(s) of

PACAP and VIP receptors present in mammalian intracardiac neurons and

cardiac muscle. For example, in the adult guinea pig intracardiac neurons, only

the PAC1 receptor has been detected (Braas et al., 1998). The PAC1 receptor is

selective for PACAP and binds VIP with low affinity (Gourlet et al., 1995).

However, electrophysiological experiments on neonatal rat intrinsic cardiac

neurons suggest the presence of VPAC1 and/or VPAC2 receptors, both of which

bind PACAP and VIP with similar high affinities (Cuevas and Adams, 1996;

Gourlet et al., 1995). The PACAP/VIP receptors in intracardiac neurons from

14

these two species also appear to couple distinct signal transduction cascades

and modulate different effector targets. We have previously shown that PACAP

and VIP potentiate ACh-evoked currents in neonatal rat intracardiac neurons

(Cuevas and Adams, 1996; Liu et al., 2000); whereas in guinea pig intracardiac

neurons, PACAP has been shown to modulate neuronal excitability and

depolarize the cells (Braas et al., 1998).

Some of these discrepancies may reflect the complex nature of the

receptors of the PACAP/VIP family. For example, seven isoforms of the PAC1

receptor have been reported (PAC1-very short, -short, -HOP1, -HOP2, -HIPHOP,

-HIP, and TM4). These splice variations have been shown to affect ligand

binding, as well as G-protein coupling and selectivity. It has also been suggested

that mammalian intracardiac ganglia express multiple PAC1 isoforms (Braas et

al., 1998), but it remains to be determined if these receptors are exclusively on

neurons or on support cells and what PACAP/VIP receptor types are expressed

by individual neurons. Identification of the receptor types involved in PACAP and

VIP neurotransmission is the first step in elucidating the signal transduction

cascade that ultimately results in neuromodulation in intracardiac ganglia and

regulation of cardiac function.

15

METHODS

Cell Culture

Receptor transcripts were investigated in isolated parasympathetic

neurons of the rat intracardiac ganglia. As previously described (Fieber and

Adams, 1991), rats were killed by decapitation and the heart was carefully

removed and placed in a physiological saline solution (PSS) containing (mM):

140 NaCl, 3 KCl, 2.5 CaCl2, 0.6 MgCl2, 7.7 glucose and 10 histidine; pH to 7.2

with HCl. Next, the atria was removed and incubated for 1 h at 37°C in saline

solution containing collagenase type 2 (1mg/ml; Worthington Biomedical Corp.,

Freehold, NJ, USA). After treatment with collagenase, clusters of ganglia were

dissected away from the remaining atrial tissue and transferred to a sterile

culture dish containing high-glucose culture media (Dulbecco’s Modified Eagle

Medium, DMEM), 10% (v/v) fetal calf serum, 100 U/ml penicillin and 0.1 mg/ml

streptomycin, and triturated using a fine-bore Pasteur pipette. The dissociated

neurons were finally plated onto poly-lysine (K) 18 mm glass coverslips and

incubated at 37°C for 36-72 h under a 95% air, 5% CO2 environment.

16

RT-PCR

The expression of PAC1, VPAC1, and VPAC2 receptors was studied in

cardiac tissues from neonatal rats (3-7 days old). Total RNA was isolated from

intracardiac ganglia and associated tissue, atria, ventricles and pituitary gland

(positive control) (RNeasy, Qiagen, Hilden, Germany). The RNA was reverse

transcribed and the resultant cDNA amplified using PCR techniques. PCR

products were resolved using agarose gel (1.5%) electrophoresis with ethidium

bromide as the label, and visualized using UV illumination. In all PCR

experiments from tissue extracts, RT-negative controls were conducted to

screen for contaminants. RNA was reverse-transcribed in a 20 µl reaction

volume using the SuperScript First-Strand Synthesis System for RT-PCR

(Invitrogen Co., San Diego, CA, USA). As a negative control, a PCR reaction

with only water was conducted to eliminate the possibility of false positives due

to contaminating cDNA. Primer pairs specific for PAC1, VPAC1 and VPAC2

receptor transcripts (Table 2.1) were designed to span an intron in order to

discriminate between genomic DNA and cDNA. PCR reactions were conducted

using the SuperScript System with Platinum Taq DNA polymerase (Invitrogen

Co.). The cycling parameters were one cycle of 94°C for 2 min; 30 cycles of

94°C for 30 s, 61°C for 45 s, and 72°C for 1 min; and one cycle of 72°C for 5

min.

17

Cytoplasm harvest of individual neurons

For single cell RT-PCR experiments, intracardiac neurons were

dissociated, and cytoplasm extracted from isolated neurons as previously

described (Poth et al., 1997). The intracellular contents of individual intracardiac

neurons were harvested by applying suction on a patch pipette in the dialyzing

whole-cell recording configuration. The pipettes were filled with 3 µL of 1X

Superscript One-Step RT-PCR Reaction Mix (Invitrogen Co.) containing 1 U/µL

RNAsin (Promega Co., Madison, WI, USA). After cytoplasm extraction, the

contents of the pipette were expelled into a microfuge tube and frozen on dry ice.

Immediately following extractions, single cell RT-PCR experiments were

conducted using Superscript One-Step RT-PCR with Platinum Taq (Invitrogen

Co.). Negative controls were obtained by suctioning extracellular solution near

the location of the harvested neuron into a separate boricillate pipette. This

control was carried out to exclude contamination with cytoplasm from nearby

cells or by contamination with VIP/PACAP receptor containing plasmids routinely

used in the laboratory. The cycling parameters were one cycle of 50°C for 30

min and 95°C for 2 min; 40 cycles of 94°C for 30 s, 61°C for 45 s, and 72°C for 1

min; and one cycle of 72°C for 5 min.

RT-PCR products were gel purified using a QIAEX II Gel Purification kit

(QIAGEN) and sequenced by the Molecular Biology Core Facility at the H. Lee

Moffitt Cancer Center and Research Institute.

18

RESULTS

PAC1 receptor mRNA isoforms detected in cardiac tissue

Experiments were conducted to determine the distribution of PAC1

receptor transcripts in cardiac tissue of neonatal rats. The tissues examined

were intracardiac ganglia and associated tissue (e.g. cardiac myocytes, Schwann

cells, vascular smooth muscle, endothelial cells, and fibroblasts), the auricles of

the atria, and the apex of the ventricles. Whole tissue RNA extracts were probed

for PAC1 receptor isoforms using the PAC1-1 and PAC1-2 oligonucleotide primers

(table 2.1), designed to differentiate between splice variations in the third

cytoplasmic loop, which is essential for G-protein interaction and influences G-

protein specificity, and the amino terminus of the PAC1 receptor (Fig 2.1A). RT-

PCR amplification of the extracts using PAC1-1 primers demonstrated that

multiple PAC1 receptor isoforms are expressed in intracardiac neurons and

associated tissues, atria and ventricles of neonatal rats (Fig 2.1B). Products of

the predicted sizes for PAC1-short and/or -very short, -HIP and/or -HOP, and -

HIPHOP were detected in all extracts.

The oligonucleotide primers (PAC1-1) designed to distinguish between

splice variations in the third cytoplasmic loop of the PAC1 receptor do not

19

discriminate between the PAC1-short or PAC1-very short variations. This splicing

occurs within the domains encoding the amino terminus of the receptor, and is

significant in ligand binding affinities. Therefore, PAC1-2 primers were developed

to amplify PAC1 cDNA associated with the extracellular, N-terminus (Fig 2.1A).

The resultant bands following RT-PCR suggest that neonatal rat cardiac tissues

only express the short sequence variant of the PAC1 receptor (Fig 2.1C).

PAC1 mRNA expression in isolated rat intracardiac neurons

The presence of PAC1 receptor transcripts in non-neuronal tissues of the

heart necessitated the use of single-cell PCR to determine if individual neurons

express PAC1 receptors and the specific isoform(s) present. Figure 2.2A shows

RT-PCR reaction results for five isolated neurons using the PAC1-1 primers.

Similar to the whole tissue samples, individual rat intracardiac neurons express

one or more splice variations in the region encoding the third cytoplasmic loop of

the PAC1 receptor. The amino terminus region was also investigated at the

single-neuron level to distinguish between short and very short transcript

presence within such neurons (Fig 2.2B). RT-PCR reaction results, following two

rounds of PCR, for two isolated neurons using the PAC1-2 oligonucleotide

primers indicate only the presence of the -short variant.

PCR products from both sets of primers were gel purified and cloned

using the pGEM-T Easy Vector System (Promega). As expected, sequences and

translation of the 493 bp size RT-PCR product (PAC1-2) from two individual

20

neurons aligned perfectly with the sequence of the PAC1-short (PAC1-s; Z23279).

None aligned with the PAC1-very short sequence (PAC1-vs). Sequences and

translation of the 303 bp size RT-PCR product (PAC1-1) from two individual

neurons also aligned with the sequence of the PAC1-short receptor, further

proving the presence of only PAC1-short splicing within the N-terminus of

neonatal rat intracardiac neurons. Sequences and translation of the 384/387 bp

size RT-PCR products (PAC1-1) from five individual neurons aligned with the

sequences for PAC1-short, PAC1-HOP1 (Z23274) and PAC1-HOP2 (Z23275).

Although experiments seemed to indicate the presence of -HIPHOP transcripts

(468/471 bp products) within these neurons and cardiac tissue, no PAC1-

HIPHOP sequences were elucidated. Thus, rat intracardiac neurons express

PAC1 transcripts lacking a cassette insert in the third cytoplasmic loop and

transcripts containing either the -HOP1 or -HOP2 cassette. No transcripts

containing the -HIP or -HIPHOP insert were detected. Single-cell RT-PCR

studies confirm that neonate rat intracardiac neurons only express PAC1-short

isoform.

VPAC1 and VPAC2 receptor transcripts detected in cardiac tissue

Related to the PAC1 receptor, the VIP (VPAC) receptor is also a member

of the secretin/glucagon receptor family. Two subtypes of the VIP receptors

(VPAC1 and VPAC2) have been cloned and sequenced, and there is fifty percent

homology between VPAC1 and VPAC2 (Rubino et al., 1996). Unlike the PAC1

21

receptor, VPAC1 and VPAC2 bind both PACAP and VIP with similar affinity

(Gourlet et al., 1995). Also, no splice variations of VPAC1 and VPAC2 are known

to exist. To investigate the presence of VPAC1 and VPAC2 receptor transcripts in

the intracardiac neurons of neonatal rats, specific oligonucleotide primers were

developed to amplify non-homologous regions of the receptor transcripts (Fig

2.3A,C). Whole tissue RNA extracts from the indicated tissues were reverse

transcribed and amplified via PCR using these primers. Both VPAC1 and VPAC2

transcripts were detected in cardiac associated tissues (Fig 2.3A,C). Among

these tissues, it was obvious that VPAC2 was the predominant messenger RNA

transcribed. Restriction digests of the resultant bands for both VPAC1 (Nde I)

and VPAC2 (Van91I) support the data that these receptor transcripts are present

in cardiac associated tissues (Fig 2.3B,D).

VPAC mRNA expression in isolated rat intracardiac neurons

To complete the investigation of VPAC1 and VPAC2 receptor transcripts,

neonatal rat intracardiac neurons were studied using single-cell RT-PCR. Figure

2.4A shows the reaction results for five isolated neurons using the VPAC1 F4R4

primers. RT-PCR reaction results for five isolated neurons using the VPAC2

F4R4 primers are shown in figure 2.4B. The two single-cell RT-PCR gels clearly

demonstrate that VPAC2 is the most abundant VIP receptor transcript within

these single neurons. Sequences of RT-PCR products from two individual

neurons identically matched with the sequence of the VPAC2 receptor (Z25885).

22

Unlike in the adult guinea pig, neonatal rat intracardiac neurons and/or

associated tissue do express the PACAP- and VIP- associated receptors VPAC1

and VPAC2, with VPAC2 being the predominant species. This supports previous

electrophysiological findings suggesting the presence of a receptor that binds

with high affinity to the ligand VIP (Liu et al., 2000).

Individual intracardiac neuron expression pattern of PAC1 and VPAC

mRNA

Splice variation of the neonatal rat PAC1 receptor was further scrutinized

by relating the data discovered in the two previous figures (Fig 2.5A,B,C). The

first bar graph depicts the percent of intracardiac neurons expressing the

indicated combinations of PAC1 receptor variants (Fig 2.5A). Neurons exhibit

three distinct expression patterns of PAC1 isoforms: 1)PAC1-short, 2)PAC1-HOP,

and 3)PAC1-short and PAC1-HOP. No PAC1-very short, PAC1-HIP, or PAC1-

HIPHOP transcripts were detected. The second bar graph indicates the percent

of neurons expressing either the PAC1-short or the PAC1-HOP (alone or with

other isoforms), and -HOP1 versus -HOP2 transcripts (cloned sequences) (Fig

2.5B). Of all of the neurons studied, the majority expressed the -HOP variant

and nearly half of the neurons expressed the short variant. Of the PAC1-HOP

isoforms, the HOP1 was expressed predominantly. The last bar graph depicts

the optical density of PAC1-HOP1 and PAC1-short receptor transcripts in cells

expressing both sequence variants (Fig 2.5C). Optical density of individual

23

bands was determined using a GS 700 Imaging Densitometer (BIO-RAD) and

Multi-Analyst (BIO-RAD) software. Figure 2.5C shows that in neurons which

expressed both PAC1-HOP and PAC1-short transcripts, PAC1-HOP1 was the

predominant species. Thus, three distinct expression patterns of PAC1 receptor

isoforms were observed in isolated intracardiac neurons. The PAC1-HOP1

receptor isoform is the most common sequence variant present in rat intracardiac

neurons and is expressed at higher levels than the PAC1-short variant.

24

TABLE 2.1: Table showing the sequence of oligonucleotide primers used in this study and the predicted size for

the individual products. a All PAC1 splice variants containing a cassette insert in the third cytoplasmic loop (PAC1-

HIP, -HOP, and –HIPHOP) have the short insert in the amino terminus region, and thus their RT-PCR products will

be indistinguishable from the PAC1-short when the PAC1-2 primers are used.

25

Receptor Primer Sequence (5’ to 3’) Variant Size (bp)

Very short 303

Short 303

HIP 387

FWD: CTTGTACAGAAGCTGCAGTCCCCAGACATG

HOP1 387

HOP2 384

HIPHOP1 471

PAC1-1

REV: CCCGTGCTTGAAGTCCATAGTGAAGTAACGGTTCACCTT

HIPHOP2 468

FWD: TGTAAGCTGCCCTGAGGTCT Very short 430

PAC1

PAC1-2 REV: CACCACGCAGTAGTGGAAGA Shorta 493

FWD: TCTTCAACAGCGGGGAGATAGACCACTGC VPAC1 VPAC1-1

REV: GAAACCCTGGAAAGAGCCCACGACAAGTTC

__ 554

FWD: ATCCTTCCTCCCAGCAGGTGTTTCC VPAC2 VPAC2-1

REV: GTATCTGTAGGGCGCTTTCTGAGCCATTCC

__ 565

26

FIGURE 2.1: Expression of PAC1 receptor isoforms in cardiac tissue. (A)

Schematic representation of the PAC1 receptor indicating the regions amplified

by the PAC1-1 and PAC1-2 primer pairs. The locations of the cassette inserts

that contribute to the different PAC1 isoforms are also shown. RT-PCR results

for RNA extracts from the indicated tissues using the primers PAC1-1 (B) and

PAC1-2 (C). STDS, 100 bp ladder standards; PIT, pituitary gland; IC, intracardiac

ganglia; VENT, ventricles. Arrows indicate predicted sizes for different splice

variants of the PAC1 receptor. *See note in Table 2.1.

27

FIGURE 2.2: Detection of PAC1 receptor isoforms in single intracardiac neurons.

(A) RT-PCR results obtained from individual intracardiac neurons using the

PAC1-1 (A) and PAC1-2 (B) primers. Arrows indicate the predicted sizes for

different splice variants of the PAC1 receptor (see Table 2.1); STDS, 100 bp

ladder standards.

28

FIGURE 2.3: Expression of VPAC1 and VPAC2 receptor isoforms in cardiac

tissue. Schematic representations of the VPAC1 and VPAC2 receptors indicating

the regions amplified by the VPAC1 F4R4 primers (A) and VPAC2 F4R4 primers

(C), as well as RT-PCR results for RNA extracts from the indicated tissues using

these oligonucleotide primer sets, respectively. Restriction digests of the

resultant bands for VPAC1 (Nde I) (B) and VPAC2 (Van91I) (D), supporting the

data that these receptor transcripts are present in cardiac associated tissues.

Arrows indicate the predicted sizes for VPAC1 and VPAC2 (see Table 2.1).

29

FIGURE 2.4: Detection of VPAC receptor transcripts in single intracardiac

neurons. RT-PCR results obtained from individual intracardiac neurons using the

VPAC1 F4R4 (A) and VPAC2 F4R4 (B) oligonucleotide primers. Arrows indicate

the predicted sizes for VPAC1 and VPAC2 (see Table 2.1). (C) Sequences of the

565 bp size RT-PCR product from two individual neurons aligned with the

sequence of the VPAC2 receptor (GI: 414188). PCR products were gel purified

(Qiagen) and cloned using the pGEM-T Easy Vector System (Promega).

30

FIGURE 2.5: Expression pattern of PAC1 isoforms and VPAC transcripts in

intrinsic cardiac neurons. (A) Comparison of the number of cells expressing

either PAC1-short, -HOP1 or –HOP2 transcripts (n = 34), VPAC1 (n = 32) or

VPAC2 (n = 30). (B) Percentage of intracardiac neurons expressing the indicated

combinations of PAC1 receptor variants (n = 28). (C) Optical density of the

PAC1-short and PAC1-HOP1 receptor transcripts in cells expressing both

sequence variants (n = 10). Asterisk denotes significant difference (p < 0.05).

31

DISCUSSION

PACAP and VIP peptides have a wide range of neuromodulatory roles in

the peripheral nervous system, potentially through the receptors PAC1, VPAC1,

or VPAC2. Expression of all three receptors within intracardial neurons was

investigated using RT-PCR. Initially, whole tissue RNA extracts of cardiac

associated tissue were reverse transcribed, and the resultant cDNA was

amplified using specific primers for each of the three receptors. But because the

primary interest was intracardiac neurons, further examination needed to be

completed to prove that these receptor transcripts are present in these neurons.

Therefore, single-cell RT-PCR was initiated to verify PAC1, VPAC1, and VPAC2

transcripts within the intracardiac neurons.

We conclude that over 90% of rat intracardiac ganglion neurons express

transcripts encoding the PACAP selective receptor PAC1. This finding is

consistent with electrophysiological experiments previously conducted.

Individual neurons express one or more isoforms of the PAC1 receptor. The

sequence variations occur in the domain encoding the third cytoplasmic loop,

which is responsible for G-protein regulation, selectivity and coupling. Neurons

exhibit three distinct expression patterns of PAC1 isoforms: 1)PAC1-short,

32

2)PAC1-HOP, and 3)PAC1-short and PAC1-HOP. No PAC1-very short, PAC1-

HIP, or PAC1-HIPHOP transcripts were detected. Rat intracardiac neurons

primarily express the PAC1-HOP1 receptor isoform, in contrast to guinea pig

intracardiac neurons where the PAC1-very short is the most abundant sequence

variant. In addition to PAC1, intracardiac neurons express VPAC1 and VPAC2

transcripts, with the latter being found in greater proportion of the neurons. This

observation is consistent with the cellular effects of VIP in intracardiac neurons.

The relationship between these receptors, signal transduction and down stream

effector targets remain to be determined.

33

CHAPTER 3

VPAC RECEPTOR MODULATION OF NEUROEXCITABILITY IN

INTRACARDIAC NEURONS: DEPENDENCE ON INTRACELLULAR CALCIUM

MOBILIZATION AND SYNERGISTIC ENHANCEMENT BY PAC1 RECEPTOR

ACTIVATION

INTRODUCTION

Pituitary adenylate-cyclase activating polypeptide (PACAP) and

vasoactive intestinal polypeptide (VIP) are pleiotropic neuropeptides that belong

to the glucagon/secretin/growth hormone-releasing factor family of peptides

(Warren et al., 1991; Ishizuka et al., 1992; Basler et al., 1995; Cardell et al.,

1997). These neuropeptides have pronounced effects on the central nervous

system, as well as on neurons and effector targets of the autonomic nervous

system. For example, in the central nervous system, PACAP has been shown to

be involved in hippocampal synaptic plasticity and associative learning in mice

(Hashimoto et al., 2002), while VIP has been shown to regulate intrathalamic

rhythm activity and may modulate information transfer through the

thalamocortical circuit (Lee and Cox, 2003). In the peripheral nervous system,

PACAP and VIP appear to play a major role in autonomic regulation of the

cardiovascular system. VIP has been shown to cause positive chronotropic and

34

inotropic effects (Rigel et al., 1989; Karasawa et al., 1990; Yonezawa et al.,

1996). In contrast, PACAP has been shown to cause a transient increase in

sinus rate and atrial contractility that is followed by negative chronotropic and

inotropic responses in isolated canine atria (Hirose et al., 1997). Also, both

PACAP and VIP are potent dilators of coronary arteries (Huang et al., 1993;

Kawasaki et al., 1997). While these neuropeptides can directly influence cardiac

tissues, the effects of PACAP and VIP on the heart are in part due to

neuroregulatory effects on parasympathetic intracardiac ganglia (Yonezawa et

al., 1996; Hirose et al., 1997; Seebeck et al., 1996; Armour et al., 1993).

Mammalian intracardiac ganglia play a major role in neuronal control of

the heart and are believed to be capable of independently monitoring and

influencing cardiac function. A variety of neurotransmitters and neuromodulators,

including PACAP and VIP, appear to be involved in the relaying of information

within intracardiac ganglia and onto effector targets such as cardiac valves,

coronary arteries and cardiomyocytes. PACAP and VIP have been detected by

immunocytochemistry in nerve fibers in the heart, coronary vasculature and

cardiac parasympathetic ganglia (Della et al., 1983; Weihe et al., 1984; Seabrook

et al., 1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et al., 2000).

Although extrinsic fibers may be one source of these neuropeptides in the heart

(Calupca et al., 2000), PACAP and VIP are also found in cell bodies and nerve

fibers of intrinsic cardiac neurons (Della et al., 1983; Weihe et al., 1984;

Seabrook et al., 1990; Gulbenkian et al., 1993; Braas et al., 1998; Horackova et

35

al., 2000). Despite the fact that data clearly demonstrate that these endogenous

neuropeptides are potent regulators of the cardiovascular system, the cellular

mechanisms mediating their effects remain poorly understood. There are also

conflicting reports in the literature concerning the mechanisms by which PACAP

and VIP regulate the function of intrinsic cardiac neurons. For example, it has

been suggested that PACAP and VIP modulate neurotransmission in rat cardiac

ganglia by potentiating nicotinic acetylcholine receptors (Cuevas and Adams,

1996; Liu et al., 2000), whereas studies on guinea pig intracardiac neurons

indicate that PACAP, but not VIP, regulates the excitability of intrinsic cardiac

neurons, possibly by influencing the K+ conductance, IA (Miura, A. et al., 2001;

Braas et al., 1998).

PACAP and VIP evoke their effects via the activation of specific G-protein

coupled receptors (Christophe, 1993; Shivers et al., 1991). The PAC1, or

PACAP-selective receptors, bind both active forms of PACAP, PACAP-27 and

PACAP-38, with equally high affinities, but VIP with much lower affinity (Gourlet,

et al., 1995); whereas, non-selective VPAC (VPAC1 and VPAC2) receptors

recognize PACAP-27, PACAP-38 and VIP with similar high affinities (Gottschall

et al., 1990; Gottschall et al, 1991; Cauvin et al., 1990; Cauvin et al, 1991; Lam

et al., 1990; Robberecht et al., 1992; Suda et al., 1992). At least seven isoforms

of the PAC1 receptor exist due to alternative splicing of the mRNA, while no

splice variants of VPAC1 or VPAC2 are presently known to exist. These different

PAC1 isoforms and VPAC receptor types are known to couple to distinct second

36

messenger pathways (Spengler et al., 1993; Pantaloni et al., 1996; Chatterjee et

al., 1996). Rat intrinsic cardiac neurons express several isoforms of the PAC1

(PAC1-short, PAC1-HOP1, PAC1-HOP2), as well as both VPAC receptors

(DeHaven and Cuevas, 2002).

The functional consequences of the PAC1/VPAC receptor heterogeneity, which is

also observed in other neuron types, such as mammalian cortical neurons,

remain to be fully elucidated. The present study examined the ability of PACAP

and VIP to regulate the electrical properties of intrinsic cardiac neurons from

neonatal rats, and to modulate [Ca2+]i in these cells. Both PACAP and VIP

depolarize intracardiac neurons and increase [Ca2+]i by evoking Ca2+ release

from ryanodine-sensitive intracellular stores and promoting Ca2+ entry through

the plasma membrane. PACAP, but not VIP, also increased the number of

action potentials fired by neurons in response to depolarizing current pulses.

The changes in neuroexcitability evoked by PACAP and VIP were blocked by

inhibiting the [Ca2+]i elevations produced by the neuropeptides.

37

METHODS

Membrane currents and [Ca2+]i were investigated in isolated intracardiac

ganglion neurons of neonatal rats (4-7 days old). The preparation and culture of

isolated intrinsic cardiac neurons has been previously described (Fieber and

Adams, 1991). Dissociated neurons were plated onto poly-L-lysine coated glass

coverslips and incubated at 37°C for 36-72 h under a 95% air, 5% CO2

environment prior to the experiments.

Microfluorometric measurements

The calcium sensitive dye fura-2 acetoxymethylester (fura-2-AM) was

used for measuring intracellular free calcium concentrations ([Ca2+]i) in

intracardiac neurons at room temperature, as previously described (Smith and

Adams, 1999). Cells plated on coverslips were then incubated for 1 hour at room

temperature in physiological saline solution (PSS) consisting of (in mM): 140

NaCl, 3 KCl, 2.5 CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with

NaOH), which also contained 1 µM fura-2-AM and 0.1 % dimethyl sulfoxide

(DMSO). The coverslips were then washed in PSS (fura-2-AM free) prior to the

38

experiments being carried out. All solutions were applied via a rapid application

system identical to that previously described (Cuevas and Berg, 1998).

A Sutter DG-4 high-speed wavelength switcher (Sutter Instruments Co.,

Novato, CA) was used to apply alternating excitation with 340 nM and 380 nM

ultraviolet light. Fluorescent emission at 510 nm was captured using a Cooke

Sensicam digital CCD camera (Cooke Corporation, Auburn Hills, MI) and

recorded with Slidebook 3.0 software (Intelligent Imaging Innovations, Denver,

CO) on a Pentium IV computer. Changes in [Ca2+]i were calculated using the

Slidebook software (Intelligent Imaging Innovations, Denver, CO) from the

intensity of the emitted fluorescence following excitation with 340 and 380 nm

light, respectively, using the equation:

[Ca2+]i = Kd Q (R-Rmin)/(Rmax-R)

where R represents the fluorescence intensity ratio (F340/F380) as determined

during experiments, Q is the ratio of Fmin to Fmax at 380 nm, and Kd is the Ca2+

dissociation constant for fura-2. Calibration of the system was performed using

the Molecular Probes (Eugene, OR) Fura-2 Calcium Imaging Calibration Kit and

values were determined to be: Fmin/Fmax (23.04), Rmin (0.31), Rmax (8.87).

Electrophysiology

Coverslips plated with the dissociated neurons were transferred to a 0.5

ml recording chamber mounted on a phase-contrast microscope (400X). The

extracellular recording solution was identical to the Ca2+ imaging PSS. The Ca2+-

39

free PSS contained no CaCl2 and included 1 mM ethylene glycol-bis(2-

aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA). All drugs were bath applied

in PSS. In some electrophysiological and Ca2+ imaging experiments the order of

drug administration was reversed, that is PACAP was given in the presence of

other drugs (or in Ca2+-free media) prior to being given alone as a control. This

alteration in the protocol was done to ensure that any change in response was

not due to rundown. Currents were amplified and filtered (5 kHz) using an

Axoclamp-200B Amplifier, digitized with a 1322A DigiData digitizer (20kHz), and

collected on a Pentium IV computer using the Clampex 8 program (Axon

Instruments, Inc., Foster City, CA, USA). Data analysis was conducted using the

pClamp 8 program, Clampfit.

The whole-cell perforated-patch variation of the patch-clamp recording

technique was used as previously described (Rae et al., 1991; Xu and Adams,

1992). This configuration preserves intracellular integrity, preventing the loss of

cytoplasmic components and subsequent alteration of functional responses of

these neurons (Cuevas and Adams, 1996; Cuevas et al., 1997). The pipette

solution contained (mM): 75 K2SO4, 55 KCl, 5 MgSO4, 10 HEPES, 198 µg/ml

amphotericin B, and 0.4% DMSO. All electrophysiological recordings were

performed at room temperature.

Membrane potential responses to hyperpolarizing and depolarizing current

pulses (-100 pA to +200 pA) were determined in the absence and presence of

VIP/PACAP receptor ligands. The mean resting membrane potential, latency for

40

action potential firing, action potential duration, amplitude of

afterhyperpolarization and the number of action potentials elicited by depolarizing

current pulses were determined in the absence and presence of PAC1 and VPAC

receptor ligands. Membrane input resistance was also determined as described

previously (Xu and Adams, 1992).

Reagents and statistical analysis

All chemicals used in this investigation were of analytic grade. The

following drugs were used: amphotericin B, DMSO, mecamylamine, caffeine, 2-

aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich, St. Louis, MO); PACAP-27,

PACAP-38, L-8-K (VIP receptor binding inhibitor), [N-Ac-Tyr1, D-Phe2]-GRF (1-

29) and VIP (American Peptide Co., Sunnyvale, CA); tetrodotoxin (TTX),

ryanodine, thapsigargin and forskolin (Alomone Labs, Jerusalem, Israel); barium

chloride (Fisher Scientific, Hampton, NH2), and fura-2-AM (Molecular Probes,

Eugene, OR). Recombinant maxadilan and M65 were generous gifts from E. A.

Lerner (Massachusetts General Hospital, Harvard Medical School). All data are

presented as the mean ± SEM of the number of observations indicated.

Statistical analysis was conducted using SigmaPlot 8 (SPSS, Chicago, IL) and

paired and unpaired t-tests were used for within group and between group

comparisons, respectively.

41

RESULTS

PACAP and VIP directly increase free [Ca2+]i

The most abundant PAC1 receptor isoform expressed in neonatal rat

intrinsic cardiac neurons, PAC1-HOP, has been shown to elicit elevations in

intracellular calcium in cortical neurons (Grimaldi and Cavallaro, 2000).

However, the relationship between PACAP and intracellular calcium has not

been investigated in the autonomic neurons. The effect of PACAP on Ca2+

handling in intracardiac neurons was studied using fura-2 Ca2+-imaging

techniques. Figure 3.1A shows a representative trace of change in [Ca2+]i

(∆[Ca2+]i) as a function of time recorded from a neuron before, during and

following 2 minute application of 100 nM PACAP-27 (black trace). Intracellular

Ca2+ concentrations increased by >400 nM when PACAP-27 was applied, and

returned to near control levels upon washout of drug. In similar experiments

PACAP-27 significantly increased intracellular calcium by ~400%, from a

baseline of 65.3 ± 5.5 nM to a peak value of 335.1 ± 65.4 nM (n=23) (Fig 3.1B).

In all cells responding to PACAP, the elevations in [Ca2+]i were reversed when

PACAP was removed from the bath, and subsequent applications of PACAP to

the same cell produced [Ca2+]i increases of similar magnitude.

42

In a series of experiments, the PAC1 receptor-selective agonist,

maxadilan, and VPAC receptor-selective agonist, VIP, were used to determine if

the PACAP-induced elevations in [Ca2+]i are mediated exclusively by activation

of PAC1 receptors, or if VPAC receptors contribute to this phenomenon. Figure

3.1A also shows representative traces of change in [Ca2+]i recorded from two

neurons as a function of time before, during and following 2 minute application of

maxadilan (10 nM, dotted trace) and VIP (100 nM, gray trace), respectively.

Maxadilan, at a concentration (10 nM) specific for PAC1 (Moro and Lerner, 1997),

failed to elicit a change in [Ca2+]i. In contrast, VIP, at a concentration (100 nM)

that preferentially activates VPAC receptors (Gourlet et al., 1995), reversibly

increased [Ca2+]i by > 225 nM in this neuron. In 14 similar experiments 100 nM

VIP significantly increased mean peak [Ca2+]i by more than 225%, from 73.2 ±

12.1 nM to 239.1 ± 27.4 nM, which is an increase comparable to that observed

when PACAP-27 was used as the agonist (Fig 3.1B). Maxadilan (10 nM-100

nM), however, did not elicit any detectable changes in [Ca2+]i in any of the cells

tested (Fig 3.1B; n = 7), which suggests that the PAC1 receptor is not responsible

for the PACAP-induced increases in [Ca2+]i observed in these cells.

Increases in free [Ca2+]i evoked by PACAP and VIP are mediated by a VPAC

receptor

To confirm that activation of VPAC receptors is responsible for the

PACAP-induced elevations in [Ca2+]i, the PAC1 receptor-specific antagonist M65,

43

and VPAC receptor-specific antagonists L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (1-

29), were used. Figure 3.2 shows representative traces of change in [Ca2+]i as a

function of time during application of 100 nM PACAP-27 alone (black traces Fig

3.2A-C) or when the neuropeptide was co-applied with 100 nM M65 (Fig 3.2A,

gray trace), 5 µM L-8-K (Fig 3.2B, gray trace) or 100 nM [N-Ac-Tyr1, D-Phe2]-

GRF (1-29) (YF-GRF) (Fig 3.2C, gray trace). Only the VPAC receptor

antagonists were shown to block the effects of PACAP on [Ca2+]i. A bar graph of

results obtained in similar experiments is shown in Figure 3.2D, and reveals that

application of either L-8-K (n = 9) or [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (YF-GRF, n

= 5) significantly attenuated PACAP-evoked elevations in [Ca2+]i in isolated

intracardiac neurons, while M65 (n = 5) had no effects on the neuropeptide-

induced changes in [Ca2+]i. These data further support the conclusion that the

PACAP and VIP evoked increases in [Ca2+]i are mediated by VPAC receptors

and not PAC1 receptors in these cells.

PACAP and VIP are known to modulate nicotinic acetylcholine receptors

(nAChRs) in intrinsic cardiac neurons (Liu et al., 2000). This raises the possibility

that the observed PACAP- and VIP-induced elevations in [Ca2+]i may be due to

regulation of presynaptic or postsynaptic nAChRs by the neuropeptides. Thus, to

verify that the effect of exogenously applied PACAP and VIP on [Ca2+]i are not

indirectly caused by nAChR modulation, the Na+ channel blocker TTX (400 nM)

and ganglionic nAChR blocker mecamylamine (25 µM) and were used to block

nicotinic neurotransmission pre- and post-synaptically, respectively. Neither the

44

application of TTX (n=4) nor mecamylamine (n=3) prevented the PACAP-induced

rise in [Ca2+]i in rat intracardiac neurons (data not shown). The application of

PACAP-27 (100 nM) in the presence of TTX significantly (p<0.01) elevated

[Ca2+]i from 107.1 ± 13.8 nM to 286.8 ± 25.1 nM, values comparable to the

calcium elevations seen in the absence of TTX. Similarly, PACAP-27 increase in

[Ca2+]i was unaffected by the application of mecamylamine (65.4 ± 9.5 nM to

236.6 ± 31.2 nM ), a 265% increase in intracellular calcium (data not shown).

These results suggest that the observed PACAP-induced rise in [Ca2+]i is not

dependent on neurotransmission.

PACAP and VIP mobilize Ca2+ from intracellular stores and evoke Ca2+ entry

through the plasma membrane.

PAC1 and VPAC receptors have been linked to both Ca2+ entry through

the plasma membrane via the activation of L-type calcium channels (Chatterjee

et al., 1996; Tanaka et al., 1998) and Ca2+ release from intracellular stores

(MacKenzie et al., 2001). Experiments were conducted to determine the source

of Ca2+ responsible for the VPAC mediated increase in [Ca2+]i. Application of

PACAP-27 produced an increase in [Ca2+]i that exhibited both a transient and a

sustained component (Fig 3.3A, black trace). Similar results were observed

when VIP was used as the agonist (data not shown). However, when PACAP

was applied in Ca2+-free PSS, the initial transient increase in [Ca2+]i was

observed, but the sustained component was abolished (Fig 3.3A, gray trace).

45

Figure 3.3B shows a bar graph of mean peak and sustained [Ca2+]i recorded

under normal and Ca2+-free conditions from 12 isolated intracardiac neurons.

Even though the magnitude of the transient peak [Ca2+]i remained unchanged

(normal PSS: 179.2 ± 17.6 nM; Ca2+-free PSS: 173.4 ± 17.8 nM), the sustained

component significantly decreased from 103.6 ± 11.5 nM to 45.7 ± 6.7 nM

following removal of extracellular Ca2+. This latter [Ca2+]i value was equivalent to

control baseline [Ca2+]i. Thus, the sustained component is dependent on

extracellular Ca2+ and is likely due to Ca2+ flux through the plasmalemma.

The presence of a PACAP-induced transient elevation in [Ca2+]i in the

absence of extracellular calcium suggested that activation of VPAC receptors

mobilized Ca2+ from intracellular stores in these neurons. In order to test this

hypothesis, we used the endoplasmic reticulum (ER) Ca2+-ATPase inhibitor,

thapsigargin, which specifically blocks Ca2+ reuptake leading to depletion of the

ER Ca2+ stores (Lytton et al., 1991). Prior to the experiments, dissociated

intracardiac neurons were incubated for 1 hr in 20 µM thapsigargin (in PSS, 37

°C). Experiments were then conducted to determine if PACAP increased [Ca2+]i

under these conditions. Untreated neurons collected from either the same

neonatal rat or animals from the same litter were used as a positive control to

determine if the neurons responded to PACAP. Figure 3.3C shows traces of

change in [Ca2+]i recorded from two neurons preincubated in 20 µM thapsigargin

and exposed to either 100 nM PACAP-27 or 500 µM acetylcholine (ACh).

PACAP failed to elicit a change in [Ca2+]i in these neurons, but ACh, which

46

promotes Ca2+ entry via plasma membrane nicotinic acetylcholine receptors in

intracardiac neurons (Beker et al., 2003), produced a pronounced transient

elevation in [Ca2+]i. In similar experiments, thapsigargin-pretreatment

significantly decreased the peak PACAP response from 370.3 ± 40.9 nM to 105.0

± 8.3 nM (n = 6; Fig 3.3D), with the latter value being indistinguishable from the

baseline [Ca2+]i measured in this group of cells (104.4 ± 16.5 nM). In contrast,

thapsigargin preincubation had no effect on the peak [Ca2+]i elevations produced

by rapid focal application of 500 µM ACh (Fig 3.3D). Thapsigargin also

eliminated the rise in [Ca2+]i elicited by bath application of 5 mM caffeine (Fig

3.3D), which has been shown to evoke release of Ca2+ from intracellular stores in

these cells (Beker et al., 2003). Therefore, depleting intracellular Ca2+ stores via

thapsigargin pretreatment abolished both the transient and sustained PACAP-

induced changes in [Ca2+]i.

PACAP induces mobilization of [Ca2+]i from caffeine- and ryanodine-

sensitive stores

Previous studies have demonstrated that rat intrinsic cardiac neurons

have two distinct ER Ca2+ stores, one that is sensitive to inositol 1,4,5-

trisphosphate (IP3) and a second that is sensitive to ryanodine and caffeine

(Smith and Adams, 1999; Beker et al., 2003). The PACAP/VIP receptors have

been shown to mobilize Ca2+ from both IP3- and ryanodine/caffeine-sensitive

stores in other cell types (Grimaldi and Cavallaro, 2000; Tanaka et al., 1998). To

47

determine if PACAP evokes release of Ca2+ from ryanodine/caffeine-sensitive

stores we used two approaches: 1) depleting the ryanodine/caffeine-sensitive

stores of Ca2+ by bath applying 5 mM caffeine and 2) blocking the release of Ca2+

from these stores by bath applying 10 µM ryanodine. Figure 3.4 shows

representative traces of change in [Ca2+]i in response to 5 mM caffeine (Fig 3.4A)

or 10 µM ryanodine (Fig 3.4C) recorded from two neurons (gray traces), and to

PACAP-27 (100 nM) in the absence (black traces) and presence (dotted traces)

of these drugs (Figs 3.4A and 3.4C, respectively). Both the transient and

sustained PACAP-evoked elevations in [Ca2+]i were suppressed by pretreatment

with caffeine or ryanodine. In 6 identical experiments, caffeine significantly

decreased peak ∆[Ca2+]i increase from 139.3 ± 32.5 nM to 21.3 ± 4.6 nM (Fig

3.4B). Similarly, ryanodine depressed the peak elevation in ∆[Ca2+]i from 162.2 ±

27.0 nM to 32.7 ± 10.9 nM (Fig 3.4D). The initial application of caffeine produced

an increase in [Ca2+]i (236.8 ± 34.1 nM) similar to that elicited by PACAP, but,

unlike PACAP, was often associated with Ca2+ oscillations (see Fig 3.4A).

Ryanodine, however, did not promote calcium release in any of the cells tested,

which is consistent with the drug acting as an inhibitor of the ryanodine receptor

at this concentration (Chu et al., 1990).

Our experiments with ryanodine, however, cannot rule out the possibility

that neuropeptide-stimulated IP3 production evokes small, local changes in

[Ca2+]i that initiate the release of Ca2+ from the caffeine/ryanodine stores. The

IP3-receptor antagonist 2-APB (Maruyama et al., 1997) was used to determine if

48

IP3-mediated Ca2+-induced-Ca2+ release is responsible for the transient elevation

in [Ca2+]i observed following VPAC receptor stimulation. Figure 3.5A shows

[Ca2+]i traces elicited by focal application of PACAP in intracardiac neurons in the

absence and presence of 2-APB (50 µM). 2-APB does not block the transient

elevation in [Ca2+]i produced by either PACAP or caffeine (Fig 3.5B). In contrast,

2-APB attenuated the increase in [Ca2+]i evoked by bath application of muscarine

(5 µM, Fig 3.5C), which is primarily due to release of Ca2+ from IP3-sensitive

stores (Beker et al., 2003). Figure 3.5D shows a bar graph of the mean peak

increase in [Ca2+]i evoked by PACAP, caffeine and muscarine in the absence and

presence of 2-APB. Whereas 2-APB significantly depressed the peak increases

in [Ca2+]i evoked by muscarine from 107 ± 25 nM to 31 ± 8 nM, it had no effect

on those elicited by PACAP or caffeine.

Whereas the transient component of the PACAP-induced elevation in

[Ca2+]i was unaffected by 2-APB, the sustained component was depressed in the

presence of the drug (Fig 3.5A). In 6 identical experiments the PACAP-induced

sustained increase in [Ca2+]i decreased from 66 ± 7 nM to 30 ± 6 nM (Fig 3.5E).

Similarly, the sustained elevations in [Ca2+]i observed following application of

caffeine or muscarine were also attenuated by 2-ABP (Figs 3.5E). At the

concentration used here (50 µM), 2-APB also directly blocks several subtypes of

transient receptor potential (TRP) ion channels (Clapham et al., 2001).

Therefore, these data suggest that capacitative Ca2+ entry through transient

49

receptor potential channels contributes to the sustained elevation in [Ca2+]i

evoked by VPAC receptor activation.

PACAP and VIP Induced Excitability in Rat Intracardiac Neurons

Earlier studies in intracardiac neurons from adult guinea pigs suggest that

PACAP, but not VIP, modulates neuroexcitability in these cells (Braas et al.,

1998). However, no such changes have been reported in neonatal rat

intracardiac neurons (Cuevas and Adams, 1996; Liu et al., 2000). Data suggest

that intracardiac neurons of these two species express different PACAP and VIP

receptor subtypes (Braas et al., 1998; DeHaven and Cuevas, 2002), and thus the

neuropeptides may have distinct cellular effects. For example, in contrast to

observations reported here, application of PACAP has not been shown to effect

[Ca2+]i in guinea pig intracardiac neurons. Thus, it seemed prudent to further

investigate the effect of PACAP and VIP on the electrical properties of rat

intrinsic cardiac neurons. Figure 3.6A shows a family of representative voltage

responses elicited by 500 ms, 150 pA depolarizing current pulses from an

isolated intracardiac neuron held under current-clamp mode using the whole-cell

perforated patch method. Membrane responses were recorded in the absence

(Control) and presence of bath applied PACAP-27 (100 nM), and following

washout of the neuropeptide (Wash). Application of PACAP depolarized the

neuron and increased the number of action potentials elicited by the current

pulse. The PACAP evoked membrane depolarization was observed in a majority

50

of the cells tested (54 of 73 cells) (Fig 3.6B). The resting membrane potential

(RMP) measured in intracardiac neurons was -52.0 ± 0.6 mV under control

conditions and depolarized to -47.7 ± 0.7 mV in the presence of PACAP-27. The

effect of PACAP on the RMP of these neurons was reversible upon washout of

drug (-51.3 ± 0.6). This difference was statistically significant (p < 0.01).

In most neurons tested the depolarizing current pulses evoked short,

adapting trains of action potentials (46 of 73 neurons), whereas 15 neurons fired

single action potentials and 12 neurons exhibited tonic firing when challenged

with similar current pulses. In a population of neurons (42 of 73), the number of

action potentials elicited was increased by 115%, from 3.2 ± 0.3 to 6.9 ± 0.5, by

100 nM PACAP-27 (Fig 3.6C). Following a 15 minute washout of the

neuropeptide, the number of action potentials induced by the current pulses

returned to near control levels (3.9 ± 0.5). The increase in action potentials

observed in the presence of PACAP was statistically significant when compared

to either control or washout. The population of neurons exhibiting augmented

action potential firing included phasic, adapting and tonic neurons. Thus, the

effect of PACAP was not associated with a cell type with distinct active

membrane properties. Examining the action potential characteristics of neurons

that showed increased firing revealed that PACAP significantly decreased the

action potential latency period from 6.0 ± 0.7 ms to 4.7 ± 0.5 ms (n = 7; p < 0.01)

and increased the afterhyperpolarization from -13.3 ± 6.1 mV to -21.4 ± 6 mV (n

= 7; p < 0.05). However, other parameters including action potential duration and

51

overshoot were not altered (data not shown). It is important to note that the

membrane depolarization and increase in action potential firing were not

correlated, and only 30 of 73 cells showed both a depolarization and increased

action potential firing. This observation suggests that two distinct mechanisms

are mediating these membrane responses.

The effects of PACAP were in part mimicked by the related neuropeptide,

VIP (Fig 3.7). Bath application of VIP depolarized a population of neurons (8 of

13) from -47.3 ± 1.7 to -44.5 ± 1.5 (Fig 3.7B). This depolarization was of lesser

magnitude than the PACAP-induced depolarization, but was statistically

significant, and reversed upon washout of the peptide (-45.9 ± 1.6). VIP affected

a population of neurons similar to PACAP (~60%). However, unlike PACAP, VIP

had no effects on action potential firing in these cells (Fig 3.7C). The number of

action potentials fired in response to 150 pA depolarizing current pulses before,

during and after washout of 100 nM VIP were 2.8 ± 0.5, 3.2 ± 0.6 and 3.4 ± 0.6,

respectively.

Membrane input resistance was investigated to determine whether the

neuropeptide-induced changes in excitability were associated with opening

and/or closing of ion channel(s). Current pulses (-100 pA) were applied to elicit

hyperpolarizations before, during and after PACAP or VIP (100 nM) application.

The amplitude of the sustained hyperpolarization was used to determine input

resistances. Neither PACAP nor VIP significantly altered the input resistance.

This observation suggests that the neuropeptides are likely exerting their effects

52

by simultaneously opening and closing multiple membrane channels resulting in

no net change in input resistance. Likewise, there was no correlation between

changes in input resistance and PACAP-induced modulation of neuroexcitability

in guinea pig intrinsic cardiac neurons (Braas et al., 1998).

Increases in neuroexcitability evoked by PACAP and VIP are in part

mediated by a VPAC receptor

In order to substantiate that VPAC receptors contribute to the PACAP and

VIP induced changes in intrinsic cardiac neuron excitability, the VPAC receptor

antagonist [N-Ac-Tyr1, D-Phe2]-GRF (1-29) was used. Figure 3.8A shows

representative action potentials evoked from a single neuron in response to a

depolarizing current pulse (300 ms, 150 pA) in the absence and presence of 100

nM PACAP-27 and/or 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (1-29). Whereas,

PACAP depolarized the cell by 3.6 mV and increased action potential firing in the

cell when administered alone, PACAP failed to change the resting membrane

potential when co-applied with [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (PACAP-27 + YF-

GRF). Bath application of [N-Ac-Tyr1, D-Phe2]-GRF (1-29) alone (YF-GRF) had

no direct effects on the active or passive membrane properties of the cell. In

similar experiments, co-application of [N-Ac-Tyr1, D-Phe2]-GRF (1-29) blocked

PACAP-induced depolarizations in cells that were shown to significantly respond

to the neuropeptide (Fig 3.8B). Figure 3.8C shows a bar graph of the number of

action potentials elicited by identical depolarizing current pulses in cells exposed

53

to PACAP prior to or following incubation in [N-Ac-Tyr1, D-Phe2]-GRF (1-29).

While PACAP increased firing from 2.7 ± 0.3 to 6.3 ± 1.5 action potentials under

control conditions, the neuropeptide had no effect on action potential firing

following application of [N-Ac-Tyr1, D-Phe2]-GRF (1-29).

Although VIP in part mimicked the depolarizing effects of PACAP, the

magnitude of the VIP-induced depolarization was only ~60% of that elicited by

PACAP. Also, VIP had no effects on action potential firing in these cells. This

observation suggests that PAC1 receptors may also contribute to the PACAP-

induced changes in the electrical properties of intracardiac neurons. To examine

this hypothesis the PAC1-selective antagonist, M65, was used in a series of

experiments to determine if inhibition of PAC1 receptors alters the PACAP-

evoked increase in excitability. Co-application of M65 (10 nM) depressed both

the PACAP-induced depolarization and increase in action potential firing in

neurons shown to respond to 100 nM PACAP-27 (Table 3.1). Surprisingly, bath

application of maxadilan (10-100 nM) failed to produce depolarizations in these

neurons (Table 3.1). Taken together these data suggest that stimulation of

VPAC receptors increases neuroexcitability in intrinsic cardiac neurons, and that

this increase in neuroexcitability is enhanced by concurrent activation of PAC1

receptors.

54

Effects of Ca2+-free extracellular conditions on PACAP-induced intracardiac

neuroexcitability

Our observation that stimulation of VPAC receptors evokes elevations in

[Ca2+]i raises the possibility that this change in [Ca2+]i may contribute to the

observed enhancement in neuroexcitability evoked by PACAP. This hypothesis

is further supported by the noted association of increases in the amplitude of the

[Ca2+]i-dependent action potential afterhyperpolarization with augmented action

potential firing in the cells. To determine the role of PACAP-induced Ca2+

mobilization in intracardiac neuroexcitability, whole-cell perforated patch

experiments were conducted in current-clamp mode under Ca2+-free extracellular

conditions. In rat intracardiac neurons, removal of extracellular Ca2+ over a short

period of time (minutes) not only prevents Ca2+ conductance through the plasma

membrane, but also results in depletion of Ca2+ from internal stores (unpublished

observation). Thus, PACAP-induced [Ca2+]i mobilization is blocked by washing

the intracardiac neurons with Ca2+-free PSS. Figure 3.9A shows representative

action potentials evoked from a neuron by depolarizing current pulses (300 ms,

150 pA) in the absence and presence of PACAP-27 (100 nM) under control

conditions (2.5 mM Ca2+) and in Ca2+-free conditions (0 Ca2+, 1 mM EGTA). In

the presence of external Ca2+, PACAP depolarized the neuron from -51.5 mV to -

47.8 mV and increased the number of action potentials fired in response to the

current pulse. However, PACAP failed to produce either of these changes when

extracellular Ca2+ was removed. In similar experiments, Ca2+-free conditions

55

inhibited the ability of PACAP to alter the resting membrane potential (Fig 3.9B)

and the action potential firing properties (Fig 3.9C) of neurons shown to respond

to the neuropeptide under control conditions. In normal extracellular Ca2+ (2.5

mM), PACAP-27 (100 nM) depolarized the cells from -51.1 ± 1.6 mV to -46.8 ±

1.9 mV, whereas in Ca2+-free PSS the resting membrane potential was -50.9 ±

1.0 mV and -51.9 ± 1.8 mV in the absence and presence of PACAP, respectively

(n=6). Similarly, in 5 neurons that exhibited increased action potential firing when

PACAP was bath applied in PSS containing normal Ca2+ (2.5 mM), removal of

extracellular Ca2+ abolished the neuropeptide-mediated effects (Fig 3.9C). Thus,

PACAP-evoked changes in excitability are dependent on the neuropeptide-

elicited elevation in [Ca2+]i.

In order to confirm that in the absence of extracellular Ca2+ intracardiac

neurons were capable of firing multiple action potentials, 1 mM Ba2+ was bath

applied in Ca2+-free PSS. Barium (1 mM) has previously been shown to block

membrane K+ channels and to increase neuroexcitability in intracardiac neurons

(Xu, Z.J. and Adams, D.J., 1992). Under these Ca-free conditions barium

significantly depolarized (p<0.01) the intracardiac neurons from -51.1 ± 1.9 mV to

-43.8 ± 1.5 mV and increased action potential firing (p<0.01) from a mean of 1.8

± 0.3 to 5.8 ± 0.5 action potentials (n = 5) (data not shown). These effects were

reversible upon washout of Ba2+. Thus, removal of extracellular Ca2+ does not

prevent intracardiac neurons from exhibiting increased neuroexcitability.

56

Effects of Ryanodine on PACAP-induced intracardiac neuroexcitability

Electrophysiological experiments conducted under Ca2+-free conditions

suggested that PACAP-induced changes in excitability were at least in part due

to the effect of the neuropeptide on [Ca2+]i. Further experiments were conducted

to determine if PACAP-induced mobilization of Ca2+ from ryanodine-sensitive

intracellular stores contributed to the increased neuroexcitability observed in the

presence of the neuropeptide. Figure 3.10A shows representative action

potentials evoked in response to a depolarizing current pulse (300 ms, 150 pA)

during bath application of 100 nM PACAP-27 before and after pretreatment with

ryanodine (10 µM). Whereas, PACAP increased action potential firing in this cell

under control conditions, preincubation in ryanodine eliminated the PACAP-

induced changes in firing characteristics. Moreover, preincubation in ryanodine

also prevented PACAP from depolarizing the cell, since PACAP depolarized the

cell by 3.7 mV under control conditions but failed to alter the resting membrane

potential in the presence of ryanodine. In similar experiments, preincubation in

ryanodine blocked PACAP-induced depolarizations in cells that were shown to

depolarize in the presence of the neuropeptide (Fig 3.10B). Figure 3.10C shows

a bar graph of the number of action potentials (± SEM) elicited by identical

depolarizing current pulses in cells exposed to PACAP prior to and following

incubation in ryanodine. Although PACAP increased firing from 1.7 ± 0.3 to 5.3 ±

0.9 action potentials under control conditions, PACAP had no effects on action

potential firing following application of ryanodine. This observation further

57

establishes elevations in [Ca2+]i as a obligatory component in the PACAP/VIP

enhancement of excitability in these cells.

58

FIGURE 3.1: PACAP and VIP, but not maxadilan, reversibly increase [Ca2+]i in

neonatal rat intracardiac neurons. (A) Graph of change in [Ca2+]i (∆[Ca2+]i),

defined as peak [Ca2+]i minus baseline [Ca2+]i, as a function of time for single

intracardiac neurons recorded before, during and following 2 minute bath

application of 100 nM PACAP-27 (black trace), 100 nM VIP (gray trace) and the

PAC1-selective agonist maxadilan (10 nM) (dotted trace). The solid line above

the traces indicates peptide application times. Individual images were captured

at 0.5 Hz. (B) Bar graph of mean peak [Ca2+]i (± SEM) recorded before

(baseline), during (drug) and following (wash) PACAP-27 (n=23), VIP (n=14) and

maxadilan (n=7) application in different preparations. Asterisks denote significant

difference (p<0.01) from respective baseline [Ca2+]i values. No significant

difference exists between the PACAP-27 and VIP induced responses.

59

60

FIGURE 3.2: PACAP-induced mobilization of [Ca2+]i in rat intracardiac neurons is via VPAC receptor activation.

Representative traces of ∆[Ca2+]i as a function of time recorded from 3 neurons (A-C, respectively) in response to 100 nM

PACAP-27 application in the absence (black traces) and presence (gray traces) of the PAC1 receptor antagonist, M65 (A,

100 nM), or the VPAC receptor antagonists L-8-K (B, 5 µM) or [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (C, YF-GRF, 100 nM).

The solid line above the traces indicates PACAP-27 bath application times. All antagonists were pre-applied for 5 min

prior to and during the administration of PACAP. (D) Bar graph of mean peak [Ca2+]i (± SEM) before (Baseline), during

(Drug) and following washout (Wash) of PACAP or PACAP and the indicated PAC1/VPAC antagonists. Asterisk denotes

significant difference (p<0.01) from the baseline [Ca2+]i recorded for each experimental condition; PACAP-27 (n = 19);

M65 + PACAP-27 (n = 5), L-8-K + PACAP-27 (n=9), YF-GRF + PACAP-27 (n=5).

61

62

FIGURE 3.3: The sustained, but not the transient, component of the PACAP-induced increase in [Ca2+]i is dependent on

extracellular Ca2+. (A) Typical traces of ∆[Ca2+]i recorded from a single neuron in response to 2 min bath application of

PACAP-27 (100 nM) in normal physiological extracellular Ca2+ (Control, black trace) and Ca2+-free conditions (0 Ca2+,

gray trace). Cells were exposed to the Ca2+-free PSS only during the PACAP application to prevent depletion of Ca2+

from intracellular stores. (B) Bar graph of mean peak [Ca2+]i (± SEM) before (Baseline), during (Drug) and following

washout (Wash) of PACAP recorded in normal and Ca-free conditions (n=12). Asterisks denote significant difference

(p<0.01) from baseline [Ca2+]i, and # denotes significant difference from sustained [Ca2+]i evoked by PACAP in normal

extracellular Ca2+. (C) Representative ∆[Ca2+]i traces recorded in response to 1.5 second application (arrow) of 500 µM

acetylcholine (ACh, gray trace) and 100 nM PACAP (black trace) from two neurons preincubated in thapsigargin (20 µM,

1 hr, 37° C). (D), Bar graph of mean baseline and mean peak [Ca2+]i (±SEM) following addition (1.5 s) of acetylcholine

(500 µM), PACAP-27 (100 nM) and caffeine (5 mM) in control neurons and neurons pretreated for 1 hr in thapsigargin.

Asterisks denote significant difference (p<0.01) from baseline [Ca2+]i. The # symbols denote significant difference

(p<0.01) from control PACAP and caffeine responses.

63

64

FIGURE 3.4: PACAP evokes a rapid transient elevation of [Ca2+]i in intracardiac neurons by releasing Ca2+ from

caffeine/ryanodine-sensitive internal stores. (A) Typical time courses of ∆[Ca2+]i recorded in response to PACAP-27 (100

nM) application before (black trace) and after (dotted trace) preincubation in 5 mM caffeine (gray trace). Caffeine was

applied until [Ca2+]i baseline stabilized (~10 min) and continued through the PACAP application (PACAP-27 + Caffeine) .

(B) Bar graph of mean ∆[Ca2+]i (± SEM) evoked by 100 nM PACAP, 5 mM caffeine or 100 nM PACAP following 5 mM

caffeine preincubation (n=6). Asterisk denotes significant difference (p<0.01) from the PACAP control. (C)

Representative ∆[Ca2+]i trace recorded in response to application of PACAP-27 (100 nM), ryanodine (10 µM) or PACAP

following ryanodine preincubation. PACAP was bath applied for 2 min, while ryanodine was applied for ~10 min. (D) Bar

graph of mean ∆[Ca2+]i (± SEM) recorded under the same conditions as (C); n = 9 for each condition. Asterisk denotes

significant difference (p<0.01) from PACAP control peak ∆[Ca2+]i.

65

66

FIGURE 3.5: The sustained, but not the transient, component of the PACAP-induced increase in [Ca2+]i is blocked by 2-

APB. Shown are typical time courses of ∆[Ca2+]i recorded in response to 100 nM PACAP-27 (A), 5 mM caffeine (B), or 5

µM muscarine (C) before (Control, black trace) and after preincubation in 50 µM 2-APB (+2-APB, gray trace). Each panel

represents recordings obtained from a single cell. 2-APB was applied for 10 min and continued through the application of

drug (PACAP, caffeine, or muscarine). Shown are bar graphs of mean peak ∆[Ca2+]i (± S.E.M.) (D) and mean sustained

∆[Ca2+]i (± S.E.M) (E) evoked by 100 nM PACAP-27 (n = 6), 5 mM caffeine (n = 7), or 5 µM muscarine (n = 6) in the

absence (Control) and presence of 50 µM 2-APB (+2-APB). The asterisks denote significant difference (p < 0.01) from the

corresponding control.

67

68

FIGURE 3.6: PACAP increases neuroexcitability in neonatal rat intracardiac neurons. (A) Action potentials elicited from a

single current-clamped neuron in response to 150 pA depolarizing current pulses in the absence (Control) and presence

of 100 nM PACAP-27 (PACAP-27), and following washout of drug (Wash). (B) Scatter plot of mean resting membrane

potential (± SEM) recorded under identical conditions as in (A) from 54 neurons. (C) Bar graph of the mean number of

action potentials (± SEM) elicited by depolarizing current pulse (500 ms, 150 pA) from neurons (n = 42) in the absence

(Control) and presence of 100 nM PACAP (PACAP) and following washout of the neuropeptide (Wash). Asterisks denote

significant difference (p<0.01).

69

70

FIGURE 3.7: VIP-induced changes in neuroexcitability within neonatal rat intracardiac neurons. (A) Action potentials

elicited form a single current-clamped neuron in response to 150 pA depolarizing current pulses in the absence (Control)

and presence of 100 nM VIP (VIP), and following washout of drug (Wash). (B) Scatter plot of mean resting membrane

potential (± SEM) recorded under identical conditions as in (A) from 8 neurons. (C) Bar graph of the mean number of

action potentials elicited by depolarizing current pulse (300 ms, 150 pA) from neurons (n = 8) in the absence (Control) and

presence of 100 nM VIP (VIP) and following washout of the neuropeptide (Wash). Asterisk denotes significant difference

(p<0.01).

71

72

FIGURE 3.8: PACAP-induced changes in intracardiac neuroexcitability are inhibited by the VPAC antagonist [N-Ac-Tyr1,

D-Phe2]-GRF (1-29). (A) Action potentials evoked from a single intracardiac neuron by depolarizing current pulse (300

ms, 150 pA) in the absence (Control) and presence of 100 nM PACAP-27 (PACAP), 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (1-

29) (YF-GRF), or 100 nM [N-Ac-Tyr1, D-Phe2]-GRF (1-29) and 100 nM PACAP-27 (PACAP-27 + YF-GRF). (B) Scatter

plot of mean resting membrane potential (RMP) (± SEM) and (C) bar graph of the average number of action potentials (±

SEM) elicited by depolarizing current pulse (300 ms, 150 pA) for neurons (n = 7) studied under the same conditions as

described above in (A), and following washout of the peptides (Wash). Asterisks denote significant difference from control

(p<0.01).

73

74

FIGURE 3.9: PACAP-induced changes in intracardiac neuroexcitability are blocked by removal of extracellular Ca2+ and

depletion of internal Ca2+ stores. (A) Action potentials evoked in response to a depolarizing current pulse (300 ms, 150

pA) from a single intracardiac neuron in the absence and presence of 100 nM PACAP in normal PSS (Control; PACAP

100 nM) or in Ca2+-free PSS (Ca2+ 0 mM, EGTA 1 mM; Ca2+ 0 mM, EGTA 1 mM, PACAP), respectively. Cells were

exposed to Ca2+-free PSS for ~10 min prior to the Ca2+-free experiments. (B) Scatter plot of mean resting membrane

potential (RMP) (± SEM) recorded from 6 neurons under control and Ca2+-free conditions (0 Ca2+) in the absence

(Control, Wash) and presence of bath applied PACAP-27 (100 nM; PACAP). (C) Bar graph of the average number of

action potentials (± SEM) elicited by depolarizing current pulse (300 ms, 150 pA) in intracardiac neurons studied under the

same conditions as described for panel (B). Asterisks denote significant difference from control (p<0.01).

75

76

FIGURE 3.10: PACAP induced changes in intracardiac neuron excitability are blocked by ryanodine. (A) Action

potentials recorded from a single intracardiac neurons in response to a depolarizing current pulse (300 ms, 150 pA) in the

absence (Control) and presence of 100 nM PACAP-27 (PACAP 100 nM) or following pretreated with ryanodine (10 µM)

for 10 min in the absence (Ryanodine) and presence (Ryanodine and PACAP) of bath applied PACAP-27 (100 nM), and

following washout of drugs (Wash). (B) Scatter plot of mean resting membrane potential (RMP) (± SEM) from 5 neurons

using the same conditions as described in panel (A), with the addition of the value obtained following washout of drugs

(Wash). (C) Bar graph of the mean number of action potentials (± SEM) elicited by depolarizing current pulse (300 ms,

150 pA) on single intracardiac neurons (n = 3) using identical conditions as in panel (B). Asterisks denote significant

difference from control (p<0.01).

77

78

TABLE 3.1: Effects of extracellular Ca2+ conditions and various inhibitors on the PACAP-induced changes in membrane

potential and action potential firing in response to a 150 pA current pulse. All neurons recorded under Ca2+-free,

ryanodine, [N-Ac-Tyr1, D-Phe2]-GRF (1-29) (YF-GRF), and M65 conditions were first shown to respond to PACAP-27

alone (data not shown), and control conditions shown indicate steady-state recordings after pretreating the cells under

each condition, respectively. Error Bars represent ± SEM for the number of cells shown in parentheses. Asterisks denote

significant difference (p<0.01).

79

Treatment Membrane Potential (mV) Action Potential Firing

PACAP Control Drug (n) Control Drug (n)

2.5 mM Ca2+ -52.0 ± 0.6 -47.7 ± 0.7* 54 3.2 ± 0.3 6.9 ± 0.5* 42

Ca2+-free -50.9 ± 1.0 -51.9 ± 1.8 6 3.6 ± 0.6 3.7 ± 1.1 4

Ryanodine -51.4 ± 1.3 -52.3 ± 1.3 5 2.0 ± 0.6 2.3 ± 0.9 3

M65 -52.2 ± 2.7 -52.8 ± 2.3 7 2.0 ± 0.6 1.7 ± 0.3 3

YF-GRF -50.8 ± 1.7 -51.0 ± 1.5 3 3.0 ± 0.6 3.3 ± 0.3 3

VIP -47.3 ± 1.7 -44.5 ± 1.5* 8 2.8 ± 0.5 3.2 ± 0.6 8

Maxadilan -50.9 ± 1.9 -51.9 ± 1.7 4 3.5 ± 1.2 3.8 ± 1.1 3

Caffeine -55.3 ± 2.1 -55.9 ± 2.0 4 3.5 ± 1.0 3.5 ± 1.2 4

80

DISCUSSION

The major finding reported here is that activation of VPAC receptors

increases neuroexcitability in intrinsic cardiac neurons, and that concurrent

activation of VPAC and PAC1 receptors results in a synergistic augmentation of

neuroexcitability. Furthermore, the PACAP and VIP mediated increase in

excitability is dependent on VPAC receptor induced Ca2+ release from caffeine-

and ryanodine-sensitive intracellular stores.

Our studies show that bath application of VIP or PACAP evokes an

elevation in intracellular free-Ca2+ that is completely blocked by the VPAC

receptor antagonists L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (1-29). Furthermore,

the effects of PACAP and VIP were not mimicked by the PAC1 selective agonist

maxadilan. Taken together these data suggest that the effects of PACAP and

VIP on [Ca2+]i are mediated by activation of VPAC receptors in these cells.

Previous studies have shown that rat intracardiac neurons express three PAC1

receptor isoforms (PAC1-short, PAC1-HOP1, and PAC1-HOP2), as well as VPAC1

and VPAC2 receptors (DeHaven and Cuevas, 2002). The predominant PAC1

receptor, PAC1-HOP, has been shown to evoke release of calcium from

intracellular stores via both cAMP and IP3 pathways in various cell types

including neuroepithelial cells, chromaffin cells, astrocytes, and cortical neurons

81

(Grimaldi and Cavallaro, 2000; Zhou et al., 2001; Payet et al., 2003). However,

our data indicate that stimulation of PAC1 has no direct effect on [Ca2+]i in

neonatal rat intracardiac neurons. Earlier studies using single-cell RT-PCR

detected VPAC1 receptor transcripts in < 20% of neonatal rat intracardiac

neurons, whereas VPAC2 receptor transcripts were expressed in > 90% the cells

(DeHaven and Cuevas, 2002). In light of the fact that PACAP increase [Ca2+]i in

over > 95% of the cells tested, VPAC2 receptors are likely to be mediating these

increases.

In contrast to PAC1 receptors, there is limited information concerning

VPAC receptor mediated regulation of [Ca2+]i, and to date, there have been no

reports of VPAC receptors evoking elevations of [Ca2+]i in neurons. Stimulation

of VPAC receptors with low concentrations of VIP (1 nM) has been shown to

evoke calcium oscillations in pancreatic acinar cells (Kase et al., 1991). In

contrast to our observations, however, higher concentrations of VIP (100 nM)

failed to elicit elevations in [Ca2+]i and had an inhibitory effect on ACh-evoked

[Ca2+]i responses in acinar cells (Kase et al., 1991). VPAC-mediated increases

in [Ca2+]i have also been reported in the lymphoblastic MOLT4 and SUPT1 cells

(Anton et al., 1993; Xia et al., 1996). Exogenously expressed VPAC1 and VPAC2

receptors have also been shown to stimulate [Ca2+]i in COS7 cells and chinese

hamster ovary (CHO) cells (MacKenzie et al., 2001; Langer et al., 2001).

The VPAC evoked increases in [Ca2+]i exhibited both a transient and a

sustained component. The transient component was observed in the absence of

82

extracellular Ca2+, but was blocked by ryanodine (10 µM) or depletion of the Ca2+

stores by caffeine or thapsigargin. These results suggest that the transient

component is due to VPAC mobilization of intracellular Ca2+, and more

specifically, due to Ca2+ release from ryanodine-sensitive Ca2+ stores. In

pancreatic and submandibular gland cells, VPAC receptor activation promotes

Ca2+ oscillations via a phospholipase C (PLC)/IP3 cascade (Luo et al., 1999).

Thus, in those secretory cells, VIP is likely increasing [Ca2+]i by evoking Ca2+

release from IP3-sensitive Ca2+ stores. Although rat intracardiac neurons also

contain IP3-sensitive stores (Beker et al., 2003), our results with ryanodine and 2-

APB suggest that a PLC-IP3-IP3-receptor pathway is not involved in the VPAC

receptor-induced increases in [Ca2+]i seen in these cells.

Unlike the transient component, the VPAC-mediated sustained elevations

in [Ca2+]i were abolished by removal of extracellular Ca2+, suggesting that they

are due to calcium entry through the plasma membrane. In various cell types,

including αT3-1 gonadotrophs (Rawlings et al., 1995) and HIT-T15 insulinoma

cells (Leech et al., 1995), VPAC2 receptor activation has been reported to

increase [Ca2+]i by enhancing Ca2+ entry through plasma membrane voltage-

gated Ca2+ channels. However, previous studies have shown that VIP does not

alter the biophysical properties of high-voltage-activated calcium channels in

intracardiac neurons (Cuevas and Adams, 1996). Furthermore, VPAC-mediated

modulation of voltage-gated Ca2+ channels appears to involve a cAMP/PKA

dependent mechanism (Rawlings et al., 1995; Leech et al., 1995), but in intrinsic

83

cardiac neurons the activator of adenylate cyclase, forskolin (100 µM), failed to

mimic the effects of PACAP and VIP on [Ca2+]i. Thus, the influx of Ca2+ observed

following VPAC receptor stimulation is unlikely to be mediated by Ca2+ entry

through voltage-gated Ca2+ channels. Given that the sustained component is

only observed following Ca2+ release from the ryanodine-sensitive stores, and

that it may also be produced by depletion of these stores by caffeine (data not

shown), it is likely mediated by store-operated channels. This conclusion is

supported by our observation that the sustained elevation in [Ca2+]i produced by

PACAP is blocked by the TRP channel antagonist 2-APB. Depletion of

caffeine/ryanodine-sensitive Ca2+ stores has previously been shown to evoke

capacitative Ca2+ entry in both excitable and non-excitable cells (Weigl et al.,

2003; Xue et al., 2000).

We have now shown that, in addition to increasing [Ca2+]i, VIP and

PACAP enhance neuronal excitability in intrinsic cardiac neurons. However, the

effects on excitability produced by these neuropeptides are not identical. These

differences may shed light into possible distinct roles for the two neuropeptides in

the regulation of intracardiac neurons, and thus of the cardiovascular system.

Bath application of PACAP or VIP results in a depolarization of intrinsic cardiac

neurons. While PACAP has previously been shown to depolarize guinea pig

intracardiac neurons, VIP had no effect on the excitability of those cells (Braas et

al., 1998). The observation that VIP depolarizes intracardiac neurons and that

VPAC-specific antagonists block PACAP-induced depolarizations suggests that

84

VPAC receptors directly influence neuroexcitability in rat intracardiac neurons.

VPAC receptor activation has been shown to depolarize thalamic relay and

medial pontine reticular formation neurons by 2-3 mV (Lee and Cox, 2003;

Kohlmeier and Reiner, 1999), which is similar to the VIP-induced depolarizations

reported here (2.4 ± 0.4 mV).

The observation that maxadilan, a PAC1 receptor specific agonist (Moro

and Lerner, 1997), does not evoke a depolarization of intracardiac neurons or

increase action potential firing suggests that PAC1 receptors do not have a direct

effect on neuroexcitability in these cells. PAC1 receptor activation, however,

potentiates VPAC receptor-induced depolarizations. Evidence for this conclusion

is provided by two observations reported here: 1) PACAP depolarizes neurons to

a greater extent than VIP, and 2) the PAC1 receptor antagonist, M65, depressed

PACAP induced depolarizations. Furthermore, increases in action potential firing

in response to depolarizing current pulses were only observed under conditions

in which both PAC1 and VPAC receptors were stimulated, that is, when PACAP

was used as the agonist and neither PAC1 nor VPAC receptor-specific

antagonists were applied. Thus, simultaneous PAC1 and VPAC receptor

stimulation elicits a synergistic enhancement of neuroexcitability and produces

changes in the active membrane properties that are not seen with stimulation of

either receptor alone.

The VPAC-mediated increases in [Ca2+]i appear to be critical for the

enhanced neuroexcitability of intracardiac neurons by PACAP. PACAP failed to

85

depolarize intracardiac neurons and to increase action potential firing when

applied in the presence of ryanodine, when the intracellular stores were depleted

with caffeine, or in the absence of extracellular Ca2+. It is interesting to note that

caffeine had no direct effects on neuroexcitability (Table 3.1), and thus Ca2+

release from intracellular stores is necessary, but not sufficient to promote

enhanced neuroexcitability. Muscarinic receptor activation has been shown to

depolarize intracardiac neurons and to augment action potential firing in these

cells (Xu and Adams, 1992). Recent studies have shown that muscarinic

receptor activation mobilizes Ca2+ from intracellular stores in intracardiac neurons

(Beker et al., 2003). Even though inhibition of the K+ conductance, IM, appears to

be a major factor contributing to muscarinic-receptor induced neuroexcitability in

these neurons (Xu and Adams, 1992), it would be of interest to determine if

muscarine-induced increases in [Ca2+]i also play a role in the enhanced

neuroexcitability, and thus if mobilization of intracellular [Ca2+]i is a mechanism by

which various excitatory neurotransmitters regulate the electrical properties of

intrinsic cardiac neurons.

In conclusion, the present study demonstrates the first evidence of VPAC

receptor-mediated regulation of intracellular Ca2+ in neurons, and shows that by

increasing [Ca2+]i, VPAC receptors enhance neuroexcitability. Furthermore, our

results demonstrate that the heterogeneity in PAC1 and VPAC receptors

observed in intracardiac neurons has significant implications for the effects of the

neuropeptides on cellular function. The ability of PACAP to depolarize the

86

neurons and increase action potential firing is dependent on PACAP stimulation

of both PAC1 and VPAC receptors. VIP, by acting exclusively on VPAC

receptors, evokes a depolarization of lesser magnitude than PACAP and fails to

increase action potential firing. The ability of PACAP and VIP to differentially

influence the electrical activity of intracardiac neurons may also help explain why

these related neuropeptides have distinct effects on the cardiovascular system.

While both PACAP and VIP have been shown to dilate coronary arteries and to

produce positive chronotropic effects (Karasawa et al., 1990; Hirose et al., 1997;

Champion et al., 1996), PACAP, but not VIP, evokes pronounced negative

chronotropic and negative inotropic effects that are mediated by activation of

intrinsic cardiac neurons (Hirose et al., 1997).

87

CHAPTER 4

REPETITIVE VPAC2 RECEPTOR-MEDIATED CALCIUM ELEVATIONS IN

INTRACARDIAC NEURONS IS DEPENDENT ON Ca2+, cADPR AND STORE-

OPERATED CALCIUM (SOC) ENTRY

INTRODUCTION

The intracardiac ganglion is capable of independently regulating the

mammalian heart, and the pituitary adenylate cyclase activating polypeptide

(PACAP) and vasoactive intestinal polypeptide (VIP) have significant effects on

the cardiovascular system. Experiments in our laboratory and by Parsons and

colleagues (Braas et al., 1998; Merriam et al., 2004; Braas et al., 2004) have

given insight into how these neuropeptides may be regulating cardiac function via

the modulation of intrinsic cardiac neurons. Our studies have recently shown

that activation of the PACAP (PAC1) and VIP (VPAC) receptors in neonatal rat

intracardiac neurons increases neuroexcitability in these cells, and that

simultaneous activation of VPAC and PAC1 receptors results in a synergistic

enhancement of excitability (DeHaven and Cuevas, 2004). Importantly, it seems

the neuropeptide mediated increase in excitability is dependent on VPAC

receptor induced elevations in intracellular calcium ([Ca2+]i) that arise from both

88

release of Ca2+ from ryanodine- and caffeine-sensitive stores, and calcium entry

through the plasma membrane. While our studies showed that VPAC receptors

mediate this effect, neither the specific VPAC receptor involved nor the signal

transduction system coupling the VPAC receptor to the ryanodine receptor have

been identified. Furthermore, the ion channel facilitating Ca2+ through the

membrane has not been unequivocally determined.

Similar to intracardiac neurons, activation of PACAP receptors in bovine

adrenal medullary cells has been shown to release Ca2+ from ryanodine- and

caffeine-sensitive intracellular stores independent of IP3 receptor activation

(Tanaka et al., 1998). Interestingly, the PACAP-evoked release from the internal

stores was found to be mediated by a Na2+-influx-dependent membrane

depolarization (Tanaka et al., 1996). Furthermore, the depolarizing effects of

PACAP were shown to be independent of Ca2+. However, the PACAP-induced

changes in neuroexcitability in intracardiac neurons appear dependent on the

release of Ca2+ from these intracellular stores (DeHaven and Cuevas, 2004).

Thus, it seems unlikely that PACAP is regulating the ryanodine receptors in

intracardiac neurons the same way as the peptide does in bovine adrenal

medullary cells. Ryanodine receptors are regulated by numerous factors,

including the physiological agents Ca2+, ATP, Mg2+ and cyclic ADP-ribose

(cADPR), as well as various cellular processes, including phosphorylation (Fill

and Copello, 2002). Both Ca2+ and cADPR have been suggested as the

endogenous ligands of neuronal ryanodine receptors (Sitsapesan et al., 1995;

89

Thomas et al., 2001; Li et al., 2001), and the data presented here suggest that

Ca2+ and cADPR are both crucial elements in the regulation of ryanodine

receptors in isolated rat intracardiac neurons by VPAC2 receptors.

Pharmacological studies with 2-APB suggest the plasma membrane

component of the PACAP and VIP elicited Ca2+ response is through transient

receptor potential (TRP) channels. TRP channels are a member of a large family

of non-selective cation channels expressed in neurons, skeletal and smooth

muscle, and in non-excitable cells (Clapham, 2003). In excitable cells such as

neurons, the opening of TRP channels has two significant effects, depolarization

of the cell, and sustained elevation of [Ca2+]i. The TRP family of ion channels is

divided into several branches, including the TRPC (canonical), TRPM

(melastatin) and TRPV (vanilloid) subfamilies, as well as the distant TRP

channels, TRPP, TRPA and TRPML. Some members of the TRPC channel

subtype appear to be activated directly by diacylglycerol (Clapham, 2003).

However, significant controversy exists as to the mechanisms regulating TRPC

activity. For example, TRPC3 has been shown to directly couple to IP3 receptors

in order to activate the channel (Zhang et al., 2001). Conversely, in IP3 knockout

cells, muscarinic receptor activation of PLC and DAG signaling activated TRPC3,

independent of IP3 receptors (Venkatachalam et al., 2001). Furthermore, some

members of the TRPC channel family are believed to be activated as a result of

elevations in intracellular free Ca2+ or by depletion of intracellular Ca2+ stores

(Clapham, 2003).

90

Earlier studies in intracardiac neurons suggested that a TRP-like channel

is activated following VPAC receptor-induced Ca2+ release from ryanodine/

caffeine-sensitive stores. This channel was not activated when VPAC receptors

were stimulated but Ca2+ mobilization was inhibited (DeHaven and Cuevas,

2004). Thus, TRP channels in intracardiac neurons appear to be regulated by

either elevations of [Ca2+]i and/or by depletion of the ryanodine/caffeine-sensitive

stores. In many non-neuronal and neuronal cell types, the depletion of

intracellular Ca2+ stores causes activation of plasma membrane store-operated

(SOC) channels (Putney, 1986; Berridge, 1995; Parekh and Penner, 1997). The

physiological functions of the store-operated Ca2+ channels include the

maintenance of proper Ca2+ levels in the intracellular stores, and the generation

of prolonged Ca2+ signals beyond those provided by the intracellular messengers

inositol (1,4,5)-trisphosphate (IP3) and cyclic ADP ribose (cADPR) (Putney,

2004). The most widely studied current involved in this capacitative Ca2+ entry is

the Ca2+-release-activated Ca2+ current (ICRAC) (Hoth and Penner, 1992).

However, unlike TRP channels, ICRAC is a divalent cation-selective channel that is

characteristically found in hematopoietic cells and not neurons. Furthermore, the

currents activated by Ca2+-store depletion in other cell types maintain different

electrophysiological properties compared to the ICRAC.

Data presented here show PACAP elevates intracellular Ca2+ in these

intracardiac neurons through the activation of VPAC2 receptors, and that

mobilization of intracellular calcium from ryanodine- and caffeine- sensitive

91

internal stores by VPAC2 is dependent on Ca2+ and cADPR, and not adenylyl

cyclase activity. The sustained component of the PACAP-evoked elevations in

[Ca2+]i are, indeed, through SOC channels, and further pharmacological evidence

suggests TRPC channels are the underlying channels mediating the capacitative

Ca2+ entry. Finally, 2-APB inhibited these neurons from repetitive VPAC2

mediated increases in [Ca2+]i, suggesting a role for TRP channels in VPAC2

receptor-elicited changes in neuroexcitability seen in rat intracardiac neurons.

92

METHODS

Cell culture

The preparation and culture of isolated intrinsic cardiac neurons has been

previously described (Fieber and Adams, 1991). Dissociated neurons were

plated onto poly-L-lysine coated glass coverslips and incubated at 37°C for 36-72

h under a 95% air, 5% CO2 environment prior to the experiments.

Microfluorometric measurements

The calcium sensitive dye fura-2 acetoxymethylester (fura-2-AM) was

used for measuring intracellular free calcium concentrations ([Ca2+]i) in

intracardiac neurons at room temperature, as previously described (Smith and

Adams, 1999). Briefly, a 1 mM fura-2-AM stock was made using DMSO as the

solvent. Cells plated on coverslips were then incubated for 1 hour at room

temperature in physiological saline solution (PSS) consisting of (in mM): 140

NaCl, 3 KCl, 2.5 CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with

NaOH), which also contained 1 µM fura-2-AM and 0.1 % dimethyl sulfoxide

(DMSO). The coverslips were then washed in PSS (fura-2-AM free) prior to the

experiments being carried out. All solutions were applied via a rapid application

system identical to that previously described (Cuevas and Berg, 1998).

93

A Sutter DG-4 high-speed wavelength switcher (Sutter Instruments Co.,

Novato, CA) was used to apply alternating excitation with 340 nM and 380 nM

ultraviolet light via a liquid light guide. Fluorescent emission at 510 nm was

captured using a Cooke Sensicam digital CCD camera (Cooke Corporation,

Auburn Hills, MI) and recorded with Slidebook 3.0 software (Intelligent Imaging

Innovations, Denver, CO) on a Pentium IV computer. Changes in [Ca2+]i were

calculated using the Slidebook software (Intelligent Imaging Innovations, Denver,

CO) from the intensity of the emitted fluorescence following excitation with 340

and 380 nm light, respectively, using the equation:

[Ca2+]i = Kd Q (R-Rmin)/(Rmax-R)

where R represents the fluorescence intensity ratio (F340/F380) as determined

during experiments, Q is the ratio of Fmin to Fmax at 380 nm, and Kd is the Ca2+

dissociation constant for fura-2. Calibration of the system was performed using

the Molecular Probes (Eugene, OR) Fura-2 Calcium Imaging Calibration Kit and

values were determined to be: Fmin/Fmax (23.04), Rmin (0.31), Rmax (8.87).


All chemicals used in this investigation were of analytic grade. The following

drugs were used: Dimethyl sulfoxide (DMSO), 2-aminoethoxydiphenylborate (2-

APB), 8-bromo-cyclic adenosine diphosphate ribose (8-Br-cADPR), lanthanum

chloride, 1-oleoyl-2-acetyl-sn-glycerol (OAG), menthol, capsaicin and caffeine

(Sigma-Aldrich, St. Louis, MO); PACAP-27, PACAP(6-38) (American Peptide

94

Co., Sunnyvale, CA); forskolin (Alomone Labs, Jerusalem, Israel); and fura-2-AM

(Molecular Probes, Eugene, OR). All data are presented as the mean ± SEM of

the number of observations indicated. Statistical analysis was conducted using

SigmaPlot 8 (SPSS, Chicago, IL) and paired t-tests were used for within group

comparisons.

95

RESULTS

VPAC2 receptors mediate PACAP-induced elevations in free [Ca2+]i

Our laboratory recently discovered that in neonatal rat intracardiac

neurons, PACAP and VIP significantly elevates intracellular calcium levels, and

furthermore, these increases in free [Ca2+]i are mediated through VPAC

receptors and not PAC1 (DeHaven and Cuevas, 2004). Earlier studies using

single-cell RT-PCR detected both VPAC1 and VPAC2 receptor transcripts in rat

intracardiac neurons (DeHaven and Cuevas, 2000). To determine the specific

VPAC receptor subtype mediating these effects, PACAP(6-38), a truncated form

of PACAP-38 which selectively inhibits VPAC2 at the concentrations used here

(100 nM) was applied simultaneously with PACAP-27. Changes in [Ca2+]i were

then measured using fura-2 mediated Ca2+-imaging. Figure 4.1A shows

representative traces of change in [Ca2+]i (∆[Ca2+]i) as a function of time for a

single intracardiac neuron in response to 2 minute PACAP-27 (100 nM) in the

absence (black trace) and presence (gray trace) of 100 nM PACAP(6-38).

PACAP(6-38) pretreatment in this cell reduced the PACAP-mediated elevations

in [Ca2+]i. In six similar experiments, PACAP(6-38) significantly decreased

elevations in [Ca2+]i evoked by PACAP from 410.9 ± 72.9 nM to 219.4 ± 23.0 nM,

96

a 44.4% peak decrease (Fig 4.1B). Thus, VPAC2 receptors mediate the PACAP

and VIP induced elevations in [Ca2+]i in rat intracardiac neurons.

Forskolin does not increase [Ca2+]i in intracardiac neurons

As the name implies, the pituitary adenylyl cyclase-activating polypeptide

(PACAP) was originally discovered to increase the activity of adenylyl cyclase in

the pituitary gland, and thus elevate cAMP levels (Miyata et al., 1989). Thus,

involvement of the AC-cAMP-PKA cascade in the VPAC2 receptor-mediated

[Ca2+]i increases in intracardiac neurons was tested by directly activating adenylyl

cyclase with forskolin (10 µM). Figure 4.2A depicts typical traces of ∆[Ca2+]i as a

function of time for a single intracardiac neuron in response to 6 minute caffeine

(5 mM) (black trace) or forskolin (10 µM) (gray trace) applications. In all

intracardiac neurons tested (n = 15), forskolin failed to elevate [Ca2+]i, yet these

same neurons did respond to caffeine (positive control) (Fig 4.2B). Forskolin

application times were varied (2 min to 16 min) to ensure enough time to activate

the AC-cAMP-PKA cascade. These data suggest that intracardiac neuron

elevations in [Ca2+]i through caffeine- and ryanodine-sensitive stores are

independent of the AC-cAMP-PKA cascade.

Role for cADP-ribose in the PACAP-elicited signal transduction cascade

In addition to cAMP, the intracellular second messenger, cADPR, has

been shown to mobilize Ca2+ from ryanodine sensitive stores. To date, neither

97

PAC1 nor VPAC receptors have been linked to the production of cADPR.

However, it seemed prudent to determine if this Ca2+-releasing signal metabolite

is involved in the VPAC2-ryanodine receptor pathway. For these experiments,

the cell permeable cADPR antagonist, 8-Br-cADPR (1 µM), was used. Figures

4.3A and 4.3C show representative traces of change in [Ca2+]i as a function of

time recorded from different isolated intracardiac neurons in response to 100 nM

PACAP-27 (A) or 5 mM caffeine (C) applications in the absence and presence of

8-Br-cADPR (1 µM). While 8-Br-cADPR alone had no effect on [Ca2+]i, it did

inhibit the PACAP-induced mobilization of [Ca2+]i in this neuron (Figure 4.3A).

However, on a different intracardiac neuron, 1 µM 8-Br-cADPR had no effect on

a caffeine mediated increase in [Ca2+]i (Figure 4.3C), as predicted from results in

other studies (Prakash et al., 2000). In 7 similar experiments, 8-Br-cADPR

significantly inhibited the PACAP-mediated mean peak increases in [Ca2+]i, from

260.7 ± 31.6 nM to 144.1 ± 14.8 nM, a 45% decrease in peak Ca2+ influx (Figure

4.3B). Nonetheless, figure 4.3D shows no effect of the cell permeable 8-Br-

cADPR on caffeine-induced increases in [Ca2+]i (caffeine alone: 336.9 ± 34.4 nM;

+ 8-Br-cADPR: 371.2 ± 34.7 nM) (n=9). These data suggest that in intracardiac

neurons VPAC2 receptors couple to ryanodine receptors via a cADPR dependent

pathway. However, the binding sites for cADPR and caffeine on the neuronal

ryanodine receptors appear to be different. These data support previous findings

which suggest a different binding site for caffeine and cADPR on the ryanodine

receptor (Walseth and Lee, 1993; Prakash et al., 2000).

98

Effects of Menthol and Capsaicin on [Ca2+]i

As previously mentioned, several subfamilies of TRP channels exist,

including TRPC, TRPM and TRPV. While TRPC channels are the most widely

implicated TRP channels in store-operated Ca2+ entry, TRPV and TRPM

activation may elevate [Ca2+]i in intracardiac neurons. Ca2+ imaging experiments

were performed using menthol and capsaicin in order to determine if the

activation of certain TRPV or TRPM receptors increase [Ca2+]i in rat intracardiac

neurons. Menthol has been shown to activate the TRPM8 channels (Hu et al,

2004; Tsuzuki et al., 2004), and capsaicin has been shown to activate TRPV1

channels (Hu et al, 2004; Krause et al., 2005). Figure 4.4A shows changes in

[Ca2+]i traces elicited by 6 minute applications of menthol (10 µM) or capsaicin (1

µM) onto different isolated intracardiac neurons. Neither menthol nor capsaicin

elevated [Ca2+]i in intracardiac neurons (Fig 4.4B), suggesting that TRPM8 and

TRPV1 do not play a role in the sustained phase of the Ca2+ response in these

cells. Furthermore, 2-APB is a common activator of TRPV1, TRPV2 and TRPV3

(Hu et al, 2004), and activation of these receptors by 2-APB elevates [Ca2+]i.

However, 2-APB alone had no effects on the cytosolic Ca2+ concentration in

neonatal rat intracardiac neurons. Taken together, these data suggest that

TRPV1, TRPV2, TRPV3 and TRPM8 channels do not play a role in the sustained

phase of the VPAC2 receptor-evoked Ca2+ response in neonatal rat intracardiac

neurons. Since a considerable number of studies have implicated each of the

99

TRPC channels as store-operated channels, and because 2-APB, menthol, and

capsaicin elicited no changes in cytosolic free Ca2+ levels, we propose that TRPC

channels are the likely candidate for the sustained component of the [Ca2+]i

elevations seen in neonatal rat intracardiac neurons.

La3+ blocks VPAC2 mediated Ca2+ responses and TRPC channels in

intracardiac neurons.

Lanthanum was used to investigate both the ryanodine receptors and the

TRPC channels in rat intracardiac neurons. The regulation of ryanodine

receptors directly by Ca2+ has been widely established in the literature (Fill and

Copello, 2002). However, in isolated intracardiac neurons, VPAC2 receptor

activation induces an initial, transient mobilization of [Ca2+]i from caffeine- and

ryanodine-sensitive stores which appears to be regulated by cADPR, and not

Ca2+. Nonetheless, experiments were performed with lanthanum in order to

determine the intracardiac neuronal regulation of ryanodine receptors by Ca2+.

Furthermore, lanthanum (La3+), a trivalent cation that inhibits all membrane Ca2+

channels, including voltage-gated, store-operated Ca2+ and TRPC channels

(Aussel et al., 1996; Halaszovich et al., 2000; Beedle et al., 2002) will provide

insight to the sustained elevation of [Ca2+]i which appears to be mediated by

activation of TRPC channels. The concentration of La3+ used (100 µM) in these

experiments was selected because this is the concentration shown previously to

maximally inhibit TRPC channels (Takai et al., 2004). Figures 4.5A, B and C

100

show changes in [Ca2+]i traces elicited by 2 minute application of PACAP-27 (100

nM), caffeine (5 mM) or muscarine (5 µM) onto different isolated intracardiac

neurons in the absence and presence of La3+ (100 µM). Lanthanum alone

produced no significant measurable changes in [Ca2+]i, and did not block the

transient elevation in [Ca2+]i produced by caffeine (Fig 4.5C) or muscarine (Fig

4.5B). However, 100 µM La3+ significantly reduced the peak change in [Ca2+]i

(∆[Ca2+]i) mediated by PACAP receptor activation in this neuron, from 139.5 nM

to 16.2 nM (Fig 4.5A). Figure 4.5D shows a bar graph of the mean peak

increase in [Ca2+]i evoked by PACAP, caffeine and muscarine in the absence and

presence of La3+. While La3+ significantly inhibited the peak Ca2+ response to

PACAP (n = 7; 137.7 ± 17.9 nM to 24.5 ± 8.0 nM), La3+ had no effect on the peak

increases in [Ca2+]i evoked by caffeine (n = 11) or muscarine (n = 4) (caffeine:

330.1 ± 60.9 nM to 285.9 ± 38.6 nM; muscarine: 88.7 ± 23.2 nM to 95.7 ± 22.4

nM). Thus, it seems likely that while IP3 receptor-mediated elevations in Ca2+ in

intracardiac neurons are not directly dependent on Ca2+, ryanodine receptor-

evoked Ca2+ elevations are dependent on Ca2+ regulation. Furthermore,

caffeine-mediated increases in Ca2+, by directly acting on the ryanodine

receptors and sensitizing them to Ca2+, do not directly depend on Ca2+ influx

through La3+-sensitive plasma membrane channels. Also, because La3+ had no

effect on the peak increases in [Ca2+]i evoked by caffeine, La3+ does not enter the

cell and alter ryanodine receptors directly.

101

Because the transient component of the PACAP-induced elevation in

[Ca2+]i was blocked by La3+, the sustained component was also significantly

abolished (Figure 4.5A,E). Therefore, La3+ would give us little insight to the

sustained component of the Ca2+ responses in neonatal rat intracardiac neurons.

However, the transient component of the caffeine-and muscarine-evoked

elevation in [Ca2+]i was unaffected by La3+, and therefore would allow us to

determine whether the sustained component of Ca2+ responses in these cells are

mediated through La3+ (and 2-APB) sensitive TRPC channels. Figures 4.5B and

C show that unlike the peak Ca2+ responses, the sustained Ca2+ increases

mediated by caffeine and muscarine in these cells are largely reduced by

application of 100 µM La3+. While the caffeine-mediated sustained increase in

[Ca2+]i decreased from 92.6 ± 11.8 nM to 15.7 ± 5.4 nM, the muscarine-evoked

sustained Ca2+ response decreased from 31.1 ± 1.8 nM to 3.2 ± 4.8 nM (Fig

4.5E). These data further support the observation that TRPC channels contribute

to the sustained elevation in [Ca2+]i evoked by VPAC2 receptor activation.

PACAP evoked Ca2+ influx through store-operated channels (SOC)

While TRPC receptors are implicated as the channels underlying store-

operated Ca2+ entry, the link between receptor activation and channel gating is

undetermined. Many of the TRPC channels that have been implicated in

capacitative Ca2+ entry have also been shown to be activated by the intracellular

messenger sn-1,2-diacylglycerol (DAG) (Hu et al, 2004; Venkatachalam et al.,

102

2003). Thus, we wanted to see the effects of the cell permeable analog of DAG,

1-oleoyl-2-acetyl-sn-glycerol (OAG), on intracellular Ca2+ levels in isolated

intracardiac neurons. Figure 4.6A shows the change in [Ca2+]i elicited by a 6

minute bath application of 100 µM OAG. In all neurons tested (n=23), OAG

failed to elevate [Ca2+]i (Fig 4.6B), suggesting that TRPC channels in neonatal rat

intracardiac neurons are not regulated by DAG.

The paradigm that we used to demonstrate that the TRPC channels

mediating the sustained component of the Ca2+ response are store-operated

Ca2+ (SOC) channels is based on a depletion of internal stores with drug

(PACAP-27 or caffeine) under Ca2+ free conditions (+1 mM EGTA). After store

depletion, application of extracellular Ca2+ results in Ca2+ influx through the

plasma membrane store-operated channels. Figure 4.7A shows typical traces of

change in [Ca2+]i (∆[Ca2+]i) as a function of time for 2 minute applications of 100

nM PACAP-27 (PACAP), 5 mM caffeine (Caffeine) and no drug (PSS) under

Ca2+ free conditions (solid line above traces), followed by the introduction of 2.5

mM Ca2+ (dashed line above traces). Both PACAP and caffeine released Ca2+

from intracellular stores under Ca2+ free conditions (+ 1 mM EGTA), and the

introduction of 2.5 mM Ca2+ in the external medium elevated [Ca2+]i above control

levels (PSS alone) under both conditions. In six similar experiments, PACAP-

and caffeine-mediated release of Ca2+ from intracellular stores under Ca2+ free

conditions caused significant increases in Ca2+ influx through the plasma

membrane after Ca2+ was introduced to the medium, when compared to PSS

103

alone (Figure 4.7B). Under 0 Ca2+ (+ 1 mM EGTA), 100 nM PACAP increased

[Ca2+]i from 68.3 ± 4.1 nM to 210.2 ± 46.4 nM, a 210% increase. The application

of 2.5 mM Ca2+ to the extracellular medium of neurons treated with PACAP

increased the [Ca2+]i to 122.5 ± 12.3 nM. Thus, the peak store-operated

component of the VPAC2 elicited Ca2+ elevations was 58% of the peak elevations

in [Ca2+]i caused by internal store release. Similar percentages were seen for

caffeine. Figure 4.7C shows a bar graph of change in [Ca2+]i (∆[Ca2+]i) measured

for PACAP, caffeine and PSS alone, under calcium free (0 Ca2+) or 2.5 mM Ca2+

conditions. Thus, the TRPC component of VPAC2 receptor-evoked elevations in

[Ca2+]i is dependent on extracellular Ca2+ and is activated by the internal store

depletion in intracardiac neurons.

The SOC channel component of the PACAP-induced Ca2+ response is

blocked by 2-APB

We previously showed that the sustained component of the Ca2+ response

in these isolated intracardiac neurons is completely abolished by the TRPC

channel antagonists, 2-APB and La3+. Furthermore, figure 4.7 showed the

depletion of internal stores by PACAP under Ca2+-free conditions activates SOC

channels located in the plasma membrane. However, the question remains

whether the SOC channels are the same as the 2-APB-sensitive TRPC

channels. Figure 4.8 shows that the PACAP-mediated Ca2+ response through

SOC channels is significantly inhibited by the pretreatment with 50 µM 2-APB.

104

PACAP-27 (100 nM) was applied to isolated intracardiac neurons under Ca2+

free conditions (1 mM EGTA) for ~5 min to ensure complete store depletion from

PACAP–sensitive pools, and the return to baseline Ca2+ levels. The

reintroduction of Ca2+ (2.5 mM) to the extracellular solution evoked a Ca2+ influx

through SOC channels, similar to what was shown in figure 4.7. However, in the

presence of 50 µM 2-APB, the influx of Ca2+ through these SOC channels was

significantly blocked. Figures 4.8A and B depict typical traces of changes in

[Ca2+]i as a function of time for 100 nM PACAP- (Fig 4.8A) and 5 mM caffeine-

(Fig 4.8B) mediated activation of SOC channels, before (black traces) and after

(gray traces) application of 2-APB. In 6 similar recordings, pretreatment with 2-

APB significantly reduced the VPAC2 receptor-mediated influx of Ca2+ through

SOC channels by more than 80%, from 102.4 ± 12.2 nM to 18.9 ± 1.4 nM (Fig

4.8C). Similarly, caffeine-mediated SOC channel activation was also significantly

blocked by the application of 2-APB (~75% decrease) (n = 7). Thus, the store-

operated component is the same as the 2-APB-sensitive component of the Ca2+

response in neonatal rat intracardiac neurons.

2-APB blocks VPAC2 receptor mediated repetitive Ca2+ responses

Store-operated calcium entry (SOC), also known as capacitative calcium

entry, plays an essential role in calcium signaling, where it can generate signals

directly or serve to replenish the internal stores in order to generate repetitive

calcium increases. Several models have been established to describe how

105

internal stores regulate SOC through the plasma membrane, including the

existence of diffusible messengers, or through a direct protein-to-protein

interaction (Putney et al.,2001; Berridge, 1995). We wanted to investigate the

role of SOC in generating repetitive Ca2+ increases in our isolated intracardiac

neurons. Figure 4.9 depicts repetitive elevations of [Ca2+]i mediated by VPAC2

receptor activations or caffeine, blocked by the TRP channel antagonist, 2-APB.

This figure shows representative traces of change in [Ca2+]i (∆[Ca2+]i) as a

function of time recorded from single neurons in response to 100 nM PACAP-27

(Fig 4.9Ai) or 5 mM caffeine (Figure 4.9Aii) application, in the absence and

presence of 2-APB (50 µM). Figure 4.9B shows a bar graph of mean peak

[Ca2+]i for the first and second bath applications of caffeine or PACAP, before

(Control) or during (+ 2-APB) 2-APB application. Importantly, under the presence

of 2-APB, neither PACAP nor caffeine were capable of eliciting a Ca2+ response

after the initial peak response occurred. While the initial peak response to

PACAP was 107.2 ± 20.3 nM under 2-APB conditions, the repetitive 2nd

application of PACAP only increased [Ca2+]i to 22.2 ± 5.5 nM, a 80% decrease in

the peak [Ca2+]i. Identical to what was previously published (DeHaven and

Cuevas, 2004), figure 4.9C depicts a bar graph of mean sustained [Ca2+]i

detailing that in these intracardiac neurons, 2-APB significantly inhibits the

sustained component of the VPAC2 receptor mediated elevations in intracellular

calcium. Thus, the SOC is essential in replenishing the internal Ca2+ stores of

106

intracardiac neurons, and as a result, regulates repetitive elevations of [Ca2+]i in

mammalian intracardiac neurons.

107

FIGURE 4.1: PACAP-induced mobilization of [Ca2+]i in rat intracardiac neurons

is via VPAC2 receptor activation. (A) Representative traces of change in [Ca2+]i

(∆[Ca2+]i), defined as peak [Ca2+]i minus baseline [Ca2+]i, as a function of time

recorded from a single neuron in response to 100 nM PACAP-27 application in

the absence (black trace) and presence (gray trace) of the PAC1 and VPAC2

receptor antagonist, PACAP(6-38) (100 nM). The solid line above the traces

indicates PACAP-27 bath application times. All antagonists were pre-applied for

5 min prior to and during the administration of PACAP. (B) Bar graph of mean

peak [Ca2+]i (± SEM) before (Baseline), during (Drug) and following washout

(Wash) of PACAP or PACAP and PACAP(6-38) (n = 7). Asterisks denote

significant difference (p<0.01) from the baseline [Ca2+]i recorded for each

experimental condition; # symbol denotes significant difference (p<0.01) from

control PACAP responses.

108

109

FIGURE 4.2: Forskolin does not increase free cytosolic calcium concentrations

in isolated rat intracardiac neurons. (A) Representative traces of change in

[Ca2+]i (∆[Ca2+]i) as a function of time recorded from a single neuron in response

to 5 mM caffeine (black trace) application and 10 µM forskolin (gray trace). The

solid line above the traces indicates caffeine and forskolin bath application times

for this cell (6 min). In other similar experiments, forskolin was bath applied in a

time range from 2 to 16 min, and similar results were seen under all conditions.

(B) Bar graph of mean peak [Ca2+]i (± SEM) before (Baseline), during (Drug) and

following washout (Wash) of forskolin (white) or caffeine (black) (n = 15).

Asterisk denotes significant difference (p<0.01) from the baseline [Ca2+]i

recorded.

110

111

FIGURE 4.3: The putative ryanodine receptor activator, cADP ribose, is involved in the PACAP-elicited signal

transduction cascade. (A) Typical time courses of )[Ca2+]i recorded in response to PACAP-27 (100 nM) application

before (black trace) and after (gray trace) preincubation in 1 µM 8 Br-cADP ribose. 8 Br-cADP ribose was applied for ~10

min prior to and continued through the PACAP application (8 Br-cADP ribose + PACAP). (B) Bar graph of peak [Ca2+]i (±

SEM) evoked by 100 nM PACAP or 100 nM PACAP following 1 µM 8 Br-cADP ribose preincubation (n=7). Asterisks

denote significant differences (p<0.01) from baseline, and # sign denotes significant difference from PACAP control peak

[Ca2+]i. (C) Representative )[Ca2+]i trace recorded in response to application of caffeine (5 mM) or caffeine following 1 µM

8 Br-cADP ribose preincubation. Caffeine was applied for 1 min, while 8 Br-cADP ribose was applied for ~10 min. (D)

Bar graph of peak [Ca2+]i (± SEM) recorded under the same conditions as (C); n = 9 for each condition. Asterisks denote

significant differences (p<0.01) from respective baselines.

112

113

FIGURE 4.4: Neither capsaicin nor menthol elicit any changes in [Ca2+]i in

neonatal rat intracardiac neurons. (A) Representative traces of change in [Ca2+]i

(∆[Ca2+]i) as a function of time recorded from two different neurons in response to

either 1 µM capsaicin (black trace) or 10 µM menthol (gray trace). The solid line

above the traces indicates bath application times. (B) Bar graph of mean peak

[Ca2+]i (± SEM) before (Baseline), during (Drug) and following washout (Wash) of

capsaicin (n=16) or menthol (n = 16).

114

115

FIGURE 4.5: La3+ blocks VPAC2 receptor mediated Ca2+ responses and the sustained component of the Ca2+ responses

in neonatal rat intracardiac neurons. Typical time courses of ∆[Ca2+]i recorded in response to 100 nM PACAP-27 (A), 5

mM caffeine (B), or 5 µM muscarine (C) before (Control, black trace) and after preincubation in 100 µM La3+ (+La3+, gray

trace). Each panel represents recordings obtained from a single cell. La3+ was applied for 10 min and continued through

the application of drug (PACAP, caffeine or muscarine). Bar graph of mean peak ∆[Ca2+]i (± SEM) (D) or mean sustained

∆[Ca2+]i (± SEM) (E) evoked by 100 nM PACAP-27 (n = 7), 5 mM caffeine (n = 11), or 5 µM muscarine (n = 4) in the

absence (Control) and presence of 100 µM La3+ (+ La3+). Asterisks denote significant difference (p<0.01) from the

corresponding control.

116

117

FIGURE 4.6: The TRPC agonist, 1-oleoyl-2-acetyl-sn-glycerol (OAG), does not

increase [Ca2+]i in neonatal rat intracardiac neurons. (A) Representative traces

of change in [Ca2+]i (∆[Ca2+]i) as a function of time recorded from two different

neurons in response to 100 µM OAG (black trace). The solid line above the trace

indicates bath application times. (B) Bar graph of mean peak [Ca2+]i (± SEM)

before (Baseline), during (Drug) and following washout (Wash) of OAG (n=23).

118

119

FIGURE 4.7: Internal store depletion by PACAP or caffeine activates SOC

channels. (A) Representative traces of change in [Ca2+]i (∆[Ca2+]i) as a function

of time recorded from a single neuron in response to 2 minute bath application of

100 nM PACAP-27 (black trace), 5 mM caffeine (gray trace) or nothing (dotted

trace), in the absence (+1 mM EGTA) and presence of 2.5 mM Ca2+. The solid

line above the traces indicates Ca2+ free conditions, while the dashed line

indicates introduction of 2.5 mM Ca2+ in the bath solution. (B) Bar graph of mean

peak [Ca2+]i (± SEM) under control (Baseline), 0 Ca2+ (0 Ca2+ Peak), and

physiological Ca2+ (2.5 mM Ca2+ Peak) conditions, in the presence of 100 nM

PACAP(black), 5 mM caffeine (gray) or no drug (PSS) (n = 6). Asterisks denote

significant difference (p<0.01) from the baseline [Ca2+]i recorded for each

experimental condition; # symbol denotes significant difference (p<0.01) from the

PSS response. (C) Bar graph (± SEM) of peak change in [Ca2+]i (∆[Ca2+]i) for

application of PACAP, caffeine and no drug (PSS) under no extracellular Ca2+ (0

Ca2+) and physiological extracellular Ca2+ (2.5 mM Ca2+) conditions (n = 6). Data

was collected from the same cells as shown in (B), and # denotes significant

difference from PSS alone condition.

120

121

FIGURE 4.8: SOC channel activation by PACAP is inhibited by 2-APB. (A) Representative traces of change in [Ca2+]i

(∆[Ca2+]i) as a function of time recorded from a single neuron in response to bath application of 2.5 mM Ca2+ before (black

trace) and after (gray trace) the treatment with 50 µM 2-APB. PACAP-sensitive internal Ca2+ stores were depleted by 100

nM PACAP-27 application under Ca2+ free conditions (+1 mM EGTA) (~5 min). Recordings started (time = 0 min) after

cytosolic free Ca2+ levels returned to baseline following PACAP or caffeine application. The solid line above the traces

indicates PACAP application under Ca2+ free conditions, while the dashed line indicates introduction of 2.5 mM Ca2+ in the

bath solution. (B) Same as (A), except 5 mM caffeine in the place of PACAP in order to deplete caffeine-sensitive internal

Ca2+ stores. (C) Bar graph of mean peak change in [Ca2+]i (Peak ∆[Ca2+]i), before (black) and after (gray) 2-APB

treatment, evoked by the application of 2.5 mM Ca2+ after the internal store depletion by PACAP (n = 6) and caffeine (n =

7). Asterisks denote significant difference (p<0.01) from control responses recorded for each experimental condition.

122

123

FIGURE 4.9: Repetitive elevations of [Ca2+]i mediated by VPAC2 receptor activations are blocked by 2-APB.

Representative trace of change in [Ca2+]i (∆[Ca2+]i) as a function of time recorded from a single neuron in response to 5

mM caffeine (i) or 100 nM PACAP-27 (ii) applications in the absence and presence of 2-APB (50 µM). The solid lines

above the trace indicate 2 minute caffeine or PACAP bath application times, and the dashed line indicates 2-APB

application times. (B) Bar graph of mean peak [Ca2+]i (± SEM) for the first and second bath applications of caffeine or

PACAP, before (Control) or during (+ 2-APB) 2-APB application. Asterisks denote significant difference (p<0.01) from the

first application and # symbol denotes significant difference (p<0.01) from control responses. (C) Bar graph of mean

sustained [Ca2+]i (± SEM) for the first and second bath applications of caffeine or PACAP, before (Control) or during (+ 2-

APB) 2-APB application. Asterisks denote significant difference (p<0.01) from the first application. (caffeine: n=5; PACAP:

n=6).

124

125

DISCUSSION

The major finding reported here is that PACAP-induced elevations in

[Ca2+]i in intrinsic cardiac neurons are mediated by the activation of VPAC2

receptors that couple to ryanodine-sensitive Ca2+ stores via a signal transduction

cascade involving Ca2+ and cADPR. Furthermore, we show pharmacological

evidence that VPAC2 receptor activation results in the opening of TRP channels,

most probably TRPC. These channels open in response to depletion of Ca2+

evoked mobilization of Ca2+ from intracellular stores, and are thus functioning as

store-operated channels that mediate capacitative calcium entry. In contrast to

previous reports on some native TRPC receptors (Venkatachalam et al, 2003;

Grimaldi et al., 2003; Hu et al., 2004), TRPC channels mediating the sustained

Ca2+ response in intracardiac neurons are not activated by DAG.

Our laboratory has previously shown that rat intracardiac neurons express

three PAC1 receptor isoforms (PAC1-short, PAC1-HOP1, and PAC1-HOP2), as

well as VPAC1 and VPAC2 receptors (DeHaven and Cuevas, 2002), and

activation of VPAC receptors mediates PACAP- and VIP-elicited elevations in

[Ca2+]i (DeHaven and Cuevas, 2004), as well as influences the electrical

properties of the cell. These data are the first to show that VPAC2 receptors

126

mediate the PACAP- and VIP-induced increases in cytosolic Ca2+ concentrations

in neonatal rat intracardiac neurons. Our results are supported by the fact that

VPAC1 receptor transcripts were detected in less than 20% of neonatal rat

intracardiac neurons, whereas VPAC2 receptor transcripts were expressed in >

90% the cells (DeHaven and Cuevas, 2002). While VPAC1 receptors can couple

to AC (Ishihara, T. et al., 1992), VPAC2 receptors can additionally activate the

PLC -IP3-PKC cascade (Lutz et al., 1993; Inagaki et al., 1994). Moreover,

PACAP-mediated increases in [Ca2+]i have been linked to both AC and PLC

activation (Payet et al., 2003; Tanaka et al., 1996; Grimaldi and Cavallaro, 2000);

however, neither of these pathways appears to be critical in the VPAC2 receptor

mediated increases in [Ca2+]i in neonatal rat intracardiac neurons.

The activation of VPAC2 receptors and subsequent increase in [Ca2+]i in

rat intracardiac neurons is not directly associated with increased levels of cAMP.

The mechanisms by which PACAP and VIP increase [Ca2+]i appears to differ

from cell-type to cell-type. For example, in five main cell-types of the rat anterior

pituitary, PACAP raises [Ca2+]i three different ways: via cAMP, phospholipase C

(PLC) and a third unknown novel mechanism (Alarcon and Garcia-Sancho,

2000). In fetal human chromaffin cells, PACAP elevates [Ca2+]i through caffeine-

and ryanodine-sensitive internal stores, and forskolin causes an identical

elevation in [Ca2+]i to PACAP (Payet et al., 2003). Pharmacological evidence

with specific PKA antagonists showed that the PACAP-induced release of Ca2+

from caffeine- and ryanodine-sensitive stores occurs through the AC-cAMP-PKA

127

cascade in fetal human chromaffin cells. However, in neonatal rat intracardiac

neurons, the AC-cAMP-PKA cascade does not play a direct role in the VPAC2

receptor-mediated elevations in [Ca2+]i. Although the AC-cAMP-PKA intracellular

signal pathway does not directly increase [Ca2+]i in these intracardiac neurons,

our experiments do not rule out the possibility that cAMP may have a different

role in PACAP modulation of neuroexcitability seen in these cells. PAC1

activation in isolated guinea pig intracardiac neurons has been shown to

enhance the cAMP-regulated, hyperpolarization-activated nonselective cationic

conductance, Ih (Merriam et al., 2004). Ih has previously been demonstrated in

neonatal rat intracardiac neurons by electrophysiology techniques (Cuevas et al.,

1997).

Cyclic ADP-ribose (cADPR) was first shown to elevate [Ca2+]i in sea-urchin

eggs (Clapper et al., 1987), and it has since been shown to mobilize Ca2+ from

intracellular stores in a wide variety of cell types (Lee, 2001), including canine

and murine autonomic neurons (Smyth et al., 2004). Convincing

pharmacological evidence suggests that cADPR may be an endogenous

modulator of the ryanodine receptor (RYR) (Perez et al, 1998; Locuta et al,

1998). For instance, the elevations of intracellular Ca2+ mediated by cADPR

have been shown to be blocked by specific RYR inhibitors and enhanced by

caffeine (Galione et al, 1991; Lee, 1993; Lee et al, 1995). Both the synthesis

(ADP-ribosyl cyclase activity) and the degradation (cADPR-hydrolase activity) of

cADPR are mediated by the orphan receptor, CD38 (Takasawa et al., 1993;

128

Zocchi et al., 1993). However, a paradox exists because of the extracellular

production of cADPR by CD38, and few data are available to explain the

transport of extracellular cADPR into the cell (Franco et al., 1998). This paradox

can partially be solved by the fact that experimental evidence has shown CD38-

like activity away from the plasma membrane and associated with several

intracellular organelles, including the mitochondria (Liang et al., 1999) and

endoplasmic reticulum (Bacher et al., 2004). Our data shown here suggests that

in isolated intracardiac neurons, VPAC2 receptor mobilization of Ca2+ through

caffeine- and ryanodine-sensitive internal stores is dependent on the production

of cADPR. However, caffeine was unaffected by the bath application of the

antagonist, 8-Br-cADPR. These data support previous findings which suggest a

different binding site for caffeine and cADPR on the ryanodine receptor (Walseth

and Lee, 1993; Prakash et al., 2000).

Lanthanum experiments performed here show that the VPAC2 receptor

mobilization of Ca2+ through caffeine- and ryanodine-sensitive internal stores is

dependent on a small Ca2+ influx through the plasma membrane. However, the

channel underlying these effects is yet to be determined. Furthermore, the

effects of La3+ on membrane Ca2+ channels appears to be faster than the

exchange of Ca2+ in bathing solution, since experiments performed under Ca2+

free conditions failed to block the VPAC2 receptor-evoked release of Ca2+ from

ryanodine-sensitive internal stores (see Fig 3.3). All three known ryanodine

receptor types (RYR1, RYR2 and RYR3) have been shown to be regulated by

129

Ca2+, both on the cytosolic and luminal surfaces of the receptors (Meissner, G.,

2004). While RYRs are activated by high-affinity, Ca2+ specific binding sites,

these receptors are also inhibited by the binding of Ca2+ to low affinity, less

specific sites, giving rise to the characteristic bimodal Ca2+ dependence of

channel activity (Meissner, 2004). However, micromolar concentrations of Ca2+

are required to fully activate the RYR; therefore, it seems unlikely to be the only

essential regulator of RYRs in neurons. More likely, several key players, such as

Ca2+, cADPR, ATP and calmodulin are required to activate RYRs. Experiments

shown here with La3+ and 8-Br-cADPR support this hypothesis. Our earlier

studies failed to show any intracellular Ca2+ events that preceded the release of

[Ca2+] from the ryanodine/caffeine-sensitive stores. Thus, it seems likely that

La3+ is not inhibiting a PACAP-induced membrane influx, but rather blocking a

Ca2+ leak channel that maintains [Ca2+]i at levels which permit cADPR activation

of the RYR. Given that 2-APB did not block PACAP-induced activation of the

RYR, this leak channel is a distinct molecular entity from the TRPC channel.

However, we cannot exclude the possibility that PACAP is promoting a Ca2+

influx that is below our threshold for detection. Further, we can not exclude the

possibility that 100 µM La3+ directly blocks PACAP binding to the VPAC2

receptors, leading to the inhibition of VPAC2 receptor-mediated Ca2+ responses

under the presence of La3+.

Capacitative calcium entry through store-operated Ca2+ channels plays an

essential role in Ca2+ signaling. We show here that the PACAP activation of

130

VPAC2 receptors in rat intracardiac neurons stimulates Ca2+ influx through TRP

channel antagonist-sensitive store-operated channels; however, the mechanisms

underlying the link between the intracellular stores and the TRP channels

remains to be determined. A number of models have been proposed to explain

how internal stores can regulate SOC channels in the plasma membrane. Some

models suggest the existence of diffusible messengers, whereas others consider

that information may be transferred more directly through a protein-protein

interaction (Putney et al.,2001; Berridge, 1995). Many of the TRPC channels

that have been implicated in capacitative Ca2+ entry have also been shown to be

activated by the intracellular messenger sn-1,2-diacylglycerol (DAG) (Hu et al,

2004; Venkatachalam et al., 2003). However, application of 100 µM 1-oleoyl-2-

acetyl-sn-glycerol (OAG) failed to increase [Ca2+]i in these intracardiac neurons,

suggesting that in intrinsic cardiac neurons, these ion channels primarily function

as store-operated channels.

While the mechanisms linking store-operated calcium channels to

intracellular Ca2+ stores remain elusive, the physiological roles for capacitative

Ca2+ entry is more clearly defined. Store-operated Ca2+ channels maintain

proper Ca2+ levels in the endoplasmic reticulum and generate prolonged Ca2+

responses (Putney, 2004). However, the majority of literature on physiological

functions of the SOC channels comes from studies on muscle and non-excitable

cells, not neurons. These data show that the SOC channels present in these rat

intracardiac neurons, indeed, function to replenish the intracellular Ca2+ stores,

131

and that activation of these channels is necessary to preserve functional

responses to PACAP. Given that TRPC channels are also activated upon Ca2+

release from intracellular stores elicited by muscarinic receptor activation, TRPC

channels are likely to be important in preserving responses to other

neurotransmitters as well.

In conclusion, the present study demonstrates the first evidence of VPAC2

receptor mediated regulation of intracellular Ca2+ in neurons, and shows that

Ca2+ and cADPR play a part in the signal transduction cascade mediating these

effects. Furthermore, the store-operated Ca2+ channels present in these neurons

pharmacologically resemble TRPC channels, and these channels are crucial in

the ability of the cells to replenish intracellular Ca2+ stores.

132

CHAPTER 5

CANONICAL TRANSIENT RECEPTOR POTENTIAL (TRPC) CHANNELS

REGULATE NEUROEXCITABILITY IN RAT INTRACARDIAC NEURONS

INTRODUCTION

The modulation of excitability of intracardiac neurons by PACAP and VIP

is in part dependent on elevations of intracellular calcium (Ca2+). These

elevations in calcium result from both mobilization of Ca2+ from ryanodine- and

caffeine-sensitive intracellular stores and capacitative Ca2+ entry through the

plasma membrane. While inhibition of Ca2+ release from intracellular stores has

been shown to abolish the enhancement of neuroexcitability induced by these

neuropeptides, less is known about the role of the capacitative Ca2+ entry on the

electrical properties of these neurons. Furthermore, the store-operated Ca2+

(SOC) channels mediating this phenomenon have not been fully characterized.

Given the importance of intrinsic cardiac neurons in the regulation of the heart,

understanding mechanisms regulating the excitability of these cells is of

significant interest. Moreover, the relationship between SOC channels and

neuroexcitability in peripheral and central neurons remans poorly understood,

133

and thus insight into how these ion channels influence passive and active

membrane properties of intracardiac neurons may have broad implications.

Previously, our laboratory showed that the SOC channels present in

intracardiac neurons pharmacologically resemble short transient receptor

potential (TRPC) channels, inhibited by both 2-aminoethoxydiphenylborate (2-

APB) and lanthanum (La3+). Interestingly, inhibition of these TRPC channels

block the ability of the intracardiac neurons to sequentially elevate free

intracellular calcium concentrations ([Ca2+]i) mediated by VPAC2 receptor

activation. VPAC2 receptor regulation of TRPC channels may underlie the

changes in the resting membrane potential (RMP) and neuroexcitability seen in

the presence of PACAP in these cells.

TRP channels are a large family of non-selective cation channels

expressed in neurons and other non-excitable cells. Originally discovered as the

Drosophila photoreceptor channels (Montell and Rubin, 1989; Wong et al, 1989;

Phillips et al., 1992; Xu et al., 2000), TRP channels are composed of tetrameric

assemblies of six transmembrane spanning units. Three main subfamilies exist

based on sequence homology: canonical TRP (TRPC), melastatin TRP (TRPM)

and vanilloid TRP (TRPV) channels, and heteromers can be formed by members

of each same subfamily. While the Ca2+ permeability makes them transducers

leading to elevations in [Ca2+]i, the non-selective cationic nature of TRP channels

makes them depolarizing channels.

134

The ionic mechanisms underlying the PACAP- and VIP-evoked changes

in the resting membrane potential (RMP) and neuroexcitability remain unclear.

TRPC channels, thought to be the store-operated component of the Ca2+

response in intracardiac neurons, may in part explain the increased

neuroexcitability and depolarizations seen in the presence of PACAP. The

present study examined the effects of the TRPC channel antagonist, 2- APB, on

neuroexcitability of neonatal rat intracardiac neurons. These data show that 2-

APB decreases the number of action potentials elicited by small depolarizing

current pulses. The reduction of action potentials occurs because of a 2-APB-

mediated hyperpolarization of the resting membrane potential (RMP) and

significant decrease in the action potential afterhyperpolarization (AHP) in

intracardiac neurons. While the effects of 2-APB on the RMP suggests a direct

role for TRPC channels on intracardiac neuroexcitability, the effects of 2-APB on

the AHP suggests TRPC regulation of Ca2+ activated K+ channels in intracardiac

neurons. Outward membrane currents underlying these effects produced by 2-

APB indeed support the indirect inhibition of such a Ca2+ activated K+

conductance. These data support our hypothesis that the store-operated phase

of the PACAP-evoked increase in [Ca2+]i, through TRPC channels, in part leads

to the changes in neuroexcitability seen with PACAP administration in neonatal

rat intracardiac neurons.

135

METHODS

Electrophysiology

The 2-APB effects on neuroexcitability were investigated in isolated

intracardiac ganglion neurons of neonatal rats (4-7 day old), as previously

described (Fieber and Adams, 1991). Coverslips containing the dissociated

neurons were transferred to a 0.5 mL recording chamber mounted on a phase-

contrast microscope (400X). The extracellular recording solution was

physiological saline solution (PSS) consisting of (in mM): 140 NaCl, 3 KCl, 2.5

CaCl2, 1.2 MgCl2, 7.7 glucose and 10 HEPES (pH to 7.2 with NaOH). All drugs

were bath applied in PSS. Ca2+-sensitive and -insensitive K+ channel currents

were isolated by adding tetrodotoxin (TTX, 400 nM) to the PSS to inhibit voltage

activated Na+ channel currents. Action potentials and currents were amplified

and filtered (5 kHz) using an Axoclamp-200B Amplifier, digitized with a 1322A

DigiData digitizer (20kHz), and collected on a Pentium IV computer using the

Clampex 8 program (Axon Instruments, Inc., Foster City, CA, USA). Data

analysis was conducted using the pClamp 8 program, Clampfit.

The whole-cell perforated-patch variation of the patch-clamp recording

technique was used, as previously described (Horn and Marty, 1988; Rae et al.,

136

1991; Xu and Adams, 1992). This configuration preserves intracellular integrity,

preventing the loss of cytoplasmic components and subsequent alteration of

functional responses of these neurons (Cuevas and Adams, 1996; Cuevas et al.,

1997). The pipette solution contained (mM): 75 K2SO4, 55 KCl, 5 MgSO4, 10

HEPES, 198 µg/ml amphotericin B, and 0.4% DMSO. Final patch pipette

resistance was 1.0 to 1.3 MΩ to permit maximal electrical access under the

present recording configuration.

Membrane potential responses to a depolarizing current pulse (-150 pA) were

determined in the absence and presence of various drugs. The mean resting

membrane potential, peak amplitude (overshoot), rise and decay slope, and

amplitude of afterhyperpolarization (AHP) were determined in the absence and

presence of 2-APB. Membrane currents were elicited by step depolarization

from -60 mV to +120 mV, or an applied voltage ramp from -120 mV to +50 mV.


All chemicals used in this investigation were of analytic grade. The following

drugs were used: Dimethyl sulfoxide (DMSO), tetraethylammonium salt (TEA),

tetrodotoxin (TTX), 2-aminoethoxydiphenylborate (2-APB), lanthanum chloride,

and cadmium chloride (Sigma-Aldrich, St. Louis, MO); and paxilline, apamin,

charybdotoxin, iberiotoxin, slotoxin (Alomone Labs, Jerusalem, Israel). All data

are presented as the mean ± SEM of the number of observations indicated.

137

Statistical analysis was conducted using SigmaPlot 8 (SPSS, Chicago, IL) and

paired t-tests were used for within group comparisons.

138

RESULTS

2-APB decreases action potential (AP) firing in rat intracardiac neurons

Earlier experiments (see Figure 3.5) showed that 2-APB effectively

blocked the store-operated channel, TRPC, activated by VPAC2 receptors in

intracardiac neurons. Therefore, this drug was used to determine the role of

TRPC in the active and passive membrane properties of intracardiac neurons.

The effects of 2-APB on action potential firing in rat intracardiac neurons were

investigated using the whole-cell perforated patch technique under current clamp

mode. Figure 5.1A shows a family of voltage responses elicited by 800 msec

depolarizing current pulses (150 pA) from an isolated intracardiac neuron.

Voltages were recorded in the absence (Control) and presence of 50 µM 2-APB

(2-APB), and following washout of the drug (Wash). Application of 2-APB

reduced the number of action potentials fired in this neuron from 19 under control

conditions to 8 during bath application of 2-APB, and this effect was completely

reversible. In 9 neurons studied, the depolarizing current pulses evoked

accommodating trains of action potentials in 4 cells (adapting neurons),

sustained firing of action potentials in 3 cells (tonic neurons), and a single action

potential in 2 cells. These data coincide with previously published reports on the

139

firing properties of neonatal rat intracardiac neurons (DeHaven and Cuevas,

2004). While 2-APB did not inhibit firing in neurons firing single action potentials,

this drug reduced the number of action potentials elicited by depolarizing current

pulses in both accommodating (adapting) and tonic neurons. In neurons firing

multiple action potentials (adapting and tonic), 2-APB significantly reduced the

number of action potentials by ~50%, from 12.4 ± 2.4 to 6.1 ± 1.0 action

potentials fired (Fig 5.1B).

2-APB-evoked changes in the single action potential waveform

To gain insight into the underlying cause of the reduction in action

potential firing evoked by bath application of 2-APB, current clamp experiments

were performed to look at the single action potential waveform parameters.

Figure 5.2A shows single action potentials elicited from brief depolarizing pulses

(100 pA) before (Control), during (2-APB) and after (Wash) bath application of 50

µM 2-APB. 2-APB hyperpolarized the intracardiac neuron from -55.9 mV to -61.1

mV, and reduced the afterhyperpolarization (AHP) by ~10 mV, from -17.9 mV to -

4.6 mV. Along with the significant resting membrane potential (RMP) and AHP

changes evoked by 2-APB, the TRP channel antagonist was also shown to alter

the rise and decay slope of the single action potential, with the latter being a

significant change (-14.2 ± 3.3 mV/sec to -12.8 ± 3.5 mV/sec). The effects of 2-

APB on the action potential waveform configuration are summarized in Figure

5.2B. Similar findings on RMP, AHP and rise and decay slope were made with

140

100 µM La3+ (Data not shown), which inhibits voltage gated ion channels and

TRP channels (Aussel et al., 1996; Halaszovich et al., 2000; Beedle et al., 2002).

The effects of 2-APB on the action potential AHP suggests a role for TRP

channel regulation of Ca2+ activated K+ channels in rat intracardiac neurons

(Franciolini et al., 2001). The effects of various direct acting (charybdotoxin,

paxilline, iberiotoxin, slotoxin, apamin, TEA) and indirect acting (Ca2+ free PSS,

La3+, Cd2+) Ca2+ activated K+ channel blockers on action potential waveform and

AHP were investigated in isolated rat intracardiac neurons. Using the perforated-

patch whole-cell recording technique, neurons were held at -50 mV under current

clamp conditions, and single action potentials were evoked by 100 pA

depolarizing current pulses for 100 msec. Interestingly, neither of the specific BK

channel toxins, charybdotoxin (100 nM, n=5) and paxilline (200 nM, n=5), or the

SK channel toxin, apamin (100 nM, n=4) elicited any changes in rat intracardiac

neuron waveform parameters, including the relative AHP (Fig 5.3C,D,E).

Iberiotoxin (10 nM) and slotoxin (10 nM) also had no effects on relative AHP

(Data not shown). Conversely, TEA (500 µM), which has been shown to inhibit

BK channels in rat intracardiac neurons (Franciolini, F. et al., 2001), increased

the action potential duration by decreasing the decay slope; however, no

significant change in the relative AHP was seen (Fig 5.3A,E). Furthermore, the

indirect acting Ca2+ activated K+ channel blockers Cd2+ (100 µM) and La3+ (10-

100 µM), and the replacement of extracellular Ca2+ with Mg2+ (Ca2+-free PSS),

significantly reduced the relative AHP in intracardiac neurons by 30%, 58% and

141

39%, respectively (Fig 5.3B,E). Thus, these data show 2-APB significantly

reduces the decay slope and AHP in rat intracardiac neurons, as well as

hyperpolarizes these cells. These effects are in part mimicked by La3+, Ca2+-free

PSS, TEA and Cd2+; yet, none of the specific toxins for Ca2+ activated K+

channels alter the action potential waveform parameters. Therefore, the identity

of the channel mediating the AHP remains to be determined.

Membrane currents underlying the 2-APB-elicited changes in action

potential properties

To analyze the effects of 2-APB on intracardiac neuron membrane K+

currents, outward currents evoked by 20 mV steps from -60 mV to +120 mV were

recorded before (Control), during (2-APB) and after (not shown) bath application

of 50 µM 2-APB (Fig 5.4A). The net 2-APB sensitive current (2-APB Sensitive)

was determined by subtracting the current remaining after 2-APB application

from that observed under control conditions (Control) (Fig 5.4A, bottom). The 2-

APB-sensitive current, and thus the TRPC channel regulated K+ current in these

neurons, exhibits pronounced time-dependent inactivation at positive potentials,

but such inactivation was not observed at negative potentials. Figure 5.4B

shows the current-voltage relationship of both the mean peak 2-APB-sensitive

current () and the mean sustained 2-APB-sensitive current (), determined at

the location of the arrows shown in figure 5.4A, for 4 neurons. The 2-APB-

sensitive current activated at potentials positive to -60 mV, and maximal

142

activation occurs near +100 mV. The 2-APB-sensitive peak and sustained

current densities at +120 mV were 106.4 ± 37.2 mV and 20.2 ± 12.9 mV,

respectively.

143

FIGURE 5.1: 2-APB induced changes in the number of action potentials fired in neonatal rat intracardiac neurons. (A)

Action potentials elicited from a single current-clamped neuron in response to 150 pA depolarizing current pulses (800

msec) in the absence (Control) and presence of 50 µM 2-APB (2-APB), and following washout of drug (Wash). (B) Bar

graph of the mean number of action potentials ± SEM recorded from 9 neurons under identical conditions as in (A).

Dashed lines indicate 0 mV. The asterisk denotes significant difference (p<0.05)

144

145

FIGURE 5.2: 2-APB-evoked changes in the single action potential waveform.

(A) Single action potentials elicited by brief depolarizing current pulses (100 ms,

150 pA) on a single intracardiac neuron before (Control, black trace), during (2-

APB, red trace) and following (Wash, gray trace) bath applied 2-APB (50 µM).

Dashed line indicates 0 mV. (B) Effects of 2-APB on the resting membrane

potential (RMP) and action potential waveform parameters. Action potentials

were evoked by 100 pA current injections for 100 msec. 2-APB was bath applied

and the data are shown as the mean ± S.E.M. for 4 cells. Asterisks denote

significant difference from control (p<0.05).

146

CONTROL 2-APB (50 µM) WASH

RMP (mV) -52.9 ± 2.4 -56.1 ± 2.9* -52.5 ±0.8

PEAK AMPLITUDE (mV) 20.3 ± 1.5 20.2 ± 3.3 19.8 ± 0.7

RISE SLOPE (mV/sec) 33.4 ± 9.1 40.4 ± 12.1 38.5 ± 9.2

DECAY SLOPE (mV/sec) -14.2 ± 3.3 -12.8 ± 3.5* -16.1 ± 3.3

AHP (mV) -17.4± 2.7 -8.2 ± 3.5* -20.1 ± 1.9

147

FIGURE 5.3: Effects of various direct- and indirect-acting Ca2+-activated K+

inhibitors on the action potential waveform and afterhyperpolarization (AHP) in rat

intracardiac neurons. Resting membrane potential (RMP) was held at -50 mV

under current clamp conditions and action potentials were elicited by brief

depolarizing current pulses (150 pA, 100 msec). Action potentials were obtained

in the absence (Control) and presence of bath applied (A) 500 µM TEA, (B) 100

µM Cd2+, (C) 200 nM paxilline, or (D) 100 nM apamin. Dashed lines indicate 0

mV. (E) Bar graph depicting the relative afterhyperpolarzations (AHP), defined

as the AHP under the presence of drug divided by the control AHP, of

intracardiac neurons under the presence of the direct acting (charybdotoxin,

paxilline, apamin, TEA) and indirect acting (Ca2+ free, La3+, Cd2+) Ca2+ activated

K+ channel blockers (± SEM). Asterisks denote a significant decrease in AHP

(p<0.05).

148

149

FIGURE 5.4: Inhibition of outward currents in rat intracardiac neurons by the TRP channel antagonist, 2-APB. (A)

Membrane currents evoked by depolarizing steps between -60 mV to +120 mV from a holding potential of -60 mV in

normal physiological saline solution (PSS) before (Control) and during (2-APB) bath applied 2-APB (50 µM). The net 2-

APB sensitive current (2-APB Sensitive) was determined by subtracting the current remaining after 2-APB application

from that observed under control conditions (Control). (B) Current-voltage relationship of both the peak 2-APB-sensitive

current (--) and the sustained 2-APB-sensitive current (-±-), determined at the location of the arrows shown in (A)

bottom (n=4). Error bars indicate ± S.E.M.

150

151

DISCUSSION

The major finding reported here is that TRP channels, most probably

TRPC, in intrinsic cardiac neurons regulate the active and passive membrane

properties of these cells. Inhibition of TRPC channels with 2-APB or La3+

hyperpolarized intracardiac neurons, depressed repetitive firing and eliminated

the action potential afterhyperpolarization (AHP) in these cells. The effects of 2-

APB and La3+ on AHP were in part mimicked by Cd2+ and Ca2+-free conditions,

suggesting that the AHP is mediated by a Ca2+-activated current that can be

regulated by TRPC. Furthermore, currents mediated by TRPC channels were

recorded at voltages near the resting membrane potential of these cells (circ. -50

mV), and exhibited little or no time-dependent inactivation at negative potentials.

However, at positive potentials the TRPC channels showed pronounced time-

dependent inactivation. These data further support that 2-APB mediates its

affects through: (1) the inhibition of non-selective TRPC channels, and (2) either

the direct inhibition of Ca2+-activated K+ channels, or more probable, the indirect

inhibition of Ca2+-activated K+ channels due to TRPC inhibition.

Our studies show that bath application of 50 µM 2-APB hyperpolarizes

intracardiac neurons by ~3 mV, and in neurons which fire tonic or

152

accommodating (adapting) action potentials in response to depolarizing current

pulses, 2-APB reduces the number of action potentials fired significantly. The

hyperpolarizing affects of 2-APB are mediated through the inhibition of the

depolarizing, non-selective TRPC channels in these intracardiac neurons.

Furthermore, the effects of 2-APB on the single action potential waveform

properties of intracardiac neurons showed a significant decrease in the peak

afterhyperpolarization (AHP) when compared to control conditions, as well as a

change in the decay slope, meaning the action potential duration increased. The

effects of 2-APB on AHP suggest a role for TRPC channel regulation of Ca2+-

activated K+ channels. Thus, TRPC channels directly, and TRPC regulation of

Ca2+ activated K+ channels, play a role in the regulation of neuroexcitability in

intracardiac neurons. Importantly, 2-APB does not block Ca2+ activated Cl-

channels in Xenopus oocytes (Chorna-Ornan et al., 2001). However, 2-APB may

block other membrane chloride channels undetermined to date. Interestingly, the

PACAP-evoked increase in action potential firing in these cells was associated

with an increase in AHP (DeHaven and Cuevas, 2004).

Ca2+ activated K+ channels are known to alter excitability in autonomic

neurons (Franciolini et al., 2001), and it previously has been shown that both IP3

(Hoesch et al., 2004) and ryanodine (Moore et al., 1998; Jobling et al., 1993;

Kawai and Watanabe, 1989, 1991) receptor-evoked Ca2+ release activates a K+

conductance which alters the AHP properties of neurons. However, these

studies focused directly on the IP3 and ryanodine receptor intracellular Ca2+

153

stores activating the Ca2+ activated K+ channels, and failed to mention the

common denominator between these two stores, the store-operated Ca2+

channels.

These studies show that while charybdotoxin, paxilline, iberiotoxin,

slotoxin and apamin have no effects on the AHP of rat intracardiac neurons, the

replacement of extracellular Ca2+ with Mg2+, or the addition of the voltage-gated

Ca2+ channel blocker, Cd2+, significantly reduced the relative AHP. These data

suggest the role of toxin insensitive, Ca2+ activated conductances in the

regulation of the AHP in these cells. Furthermore, La3+, which inhibits voltage

gated and store-operated Ca2+ channels, as well as TRP channels (Aussel et al.,

1996; Halaszovich et al., 2000; Beedle et al., 2002), was shown to have nearly

identical effects to 2-APB on the action potential properties, including the RMP

and AHP. This finding is important because 2-APB is known to inhibit IP3

receptors along with plasma membrane SOC channels. The fact that La3+

showed similar effects on the intracardiac neuroexcitability and action potential

waveform properties suggests the 2-APB effects on action potential firing are not

mediated by the inhibition of IP3 receptors, but instead inhibition of TRP channels

in the plasma membrane. To our knowledge, these are the first data showing the

regulation of plasma membrane ion channels important in the production of the

AHP by the TRP channel antagonists, 2-APB and La3+.

Finally, we find a reversible inhibition of an outward current elicited by

voltage steps from -60 mV to +120 mV before and after 2-APB bath application.

154

Two phases of the outward currents were investigated, the initial peak K+ current

and the sustained K+ current. While the peak K+ current is generally thought to

be mediated by BK and IA currents, the sustained conductance is through

delayed rectifier K+ channels (Wang et al., 2002; Sun et al., 2003). BK channels

are present in these neurons (Franciolini et al., 2001), but IA has yet to be

identified. These data show that the majority of the 2-APB sensitive outward

current in rat intracardiac neurons is the peak, transient current; however, a very

small inhibition of the sustained current was noted. Thus, 2-APB blocks a peak

transient outward current in rat intracardiac neurons which resembles BK or IA.

However, these effects are probably also due to actions on the TRPC channels

themselves. To date, very little is known about the regulation of excitability by

TRPC channels. Thus, further experiments must be performed in order to

determine (1) the direct effects of SOC channels (TRPC) on membrane currents

and (2) the regulation of other Ca2+ activated ion channels, such as K+ channels,

by these SOC channels in rat intracardiac neurons. These studies will give

further insight to the Ca2+ dependent regulation of neuroexcitability seen with the

neuropeptides, PACAP and VIP, in rat intracardiac neurons.

In conclusion, the Ca2+ dependent regulation of neuroexcitability in rat

intracardiac neurons by PACAP and VIP can in part be explained by the

activation of 2-APB- and La3+-sensitive SOC channels in the plasma membrane,

indirectly associated with the regulation of other Ca2+ activated ion channels,

most notably the Ca2+ activated K+ channels.

155

CHAPTER 6

SUMMARY

Results reported here using PACAP and VIP provide direct evidence of

some of the complex signaling which occurs in neurons of the mammalian

intracardiac ganglia (Fig 6.2), and this study provides the first description of

modulation of intracardiac neuron excitability through the VPAC2 receptor-

mediated regulation of intracellular Ca2+. Furthermore, these data describe, in

general, a novel method in which neurons can increase excitability through G

protein regulated changes in Ca2+ handling, and these results can be related to

various mammalian cells.

The expression of PACAP and VIP receptors were investigated in isolated

intracardiac neurons of neonatal rat intracardiac ganglia using single-cell reverse

transcription-polymerase chain reaction (RT-PCR). Individual intracardiac

neurons were shown to express various isoforms of the PAC1 receptor, including

the PAC1-short, -HOP1 and -HOP2 variants, which differ in the region encoding

the G protein-binding domain. Neither the PAC1-very short, -HIP, nor –HIPHOP

variants were detected. The PAC1-HOP1 was expressed at higher levels and in

a greater number of cells than other PAC1 variants. VPAC1 and VPAC2

156

transcripts were also detected in intracardiac neurons, with VPAC2 being found in

nearly all of the neurons (Fig 6.1). These data support previous cloning

experiments which suggest the two major forms in mammals are the PAC1-short

and -HOP1 receptors (Spengler et al, 1993; Svoboda, 1993). In contrast, in

isolated adult guinea pig intracardiac neurons, the expression of PAC1-very short

and PAC1-HOP2 isoforms predominate (Braas et al., 1998), and no VPAC

receptor isoforms have been reported. The present findings underlie the

complex effects of PACAP and VIP on neuroexcitability and Ca2+ handling in the

intracardiac ganglia.

The effects of PACAP and VIP on neonatal rat intracardiac

neuroexcitability were investigated using the whole cell perforated patch

technique under current clamp mode. PACAP and VIP have been shown to

modulate the activity of various neuronal populations. For instance, in the CNS,

administration of PACAP in the hypothalamus increased the firing rate activity

and caused membrane depolarization (Uchimura et al., 1996; Shibuya, et al.,

1998). Likewise, in the PNS, application of PACAP on isolated adult guinea pig

intracardiac neurons also depolarized the cells and changed the action potential

firing frequencies (Braas et al., 1998; Parsons et al., 2000). The present results

show both PACAP and VIP enhanced neuronal excitability in isolated neurons of

rat intracardiac ganglia. Interestingly, the effects on excitability produced by

these neuropeptides were not identical. While bath application of PACAP or VIP

resulted in a depolarization of intracardiac neurons, PACAP depolarized the

157

neurons to a greater extent than VIP. However, maxadilan, a PAC1 receptor

specific agonist, did not evoke a depolarization of intracardiac neurons or

increase action potential firing, suggesting that PAC1 receptors do not have a

direct effect on neuroexcitability in these cells. Nonetheless, the PAC1 receptor

antagonist, M65, depressed PACAP induced depolarizations. Furthermore,

increases in action potential firing in response to depolarizing current pulses

were only observed under conditions in which both PAC1 and VPAC receptors

were stimulated, that is, when PACAP was used as the agonist and neither PAC1

nor VPAC receptor-specific antagonists were applied. Thus, simultaneous PAC1

and VPAC receptor stimulation elicits a synergistic enhancement of

neuroexcitability and produces changes in the active membrane properties that

are not seen with stimulation of either receptor alone.

The effects of PACAP and VIP on Ca2+ handling in intracardiac neurons

was investigated using fura-2 Ca2+ imaging techniques. While PACAP and VIP

increased [Ca2+]i in isolated intracardiac neurons, maxadilan, a PAC1-selective

agonist, failed to elicit a response. Furthermore, the VPAC-selective antagonists,

L-8-K and [N-Ac-Tyr1, D-Phe2]-GRF (1-29), significantly blocked the

neuropeptide-evoked Ca2+ elevations, while M65, the PAC1-selective antagonist

failed to inhibit the response. Lastly, application of PACAP(6-38) significantly

inhibited the PACAP-induced elevations in [Ca2+]i. Taken with the fact that

neonatal rat intracardiac neurons predominantly express the VPAC2 receptor

158

(>90%), these results show that activation of VPAC2 receptors mediates the Ca2+

responses in these cells.

PACAP and VIP are known to modulate nicotinic acetylcholine receptors

(nAChRs) in isolated rat intracardiac neurons (Liu et al., 2000). However,

blocking neurotransmission with the Na2+ channel blocker, tetrototoxin (TTX), and

the ganglionic nAChR blocker, mecamylamine, had no effect on the VPAC2

receptor-elicited changes in [Ca2+]i in rat intracardiac neurons. Thus, the

observed rise in [Ca2+]i is not dependent on neurotransmission.

VPAC2 receptor-elicited changes in [Ca2+]i in rat intracardiac neurons

exhibited both a transient and sustained component. VPAC receptors have been

linked to both Ca2+ entry through the plasma membrane via the activation of L-

type Ca2+ channels (Chatterjee et al., 1996; Tanaka et al., 1998) and Ca2+

release from intracellular stores. Two distinct ER intracellular Ca2+ stores exist in

intracardiac neurons, one that is sensitive to inositol 1,4,5-trisphosphate (IP3) and

another sensitive to ryanodine and caffeine. Under Ca2+-free conditions, PACAP

and VIP still elicited a Ca2+ response in these neurons. However, the sustained,

plateau component of the Ca2+ response was lost. Conversely, VPAC2 receptor-

induced increases in [Ca2+]i were completely blocked by the application of

ryanodine, or depletion of the intracellular Ca2+ stores by caffeine or thapsigargin.

Furthermore, 2-APB, an IP3 receptor and TRP channel antagonist, only blocked

the sustained component of the PACAP-elicited elevations in [Ca2+]i. These data

suggest VPAC2 receptor activation in intracardiac neurons leads to an elevation

159

in [Ca2+]i which initially comes from ryanodine- and caffeine-sensitive intracellular

pools, followed by the influx of Ca2+ through the plasma membrane. Moreover,

the plasma membrane component appears to be through some unknown, 2-APB

sensitive TRP channel.

While our studies showed that VPAC2 receptors mediate a Ca2+ response

in isolated intracardiac neurons initially through the release of Ca2+ from caffeine-

and ryanodine-sensitive intracellular pools, followed by the activation of 2-APB

sensitive plasma membrane channels, the signal transduction system coupling

the VPAC2 receptor to the ryanodine receptor had not been identified.

Furthermore, the 2-APB sensitive channel facilitating Ca2+ through the plasma

membrane had not been determined. Fura-2 mediated Ca2+ imaging

experiments were performed in order to elucidate some of the factors in the

VPAC2 receptor regulation of ryanodine receptors and plasma membrane TRP

channels in isolated rat intracardiac neurons. The activation of VPAC2 receptors

and subsequent increase in [Ca2+]i in rat intracardiac neurons was not directly

associated with increased levels of cAMP. Forskolin, an adenylyl cyclase

activator, failed to elevate [Ca2+]i in these isolated neonatal rat intracardiac

neurons. However, 8-Br cADPR significantly reduced the VPAC2-evoked Ca2+

elevations, suggesting that ryanodine receptor activation is dependent on the

production of cADPR in neonatal rat intracardiac neurons. Furthermore, the

binding site of caffeine and cADPR to the ryanodine receptor is different,

because caffeine was unaffected by the bath application of 8-Br cADPR.

160

Lanthanum experiments performed here showed that the VPAC2 receptor

mobilization of Ca2+ through caffeine- and ryanodine-sensitive internal stores is

dependent on a small Ca2+ influx through the plasma membrane. However, the

channel underlying these effects is yet to be determined. Interestingly, the

inhibition of membrane channels by La3+ appears to be faster than the exchange

of Ca2+ in the bathing solution, since experiments performed under Ca2+ free

conditions failed to block the VPAC2-evoked release of Ca2+ from ryanodine-

sensitive internal stores. Conversely, this paradoxical effect mediated by La3+

might be explained by the direct inhibition of PACAP binding to the VPAC2

receptor. Nonetheless, several key factors, including cADPR and Ca2+ are

required to activate ryanodine receptors in neonatal rat intracardiac neurons.

The inhibition of the VPAC2 receptor-mediated influx of Ca2+ through the

plasma membrane by 2-APB suggested TRP channels mediates this effect. The

inhibition of the sustained component of the Ca2+ response by La3+ in these

neurons further supported that TRP channels underlie the response. However,

several subfamilies of TRP channels exist, including TRPC, TRPM and TRPV.

While TRPC channels are the most widely implicated in store-operated Ca2+

entry, TRPV and TRPM needed to be ruled out. Fura-2 mediated Ca2+ imaging

experiments showed that neither menthol, nor capsaicin increased [Ca2+]i in

isolated neonatal rat intracardiac neurons. While menthol has been shown to

activate TRPM8 channels (Hu et al., 2004; Tsuzuki et al., 2004), capsaicin has

been shown to activate TRPV1 channels (Hu et al., 2004; Krause et al., 2005).

161

Thus, these data suggest TRPM8 and TRPV1 do not play a role in the sustained

phase of the Ca2+ response in these neurons. Furthermore, 2-APB is a common

activator of TRPV1, TRPV2 and TRPV3 (Hu et al., 2004). However, 2-APB

alone had no effects on the [Ca2+]i in intracardiac neurons. Taken together,

these data suggest TRPV and TRPM do not play a role in the sustained phase of

the VPAC2 receptor-evoked Ca2+ response in neonatal rat intracardiac neurons.

Thus, TRPC channels are the likely candidate for this effect.

TRPC channels have been implicated in store-operated Ca2+ entry, as well

been shown to be activated by the intracellular messenger DAG (Hu et al., 2004;

Venkatachalam et al., 2003). However, application of OAG failed to increase

[Ca2+]i in these intracardiac neurons, suggesting that these ion channels primarily

function as store-operated channels in these cells. This was supported by the

fact that store depletion by PACAP under Ca2+ free conditions evoked a store

dependent influx of Ca2+ across the plasma membrane, and that influx was

significantly blocked by bath application of 2-APB. Thus, TRPC channels are

regulated by store depletion in neonatal rat intracardiac neurons.

Store-operated Ca2+ channels maintain proper intracellular store Ca2+

levels, as well as generate prolonged Ca2+ responses (Putney, 2004). These

data showed that 2-APB significantly inhibited the ability of the neuron to

repetitively increase [Ca2+]i. Thus, TRPC channels regulated by store depletion

function to replenish the intracellular Ca2+ stores, and activation of these

channels is essential to preserve functional responses to PACAP.

162

Experiments using electrophysiological techniques showed that the

modulation of excitability of intracardiac neurons by PACAP and VIP is

dependent on elevations of [Ca2+]i. Bath application of ryanodine, and the

removal of extracellular Ca2+ significantly reduced the depolarization and

increases in action potential firing induced by application of PACAP. Thus, the

inhibition of the Ca2+ release from ryanodine-sensitive has been shown to abolish

the enhancement of neuroexcitability induced by PACAP in these intracardiac

neurons. However, little is known about the role of store-operated Ca2+ entry on

the electrical properties of these neurons. Store-operated TRPC channels may

in part underlie the changes in neuroexcitability seen in the presence of PACAP

and VIP in intracardiac neurons. While the Ca2+ permeability of TRPC channels

makes them candidates for store-operated Ca2+ channels, the non-selective

cationic nature of TRPC channels makes them depolarizing agents. Thus,

electrophysiological experiments were performed to investigate the ionic

mechanisms underlying the PACAP and VIP evoked changes in resting

membrane potential (RMP) and neuroexcitability seen in isolated neonatal rat

intracardiac neurons. Data presented here showed that 2-APB decreased the

number of action potentials elicited by small depolarizing current pulses. The

reduction of action potentials occurred because of a 2-APB mediated

hyperpolarization of the resting membrane potential (RMP) and significant

decrease in the action potential afterhyperpolarization (AHP) in these intracardiac

neurons. The effects of 2-APB on the RMP suggests a direct role for TRP

163

channels on the regulation of intracardiac neuron passive and active membrane

properties. However, the effects of 2-APB on the AHP suggests TRPC channels

regulate Ca2+ activated K+ channels in intracardiac neurons. These data were

supported by the fact that 2-APB inhibited transient outward currents that

resembled Ca2+ activated K+ currents.

While these results discussed give insight to the Ca2+-dependent changes

in neuroexcitability evoked by VPAC2 receptor activation in isolated intracardiac

neurons, the PAC1 receptor mediated effects have yet to be determined.

Although the AC-cAMP-PKA intracellular signal pathway does not directly

increase [Ca2+]i in these cells, our experiments do not rule out the possibility that

cAMP may have a different role in PACAP modulation of neuroexcitability seen in

intracardiac neurons. PAC1 activation in guinea pig intracardiac neurons has

been shown to enhance the cAMP-regulated, hyperpolarization-activated

nonselective cation conductance, Ih (Merriam et al., 2004). Ih has previously

been demonstrated in neonatal rat intracardiac neurons by electrophysiological

techniques (Cuevas et al., 1997).

164

FIGURE 6.1: Schematic representation of the expression pattern of PAC1 and

VPAC2 receptors in individual intracardiac neurons. The percentages (%)

located inside the cells indicate the predicted percent of individual neonatal rat

intracardiac neurons that express the various PAC1 receptor isoforms, as well as

VPAC2 receptors. Data are interpreted from experiments performed using single-

cell RT-PCR (Chapter 2). In order to avoid confusion, VPAC1 receptors were left

out of the diagram. However, VPAC1 receptor transcripts were detected in a

small proportion of isolated neonatal rat intracardiac neurons (>20%).

165

FIGURE 6.2: Schematic representation of the pathways mediating the PACAP- and VIP-induced elevations in [Ca2+]i and

enhancement of neuroexcitability seen in isolated rat intracardiac neurons. PACAP and VIP increase [Ca2+]i in

intracardiac neurons through the activation of G-protein coupled VPAC2 receptors, and this mobilization of Ca2+ exhibits

both a transient and sustained component. The transient component is in part due to mobilization of Ca2+ from

caffeine/ryanodine-sensitive stores, and the signal transduction is Ca2+ and cADPR-dependent. Ca2+ release from these

stores regulates the entry of Ca2+ through the plasma membrane, and pharmacological evidence suggests TRPC

channels mediate this effect. TRPC is critical in these intracardiac neurons abilities to repetitively elevate intracellular

Ca2+ levels and replenish internal Ca2+ stores. PACAP-induced changes in Ca2+ handling by intracardiac neurons is

linked to the neuroexcitability produced by the neuropeptide in these cells, and simultaneous activation of VPAC2 and

PAC1 receptors results in a synergistic amplification of excitability. Pharmacological evidence suggests inhibition of TRPC

decreases action potential firing in intracardiac neurons through changes in resting membrane potential (RMP),

suggesting a direct role for TRPC in the regulation of neuroexcitability. Furthermore, 2-APB effects on the action potential

afterhyperpolarizations (AHP) and outward currents suggest TRPC channels regulate Ca2+ activated K+ channels.

However, PAC1 receptor mediated effects have yet to be elucidated.

166

167

CONCLUSION

Autonomic control of cardiac function depends on the coordinated activity

generated by neurons within the intracardiac ganglia, and intrinsic feedback

loops within the ganglia provide precise control of cardiac function. Interestingly,

the progressive development of heart disease is associated with a remodeling of

this intrinsic cardiac ganglion, and an adaptation of the control mechanisms

which regulate these intrinsic cardiac neurons. Such a remodeling process likely

involves both afferent and efferent neurons, hormones, receptors, and signal

transduction pathways within the intracardiac neurons. Although recent studies

have identified some of the anatomical and functional characteristics of the

intracardiac ganglia, we are just beginning to understand how interactions among

the network of neurons act to regulate cardiac function. Understanding the

intracardiac ganglia in normal physiological conditions, as well as the remodeling

that occurs in diseased states, will lead to novel approaches to the development

of therapy to treat heart disease.

Results reported here using PACAP and VIP provide direct evidence of

some of the complex signaling which occurs in neurons of the rat intracardiac

ganglia. The physiological effects of VPAC2 receptor activation on intracardiac

168

neurons have clinical implications. Interestingly, VIP has been shown by both in

vivo and in vitro experiments to act as a positive inotropic (Unverferth et al.,

1986; Bell and McDermott, 1994) and chronotropic agent (Christophe et al.,

1984; Smitherman et al., 1989; Rigel and Lanthrop, 1990). Moreover, VIP has

been shown to be elevated in patients suffering from early heart failure, while

decreased concentrations of VIP are related to the progressive worsening of the

disease (Lucia et al., 2003). Furthermore, it has been suggested that some of

the beneficial effects seen with angiotensin converting enzyme (ACE) inhibitor

therapy in heart failure patients may be caused by VIP (Duggan and Ye, 1998).

ACE inhibitors result in an increase in cardiac output without an increase in heart

rate, suggesting a positive inotropic effect. However, this cannot be explained by

a reduction in angiotensin II and bradykinin concentrations. It has been

suggested that the angiotensin converting enzyme may metabolize VIP (Duggan

and Ye, 1998), and the increased concentrations of VIP that would result from

ACE inhibitor therapy would explain the positive inotropic effects seen. However,

several studies have now shown that the angiotensin converting enzyme does

not metabolize VIP (Farmer and Togo, 1990; Duggan and Ye, 1998).

Nonetheless, VIP concentrations do increase during ACE inhibitor therapy, and

these changes probably contribute to the improvement in cardiac function

following therapy with these agents (Duggan and Ye, 1998).

In conclusion, the mammalian intracardiac ganglion exerts intrinsic regulation

over cardiac performance, and is thus a potential pharmacological target for

169

treating disease. Experiments performed here give insight into some of the

complex signaling which occurs in neurons of the mammalian intracardiac

ganglia, and these results support the hypothesis that the intrinsic cardiac nerve

plexus acts as much more than a simple relay center for parasympathetic

innervation to the heart. PACAP and VIP are important regulators of neuronal

signaling within the intracardiac ganglia, and VPAC2 and PAC1 receptor

activation plays an important neuromodulatory role in the regulation of cardiac

homeostasis. Even more interesting is the possible roles these peptides play in

various diseases associated with the heart. Despite the progress made in

intracardiac ganglion research, much of the physiological and pathological roles

of these ganglia remain incomplete. Further investigations of the intracardiac

ganglia will shed light on the intrinsic beat-to-beat regulation of the mammalian

heart. For instance, the molecular identities of many of the membrane proteins

associated with intracardiac neuroexcitability have yet to be determined.

Furthermore, the electrophysiological properties of intrinsic cardiac neurons have

not been completely established (Adams and Cuevas, 2004). To my knowledge,

data shown here are the first to indicate the importance of TRPC activity on the

resting membrane potential (RMP) in intracardiac neurons, as well as the

regulation of Ca2+ activated K+ channels. Nonetheless, progress is being made

in the understanding of intracardiac neuronal control of the mammalian heart.

170

WORKS CITED

Adams, D.J. and Cuevas, J. (2004) Electrophysiological properties of intrinsic cardiac neurons in Basic and Clinical Neurocardiology. Edited by Armour, J.A. and Ardell, J.L. Oxford University Press, New York. Adams P.R., Constanti, A., Brown, D.A., and Clark, R.B. (1982) Intracellular Ca2+ activates a fast voltage-sensitive K+ current in vertebrate sympathetic neurons. Nature 296, 746-749. Alarcon, P., and Garcia-Sancho, J. (2000) Differential calcium responses to the pituitary adenylate cyclase-activating polypeptide (PACAP) in the five main cell types of rat anterior pituitary. European J Physiol. 440, 685-91. Allen, T.G., Burnstock, G. (1987) Intracellular studies of the electrophysiological properties of cultured intracardiac neurones of the guinea-pig. J. Physiol. 388, 349-66. Anton, P.A., Shanahan, F., Sun, X.P., Diehl, D., Kodner, A., and Mayer, E.A. (1993) VIP modulates intracellular calcium oscillations in human lymphoblasts. Immunopharmacol. Immunotoxicol. 15, 429-446. Ardell, J.L. (1994) Structure and function of mammalian intrinsic cardiac neurons. In: Neurocardiology, edited by Armour JA and Ardell JL. New York: Oxford Univ. Press, p. 95–114. Ardell, J.L. (1994) Structure and function of mammalian intrinsic cardiac neurons. In: J.A. Armour and J.L. Ardell, Editors, Neurocardiology, Oxford University Press, Oxford, 95–114. Arimura A. (1998) Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocrine, endocrine, and nervous systems. Jpn J Physiol. 48, 301-31. Armour, J.A. (1999) Myocardial ischaemia and the cardiac nervous system. Cardiovasc Res 41, 41–54.

171

Armour, J.A., Collier, K., Kember, G., and J.L. Ardell (1998) Differential selectivity of cardiacneurons in separate intrathoracic autonomic ganglia. American J. Physiol. 274, 939-49. Armour, J.A., Hopkins, D.A. (1990) Activity of in vivo canine ventricular neurons. American J. Physiol. 258, 326-36. Armour, J.A., Huang, M.H. and Smith, F.M. (1993) Peptidergic modulation of in situ canine intrinsic cardiac neurons. Peptides. 14, 191-202. Aussel, C., Marhaba, R., Pelassy, C., Breittmayer, J.P. (1996) Submicromolar La3+ concentrations block the calcium release-activated channel, and impair CD69 and CD25 expression in CD3- or thapsigargin-activated Jurkat cells. Biochem J. 313, 909-13. Barritt, G.J. (1999) Receptor-activated Ca2þ inflow in animal cells: a variety of pathways tailored to meet different intracellular Ca2+ signalling requirements. Biochem. J. 337, 153–169. Basler, I., Kuhn, M., Muller, W., and Forssmann, W.G. (1995) Pituitary adenylate cyclase-activating polypeptide stimulates cardiodilatin/atrial natriuretic peptide (CDD/ANP-(99-126)) secretion from cultured neonatal rat myocardiocytes. Eur J Pharmacol. 291, 335-342. Beaudet, M.M, Parsons, R.L., Braas, K.M., and May, V. (2000) Mechanisms Mediating Pituitary Adenylate Cyclase-Activating Polypeptide Depolarization of Rat Sympathetic Neurons. J. Neurosci. 20, 7353-7361. Beedle, A.M., Hamid, J., Zamponi, G.W. (2002) Inhibition of transiently expressed low- and high-voltage-activated calcium channels by trivalent metal cations. J Membr Biol. 187,225-38. Beker, F., Weber, M., Fink, R.H., and Adams, D.J. (2003) Muscarinic and nicotinic ACh receptor activation differentially mobilize Ca2+ in rat intracardiac ganglion neurons. J. Neurophysiol. 90, 1956-1964. Bell, D., McDermott, B.J. (1994) Secretin and vasoactive intestinal peptide are potent stimulants of cellular contraction and accumulation of cyclic AMP in rat ventricular cardiomyocytes. J Cardiovasc Pharmacol. 23, 959-969. Berridge, M.J. (1995) Capacitative calcium entry. Biochem. J. 312, 1–11.

172

Braas, K.M. and V. May (1999) Pituitary adenylate cyclase-activating polypeptides directly stimulate sympathetic neuron neuropeptide Y release through PAC(1) receptor isoform activation of specific intracellular signaling pathways. J. Biol. Chem. 274, 27702–27710. Braas, K.M., May, V., Harakall, S.A., Hardwick, J.C. and Parsons, R.L. (1998) Pituitary adenylate cyclase-activating polypeptide expression and modulation of neuronal excitability in guinea pig cardiac ganglia. J. Neurosci. 18, 9766-9779. Braas, K.M., Rossignol, T.M., Girard, B.M., May, V., Parsons, R.L. (2004) Pituitary adenylate cyclase activating polypeptide (PACAP) decreases neuronal somatostatin immunoreactivity in cultured guinea-pig parasympathetic cardiac ganglia. Neuroscience. 126, 335-46. Brum, J.M., Bove, A.A., Sufan, Q., Reilly, W., Go, V.L. (1986) Action and localization of vasoactive intestinal peptide in the coronary circulation: evidence for nonadrenergic, noncholinergic coronary regulation. J Am Col Cardiol. 7, 406-413. Burnstock, G. (1972) Purinergic nerves. Pharmacol. Rev. 24, 509-560. Calaresu, F.R. and St. Louis A.J. (1967) Topography and numerical distributions of intracardiac ganglion cells in the cat. J Comp Neurol 131, 55–66. Calupca, M.A., Vizzard, M.A., and Parsons, R.L. (2000) Origin of pituitary adenylate cyclase-activating polypeptide (PACAP)-immunoreactive fibers innervating guinea pig parasympathetic cardiac ganglia. J. Comp. Neurol. 423, 26-39. Cardell, L.O., Hjert, O., and Uddman, R. (1997) The induction of nitric oxide mediated relaxation of human isolated pulmonary arteries by PACAP. Br J Pharmacol. 120, 1096-1100. Cauvin, A., Buscail, L., Gourlet, P., De Neef, P., Gossen, D., Arimura, A., Miyata, A., Coy, D.H., Robberecht, P., and Christophe, J. (1990) The novel VIP-like hypothalamic polypeptide PACAP interacts with high affinity receptors in the human neuroblastoma cell line NB-OK. Peptides. 11, 773-777. Cauvin, A., Robberecht, P., De Neef, P., Gourlet, P., Vandermeers, A., Vandermeers-Piret, M.C., and Christophe, J. (1991) Properties and distribution of receptors for pituitary adenylate cyclase activating peptide (PACAP) in rat brain and spinal cord. Reg. Peptides. 35, 161-173.

173

Cavallaro, S., Copani, A., D’Agata, V., Musco, S., Petralia, S., Ventra, C., Stivala, F., Travali, S. and Canonico, P.L. (1996) Pituitary adenylate cyclase-activating polypeptide prevents apoptosis in cultured cerebellar granule neurons. Mol Pharmacol 50, 60–66. Champion, H.C., Santiago, JA., Garrison, E.A.., Cheng, D.Y., Coy, D.H., Murphy, W.A., Ascuitto, R.J., Ross-Ascuitto, N.T., McNamara, D.B., and Kadowitz, P.J. (1996) Analysis of cardiovascular responses to PACAP-27, PACAP-38, and vasoactive intestinal polypeptide. Ann. N. Y. Acad. Sci. 805, 429-441. Chatterjee, T.K., Sharma, R.V., and Fisher, R.A. (1996) Molecular cloning of a novel variant of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor that stimulates calcium influx by activation of L-type calcium channels. J. Biol. Chem. 271, 32226-32232. Chorna-Ornan, I., Joel-Almagor, T., Beni-Ami, H.C. et al. (2001) A common mechanism underlies vertebrate calcium signaling and Drosophila phototransduction. J Neurosci. 21, 2622-2629. Christophe, J. (1998) Is there appetite after GLP-1 and PACAP? Ann N Y Acad Sci 865, 323–335. Christophe, J. (1993) Type I receptors for PACAP (a neuropeptide even more important than VIP?). Biochim. Biophys. Acta. 1154,183-199. Christophe, J., Waelbroeck, M., Chatelain, P., Robberecht, P. (1984) Heart receptors for VIP, PHI and secretin are able to activate adenylate cyclase and to mediate inotropic and chronotropic effects. Species variations and physiopathology. Peptides. 5, 341-353. Chu, A., Diaz-Munoz, M., Hawkes, M.J., Brush, K., and Hamilton, S.L. (1990) Ryanodine as a probe for the functional state of the skeletal muscle sarcoplasmic reticulum calcium release channel. Mol. Pharmacol. 37, 735-741. Clapham, D.E., Runnels, L.W., and Strubing, C. (2001). The TRP ion channel family. Nat. Rev. Neurosci. 2, 387-396. Clapham, D.E. (2003) TRP channels as cellular sensors. Nature. 426, 517-24. Clapper, D.L., Walseth, T.F., Dargie, P.J., Lee, H.C. (1987) Pyridine nucleotide metabolites stimulate calcium release from sea urchin egg microsomes desensitized to inositol trisphosphate. J. Biol. Chem. 262, 9561 68

174

Cuevas, J. and Adams, D.J. (1996) Vasoactive intestinal polypeptide modulation of nicotinic ACh receptor channels in rat intracardiac neurones. J. Physiol. 493, 503-515. Cuevas, J. and Berg, D.K. (1998). Mammalian nicotinic receptors with α7 subunits that slowly desensitize and rapidly recover from α-bungarotoxin blockade. J. Neurosci. 18, 10335-10344 Cuevas, J., Harper, A.A., Trequattrini, C., and Adams, D.J. (1997) Passive and active membrane properties of isolated rat intracardiac neurons: regulation by H- and M-currents. J. Neurophysiol. 78, 1890-1902. DeHaven, W.I. and Cuevas, J. (2002) Heterogeneity of pituitary adenylate cyclase-activating polypeptide and vasoactive intestinal polypeptide receptors in rat intrinsic cardiac neurons. Neurosci. Lett. 328, 45-49. DeHaven, W.I. and Cuevas, J. (2004) VPAC receptor modulation of neuroexcitability in intracardiac neurons: dependence on intracellular calcium mobilization and synergistic enhancement by PAC1 receptor activation. J. Biol. Chem. 279, 40609-21. Della, N.G., Papka, R.E., Furness, J.B. and Costa, M. (1983) Vasoactive intestinal peptide-like immunoreactivity in nerves associated with the cardiovascular system of guinea pigs. J. Neurosci. 9, 605-619. Dickerson, L.W., Rodak, D.J., Fleming, T.J., Gatti, P.J., Massari, V.J., McKenzie, J.C., and Gillis, R.A. (1997) Parasympathetic neurons in the cranial medial ventricular fat pad on the dog heart selectively decrease ventricular contractility without effect on sinus rate or A-V conduction. Soc Neurosci Abstr 23, 1516. Diochot, S., Schweitz, H., Beress, L., Lazdunski, M. (1998) Sea anemone peptides with a specific blocking activity against the fast inactivating potassium channel Kv3.4. J. Biol Chem. 273, 6744-9. Duggan, K.A., Ye, V.Z. (1998) Effects of enalapril on vasoactive intestinal peptide metabolism and tissue levels. Eur J Pharmacol. 358, 25-30. Edwards, F.R., Hirst, G.D.S., Klemm, M.F., and Steele, P.A. (1995) Different types of ganglion cell in the cardiac plexus of guinea-pigs. J. Physiol. 486.2, 453-471. Fahrenkrug, J. (1993) Transmitter role of vasoactive intestinal peptide. Pharmacology & Toxicology. 72, 354-63.

175

Farmer, S.G., Togo, J. (1990) Effects of epithelium removal on relaxation of airway smooth muscle induced by vasoactive intestinal peptide and electrical field stimulation. Br J Pharmacol. 100, 73-78. Feliciano, L. and Henning, R.J. (1998) Vagal nerve stimulation during muscarinic and beta-adrenergic blockade causes significant coronary artery dilation. J. Auton. Nerv. Sys. 68, 78-88. Fieber, L.A. and Adams, D.J. (1991) Acetylcholine-evoked currents in cultured neurons dissociated from rat parasympathetic cardiac ganglia. J. Physiol. 434, 215-237. Fill, M., Copello, J.A. (2002) Ryanodine receptor calcium release channels. Physiol Rev. 82, 893-922. Franciolini, F., Hogg, R., Catacuzzeno, L., Petris, A., Trequattrini, C., Adams, D.J. (2001) Large-conductance calcium-activated potassium channels in neonatal rat intracardiac ganglion neurons. Eur. J. Physiol. 441, 629-638. Franco-Cereceda, A., Bengtsson, L., and Lundberg, J.M. (1987) Inotropic effects of calcitonin gene-related peptide, vasoactive intestinal polypeptide and somatostatin on the human right atrium in vitro. Eur. J. Pharmacol. 134, 69-76. Fukuhara, C., Inouye, S.I., Matsumoto, Y., Tsujimoto, G., Aoki, K. and Masuo, Y. (1998) Pituitary adenylate cyclase-activating polypeptide rhythm in the rat pineal gland. Neurosci Lett 241, 115–119. Galione, A., Lee, H.C., Busa, W.B. (1991) Ca2+-induced Ca2+ release in sea urchin egg homogenates: modulation by cyclic ADP-ribose. Science 253, 114346. Gatti, P.J., Johnson, T.A., McKenzie, J.C., Lauenstein, J.M., Gray, A.L., and Massari, V.J. (1997) Vagal control of left ventricular contractility is selectively mediated by a cranioventricular intracardiac ganglion in the cat. J Auton Nerv Syst 66, 138–144. Gatti, P.J., Johnson, T.A., Phan, P., Jordan, I.K., Coleman, W., and Massari, V.J. (1995) The physiological and anatomical demonstration of functionally selective parasympathetic ganglia located in discrete fat pads on the feline myocardium. J Auton Nerv Syst 51, 255–259. Gonzalez, B.J., Basille, M., Vaudry, D., Fournier, A. and Vaudry, H. (1997) Pituitary adenylate cyclase-activating polypeptide promotes cell survival and neurite outgrowth in rat cerebellar neuroblasts. Neuroscience 78, 419–430.

176

Gottschall, P.E., Tatsuno, I., and Arimura, A. (1991) Hypothalamic binding sites for pituitary adenylate cyclase activating polypeptide: characterization and molecular identification. FASEB J. 5, 194-199. Gottschall, P.E., Tatsuno, I., Miyata, A., and Arimura, A. (1990) Characterization and distribution of binding sites for the hypothalamic peptide, pituitary adenylate cyclase-activating polypeptide. Endocrinology. 127, 272-277. Gourlet, P., Vandermeers, A., Vandermeers-Piret, M-C., Rathe, J., De Neef, P., & Robberecht, P. (1995) Fragments of pituitary adenylate cyclase polypeptide discriminate between type I and type II recombinant receptors. Eur. J. Pharm. 287, 7-11. Gray, A.L., Johnson, T.A., Ardell, J.L., massari, V.J. (2004) Parasympathetic control of the heart. II. A novel interganglionic intrinsic cardiac circuit mediates neural control of heart rate. J Appl Physiol 96, 2273–2278. Grimaldi, M. and Cavallaro, S. (2000) Expression and coupling of PACAP/VIP receptors in cortical neurons and type I astrocytes. Ann. N. Y. Acad. Sci. 921, 312-316. Grimaldi, M., Maratos, M., Verma, A. (2003) Transient receptor potential channel activation causes a novel form of [Ca2+]i oscillations and is not involved in capacitative Ca2+ entry in glial cells. J Neurosci. 23, 4737-4745. Gulbenkian, S., Saetrum Opgaard, O., Ekman, R., Costa Andrade, N., Wharton, J., Polak, J.M., Queiroz e Melo, J., and Edvinsson, L. (1993) Peptidergic innervation of human epicardial coronary arteries. Circ. Res. 73, 579-588. Halaszovich, C.R., Zitt, C., Jungling, E., Luckhoff, A. (2000) Inhibition of TRP3 channels by lanthanides. Block from the cytosolic side of the plasma membrane. J Biol Chem. 275, 37423-8. Hashimoto, H., Shintani, N., and Baba, A. (2002) Higher brain functions of PACAP and a homologous Drosophila memory gene amnesiac: insights from knockouts and mutants. Biochem. Biophys. Res. Commun. 297, 427-431. Henning, R.J. (1992) Vagal stimulation during muscarinic and beta-adrenergic blockade increases atrial contractility and heart rate. J. Auton. Nerv. Sys. 40, 121-129. Henning, R.J., and Sawmiller, D.R. (2000) Vasoactive intestinal peptide: cardiovascular effects. Cardiovascular Research. 49, 27-37.

177

Hille, B. (1992) G protein-coupled mechanisms and nervous signaling. Neuron. 9, 187-195. Hirose, M., Furukawa, Y., Nagashima, Y., Lakhe, M., Miyashita, Y., and Chiba, S. (1997) PACAP-27 causes negative and positive dromotropic effects in anesthetized dogs. Eur. J. Pharmacol. 338, 35-42. Hirose, M., Y. Furukawa, Y. Nagashima, M. Lakhe and S. Chiba (1997) Pituitary adenylate cyclase-activating polypeptide-27 causes a biphasic chronotropic effect and atrial fibrillation in autonomically decentralized, anesthetized dogs. J. Pharmacol. Exp. Ther. 283, 478–487. Hoesch, R.E., Weinreich, D., Kao, J.P.Y. (2004) Localized IP3-Evoked Ca2+ Release Activates a K+ Current in Primary Vagal Sensory Neurons. J Neurophysiol 91, 2344-2352. Horackova, M., Slavikova, J., and Byczko, Z. (2000) Postnatal development of the rat intrinsic cardiac nervous system: a confocal laser scanning microscopy study in whole-mount atria. Tissue Cell. 32, 377-388. Horn, R., Marty, A. (1988) Muscarinic activation of ionic currents measured by a new whole-cell recording method. J Gen Physiol. 92, 145-159. Hoth, M. and Penner, R. (1992) Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355, 353–355. Hu, H.Z., Gu, Q., Wang, C., Colton, C.K., Tang, J., Kinoshita-Kawada, M., Lee, L.Y., Wood, J.D., Zhu, M.X. (2004) 2-aminoethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3. J Biol Chem. 279, 35741-8. Huang, M., Shirahase, H., and Rorstad, O.P. (1993) Comparative study of vascular relaxation and receptor binding by PACAP and VIP. Peptides. 14, 755-762. Ingram, S.L. and Williams J.T. (1994). Opioid inhibition of Ih via adenylyl cyclase. Neuron. 13, 179-186 Ishihara, T., Shigemoto, R., Mori, K., Takahashi, K., Nagata, S. (1992) Functional expression and tissue distribution of a novel receptor for vasoactive intestinal polypeptide. Neuron. 8, 811-819.

178

Ishizuka, Y., Kashimoto, K., Mochizuk, I.T., Sato, K., Ohshima, K., and Yanaihara, N. (1992) Cardiovascular and respiratory actions of pituitary adenylate cyclase-activating polypeptides. Regul. Pept. 40, 29-39. Itoh, N., Obata, K.-I., Yanaihara, N., and Okamoto, H. (1983) Human preprovasoactive intestinal polypeptide contains a novel PHI-27-like peptide, PHM-27. Nature (Lond.) 304, 547-549. Jacobowitz, D., Cooper, T., & Barner, H.B. (1967) Histochemical and chemical studies of the localization of adrenergic and cholinergic nerves in normal and denervated cat hearts. Circulation Research. 20, 289-298. Jobling, P., Mclachlan, E. M., and Sah, P. (1993) Calcium induced calcium release is involved in the afterhyperpolarization in one class of guinea pig sympathetic neuron. J. Auton. Nerv. Syst. 42, 251–258. Johnson, T.A., Gray, A.L., Lauenstein, J-M., Newton, S.S., and Massari, V.J. (2004) Parasympathetic control of the heart. I. An interventriculo-septal ganglion is the major source of the vagal intracardiac innervation of the ventricles. J Appl Physiol 96, 2265–2272. Jung, S., Muhle, A., Schaefer, M., Strotmann, R., Schultz, G., Plant, T.D. (2002) Lanthanides potentiate TRPC5 currents by an action at extracellular sites close to the pore mouth. J Biol Chem. 278, 3562-3571. Karasawa, Y., Furukawa, Y., Ren, L., Takei, M., Murakami, M., Narita, M., and Chiba, S. (1990) Cardiac responses to VIP and VIP-ergic-cholinergic interaction in isolated dog heart preparations. Eur. J. Pharmacol. 187, 9-17. Kase, H., Wakui, M., and Petersen, O.H. (1991) Stimulatory and inhibitory actions of VIP and cyclic AMP on cytoplasmic Ca2+ signal generation in pancreatic acinar cells. Pflugers Arch. Eur. J. Physiol. 419, 668-670. Kawai, T. and Watanabe, M. (1989) Effects of ryanodine on the spike after-hyperpolarization in sympathetic neurones of the rat superior cervical ganglion. Eur. J. Physiol. 413, 470–475. Kawai, T. and Watanabe, M. (1991) Ryanodine suppresses the frequency-dependent component of the spike after-hyperpolarization in the rat superior ganglion. Jpn. J. Pharmacol. 55, 367–374. Kawasaki, J., Kobayashi, S., Miyagi, Y., Nishimura, J., Fujishima, M., and Kanaide, H. (1997) The mechanisms of the relaxation induced by vasoactive intestinal peptide in the porcine coronary artery. Br. J. Pharmacol. 121, 977-985.

179

Kawatani, M., Rutigliano, M., de Groat, W.C. (1985) Depolarization and muscarinic excitation induced in a sympathetic ganglion by vasoactive intestinal polypeptide. Science. 229, 879-881. King, T-S., and Coakley, J.B. (1958) The intrinsic nerve cells of the cardiac atria of mammals and man. J Anatomy. 92, 353-379. Kohlmeier, K.A. and Reiner, P.B. (1999) Vasoactive intestinal polypeptide excites medial pontine reticular formation neurons in the brainstem rapid eye movement sleep-induction zone. J. Neurosci. 19, 4073-4081. Krause, J.E., Chenard, B.L., Cortright, D.N. (2005) Transient receptor potential ion channels as targets for the discovery of pain therapeutics. Curr Opin Investig Drugs. 6, 48-57. Lam, H.C., Takahashi, K., Ghatei, M.A., Kanse, S.M., Polak, J.M., and Bloom, S.R. (1990) Binding sites of a novel neuropeptide pituitary-adenylate-cyclase-activating polypeptide in the rat brain and lung. Eur. J. Biochem. 193, 725-729. Langer, I., Perret, J., Vertongen, P., Waelbroeck, M., and Robberecht, P. (2001) Vasoactive intestinal peptide (VIP) stimulates [Ca2+]i and cyclic AMP in CHO cells expressing Galpha16. Cell Calcium. 30, 229-234. Lee, H.C., Aarhus, R., Graeff, R.M. (1995) Sensitization of calcium-induced calcium release by cyclic ADP-ribose and calmodulin. J. Biol. Chem. 270, 906066 Lee, H.C. (1993) Potentiation of calcium- and caffeine-induced calcium release by cyclic ADP-ribose. J. Biol. Chem. 268, 293 99 Lee, H.C. (2001) Physiological functions of cyclic ADP-ribose and NAADP as calcium messengers. Annu. Rev. Pharmacol. Toxicol. 41, 317-45 . Lee, S.H. and Cox, C.L. (2003) Vasoactive intestinal peptide selectively depolarizes thalamic relay neurons and attenuates intrathalamic rhythmic activity. J. Neurophysiol. 90, 1224-1234. Leech, C.A., Holz, G.G., and Habener, J.F. (1995) Pituitary adenylate cyclase-activating polypeptide induces the voltage-independent activation of inward membrane currents and elevation of intracellular calcium in HIT-T15 insulinoma cells. Endocrinology. 136, 1530-1536.

180

Li, P-L., Tang, W-X., Valdivia, H-H., Zou, A-P, and Campbell, W.B. (2001) cADP-ribose activates reconstituted ryanodine receptors from coronary arterial smooth muscle. Am J Physiol Heart Circ Physiol. 280, 208-215. Liang, M., Chini, E.N., Cheng, J., Dousa, T.P. (1999) Synthesis of NAADP and cADPR in mitochondria. Arch Biochem Biophys. 371, 317-25. Liu, D-M., Cuevas, J., and Adams, D.J. (2000) VIP and PACAP potentiation of nicotinic ACh-evoked currents in rat parasympathetic neurons is mediated by G-protein activation. Eur. J. Neurosci. 12, 2243-2251. Lokuta, A.J., Darszon, A., Beltran, C., Valdivia, H.H. (1998) Detection and functional characterization of ryanodine receptors from sea urchin eggs. J. Physiol. 510.1, 155 64 Lucia, P., Caiola, S., Coppola, A., Manetti, L.L., Maroccia, E., Buongiorno, A.M., De Martinis, C. (2003) Vasoactive intestinal peptide (VIP): a new neuroendocrine marker of clinical progression in chronic heart failure? Clin Endocrinol 59, 723-727. Lundberg, J.M. (1981) Evidence for coexistence of vasoactive intestinal polypeptide (VIP) and acetylcholine in neurons of cat exocrine glands. Acta. Physiol. Scand. 496 (suppl. 112), 1-57. Lundberg, J.M. (1996) Pharmacology of cotransmission in the autonomic nervous system: integrative aspects on amines, neuropeptides, adenosine triphosphate, amino acids and nitric oxide. Pharmacol Rev. 48, 113-178. Lundberg, J.M., and Tatemoto, K. (1982) Pancreatic polypeptide family (APP, BPP, NPY, and PYY)in relation to sympathetic vasoconstriction resistant to alpha-adrenoceptor blockade. Acta. Physiol. Scand. 116, 393-402. Luo, X., Zeng, W., Xu, X., Popov, S., Davignon, I., Wilkie, T.M., Mumby, S.M., and Muallem S. (1999) Alternate coupling of receptors to Gs and Gi in pancreatic and submandibular gland cells. J. Biol. Chem. 274, 17684-17690. Lutz, E.M., Sheward, W.J., West, K.M., Morrow, J.A., Fink, G., Harmar, A.J. (1993) The VIP2 receptor: molecular characterisation of a cDNA encoding a novel receptor for vasoactive intestinal peptide. FEBS Letters. 334, 3-8. Luu, T.N., Dashwood, M.R., Chester, A.H., Tadjkarimi, S., and Yacoub, M.H. (1993) Action of vasoactive intestinal peptide and distribution of its binding sites in vessels used for coronary artery bypass grafts. Am J Cardiol. 71, 1278-1282.

181

Lytton, J., Westlin, M., and Hanley, M.R. (1991) Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J. Biol. Chem. 266, 17067-17071. MacKenzie, C.J., Lutz, E.M., Johnson, M.S., Robertson, D.N., Holland, P.J., and Mitchell, R. (2001) Mechanisms of phospholipase C activation by the vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide type 2 receptor. Endocrinology. 142, 1209-1217. Maruyama, T., Kanaji, T., Nakade, S., Kanno, T., Mikoshiba, K. (1997). 2APB, 2-aminoethoxydiphenyl borate, a membrane-penetrable modulator of Ins(1,4,5)P3-induced Ca2+ release. J. Biochem. (Tokyo). 122, 498-505. Massari, V.J., Johnson, T.A., and Gatti, P.J. (1995) Cardiotopic organization of the nucleus ambiguus? An anatomical and physiological analysis of neurons regulating atrio-ventricular conduction. Brain Res 679, 227–240. Massari, V.J., Johnson, T.A., Gillis, R.A., and Gatti, P.J. (1996) What are the roles of substance P and neurokinin-1 receptors in the control of negative chronotropic and negative dromotropic vagal motoneurons? A physiological and ultrastructural analysis. Brain Res 693, 133–147. Massari, V.J., Johnson, T.A., Llewellyn-Smith, I.J., and Gatti, P.J. (1994) Substance P neurons synapse upon negative chronotropic vagal motoneurons. Brain Res 660, 275–287. McCulloch, D.A., Lutz, E.M., Johnson, M.S.,Robertson, D.N., MacKenzie, C.J., Holland, P.J. and Mitchell, R. (2001) ADP-ribosylation factor-dependent phospholipase D activation by VPAC receptors and a PAC(1) receptor splice variant. Mol. Pharmacol. 59, 1523–1532. Merriam, L.A., Barstow, K.L., Parsons, R.L. (2004) Pituitary adenylate cyclase-activating polypeptide enhances the hyperpolarization-activated nonselective cationic conductance, Ih, in dissociated guinea pig intracardiac neurons. regulatory Peptides 123, 123-133. Meissner, G. (2004) Molecular regulation of cardiac ryanodine receptor ion channel. Cell Calcium. 35, 621-8. Miura, A., Kawatani, M., de Groat, W.C. (2001) Effects of pituitary adenylate cyclase activating polypeptide on lumbosacral preganglionic neurons in the neonatal rat spinal cord. Brain Res. 895, 223–232

182

Miyata, A., Arimura, A., Dahl, R.R., Minamino, N., Uehara, A., Jiang, L., Culler, M.D., Coy, D.H. (1989) Isolation of a novel 38 residue-hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun 164, 567-574. Montell, C., Rubin, G.M. (1989) Molecular characterization of the Drosophila TRP locus: a putative integral membrane protein required for phototransduction. Neuron 2 1313-1323. Moore, K.A., Cohen, A.S., Kao, J.P., and Weinreich, D. (1998) Ca2+-induced Ca2+ release mediates a slow post-spike hyperpolarization in rabbit vagal afferent neurons. J Neurophysiol 79, 688-694. Moravec, J. and Moravec, M. (1987) Intrinsic nerve plexus of mammalian heart: Morphological basis of cardiac rhythmical activity? Internat. Rev. Cytology. 106, 89-147. Moro, O. and Lerner, E.A. (1997) Maxadilan, the vasodilator from sand flies, is a specific pituitary adenylate cyclase activating peptide type I receptor agonist. J. Biol. Chem. 272, 966-970. Muraki, K., Imaizumi, Y., Bolton, T.B., Watanabe, M. (1998) Comparative study of effects of isoproterenol and vasoactive intestinal polypeptide on voltage dependent Ca2+ and Ca2+-activated K+ currents in porcine tracheal smooth muscle cells. General Pharm. 30, 115-9. Murase, T., Kondo, K., Otake, K. and Oiso, Y. (1993) Pituitary adenylate cyclase activating polypeptide stimulates arginine vasopressin release in conscious rats. Neuroendocrinology 57, 1092–1096. Mutt, V., and Said, S.I. (1974) Structure of the porcine vasoactive intestinal octacosapeptide. The amino-acid sequence. Use of kallikrein in its determination. Eur. J. Biochem. 42, 581-589. Nicoll, R.A. (1988) The coupling of neurotransmitter receptors to ion channels in the brain. Science 241, 545–551. Nilsson, S.F.E. (1994) PACAP-27 and PACAP-38: vascular effects in the eye and some other tissues in the rabbit. Eur. J. Pharmacol. 253, 17-25. Nussdorfer, G.G., and Malendowicz, L.K. (1998) Role of VIP, PACAP, and related peptides in the regulation of the hypothalamo-pituitary-adrenal axis. Peptides. 19, 1443-1467.

183

Ogi, K., Kimura, C., Onda, H., Arimura, A., Fujino, M. (1990) Molecular cloning and characterization of cDNA for the precursor of rat pituitary adenylate cyclase activating polypeptide (PACAP). Biochem Biophys Res Commun 173, 1271-1279 Ohkubo, S., Kimura, C., Ogi, K., Okazaki, K., Hosoya, M., Onda, H., Miyata, A., Arimura, A., Fujino, M. (1992) Primary structure and characterization of the precursor to human pituitary adenylate cyclase activating polypeptide. DNA Cell Biol. 11, 21-30 Okazaki, K., Itoh, Y., Ogi, K., Ohkubo, S., Onda, H. (1995) Characterization of murine PACAP mRNA. Peptides 16, 1295-1299 Pantaloni, C., Brabet, P., Bilanges, B., Dumuis, A., Houssami, S., Spengler, D., Bockaert, J., and Journot, L. (1996) Alternative splicing in the N-terminal extracellular domain of the pituitary adenylate cyclase-activating polypeptide (PACAP) receptor modulates receptor selectivity and relative potencies of PACAP-27 and PACAP-38 in phospholipase C activation. J. Biol. Chem. 271, 22146-22151. Parekh, A.B. and Penner, R. (1997) Store depletion and calcium influx. Physiol. Rev. 77, 901–930. Parsons, R.L., Rossignol, T.M., Calupca, M.A., Hardwick, J.C., Brass, K.M. (2000) PACAP peptides modulate guinea pig cardiac neuron membrane excitability and neuropeptide expression. Ann N Y Acad Sci. 921, 202-210. Payet, M.D., Bilodeau, L., Breault, L., Fournier, A., Yon, L., Vaudry, H., and Gallo-Payet, N. (2003) PAC1 receptor activation by PACAP-38 mediates Ca2+ release from a cAMP-dependent pool in human fetal adrenal gland chromaffin cells. J. Biol. Chem. 278, 1663-70. Pedarzani, P., Kulik, A., Muller, M., Ballanyi, K., Stocker, M. (2000) Molecular determinants of Ca2+-dependent K+ channel function in rat dorsal vagal neurons. J. Physiol. 527.2, 283-290. Perez, C.F., Marengo, J.J., Bull, R., Hidalgo, C. (1998) Cyclic ADP-ribose activates caffeine-sensitive calcium channels from sea urchin egg microsomes. Am. J. Physiol. 274, 430 39 Phillips, A.M., Bull, A., Kelly, L.E. (1992) Identification of a Drosophila gene encoding a calmodulin binding protein with homology to the trp phototransduction gene. Neuron 8, 631-642.

184

Phillips, A.M., Bull, A., Kelly, L.E. (1992) Identification of a Drosophila gene encoding a calmodulin binding protein with homology to the trp phototransduction gene. Neuron 8, 631-642. Popma, J.J., Smitherman, T.C., Bedotto, J.B., Eichhorn, E.J., Said, S.I. and Dehmer, G.J. (1990) Direct coronary vasodilation induced by intracoronary vasoactive intestinal peptide. J Cardiovasc Pharmacol. 16, 1000-1006. Poth, K. Nutter, T.J. Cuevas, J., Parker, M.J. Adams, D.J., Luetje, C.W. (1997) Heterogeneity of nicotinic receptor class and subunit mRNA expression among individual parasympathetic neurons from rat intracardiac ganglia. J of Neurosci. 17, 586-96. Prakash, Y.S., Prakash YS, Kannan MS, Walseth TF, Sieck GC. (2000) cADP ribose and [Ca(2+)](i) regulation in rat cardiac myocytes. Am J Physiol Heart Circ Physiol. 279, 1482-1489. Putney, J.W. Jr (1986) A model for receptor-regulated calcium entry. Cell Calcium 7, 1–12. Putney, J.W. Jr (2004) The enigmatic TRPCs: multifunctional cation channels. TRENDS in Cell Biol. 14, 282-286. Putney, J.W. Jr, Broad, L.M., Braun, F-J., Lievremont, J-P., Bird, G. St. J. (2001) Mechanisms of capacitative calcium entry. J. Cell Science. 114, 2223-2229. Rae, J., Cooper, K., Gates, P. and Watsky, M. (1991) Low access resistance perforated patch recordings using amphotericin B. J. Neurosci. Methods. 37, 15-26. Randall, W.C. and Wurster, R.D. (1994) Peripheral innervation of the heart. Vagal Control of the Heart: Experimental Basis and Clinical Implications. Futura, New York. Rawlings, S.R., Piuz, I., Schlegel, W., Bockaert, J., and Journot, L. (1995) Differential expression of pituitary adenylate cyclase-activating polypeptide/vasoactive intestinal polypeptide receptor subtypes in clonal pituitary somatotrophs and gonadotrophs. Endocrinology. 136, 2088-2098. Richardson, R.J., Grkovic, I., Anderson, C.R. (2003) Immunohistochemical analysis of intracardiac ganglia of the rat heart. Cell Tissue Res. 314, 337-50. Rigel, D.F. (1998) Effects of neuropeptides on heart rates of dogs: Comparison of VIP, PHI, NPY, CGRP, and NT. Am. J. Physiol. 255, 311-317.

185

Rigel, D.F., Lathrop, D.A. (1990) Vasoactive intestinal polypeptide facilitates atrioventricular nodal conduction and shortens atrial and ventricular refractory periods in conscious and anesthetized dogs. Circ Res. 67, 1323-1333. Rigel, D.F., Grupp, I.L., Balasubramaniam, A., and Grupp, G. (1989) Contractile effects of cardiac neuropeptides in isolated canine atrial and ventricular muscles. American J. Physiol. 257, 1082-1087. Robberecht, P., Gourlet, P., De Neef, P., Woussen-Colle, M.C., Vandermeers-Piret, M.C., Vandermeers, A., and Christophe, J. (1992) Structural requirements for the occupancy of pituitary adenylate-cyclase-activating-peptide (PACAP) receptors and adenylate cyclase activation in human neuroblastoma NB-OK-1 cell membranes. Discovery of PACAP(6-38) as a potent antagonist. Eur. J. Biochem. 207, 239-246. Ross-Ascuitto, N.T., Ascuitto, R.J., Ramage, D., Kydon, D.W., Coy, D.H. and Kadowitz, P.J. (1993) Pituitary adenylate cyclase activating polypeptide: a neuropeptide with potent inotropic and coronary vasodilatory effects in neonatal pig hearts. Pediatr. Res. 34, 323–328. Rubino, A., Hassall, C.J.S. and Burnstock, G. (1996) Autonomic control of the myocardium: Non-adrenergic non-cholinergic (NANC) mechanisms. In Shepherd, J.T. & Vatner, S.F. (eds) Nervous Control of the Heart. Harwood Academic Publishers, The Netherlands. 139-171. Sah, P. and Louise Faber, E.S. (2002) Channels underlying neuronal calcium-activated potassium currents. Prog Neurobiol 66, 345-53. Sah, P. and Mclachlan, E. M. (1992) Potassium currents contributing to action potential repolarization and the afterhyperpolarization in rat vagal moto-neurons. J. Neurophysiol. 68, 1834–1841. Sah, P. and Mclachlan, E.M. (1991) Ca2+-activated K+ currents underlying the afterhyperpolarization in guinea pig vagal neurons: a role for Ca2+- activated Ca2+

release. Neuron 7, 257–264. Said, S.I., and Mutt, V. (1970) Potent peripheral and splanchnic vasodilator peptide from normal gut. Nature (Lond). 225, 863-864. Sawmiller, D.R., Henning, R.J., Cuevas, J., DeHaven, W.I., Vesely, D.L. (2004) Coronary vascular effects of vasoactive intestinal peptide in the isolated perfused rat heart. Neuropeptides 38, 289-297.

186

Seabrook, G.R., Fieber, L.A., and Adams, D.J. (1990) Neurotransmission in neonatal rat cardiac ganglion in situ. Am J Physiol 259, H997-H1005. Seebeck, J., Schmidt, W.E., Kilbinger, H., Neumann, J., Zimmermann, N., and Herzig, S. (1996) PACAP induces bradycardia in guinea-pig heart by stimulation of atrial cholinergic neurones. Naunyn-Schmiedebergs Arch. Pharmacol. 354, 424-430. Seki, Y., Suzuki, Y., Baskaya, M.K., Saito, K., Takayasu, M., Shibuya, M. and Sugita, K. (1995) Central cardiovascular effects induced by intracisternal PACAP in dogs. Am J Physiol 269, 135–139. Shao, L.R., Halvorsrud, R., Borg-Graham, L., and Storm, J.F. (1999) The role of BK-type Ca2+-dependent K+ channels in spike broadening during repetitive firing in rat hippocampal pyramidal cells. J Physiol 521, 135-146. Shibuya, I., Kabashima, N., Tanaka, K., Setiadji, V.S., Noguchi, J., Harayama, N., Ueta, Y., Yamashita, H. (1998) Patch-clamp analysis of the mechanism of PACAP-induced excitation in rat supraoptic neurones. J Neuroendocrinol. 10, 759-768. Shivers, B.D., Gorcs, T.J., Gottschall, P.E. and Arimura, A. (1991) Two high affinity binding sites for pituitary adenylate cyclase-activating polypeptide have different tissue distributions. Endocrinology. 128, 3055. Sitsapesan, R., McGarry, S.J., Williams, A.J. (1995) Cyclic ADP-ribose, the ryanodine receptor and Ca2+ release. Trends Pharmacol Sci. 16, 386-91. Smith, A.B. and Adams, D.J. (1999) Met-enkephalin-induced mobilization of intracellular Ca2+ in rat intracardiac ganglion neurones. Neurosci. Lett. 264, 105-108. Smitherman, T.C., Popma, J.J., Said, S.I., Krejs, G.J., Dehmer, G.J. (1989) Coronary hemodynamic effects of intravenous vasoactive intestinal peptide in humans.Am J Physiol. 257, 1254-1262 Smyth, L.M., Bobalova, J., Mendoza, M.G., Lew, C., Mutafova-Yambolieva, V.N. (2004) Release of beta-nicotinamide adenine dinucleotide upon stimulation of postganglionic nerve terminals in blood vessels and urinary bladder. J Biol Chem. 279, 48893-903. Spengler, D., Waeber, C., Pantaloni, C., Holsboer, F., Bokaert, J., Seeburg, P.H. and Journot, L. (1993) Differential signal transduction by five splice variants of the PACAP receptor. Nature 365, 170–175.

187

Sreedharan, S.P., Patel, D.R., Huang, J.X., and Goetzl, E.J. (1993) Cloning and functional expression of a human neuroendocrine vasoactive intestinal peptide receptor. Biochem. Biophys. Res. Commun. 193, 546-553. Storm, J.F. (1987) Action potential repolarization and a fast afterhyperpolarization in rat hippocampal pyramidal cells. J. Physiol. 385, 733–759. Storm, J.F. (1990) Potassium currents in hippocampal pyramidal cells. Prog. Brain Res. 83, 161–187. Suda, K., Smith, D.M., Ghatei, M.A., and Bloom, S.R. (1992) Investigation of the interaction of VIP binding sites with VIP and PACAP in human brain. Neurosci. Lett. 137, 19-23. Sun, X., Gu, X.Q., Haddad, G.G. (2003) Calcium influx via L-and N-type calcium channels activates a transient large-conductance Ca2+-activated K+ current in mouse neocortical pyramidal cells. J. Neurosci. 23, 3639-3648. Svoboda, M., Tastenoy, M., Ciccarelli, E., Stievenart, M., and Christophe, J. (1993) Cloning of a splice variant of the pituitary adenylate cyclase-activating polypeptide (PACAP) type I receptor. Biochem. Biophys. Res. Commun. 195, 881. Takai, Y., Sugawara, R., Ohinata, H., Takai, A. (2004) Two types of non-selective cation channel opened by muscarinic stimulation with carbachol in bovine ciliary muscle cells. J. Physiol. 559.3, 899-922. Takasawa, S., Tohgo, A., Noguchi, N., Koguma, T., Nata, K., Sugimoto, T., Yonekura, H., Okamoto, H. (1993) Synthesis and hydrolysis of cyclic ADP-ribose by human leukocyte antigen CD38 and inhibition of the hydrolysis by ATP. J Biol Chem. 268, 26052-4. Tanaka, K., Shibuya, I., Nagatomo, T., Yamashita, H., Kanno, T. (1996) Pituitary adenylate cyclase-activating polypeptide causes rapid Ca2+ release from intracellular stores and long lasting Ca2+ influx mediated by Na+ influx-dependent membrane depolarization in bovine adrenal chromaffin cells. Endocrinology. 137, 956-966.

188

Tanaka, K., Shibuya, I., Uezono, Y., Ueta, Y., Toyohira, Y., Yanagihara, N., Izumi, F., Kanno, T., and Yamashita, H. (1998) Pituitary adenylate cyclase-activating polypeptide causes Ca2+ release from ryanodine/caffeine stores through a novel pathway independent of both inositol trisphosphates and cyclic AMP in bovine adrenal medullary cells. J. Neurochem. 70, 1652-1661. Tatsuno, I. and Arimura, A. (1994) Pituitary adenylate cyclase-activating polypeptide (PACAP) mobilizes intracellular free calcium in cultured type-2, but not type-1, astrocytes. Brain Res 662, 1–10. Thomas, J.M., Masgrau, R., Churchill, G.C., Galione, A. (2001) Pharmacological characterization of the putative cADP-ribose receptor. Biochem J. 359, 451-7. Tsuzuki, K., Xing, H., Ling, J., Gu, J.G. (2004) Menthol-induced Ca2+ release from presynaptic Ca2+ stores potentiates sensory synaptic transmission. J. Neurosci. 24, 762-771. Thureson-Klein, A., and Klein, R.L. (1990) Exocytosis from neuronal large dense-cored vesicles. Int. Rev. Cytol. 121, 67-126. Uchimura, D., Katafuchi, T., Hori, T., Yanaihara, N. (1996) Facilitatory effects of pituitary adenylate cyclase activating polypeptide (PACAP) on neurons in the magnocellular portion of the rat hypothalamic paraventricular nucleus (PVN) in vitro. J Neuroendocrinol. 8, 137-143. Unverferth, D.V., O'Dorisio, T.M., Miller, M.M., Uretsky, B.F., Magorien, R.D., Leier, C.V., Thompson, M.E., Hamlin, R.L. (1986) Human and canine ventricular vasoactive intestinal polypeptide: decrease with heart failure. J Lab Clin Med. 108, 11-16. Vaudry, D., Gonzalez, B.J., Basille, M., Yon, L., Fournier, A., Vaudry, H. (2000) Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev. 52, 269-324 Venkatachalam, K., Ma, H.T., Ford, D.L., Gill, D.L. (2001) Expression of functional receptor-coupled TRPC3 channels in DT40 triple receptor InsP3 knockout cells. J Biol Chem. 276, 33980-33985. Venkatachalam, K., Zheng, F., Gill, D.L. (2003) Regulation of canonical transient receptor potential (TRPC) channel function by diacylglycerol and protein kinase C. J Biol Chem. 278, 29031-40 Walseth, T.F., Lee, H.C. (1993) Synthesis and characterization of antagonists of cyclic-ADP-ribose-induced Ca2+ release. Biochim Biophys Acta. 1178, 235-42.

189

Wang, Y., Deshpande, M., Payne, R. (2002) 2-Aminoethoxydiphenyl borate inhibits phototransduction and blocks voltage-gated potassium channels in Limulus ventral photoreceptors. Cell Calcium. 32, 209-216. Warren, J.B., Donnelly, L.E., Cullen, S., Robertson, B.E., Ghatei, M.A., Bloom, S.R., and MacDermot, J. (1991) Pituitary adenylate cyclase-activating polypeptide: a novel, long-lasting, endothelium-independent vasorelaxant. Eur J Pharm. 197, 131-134. Weigl, L., Zidar, A., Gscheidlinger, R., Karel, A., and Hohenegger, M. (2003) Store operated Ca2+ influx by selective depletion of ryanodine sensitive Ca2+ pools in primary human skeletal muscle cells. Naunyn-Schmiedeberg’s Arch. Pharmacol. 367, 353-363. Weihe, E., Reinecke, M., and Forssmann, W.G. (1984) Distribution of vasoactive intestinal polypeptide-like immunoreactivity in the mammalian heart. Interrelation with neurotensin- and substance P-like immunoreactive nerves. Cell Tissue Res. 236, 527-540. Willmott, N.J., Galione, A., Smith, P.A. (1995) A cADP-ribose antagonist does not inhibit secretagogue-, caffeine- and nitric oxide-induced Ca2+ responses in rat pancreatic beta-cells. Cell Calcium. 18, 411-419. Wong, F., Schaefer, E.L., Roop, B.C., LaMendola, J.N., Johnson-Seaton, D., Shao, D. (1989) Proper function of the Drosophila trp gene product during pupal development is important for normal visual transduction in the adult. [Journal Article] Neuron. 3, 81-94. Xia, M., Sreedharan, S.P., and Goetzl, E.J. (1996) Predominant expression of type II vasoactive intestinal peptide receptors by human T lymphoblastoma cells: transduction of both Ca2+ and cyclic AMP signals. J. Clin. Immunol. 16, 21-30. Xi-Moy, S-X, Randall, W.C., & Wurster, R.D. (1993) Nicotinic and muscarinic synaptic transmission in canine intracardiac ganglion cells innervating the sinoatrial node. J Auton Nerv Syst. 47, 69-74. Xu, X.Z., Chien, F., Butler, A., Salkoff, L., Montell, C. (2000) TRPgamma, a drosophila TRP-related subunit, forms a regulated cation channel with TRPL. Neuron. 26, 647-57. Xu, Z.J. and Adams, D.J. (1992) Voltage-dependent sodium and calcium currents in cultured parasympathetic neurones from rat intracardiac ganglia. J. Physiol. 456, 425-441.

190

Xue, H.H., Zhao, D.M., Suda, T., Uchida, C., Oda, T., Chida, K., Ichiyama, A., and Nakamura, H. (2000). Store depletion by caffeine/ryanodine activates capacitative Ca(2+) entry in nonexcitable A549 cells. J. Biochem. 128, 329-336.

Yonezawa, T., Furukawa, Y., Lajhe, M., Nagashima, Y., Hirose, M., & Chiba, S. (1996) PACAP-38 activates parasympathetic nerves in isolated, blood-perfused dog atria. Euro J Pharmacol. 315, 289-296. Zhang, Z., Tang, J., Tikunova, S., Johnson, J.D., Chen, Z., Qin, N., Dietrich, A., Stefani, E., Birnbaumer, L. and Zhu, M.X. (2001) Activation of Trp3 by inositol 1,4,5-trisphosphate receptors through displacement of inhibitory calmodulin from a common binding domain. Proc Natl Acad Sci USA. 98, 3168-3173. Zhou, C.J., Yada, T., Kohno, D., Kikuyama, S., Suzuki, R., Mizushima, H., and Shioda, S. (2001) PACAP activates PKA, PKC and Ca(2+) signaling cascades in rat neuroepithelial cells. Peptides. 22, 1111-1117. Zocchi, E., Franco, L., Guida, L., Benatti, U., Bargellesi, A., Malavasi, F., Lee, H.C., De Flora, A. (1993) A single protein immunologically identified as CD38 displays NAD+ glycohydrolase, ADP-ribosyl cyclase and cyclic ADP-ribose hydrolase activities at the outer surface of human erythrocytes. Biochem Biophys Res Commun. 196, 1459-65.

ABOUT THE AUTHOR

Wayne Isley DeHaven was born in St. Petersburg, Florida on April 8,

1976, to Eugene W. and Kathy I. DeHaven. He received his elementary

education at Bear Creek and Azalea Middle Schools. In 1994, Wayne graduated

Boca Ciega High School in Gulfport, Florida. Wayne earned his bachelor’s

degree in Entomology from the University of Florida in 1998. Two years later,

Wayne earned his Master’s degree in Biomedical Sciences from Barry University

in Miami, Florida. In 2000, Wayne entered the Ph.D. program at the University of

South Florida College of Medicine to pursue further education and training in

science. Wayne completed his studies at the University of South Florida

Pharmacology and Therapeutics Department in the Spring of 2005.

Documents

PACAP and VIP Modulation of Neuroexcitability in Rat