Click here to load reader
Upload
maria-j-perez
View
218
Download
0
Embed Size (px)
Citation preview
Oxidative stress and apoptosis in fetal rat liver induced by maternal
cholestasis. Protective effect of ursodeoxycholic acid*
Maria J. Perez1, Rocio I.R. Macias2, Cristina Duran1, Maria J. Monte2,
Jose M. Gonzalez-Buitrago1, Jose J.G. Marin2,*
1Laboratory of Experimental Hepatology and Drug Targeting, Research Unit, University Hospital,
University of Salamanca, 37007 Salamanca, Spain2Laboratory of Experimental Hepatology and Drug Targeting, Department of Physiology and Pharmacology,
University of Salamanca, Campus Miguel de Unamuno E.I.D. S-09, 37007 Salamanca, Spain
Background/Aims: The sensitivity of fetal rat liver to maternal obstructive cholestasis during pregnancy (OCP), and
the effect of ursodeoxycholic acid (UDCA) were investigated.
Methods: UDCA was administered (i.g. 0.6 mg/kg b.wt./day) from day 14 to day 21 of pregnancy after maternal
common bile duct ligation.
Results: Impairment in the activity of antioxidant enzymes, levels of total glutathione and GSH/GSSG ratio and the
degrees of lipid peroxidation and protein carbonylation were similar in livers of OCP mothers and fetuses at term,
despite hypercholanemia was milder in fetuses. Treatment of OCP rats with UDCA reduced maternal and fetal liver
oxidative stress. Although maternal hypercholanemia was not corrected, fetal serum concentrations of major bile acids
(except UDCA and b-muricholic acid) were reduced. Fetal liver expression of key enzyme in bile acid synthesis,
Cyp7a1, Cyp27 and Cyp8b1 was not affected by OCP or UDCA treatment. In OCP fetal livers, the relative expression of
Bax-a and Bcl-2 and the activity of caspase-3, but not caspase-8, were increased. These changes were markedly reduced
in fetuses of OCP animals treated with UDCA.
Conclusions: OCP induced moderate fetal hypercholanemia but marked liver oxidative stress and apoptosis that
were partly prevented by treatment of pregnant rats with UDCA.
q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Keywords: Bax; Bile acid; Caspase; Glutathione; Pregnancy
1. Introduction
Several mechanisms may account for the cytotoxicity
associated with the most hydrophobic bile acids (BAs) in
0168-8278/$30.00 q 2005 European Association for the Study of the Liver. Pub
doi:10.1016/j.jhep.2005.02.028
Received 2 July 2004; received in revised form 21 January 2005; accepted 2 Fe* This study was supported in part by the Junta de Castilla y Leon (Grant SA
Ministerio de Sanidad y Consumo, Spain, alone (CP03/00093) and co-funded by th
y Tecnologıa, Plan Nacional de Investigacion Cientıfica, Desarrollo e Innovaci
Research Fellowships: the ‘Juan Rodes’ Research Fellowship from the Spanish A
from the Fundacion ‘Miguel Casado San Jose’, Salamanca, Spain. The group is m
Salud Carlos III, FIS (Grant G03/015), Spain.* Corresponding author. Tel.: C34 923 294674; fax: C34 923 294669.
E-mail address: [email protected] (J.J.G. Marin).
Abbreviations: BAs, bile acids; ICP, intrahepatic cholestasis of pregnancy; MC
ursodeoxycholic acid.
cholestatic diseases [1]. BAs may disrupt cell membranes
through their detergent action on lipid components [2] and can
promote the generation of reactive oxygen species that, in turn,
oxidatively modify lipids, proteins, and nucleic acids,
Journal of Hepatology 43 (2005) 324–332
www.elsevier.com/locate/jhep
lished by Elsevier B.V. All rights reserved.
bruary 2005; available online 3 May 2005
013/04 and Grant SA017/03) Spain. Fondo de Investigaciones Sanitarias,
e FEDER-FSE Program of the E.U. (Grant 01/1043). Ministerio de Ciencia
on Tecnologica (Grant BFI2003-03208). Dr Maria J. Perez received two
ssociation for the Study of the Liver (AEEH), and the Research Fellowship
ember of the Network for Cooperative Research on Hepatitis, Instituto de
A, muricholic acid; OCP, obstructive cholestasis during pregnancy; UDCA,
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 325
and eventually cause hepatocyte apoptosis [3]. Additionally,
they can activate Kupffer cells to generate reactive
oxygen species that may contribute to liver cell insult [4].
Two pathways are involved in triggering hepatocytes
apoptosis (for a review see [5]). Toxic BAs can activate Fas
death receptors directly [6] and induce oxidative damage
that causes mitochondrial dysfunction and apoptosis [7,8].
The Bcl-2 protein family plays a role in the regulation of the
mitochondria-mediated pathway. Two key representative
members of this family are the anti-apoptotic Bcl-2 and the
pro-apoptotic Bax [9–11].
Ursodeoxycholic acid (UDCA) has therapeutic useful-
ness in several cholestatic liver diseases (for a review,
see [12]). The major beneficial effects of treatment with
UDCA are protection against cytotoxicity due to more
toxic BAs [13], stimulation of hepatobiliary secretion
[14], antioxidant activity due in part to an enhancement
in glutathione levels [15,16] and inhibition of liver cells
apoptosis [7].
Intrahepatic cholestasis of pregnancy (ICP), usually
implies a benign condition for the mother. However, in
the conceptus it is associated with serious repercussions,
including increased fetal distress, premature delivery, and
perinatal mortality and morbidity (for a review, see [17]).
This is probably due to the higher sensitivity of more fragile
fetal developing organs to toxic BAs [18]. In addition, ICP
impairs placental functions, reducing the ability of the fetus
to eliminate BAs towards the maternal blood [19], which
may aggravate the situation.
Like several other cholestatic disorders, ICP has been
shown to respond to UDCA treatment with a reduction in
maternal pruritus, a normalization of biochemical par-
ameters, including serum bilirubin and transaminases, and a
decrease in the number of premature deliveries [20].
Although UDCA administration to pregnant women induces
changes in the fetal BA pool [21], several studies have
indicated that treatment of ICP with UDCA has no risk for
the mother or the fetus [22,23].
Table 1
Morphological and biochemical parameters
Mothers
Control OCP OCPC
Body weight (g) 377G12a 314G17 346G
Liver weight (g) 11.9G0.5 13.3G1.0 13.4G
Fetuses per pregnancy 13.7G0.8a 8.3G0.8 12.7GTotal bile acids (mmol/L) 13G3a 238G29 275G
Total bilirubin (mg/dL) 0.18G0.03a 2.85G0.75 0.39G
Alkaline phosphatase (UI/L) 98G9b 185G15 128GGGT (UI/L) 5.8G0.4b 10.5G1.4 12.8G
LDH (UI/L) 1175G167b 1936G128 2161G
GPT (UI/L) 18G2b 37G5 45G
GOT (UI/L) 100G15b 401G57 515G
Biochemical parameters were determined in blood samples on day 21 of pregnancy
cholestasis (OCP), or OCP followed by i.g. treatment with UDCA (OCPCUDCA, 60
meansGSEM. aP!0.05; bP!0.01 on comparing with OCP by the Bonferroni me
The present study, carried out on an experimental model of
complete obstructive cholestasis (OCP) during the last third
of pregnancy in the rat, was undertaken to investigate whether
maternal cholestasis causes oxidative stress and apoptosis in
fetal liver and whether treatment of pregnant rats with UDCA
has beneficial effects. Although with a different etiology and
degree of impairment in biliary function, the experimental
model of OCP shares two important characteristics with
human ICP: the presence of marked maternal hypercholane-
mia, to which the conceptus is exposed, and a reduction in the
amount of BAs that reaches the maternal intestine, which
limits the absorption of dietary fat and liposoluble vitamins.
Other alternative models of cholestasis, such as drugs- or
hormones-induced cholestasis, which would be closer to the
actual situation of partial cholestasis occurring in ICP, were
not selected due to potential placental transfer and inter-
ference of cholestatic agents with fetal liver function.
2. Materials and methods
2.1. Animals and experimental design
Pregnant Wistar CF rats (University of Salamanca, Spain) were used.The experimental protocols were approved by the Local Ethical Committeefor the Use of Laboratory Animals. On day 14 of pregnancy, the rats wereanesthetized with ether and a sham operation (Control group) or completebiliary obstruction (OCP group) was performed as previously described[24]. In brief, using a non-absorbable suture, a double ligation separated by2 mm was carried out. The common bile duct was divided between theligations. During the following week, some of these animals (OCPCUDCAgroup) received daily intragastric administration of UDCA (60 mg/100 gb.wt.). This apparently low dose of UDCA was selected based on previousstudies on OCP, in which maternal serum BA concentrations were found toreach values 16-fold higher than in Controls. After receiving approximately3 mmol UDCA over the last week of pregnancy these values were furtherincreased by approximately 20% [25].
On day 21 of pregnancy, the animals were sacrificed under sodiumpentobarbital anesthesia. Liver and serum samples from the mothers andfetuses were collected [25], frozen in liquid nitrogen and stored at K80 8Cfor further use. Some morphological and biochemical characteristics ofthese experimental groups are shown in Table 1.
Fetuses
UDCA Control OCP OCPCUDCA
12 5.17G0.05a 4.77G0.05 4.67G0.03
0.6 0.31G0.01 0.30G0.01 0.30G0.01
0.4a
31 18G3a 47G5 33G4
0.07a 0.30G0.03a 0.66G0.05 0.31G0.03a
11a 975G58a 1242G61 1319G77
1.9 6.6G0.6 7.3G0.5 7.4G1.2
287 3102G198 2652G351 2653G272
9 23G5 27G5 22G4
62 350G23 361G25 369G22
. On day 14, pregnant rats underwent a sham operation (Control), obstructive
mg/100 g b.wt./day). In all groups nZ6 mothers and R12 fetuses. Values are
thod of multiple range testing.
Table 2
Oligonucleotide sequences of primers used for real-time quantitative PCR determinations of the relative abundance of mRNA
Gene Forward primer (50-30) Reverse primer (5 0-30) Accession number Product
size
Position (5 0-3 0)
Bax-a ATGGAGCTGCAGAGGATGATT TGAAGTTGCCATCAGCAAACA NM_017059 97 bp 220–316
Bcl2 TGGGATGCCTTTGTGGAACT TCTTCAGAGACTGCCAGGAGAAA U34964 73 bp 574–646
Cyp7a1 GCTTTACAGAGTGCTGGCCAA CTGTCTAGTACCGGCAGGTCATT NM012942 92 bp 987–1078
Cyp27 CCTTTGGGACTCGCACCA GCCCTCCTGTCTCATCACTTG M73231 71 bp 748–818
Cyp8b1 GTACACATGGACCCCGACATC GGGTGCCATCAGGGTTGAG AB009686 76 bp 1195–1270
Cyp7a1, cholesterol 7a-hydroxylase; Cyp27, sterol 27-hydroxylase; Cyp8b1, sterol 12a-hydroxylase.
Fig. 1. Bile acid concentrations measured by gas–liquid chromatog-
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332326
2.2. Analytical determinations and statistical methods
Total BA concentrations in serum were assayed by an enzymatic/fluorometric method [26]. BA species in serum were measured by gas–liquidchromatography-mass spectrometry [27]. To evaluate the state of oxidativestress, the following assays were carried out in liver homogenates prepared inice-cold phosphate-buffered saline. Lipid peroxidation was estimated bymeasuring malondialdehyde (MDA) formation [28]. Protein carbonylationwas determined using the 2,4-dinitrophenylhydrazine assay [29]. Totalglutathione (GSHCGSSG) contents in trichloroacetic acid supernatants ofliver homogenates were determined by an enzymatic method [30]. The GSH/GSSG ratio was calculated after selective measurement of GSSG levels [31].The activity of the following enzymes was determined: catalase [32],glutathione peroxidase [33], glutathione reductase [34] and glutathione-S-transferase [35]. Caspase-3 and caspase-8 activities were determined usingAc-DEVD-AMC and Ac-IETD-AFC (Alexis Corp., San Diego, CA) asspecific substrates, respectively [36]. Protein concentrations were deter-mined [37] using bovine serum albumin as standard. Nucleosomal DNAfragmentation was investigated by the DNA-ladder method using DNAobtained from the liver of an adult male rat that had received D-galactosamine (i.p. 0.1 g/100 g b.wt.) 24 h before, as a positive control ofapoptosis [38].
The abundance of mRNA of the key enzymes in BA synthesis (Cyp7a1,Cyp27 and Cyp8b1), as well as of the pro-apoptotic Bax-a, and the anti-apoptotic Bcl-2 proteins were determined by RT followed by real-timequantitative PCR using appropriate primers (Table 2), as previouslydescribed [39]. RNA from liver samples collected in RNAlater (QIAGEN,Izasa, Barcelona, Spain) was isolated using RNeasy spin columns(QIAGEN) and measured with the RiboGreen RNA-Quantitation kit(Molecular Probes, Leiden, The Netherlands). RT was carried out withtotal RNA, using random nanomers and Enhanced Avian RT-PCR kit(Sigma-Genosys, Cambridge, UK). The PCR amplification products weredetected using SYBR Green I, once it had been ascertained that non-specificproducts were not formed during PCR, in any case. Total liver RNA from ahealthy adult rat (for Bcl-2, Cyp7a1, Cyp27 and Cyp8b1) or from an adult ratwith bile duct ligation for 7 days (for Bax-a) were used in all determinationsas external calibrators. To normalize the results the level of 18S rRNA ineach sample was determined with an appropriate Taqmanw probe [39].
Immunoblotting studies on liver homogenates were carried out aspreviously described [39], using mouse monoclonal antibody againsta-tubulin (DM1A) from Sigma-Aldrich and rabbit polyclonal antibodiesto Bax-a (P19) and Bcl-2 (N19) from Santa Cruz Biotechnology (CA, USA).Anti-mouse or anti-rabbit IgG horseradish peroxidase-linked antibodies andenhanced chemiluminiscence reagents were from Amersham PharmaciaBiotech (Freiburg, Germany). Lysate from human promyelocytic leukaemiaHL-60 cells (Santa Cruz Biotechnology), which highly express severalmembers of the Bcl-2 family of proteins, was used as a positive control [40].
Values are expressed as meanGSEM. Comparisons were carried out bythe Bonferroni method of multiple range testing.
raphy coupled to mass spectrometry in fetal (A) and maternal (B)
serum on day 21 of pregnancy. On day 14, pregnant rats underwent a
sham operation (Control), obstructive cholestasis (OCP), or OCP
followed by treatment with ursodeoxycholic acid (UDCA) (OCPC
UDCA). In all groups nZ5 mothers and 7 fetuses. Inset of A: relative
abundance of mRNA for Cyp7a1, Cyp27 and Cyp8b1 in fetal livers
(nZ5 in all groups). *, P!0.05 on comparing with OCP. CA, Cholic
acid; CDCA, Chenodeoxycholic acid; DCA, Deoxycholic acid; MCA,
Muricholic acid.
3. Results
3.1. Obstructive cholestasis in pregnant rats
In agreement with previous studies [25], OCP caused a
decrease in body weight in both mothers and fetuses,
together with a reduction in the number of fetuses per
gestation. UDCA treatment partly restored normal maternal
body weight gaining and the number of fetuses per
pregnancy (Table 1). Changes in several serum biochemical
parameters were consistent with typical signs of liver cell
injury associated with cholestasis. The repercussions of
OCP on fetal biochemical parameters were milder. Serum
bilirubin concentrations and alkaline phosphatase activity
were significantly elevated; only the former of these two
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 327
alterations was prevented by UDCA. OCP induced an
elevation in serum BA concentrations that was less
marked in fetuses (Table 1, Fig. 1A) than in their mothers
(Table 1, Fig. 1B). UDCA treatment further increased
maternal hypercholanemia, mainly due to an elevation in
b-muricholic acid (b-MCA) serum concentrations, but
reduced fetal serum concentrations of major BAs, except
UDCA and b-MCA. No significant change in OCP or
OCPCUDCA groups in the abundance of mRNA in fetal
liver for Cyp7a1, Cyp27 or Cyp8b1 was found (Fig. 1A,
inset).
3.2. Oxidative stress
In both mothers and fetuses, OCP caused a reduction
in the activities of enzymes involved in resistance against
oxidative stress, such as glutathione peroxidase (Fig. 2A),
glutathione-S-transferase (Fig. 2B) and catalase (Fig. 2C),
whereas the activity of glutathione reductase was not
impaired (Fig. 3D). The absence of effect, or a moderate
tendency to amelioration, was observed in animals
treated with UDCA. Steady-state levels of total gluta-
thione were enhanced in maternal liver but decreased in
fetal liver by OCP (Fig. 3A). The GSH/GSSG ratio was
significantly reduced by OCP both in maternal and fetal
liver (Fig. 3B). UDCA prevented changes in total
Fig. 2. Glutathione peroxidase (A), glutathione-S-transferase (B), catalase (C)
day 21 of pregnancy. On day 14, pregnant rats underwent a sham operation (
with ursodeoxycholic acid (OCPCUDCA). In all groups nZ6 mothers and R
glutathione but did not restore GSH/GSSG ratio to
normal values. Oxidative damage, as indicated by the
magnitude of hepatic lipid peroxidation (Fig. 3C) and
protein carbonylation (Fig. 3D), was increased by OCP to
a similar extent in both maternal and fetal livers. UDCA
prevented (partially in mothers and more efficiently in
fetuses) these alterations.
3.3. Apoptosis
Caspase-3, which participates in several alternative path-
ways of apoptosis activation (for a review, see [41]), was
significantly enhanced by OCP in maternal liver (C50%),
and more markedly so (C150%) in fetal liver (Fig. 4A);
UDCA inhibited these changes. Since at least in adult rat
BA-mediated apoptosis is in part due to activation of the
death receptor-dependent pathway of apoptosis [6],
the activity of a mediator of this pathway, caspase-8, was
also measured. OCP and UDCA treatment had no effect on
caspase-8 activity in either fetal or maternal livers (Fig. 4B).
DNA fragmentation, although present in the liver of OCP
animals (Fig. 4C), was less marked than that found in animals
treated with a typical inducer of liver apoptosis such as
D-galactosamine [38]. Moreover, DNA fragmentation was
more evident in fetal than in maternal livers. However, it
should be considered that although this method permits to
and glutathione reductase (D) activities in maternal and fetal livers on
Control), obstructive cholestasis (OCP), or OCP followed by treatment
9 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.
Fig. 3. Total glutathione content (A), GSH/GSSG ratio (B), lipid peroxidation (C), and protein carbonylation (D) in maternal and fetal livers on day 21
of pregnancy. On day 14, pregnant rats underwent a sham operation (Control), obstructive cholestasis (OCP), or OCP followed by treatment with
ursodeoxycholic acid (OCPCUDCA). In all groups nZ6 mothers and R12 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332328
visualize the presence of apoptosis, it lacks accuracy to
quantify the intensity of the process, above all when this is
relatively low as happens in most experimental groups of the
present study.
Although similar tests were passed by all pairs of primers
investigated in the present study, only the results for one
pro-apoptotic and another anti-apoptotic proteins, i.e. Bax-aand Bcl-2, respectively, that were measured as an index of
apoptosis susceptibility, are shown (Fig. 5A and C) to
illustrate the presence of a single peak in DNA melting
curves and a single band of the expected size in agarose gel
electrophoresis. Bax-a mRNA in the liver was significantly
increased by OCP (C100% in mothers; C200% in fetuses);
UDCA diminished this increase (Fig. 5B). Liver Bcl-2
mRNA was also increased by OCP (C350% in mothers;
C100% in fetuses), and a tendency to further increase in
both the mothers and fetuses of the OCPCUDCA group
was observed (Fig. 5D). In maternal liver with OCP, the
ratio between the relative abundances of mRNA (Fig. 5E)
was decreased (K50%). This change in part of the signaling
mechanism involved in controlling apoptosis might be
related with the finding that in this organ OCP-induced
increase in caspase-3 activity (Fig. 4A) and DNA fragmen-
tation (Fig. 4C) were mild. By contrast, in the fetal liver
Bax-a/Bcl-2 ratio for mRNA was enhanced by OCP
(C35%; Fig. 5E), which was consistent with the marked
increase in caspase-3 activity (Fig. 4A) and a more evident
DNA fragmentation (Fig. 4C) in this group. In both mothers
and fetuses UDCA induced a reduction in the Bax-a/Bcl-2
mRNA ratio and restored caspase-3 activity to normal
values. Changes in the abundance of these proteins as
investigated by western-blotting, were, in general, consist-
ent with measurements of mRNA abundance (Fig. 6),
except for the findings that Bax proteins were more
abundant in fetal than in maternal liver, whereas the
contrary occurred for Bcl-2. Indeed, Bcl-2 could be hardly
detected in fetal liver (Fig. 6).
4. Discussion
After bile duct ligation in the rat, biphasic changes in
total glutathione levels occur [42,43]. These are: (i) a
transient increase during the first week, which was also
observed here in maternal liver during OCP and,
(ii) subsequent depletion. Initial accumulation has been
explained in terms of the lack of integrity in the biliary
pathway for glutahione secretion [43]. This enhanced
amount of glutathione was not able to prevent liver
oxidative damage in OCP animals. Moreover, in the fetal
livers, partial depletion in glutathione contents occurred
Fig. 4. Caspase-3 (A) and caspase-8 (B) activities in maternal and fetal
livers on day 21 of pregnancy. On day 14, pregnant rats underwent a
sham operation (Control), obstructive cholestasis (OCP), or OCP
followed by treatment with ursodeoxycholic acid (OCPCUDCA). In all
groups nZ6 mothers and R9 fetuses. NS, PO0.05; **, P!0.01 on
comparing with OCP. C. Representative agarose gel electrophoresis of
cytosolic oligonucleosomal DNA obtained from maternal and fetal
livers in each experimental group. As a positive control, DNA obtained
from the liver of an adult male rat that had received D-galactosamine
was used (D-GalN).
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 329
even during transient glutathione accumulation in maternal
liver.
UDCA treatment lowered total glutathione contents in
maternal livers, even though biliary obstruction was main-
tained. Enhanced glutathione output from the hepatocytes
through their sinusoidal membrane was probably involved in
such decrease. Thus, the presence in this pole of the plasma
membrane of ABC proteins that export glutathione con-
jugates is enhanced by BAs, among which UDCA has been
reported to be particularly efficient in triggering this up-
regulation [44]. Moreover, UDCA may ameliorate hepatic
BA load in cholestasis by stimulating an alternative excretory
route via induction of hepatocellular/basolateral Mrp3 efflux
with concomitant overexpression of renal Mrp2. A similar
route could be followed by glutathione conjugates [44].
Whether this also occurs in pregnant rats with obstructive
cholestasis is not known.
During rat development there is an exaggerated
mitochondrial response to pro-oxidant stimuli [45],
together with less developed antioxidant protection mech-
anisms [46]. This may account for the particularly high
sensitivity of the fetal liver to hypercholanemia. Moreover,
this situation implies an increase in the danger associated
with any additional oxidative insult during the fetal-to-
neonatal transition, when important circulatory and respir-
atory changes already lead to a transient oxidative stress
[47]. Thus, at least in the rat, the liver is maximally
susceptible to lipid peroxidation during the first day after
birth [48]. Impairment in liver structure and function was
indeed observed in 4-week-old rats born from mothers with
OCP. These alterations were in part prevented if the
mothers were treated with UDCA during the last week of
pregnancy [49].
Several antioxidants have been shown to reduce the liver
injury caused by toxic BAs [8]. Among them is UDCA,
which is able to protect hepatocytes against oxidative injury
by enhancing the hepatic levels of glutathione and other
thiol-containing antioxidants [15]. Whether this is a specific
effect of UDCA or it is shared by other BAs has not been
elucidated. However, this could explain why UDCA had
marked antioxidant protective effect in OCP animals, even
though the activity of antioxidant enzymes was not restored.
The fact that GSH/GSSG ratio was decreased in both
maternal and fetal livers of OCP rats treated with UDCA
suggests that enhanced levels of glutathione are being used
to buffer OCP-induced free radical formation.
Since UDCA treatment also reduced fetal hyperchola-
nemia, due to a decrease in all major BA species except
UDCA and b-MCA, it is likely that part of the beneficial
effect observed in the fetal liver would be due to a
displacement of the most toxic BA species. The absence
of change in the abundance of Cyp7a1, Cyp27 and Cyp8a1
mRNA is consistent with an absence of increased fetal BA
synthesis. Fetal hypercholanemia was therefore probably
accounted for by enhanced overall transfer of BAs across
the placenta in the maternal-to-fetal direction. UDCA
improves placental functions by restoring the ability of
this organ to eliminate fetal BAs towards the mother and
reducing the permeability of the placental barrier to
maternal BAs [19,25]. Both mechanisms are likely to be
involved in the reduction of the fetal hypercholanemia
observed in OCPCUDCA group.
In adult rats, cholestasis enhances liver caspase-3
activity [50]. This was confirmed in OCP mothers and
was more marked in fetal liver. In addition to
mitochondria-mediated activation of apoptosis, the Fas
receptor/caspase-8 pathway is involved in BA-induced
apoptosis in the adult rat liver [6]. However, no
significant change in caspase-8 activity in maternal and
fetal livers of the OCP group was detected. Since
hepatocytes are considered type II cells, and thus a small
increase in caspase-8 activity might suffice to induce
apoptosis, a role of Fas-receptor in observed apoptosis
Fig. 5. Validation of the SYBR Green I method of detection in real time quantitative PCR to measure the relative abundance of mRNA for rat Bax-a
(A) and Bcl-2 (C) and the results of such measurements in maternal and fetal livers (B and D). A and C panels: negative derivative of DNA melting
curves for the amplified PCR product (inset: electrophoresis in 2.5% agarose gel; lane 1: calibrator cDNA; lane 2: no DNA template; lane 3: standard
DNA). On day 14, pregnant rats underwent a sham operation (Control), obstructive cholestasis (OCP), or OCP followed by treatment with
ursodeoxycholic acid (UDCA) (OCPCUDCA). Values are expressed as percentages of the external calibrator. E. Ratio between the relative
abundances of mRNA for Bax-a and Bcl-2 in maternal and fetal livers expressed as percentages of the values found in the Control group. In all groups
nZ7 mothers and R14 fetuses. NS, PO0.05; *, P!0.05; **, P!0.01 on comparing with OCP.
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332330
cannot be ruled out. However, if this mechanism does
exist, it does not seem to play a major role in OCP-
induced maternal/fetal liver apoptosis.
In fetal and maternal livers OCP induced not only Bax-a,
but also Bcl-2 expression. This has been previously found in
hepatocytes from cholestatic adult rats, in which such
increase has been suggested to play a role as an adaptive
response to resist, up to a certain extent, BA-induced injury
[51]. This mechanism seems to be more developed, and
hence more potent, in the maternal than in the fetal liver, but
not enough to counterbalance other signals promoting
caspase 3 activation.
In conclusion, in addition to several confirmatory data
related to oxidative stress caused in the rodent liver by bile
Fig. 6. A. Representative Western blot of the expression of members of
the Bcl-2 family in maternal and fetal liver at term. On day 14,
pregnant rats underwent a sham operation (Control), obstructive
cholestasis (OCP), or OCP followed by treatment with ursodeoxycholic
acid (UDCA) (OCPCUDCA). Similar results were obtained in samples
from six different animals from each group. Lysate from human
promyelocytic leukaemia HL-60 cells (Santa Cruz Biotechnology),
which highly express several members of the Bcl-2 family of proteins
was used as positive controls.
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332 331
duct ligation [42,43,51], the present study also provides the
following original results: (i) imbalance in the antioxidant
status of maternal livers caused by OCP was partly
prevented by UDCA treatment, even though maternal
hypercholanemia was not corrected. (ii) In both maternal
and fetal livers some of the enzyme activities involved in
antioxidant system were impaired in OCP. (iii) As indicated
by the lower activities of catalase, glutathione peroxidase
and glutathione-S-transferase as well as the levels of total
glutathione, fetal livers had lower antioxidant defenses than
maternal livers. Consistently, fetal livers were more
sensitive to BA-mediated oxidative insult. Thus, although
OCP increased serum BA concentrations to a much lower
extent in the fetuses (2.7-fold) than in the mothers (15-fold),
oxidative damage and apoptosis were higher in the former.
(iv) Finally, UDCA treatment of pregnant rats has beneficial
effects on the fetal liver by lowering the exposure of the
fetus to toxic BAs, restoring the levels of glutathione,
preventing lipid peroxidation and protein carbonylation,
and correcting pro-apoptotic alterations in the Bax-a/Bcl-2
ratio.
Acknowledgements
The authors thank Mrs M.I. Hernandez Rodriguez for
her secretarial help, and Mr L. Munoz de la Pascua
and Mr J.F. Martin Martin for caring for the animals.
Thanks are also due to Nicholas Skinner for revision of
the English text of the manuscript.
References
[1] Attili AF, Angelico M, Cantafora A, Alvaro D, Capocaccia L. Bile
acid-induced liver toxicity: relation to the hydrophobic–hydrophilic
balance of bile acids. Med Hypotheses 1986;19:57–69.
[2] Billington D, Evans CE, Godfrey PP, Coleman R. Effects of bile salts
on the plasma membranes of isolated rat hepatocytes. Biochem J
1980;188:321–327.
[3] Sokol RJ, Straka MS, Dahl R, Devereaux MW, Yerushalmi B,
Gumpricht E, et al. Role of oxidant stress in the permeability
transition induced in rat hepatic mitochondria by hydrophobic bile
acids. Pediatr Res 2001;49:519–531.
[4] Ljubuncic P, Fuhrman B, Oiknine J, Aviram M, Bomzon A. Effect of
deoxycholic acid and ursodeoxycholic acid on lipid peroxidation in
cultured macrophages. Gut 1996;39:475–478.
[5] Czaja MJ. Induction and regulation of hepatocyte apoptosis by
oxidative stress. Antioxid Redox Signal 2002;4:759–767.
[6] Faubion WA, Guicciardi ME, Miyoshi H, Bronk SF, Roberts PJ,
Svingen PA, et al. Toxic bile salts induce rodent hepatocyte apoptosis
via direct activation of Fas. J Clin Invest 1999;103:137–145.
[7] Rodrigues CM, Fan G, Ma X, Kren BT, Steer CJ. A novel role for
ursodeoxycholic acid in inhibiting apoptosis by modulating mito-
chondrial membrane perturbation. J Clin Invest 1998;101:2790–2799.
[8] Yerushalmi B, Dahl R, Devereaux MW, Gumpricht E, Sokol RJ. Bile
acid-induced rat hepatocyte apoptosis is inhibited by antioxidants and
blockers of the mitochondrial permeability transition. Hepatology
2001;33:616–626.
[9] Oh SH, Yun KJ, Nan JX, Sohn DH, Lee BH. Changes in expression
and immunolocalization of protein associated with toxic bile salts-
induced apoptosis in rat hepatocytes. Arch Toxicol 2003;77:110–115.
[10] Narita M, Shimizu S, Ito T, Chittenden T, Lutz RJ, Matsuda H, et al.
Bax interacts with the permeability transition pore to induce
permeability transition and cytochrome c release in isolated
mitochondria. Proc Natl Acad Sci USA 1998;95:14681–14686.
[11] Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M,
Alnemri ES, et al. Cytochrome c and dATP-dependent formation of
Apaf-1/caspase-9 complex initiates an apoptotic protease cascade.
Cell 1997;91:479–489.
[12] Paumgartner G, Beuers U. Ursodeoxycholic acid in cholestatic liver
disease: mechanisms of action and therapeutic use revisited.
Hepatology 2002;36:525–531.
[13] Guldutuna S, Leuschner M, Wunderlich N, Nickel A, Bhatti S,
Hubner K, et al. Cholic acid and ursodeoxycholic acid therapy in
primary biliary cirrhosis. Changes in bile acid patterns and their
correlation with liver function. Eur J Clin Pharmacol 1993;45:
221–225.
[14] Dumont M, Erlinger S, Uchman S. Hypercholeresis induced by
ursodeoxycholic acid and 7-ketolithocholic acid in the rat: possible
role of bicarbonate transport. Gastroenterology 1980;79:82–89.
[15] Mitsuyoshi H, Nakashima T, Sumida Y, Yoh T, Nakajima Y,
Ishikawa H, et al. Ursodeoxycholic acid protects hepatocytes against
oxidative injury via induction of antioxidants. Biochem Biophys Res
Commun 1999;263:537–542.
[16] Serviddio G, Pereda J, Pallardo FV, Carretero J, Borras C, Cutrin J,
et al. Ursodeoxycholic acid protects against secondary biliary
cirrhosis in rats by preventing mitochondrial oxidative stress.
Hepatology 2004;39:711–720.
[17] Lammert F, Marschall HU, Matern S. Intrahepatic cholestasis of
pregnancy. Curr Treat Options Gastroenterol 2003;6:123–132.
[18] Zimber A, Zusman I. Effects of secondary bile acids on the
intrauterine development in rats. Teratology 1990;42:215–224.
[19] Serrano MA, Brites D, Larena MG, Monte MJ, Bravo MP, Oliveira N,
et al. Beneficial effect of ursodeoxycholic acid on alterations induced
by cholestasis of pregnancy in bile acid transport across the human
placenta. J Hepatol 1998;28:829–839.
[20] Palma J, Reyes H, Ribalta J, Hernandez I, Sandoval L, Almuna R,
et al. Ursodeoxycholic acid in the treatment of cholestasis of
pregnancy: a randomized, double-blind study controlled with placebo.
J Hepatol 1997;27:1022–1028.
[21] Rodrigues CMP, Marin JJG, Brites D. Bile acid patterns in meconium
are influenced by cholestasis of pregnancy and not altered by
ursodeoxycholic acid treatment. Gut 1999;45:446–452.
M.J. Perez et al. / Journal of Hepatology 43 (2005) 324–332332
[22] Mazzella G, Rizzo N, Azzaroli F, Simoni P, Bovicelli L, Miracolo A,
et al. Ursodeoxycholic acid administration in patients with cholestasis
of pregnancy: effects on primary bile acids in babies and mothers.
Hepatology 2001;33:504–508.
[23] Palma J, Reyes H, Ribalta J, Iglesias J, Gonzalez MC, Hernandez I,
et al. Effects of ursodeoxycholic acid in patients with intrahepatic
cholestasis of pregnancy. Hepatology 1992;15:1043–1047.
[24] Monte MJ, Morales AI, Arevalo M, Alvaro I, Macias RIR, Marin JJG.
Reversible impairment of neonatal hepatobiliary function by maternal
cholestasis. Hepatology 1996;23:1208–1217.
[25] Serrano MA, Macias RI, Vallejo M, Briz O, Bravo A, Pascual MJ,
et al. Effect of ursodeoxycholic acid on the impairment induced by
maternal cholestasis in the rat placenta-maternal liver tandem
excretory pathway. J Pharmacol Exp Ther 2003;305:515–524.
[26] Mashige U, Imai K, Osuga T. Simple and sensitive assay of serum
total bile acids. Clin Chim Acta 1976;70:79–86.
[27] El-Mir MY, Monte MJ, Morales AI, Arevalo M, Serrano MA,
Marin JJG. Effect of maternal cholestasis on biliary lipid and bile acid
secretion in the infant rat. Hepatology 1997;26:527–536.
[28] Niehaus WG, Samuelsson B. Formation of malonaldehyde from
phospholipid arachidonate during microsomal lipid peroxidation. Eur
J Biochem 1968;6:126–130.
[29] Reznick AZ, Packer L. Oxidative damage to proteins: spectro-
photometric method for carbonyl assay. Methods Enzymol 1994;233:
357–363.
[30] Tietze F. Enzymatic method for quantitative determination of
nanogram amounts of total and oxidized glutathione: applications to
mammalian blood and other tissues. Anal Biochem 1969;27:502–522.
[31] Griffith OW. Determination of glutathione and glutathione disulfide
using glutathione reductase and 2-vinylpyridine. Anal Biochem 1980;
106:207–212.
[32] Clairborne A, Fridovich I. Purification of the o-dianisidine peroxidase
from Escherichia coli B. Physicochemical characterization and
analysis of its dual catalatic and peroxidatic activities. J Biol Chem
1979;254:4245–4252.
[33] Flohe L, Gunzler WA. Assays of glutathione peroxidase. Methods
Enzymol 1984;105:114–121.
[34] Carlberg I, Mannervick B. Glutathione reductase. Methods Enzymol
1985;113:484–490.
[35] Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases. The
first enzymatic step in mercapturic acid formation. J Biol Chem 1974;
249:7130–7139.
[36] Hasegawa JI, Kamada S, Kamiike W, Shimizu S, Imazu T,
Matsuda H, et al. Involvement of CPP32/Yama (-like) proteases in
Fas-mediated apoptosis. Cancer Res 1996;56:1713–1718.
[37] Markwell MA, Haas SM, Bieber LL, Tolbert NE. A modification of
the Lowry procedure to simplify protein determination in membrane
and lipoprotein samples. Anal Biochem 1978;87:206–210.
[38] Muntane J, Montero JL, Marchal T, Perez-Seoane C, Lozano JM,
Fraga E, et al. Effect of PGE1 on TNF-alpha status and hepatic
D-galactosamine-induced apoptosis in rats. J Gastroenterol Hepatol
1998;13:197–207.
[39] Briz O, Macias RI, Vallejo M, Silva A, Serrano MA, Marin JJ.
Usefulness of liposomes loaded with cytostatic bile acid derivatives to
circumvent chemotherapy resistance of enterohepatic tumors. Mol
Pharmacol 2003;63:742–750.
[40] Sawai H, Kawai S, Domae N. Reduced expression of Bax in
ceramide-resistant HL-60 subline. Biochem Biophys Res Commun
2004;319:46–49.
[41] Salvesen GS, Dixit VM. Caspase activation: the induced-proximity
model. Proc Natl Acad Sci USA 1999;96:10964–10967.
[42] Singh S, Shackleton G, Ah-Sing E, Chakraborty J, Bailey ME.
Antioxidant defenses in the bile duct-ligated rat. Gastroenterology
1992;103:1625–1629.
[43] Purucker E, Winograd R, Roeb E, Matern S. Glutathione status in
liver and plasma during development of biliary cirrhosis after bile
duct ligation. Res Exp Med (Berl) 1998;198:167–174.
[44] Zollner G, Fickert P, Fuchsbichler A, Silbert D, Wagner M,
Arbeiter S, et al. Role of nuclear bile acid receptor, FXR, in adaptive
ABC transporter regulation by cholic and ursodeoxycholic acid in
mouse liver, kidney and intestine. J Hepatol 2003;39:480–488.
[45] Henderson GI, Chen JJ, Schenker S. Ethanol, oxidative stress, reactive
aldehydes, and the fetus. Front Biosci 1999;4:D541–D550.
[46] Yoshioka T, Takehara Y, Shimatani M, Abe K, Utsumi K. Lipid
peroxidation and antioxidants in rat liver during development. Tohoku
J Exp Med 1982;137:391–400.
[47] Sastre J, Asensi M, Rodrigo F, Pallardo FV, Vento M, Vina J.
Antioxidant administration to the mother prevents oxidative
stress associated with birth in the neonatal rat. Life Sci 1994;54:
2055–2059.
[48] Gonzalez MM, Madrid R, Arahuetes RM. Physiological changes in
antioxidant defences in fetal and neonatal rat liver. Reprod Fertil Dev
1995;7:1375–1380.
[49] Macias RIR, Serrano MA, Monte MJ, Jimenez S, Hernandez B, Marin
JJG. Long-term effect of treating pregnant rats with ursodeoxycholic
acid on the congenital impairment of bile secretion induced in
the pups by maternal cholestasis. J Pharmacol Exp Ther
2005;312:751–758.
[50] Schoemaker MH, Gommans WM, de la Rosa LC, Homan M, Klok P,
Trautwein C, et al. Resistance of rat hepatocytes against bile acid-
induced apoptosis in cholestatic liver injury is due to nuclear factor-
kappa B activation. J Hepatol 2003;39:153–161.
[51] Kurosawa H, Que FG, Roberts LR, Fesmier PJ, Gores GJ.
Hepatocytes in the bile duct-ligated rat express Bcl-2. Am J Physiol
1997;272:G1587–G1593.