DOI: 10.1530/JOE-16-0368http://joe.endocrinology-journals.org © 2017 Society for Endocrinology

Printed in Great BritainPublished by Bioscientifica Ltd.

Journ

alofEn

docrinology

205–219e asadi and others Effect of VEGF and fetuin on human ovarian tissueResearch

232:2

10.1530/JOE-16-0368

Ovarian tissue culture in the presence of VEGF and fetuin stimulates follicle growth and steroidogenesis

Ebrahim Asadi1, Atefeh Najafi1, Ashraf Moeini2, Reihaneh Pirjani2, Gholamreza Hassanzadeh1, Saideh Mikaeili1, Ensieh Salehi1, Emmanuel Adutwum3, Mansoureh Soleimani4,5, Fariba Khosravi6, Mahmood Barati7 and Farid Abolhassani1

1Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Science, Tehran, Iran2Department of Gynecology and Obstetrics, Arash Hospital, Tehran University of Medical Sciences, Tehran, Iran3School of Medicine, Tehran University of Medical Science, Tehran, Iran4Cellular and Molecular Research Center, Iran University of Medical Sciences, Tehran, Iran5Department of Anatomical Sciences, School of Medicine, Iran University of Medical Science, Tehran, Iran6One Fertility, Kitchener, Ontario, Canada7Department of Pharmaceutical Biotechnology, School of Pharmacy, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Abstract

Ovarian tissue cryopreservation together with follicle culture provides a promising

technique for fertility preservation in cancer patients. The study aimed to evaluate

follicle parameters in a culture medium supplemented with VEGFA165 and/or fetuin.

Vitrified-warmed ovarian cortical pieces were divided randomly into four culture

groups consisting of basic culture medium (control), and the basic culture medium

supplemented with VEGFA165, fetuin or both. After six days of culture, we evaluated

the following: percentage of resting, primary and secondary growing follicles; survival

rate; steroid hormones production; levels of reactive oxygen species, lipid peroxidation

and total antioxidant capacity; and developmental and antioxidant gene expression.

The addition of VEGFA165 alone or in combination with fetuin to the culture medium

caused resting follicle activation and increased the number of growing follicles. In the

VEGFA165 group, we found a significant increase in the concentrations of 17β-estradiol

at day 6 and progesterone from 4th day of the culture period. In the VEGFA165 + fetuin

group, the concentration of 17β-estradiol rose at day 4 of the culture period. The levels

of BMP15, GDF9 and INHB mRNAs were increased in all treated groups. In the fetuin and

fetuin + VEGFA165 groups, we observed a high level of total antioxidant capacity and

expression of SOD1 and CAT genes, low reactive oxygen species and lipid peroxidation

levels and increased number of viable follicles. In conclusion, the present study provides

useful evidence that supplementation of culture medium with VEGFA165 + fetuin leads

to primordial follicle activation and development and increased percentage of healthy

secondary growing follicles. Journal of Endocrinology (2017) 232, 205–219

2322

Correspondence should be addressed to F Abolhassani Email abolhasani.f@yahoo.com

Key Words

f growth factors

f ovary

f cell culture

f steroidogenesis

f development

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 206Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

Introduction

Cryopreservation of ovarian cortex is useful for fertility preservation in prepubertal and adolescent cancer patients who are undergoing chemotherapy or radiotherapy and patients at risk of losing their ovarian function as a result of surgery (Schmidt et al. 2010, Donnez & Dolmans 2013). Currently, autografting of cryopreserved ovarian cortex is applicable in the clinics. Cryopreservation together with autotransplantation of cortical tissues has reportedly resulted in the birth of 30 babies since 2004 (Donnez & Dolmans 2013). Even though restored ovarian endocrine function has been reported, the rate of success of this procedure is not clear as the total number of patients for whom this method has been used is unknown (Wallace et al. 2014). The ovarian cortex contains a large number of primordial follicles that are resistant to the adverse effects of freezing and thawing processes (Feigin et  al. 2008, Salama et  al. 2013) and plays a major role in the success of ovarian cortex autotransplantation. However, the number of available primordial follicles may be affected by several factors including ovarian cortex size, age, previous chemotherapy and different types of malignancies (Titus et  al. 2013). One major problem usually encountered in frozen-thawed ovarian cortical grafts is the risk of re-seeding malignancies (Abir et  al. 2010b). These limitations could be overcome by the in vitro development of the isolated primordial follicles into mature follicles in a well-designed culture system (Picton et  al. 2008, Fabbri et  al. 2009). In vitro development of mouse primordial follicles has already been reported and used for the production of embryo and subsequent birth of pups (Eppig & O’Brien 1996, Li et al. 2010). However, it is difficult to apply this culture method to higher animals and humans due to the differences in anatomical and physical characteristics of the ovary. Some studies have experimented on the most important factors involved in primordial follicles activation and development to optimize this in vitro culture system (Kedem et al. 2011, McLaughlin et al. 2014). One of the possible candidates for this role is vascular endothelial growth factor A (VEGFA).

VEGFA is a growth factor, which stimulates the proliferation, migration and survival of endothelial cells for vascular formation (Araújo et al. 2013). In humans, at least eight VEGFA isoforms including VEGFA 121, VEGFA 148, VEGFA 165, VEGFA 165b, VEGFA 145, VEGFA 183, VEGFA 189 and VEGFA 206 have been found to be produced by alternative splicing of the VEGFA mRNA (Cui et al. 2004). VEGFA 121 and VEGFA 165 are the two

major isoforms of VEGFA, but VEGFA 165 is the most biologically active and abundant in humans (Abir et  al. 2010a). However, in other species, it has been found that VEGFA is one amino acid shorter compared with that of humans (Redmer et  al. 1996). VEGFA has also been found to induce the proliferation of other cells such as spermatogonial stem cell (SSC) (VEGFA 164 and 165b) (Caires et  al. 2011) and breast cancer cells (VEGFA 165 and 121) (Liang et al. 2006). VEGFA exerts its effects via two tyrosine kinase receptors: FLT1 (VEGFR1) and KDR (VEGFR2) (Ferrara 2004). VEGFA and its receptors (VEGFR1 and VEGFR2) are expressed in granulosa cells of all follicle stages and theca cells of mature follicles in rats (McFee et al. 2009). Moreover, addition of proangiogenic isoform VEGFA 164 to the culture medium of perinatal rat ovaries, and the neutralization of the antiangiogenic isoforms via treatment with a VEGFAxxxB antibody (xxx indicates varying lengths) decreased the percentage of primordial follicles and increased the proportion of developing follicles. However, the neutralization of the antiangiogenic isoform was more effective than the supplementation with proangiogenic isoforms (Artac et  al. 2009). VEGFA 165, VEGFA 121, VEGFA 189 and their receptor were detected in granulosa and theca cells of secondary bovine follicles with varying levels of expression. Supplementation of the culture medium of the bovine follicles with VEGFA 165 induced the development of primary to secondary follicles in vitro (Yang & Fortune 2007). In another study, VEGFA 165 in treated goat follicles induced the development of secondary follicles and improved the progression of oocyte meiosis to metaphase II stage (Araújo et al. 2011). In vivo VEGFA inhibitor has been found to decrease the endothelial cell proliferation in theca layer and prevent the formation of antrum in primates follicles (Taylor et al. 2007). VEGFA concentration continuously increased during the development of primate follicle in a culture media (Fisher et  al. 2013). In humans, VEGFA165, VEGFA121, VEGFA189 and its receptors’ mRNA and proteins have been found in preantral follicles (Abir et al. 2010a).

The in vitro growth of ovarian follicles and maturation depend on several parameters. Reactive oxygen species (ROS) play important roles in in vitro follicular growth and maturation (Agarwal & Allamaneni 2004, Wiener-Megnazi  et  al. 2004). Reactive oxygen species such as hydrogen peroxide, superoxide anion and hydroxyl radicals are generated during normal cellular activity

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

207Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

and metabolism (Turrens 2003). ROS play a fundamental role in intracellular pathways, which involve several reproductive physiological functions including the maturation of follicles and oocyte, ovulation, ovarian steroidogenesis, fertilization, embryo development and pregnancy (Agarwal  et  al. 2005, Fujii  et  al. 2005). Overproduction of ROS or imbalance between ROS levels and antioxidant defense system can also lead to cell injury and apoptosis (Finkel 2011, Asadi  et  al. 2013). ROS generation is stimulated during ovarian tissue cryopreservation (Abedelahi et al. 2010), and it is a primary mechanism that causes DNA damage during freezing-thawing process (Tremellen 2008). Moreover, reactive oxygen species may lead to polyunsaturated fatty acid (PUFA) peroxidation, protein and cellular damage (Ergüder et al. 2005, Pajovic & Saicic 2008) and preovulatory follicle apoptosis (Tsai-Turton & Luderer 2006). Enzymatic antioxidants such as superoxide dismutase (SOD), catalase, glutathione peroxidase and glutathione reductase, and non-enzymatic scavengers like albumin, taurine, urates and ascorbate convert ROS to H2O, which inhibits the excessive production of ROS and play protective roles against damages caused by ROS (Van Langendonckt  et  al. 2002). The level of total antioxidant capacity (TAC) in follicular fluid positively correlated with the rate of pregnancy in the subjects undergoing IVF. Also, baseline level of TAC was notably increased in follicular fluids of follicles whose oocytes were consequently fertilized. Fetuin is the most abundant glycoprotein constituent of fetal blood and body fluids produced by hepatocytes of the liver (Arnaud & Kalabay 2002). It has been documented that human follicular fluid contains significant quantities of fetuin (Kalab et al. 1993), and granulosa cells of growing and large follicles may release fetuin to maintain zona pellucida fluidity (Høyer  et  al. 2001). It has been reported that fetuin prevents zona pellucida (ZP) hardening via its protease inhibitor function in mouse and equine (Ducibella  et  al. 1988, Dell’Aquila  et  al. 1999). Recently, studies have shown that addition of fetuin to freezing-thawing medium leads to a reduction in malondialdehyde (MDA) formation and an increase in superoxide dismutase and glutathione peroxidase antioxidant activities and membrane integrity of bull spermatozoa (Sarıözkan et al. 2015a,b).

To the best of our knowledge, there are no reports of the effects of VEGFA 165 and fetuin supplementation on the in vitro culture of frozen-thawed human ovarian cortical fragments. The purpose of this study was to fill this gap by evaluating the effects of VEGFA 165

and/or fetuin on in vitro human follicle development and survival, steroid hormone production, ROS and lipid peroxidation levels, total antioxidant capacity and the expression of developmental and antioxidant genes during in vitro culture of human frozen-thawed ovarian cortical fragments.

Materials and methods

Ethical approval

This study was ethically approved by the Ethics Committee of Tehran University of Medical Sciences. All patients signed written informed consent.

Ovarian cortical tissue collection

Ovarian cortical tissues were obtained as small biopsy pieces approximately 7–10 × 7–10 mm with a changeable thickness from 14 patients who were undergoing planned Caesarean section. The mean age of the women was 32.4 ± 3.7 with a range between 24 and 38 years.

Tissue preparation

All chemicals applied in this study were obtained from Sigma-Aldrich unless otherwise indicated. The ovarian cortex biopsies were collected and placed in sterile, labeled specimen containers containing 10 mL of Leibovitz medium (GIBCO) supplemented with sodium pyruvate (2 mM), glutamine (2 mM), human serum albumin (HSA) (3 mg/mL), penicillin G (75 mg/mL), streptomycin (50 mg/mL) and ascorbic acid (50 mg/mL). The samples were transferred to the laboratory on ice within 45 min. In the laboratory, the ovarian tissues were placed into an organ culture dish (Becton Dickinson, Franklin Lakes, NJ, USA) containing fresh medium with supplements as described previously. Under laminar flow conditions, cortical tissues were gently stretched by the blunt edge of a scalpel blade. After removal of the medulla, the cortical tissues were cut into small fragments of 1–1.5 mm2 with 0.5 mm thickness. The pieces were then transferred to a freezing-thawing medium for cryopreservation.

Vitrification

The vitrification procedure was performed as described in the previous article of our group (Khosravi et al. 2013). The vitrification method for the cortical ovarian tissue

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 208Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

samples included two vitrification solutions (VSs). Ovarian cortical fragments were first transferred into VS1 containing 7.5% dimethyl sulfoxide (DMSO) and 7.5% ethylene glycol (EG) in HTCM (TCM-199 with HEPES-buffer, GIBCO) supplemented with 10% human serum albumin (HSA) (Life Global, Guelph, Ontario, Canada) for 15 min at room temperature. They were subsequently transferred into VS2 containing 15% DMSO, 15% EG, 2.5% polyvinylpyrrolidone (PVP) and 10% HSA with 0.5 mol/L sucrose in HTCM for 7 min or until all strips descended to the bottom of the container. After vitrification, the ovarian strips were plunged into liquid nitrogen using stainless steel mesh as the carrier device. Ovarian pieces were then placed into a 1.8 mL cryovial pre-filled with liquid nitrogen and stored in a liquid nitrogen tank for one week.

Warming

After cryopreservation, the ovarian cortical pieces were instantly transferred into pre-warmed (37°C) HTCM solution supplemented with 10% HSA and 1.0 mol/L sucrose for 3 min. The samples were then incubated in HTCM solution supplemented with 10% HSA and 0.5, 0.25 or 0.125 mol/L sucrose, in a respective order. The incubation time was 5 min each at room temperature. Subsequently, they were washed twice with HTCM supplemented with 10% HSA for 10 min. Two ovarian cortical pieces were selected from each participant as uncultured freeze controls and were fixed immediately in Bouin’s solution for histological evaluation (Fig. 1).

Cortical tissue culture

The vitrified-warmed ovarian cortical pieces from each sample were divided randomly into four groups. They were then placed into 24-well cell culture plates (Corning B.V. Life Sciences Europe) containing the basic culture medium consisting of 300 µL of McCoy’s 5a medium with bicarbonate supplemented with HEPES (25 mM), HSA (0.1%), glutamine (3 mM), penicillin G (0.1 mg/mL), streptomycin (0.1 mg/mL), transferrin (2.5 µg/mL), selenium (4 ng/mL), insulin (10 ng/mL) and ascorbic acid (50 µg/mL). In the control group, the culture plates contained only the basic culture medium. The treatment groups were as follows: basic culture medium + bovine fetuin (10 mg) (Sarıözkan  et  al. 2015a), basic culture medium + human VEGFA 165 (100 ng) (Araújo et al. 2014) and basic culture medium + bovine fetuin and human VEGFA 165. Cortical fragments were cultured for six days and incubated at 37°C in 5% CO2 (Fig. 1). Approximately half of the culture medium was exchanged with fresh culture medium every two days, and the spent medium samples were collected from all cultures and stored at −80°C for 17-estradiol (E2) and progesterone (P4) quantification. At the end of the culture period, the ovarian cortical tissues were collected for further processing.

Histological analysis

From the ovarian cortical tissue samples obtained from each participant, two fragments at day 0 after thawing, and two fragments from each culture group, were

Figure 1Experimental design of the study.

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

209Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

randomly fixed in Bouin’s solution for 24 h and then dehydrated in ascending concentrations of ethanol (70–100%). The fixed tissues were embedded in paraffin wax. Serial sections of 5 µm thickness were carried out, and every 10th section of each sample was mounted on a glass slide. After deparrafination and hydration, the slides were stained with hematoxylin–eosin stain and then evaluated under a light microscope (Nikon). To avoid double counting, the follicles were counted only when they were focused on one plane and only follicles displaying oocytes were counted. Based on the number of layers and morphology of the granulosa cells surrounding the oocytes, the developmental stages of the follicles were classified into the following categories (Gougeon 1986, 1996, McLaughlin et al. 2014):

1. Resting follicles:A. Primordial follicles: follicles with oocytes

surrounded by flattened granulosa cells.B. Transitory follicles: follicles with oocytes

surrounded by one or more cuboidal granulosa cells.

C. Small primary follicles: follicles with oocytes surrounded by a single layer of less than 15 cuboidal granulosa cells.

2. Primary growing (big primary) follicles: follicles with oocytes surrounded by a single layer of more than 15 cuboidal granulosa cells.

3. Secondary growing follicles.

A. Secondary follicles: follicles with oocytes surrounded by two complete layers of cuboidal granulosa cells.

B. Preantral follicles: follicles with oocytes surrounded by more than two layers of cuboidal granulosa cells.

4. Atretic follicles: follicles with oocytes that have pyknotic nuclei and are surrounded by pyknotic granulosa cells (Fig. 2).

Assessment of follicular viability

From the ovarian cortical tissue samples obtained from each participant, one fragment from each sample at the beginning of the culture period (at day 0), and one fragment from each culture group at the end of the culture period (at day 6) were selected for follicle viability assessment using calcein-AM/ethidium homodimer-1 staining (Invitrogen). Ovarian cortical fragments were briefly transferred to 1 mL of McCoy’s 5a medium supplemented with 5 μM ethidium homodimer-1 and 2 μM calcein-AM and incubated for 1 h at 37°C in 5% CO2. After incubation, the fragments were placed in 2 μM calcein-AM and 5 μM ethidium homodimer-1/DPBS solution supplemented with 6–8 mg/mL collagenase type 1A for 1 h at 37°C. Also, gentle pipetting was done every 15 min. The reaction was ended by the addition of cold DPBS supplemented with 10% serum supplement substitute at room temperature

Figure 2A representative figure of histological sections shows follicles at different stages of development in uncultured and cultured cortical fragments. (A, B) Uncultured group. (C) Control group. (D, E) Fetuin treated group. (F) VEGFA 165 treated group. (G, H) VEGFA 165 + fetuin treated group. The number sign indicates primordial follicle. Asterisk indicates transitory follicle. Thick black arrow indicates small primary follicle. Thick white arrow indicates big primary (primary growing) follicle. Thin black arrow indicates secondary follicle. Arrowhead indicates preantral follicle. Left right arrow indicates atretic follicle. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0368.

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 210Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

(Martinez-Madrid  et  al. 2004, Liebenthron  et  al. 2013). Calcein-AM is cleaved by intracellular esterase enzymes in viable cells, and ethidium homodimer-1 binds to the DNA of non-viable cells after plasma membrane damage. A follicle was classified as viable if the oocyte and its surrounding granulosa cells were stained with calcein-AM (green) and dead if chromatin was labeled with ethidium homodimer-1 (bright red). Due to the non-uniform distribution of follicles within the ovarian cortex (Kedem  et  al. 2011), 5–23 follicles in all fields were evaluated for each ovarian piece (Fujihara  et  al. 2014). Viable follicles were detected using fluorescence microscopy (Nikon, Eclipse80i). The emitted fluorescent signals of calcein-AM and ethidium homodimer were detected at 488 and 568 nm, respectively.

Steroid hormone assay

During the culture period at days 2, 4 and 6, spent media were collected and stored at −80°C for subsequent 17 beta-estradiol and progesterone quantification. 17 beta-estradiol and progesterone levels were evaluated using 17 beta-estradiol ELISA kit (Abcam) and progesterone ELISA kit (Abcam), respectively, according to the manufacturer’s instructions. Absorbance was calculated at 450 nm. The analytical sensitivity of the assay was 8.68 pg/mL (assay range, 20–2000 pg/mL) for 17 beta-estradiol and 0.05 ng/mL (assay range, 0.2–40 ng/mL) for progesterone.

ROS levels

Intracellular ROS levels were measured by a spectrofluorimetric method using 2′,7′-dihydrodichlorofluorescein diacetate (DCHF-DA) assay. From the ovarian cortical tissue samples obtained from each patient, one fragment from each group with the same weight at day 6 of the culture period was selected for ROS assay. Ovarian tissues were homogenized on ice using 50 mM Tris–HCl at pH 7.5 and then sonicated at 50 W for 1 min. The homogenate was centrifuged at 3000 g for 10 min at 4°C, and the pellet was discarded. The supernatants were separated and used for ROS levels assay. In this regard, the supernatants were incubated with DCHF-DA (0.5 mM) for 30 min in the dark, and the oxidation of DCHF-DA to fluorescent dichlorofluorescein was measured for the detection of intracellular ROS. After the incubation, DCF fluorescence intensity emission was assessed at 520 nm (with 480 nm excitation) using spectrofluorimeter (Carvalho et al. 2014).

Total antioxidant capacity assay

TAC level was evaluated based on the Trolox equivalent antioxidant capacity (TEAC) method. From the ovarian cortical tissue samples obtained from each patient, one fragment from each group at day 6 of the culture period was selected for TAC assay. Ovarian pieces with the same weight were homogenized, and 10 μL of the supernatant was used for TEAC evaluation. The TEAC level was measured according to the method by Re and coworkers (Re et al. 1999). A fresh solution was briefly made by dissolving 19.5 mg of 2,2-azinobis-3-ethylbenzothiazoline-6-sulfonic acid diammonium (ABTS) and 3.3 mg of potassium persulphate in 7 mL of 0.1 mol/L phosphate buffer at pH 7.4. The solution was kept in a dark place for 12 h for the completion of the reaction. ABTS+ solution was diluted in 0.1 mol/L phosphate buffer to give an absorbance reading of 1.0 at 734 nm. The samples were mixed with the ABTS+ solution, and the absorbance was evaluated twice in a spectrophotometer (Thermo Electron Corporation Genesys 10 u.v., Madison, WI, USA) at 734 nm for 3 min. The extension of discoloration was considered an index of total antioxidant activity of the sample. The TEAC level was calculated using Trolox as a standard (Re et al. 1999, Manca et al. 2014).

Measurement of lipid peroxidation

The degree of lipid peroxidation of the ovarian fragments was determined by the evaluation of MDA levels produced from polyunsaturated fatty acids breakdown using thiobarbituric acid. From the ovarian cortical tissue samples obtained from each patient, one fragment from each group with the same weight at day 6 of the culture period was selected for MDA assay. After the ovarian tissues had been homogenized, the supernatant was incubated for 3 h at 95°C in a 1.5 mL of 20% acetic acid solution containing 0.27 M HCl and 1.5 L of 0.8% thiobarbituric acid (TBA) solution. Absorbance was calculated using a plate reader at 532 nm to determine the MDA levels (Luz et al. 2012).

RNA extraction

From the ovarian cortical tissue samples obtained from each participant, one fragment from each group at day 6 of the culture period was selected for RNA extraction. Total ovarian tissue RNA was extracted using TRIzol reagent (Life Technology). The RNA samples were treated with DNase to prevent possible DNA contamination. Chloroform

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

211Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

was added to the homogenates and centrifuged at 4°C to obtain RNA fractions (supernatants). The solution was supplemented with phenol–chloroform–isoamyl alcohol and centrifuged again at 4°C. Isopropanol was added to the solution and stored overnight at −20°C. After the overnight storage, the solution was centrifuged at 4°C to obtain the RNA pellet. Finally, ethanol (75%) was added for stabilization of the pellet, which was then suspended in RNase-free diethylpyrocarbonate-treated water. The samples were stored at −80°C until real-time PCR was performed (Abir et al. 2009, 2010a).

cDNA synthesis

Reverse transcription (RT) was performed using cDNA Synthesis Kit (BioRad Laboratories) by the manufacturer’s instructions. 10 µL total RNA was mixed with oligo(dT) and random hexamers and DEPC-treated distilled water to obtain a final volume of 20 µL. In the negative controls, RNA or the RT enzymes were not used. Reverse-transcribed cDNA was diluted to 2:5 with DEPC-treated water and kept at −80°C until real-time PCR was performed.

Real-time PCR was carried out using LightCycler 480 (Roche Diagnostics). PCR primer sequences are showed in Table  1. Amplification reactions were done in a final volume of 15 µL including 2 µL cDNAs, 7.5 µL SYBR Green PCR Master Mix 2X (Roche Diagnostics) and 0.6 mM forward and reverse gene-specific primers. The thermal cycling profile was as follows: 95°C for 10 min followed by 55 cycles at 95°C for 10 s and 60°C for 30 s. For the quantification, standard curves were generated by amplifying serial dilutions of each amplicon. The specificity of the PCR products were checked by the melting curve analysis performed after the amplification cycles and was

further confirmed by sequencing the amplicons. Ribosomal protein L19 (RPL19) and GAPDH were used as housekeeping genes for the normalization of gene expression.

Statistical analysis

Data were analyzed using SPSS software (version 18). Data were tested for normality analysis of the parameters with Kolmogorov–Smirnov test. One-way ANOVA was used to compare the mean values across groups, followed by Tukey’s or Tamhane’s tests. The results are given as mean ± standard deviation (s.d.). Non-parametric statistical analysis was also performed as some of the experimental groups did not show normal distribution. The Kruskal–Wallis test was performed for multiple-group analysis, and Mann–Whitney test was also performed for two group analysis. In this study, differences with a P value <0.05 were considered as significant.

Results

Stage of follicle development in histologic sections and viability

A total of 917 follicles from 140 fragments of fourteen patients were classified by H&E staining under a light microscope in all groups. Histological analysis revealed follicles at all developmental stages in both the non-culture and culture (VEGFA 165 and/or fetuin) groups (images can be seen in Fig. 2). In the frozen-thawed non-culture group, the following follicles were recognized; 78.1% resting follicles, 10.2% primary growing follicles, 2.3% secondary growing follicles and 9.4% atretic follicles. After 6  days of culture, the percentage of resting follicles showed a

Table 1 Quantitative real time PCR primer sequences.

Gene name Accession no. Forward primer (5′–3′) Reverse primer (5′–3′)

Bone morphogenetic protein 15 (BMP15)

NM_005448.2 TCAGACCAAACCGAGGACTATAC TGGCAGGAGAGATTGAAGCG

Growth differentiation factor 9 (GDF9)

NM_005260.4 ATCGCATTACTACCGTTGAACAC CACACACATTTGACAGCAGAGG

Inhibin beta B (INHBB) NM_002193.2 TTTACCTGAAACTCCTGCCCTAC CCCTCTTCTCCACCATGTTCCSuperoxide dismutase 1 (SOD1) NM_000454.4 AAGCATTAAAGGACTGACTGAAGG TTTCTGGATAGAGGATTAAAGTGAGGSuperoxide dismutase 2 (SOD2) NM_000636.2 CACCGAGGAGAAGTACCAGGAG ATTGATATGACCACCACCATTGAACCatalase (CAT) NM_001752.3 ATTACCAAATACTCCAAGGCAAAGG AACCCGATTCTCCAGCAACAGGlutathione peroxidase 1 (GPX1) NM_000581.2 AACGATGTTGCCTGGAACTTTG CGATGTCAATGGTCTGGAAGCGlutathione S-transferase alpha 3

(GSTA3)NM_000847.4 GATTTGGGAAAGTTAAGAAATGATGGG GCTGGCAATGTAGTTGAGAATGG

Glutathione reductase (GSR) NM_000637.3 GAAAAGCGGGATGCCTATGTG CGGATGATTTCTATATGGGACTTGGRibosomal protein L19 (RPL19) NM_000981.3 CCAATGCCAACTCCCGTCAG TACCCTTCCGCTTACCTATGCGlyceraldehyde-3-phosphate

dehydrogenase (GAPDH)NM_002046.5 GAGTCCACTGGCGTCTTCAC GAGGCATTGCTGATGATCTTGAG

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 212Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

dramatic reduction in the culture groups compared with that of the frozen-thawed non-culture group (Kruskal–Wallis, P < 0.001). The percentage of resting follicles was also significantly reduced in the VEGFA 165 and VEGFA 165 + fetuin groups compared with the control group. In the case of primary growing follicles, the percentage was notably higher in all the culture groups compared with that of the frozen-thawed non-culture group (Kruskal–Wallis, P < 0.01). There was no significant difference between the culture groups in the percentage of primary growing follicles. The percentages of secondary growing and atretic follicles were also increased in the cultured groups compared with the frozen-thawed uncultured group (Kruskal–Wallis, P < 0.001 and P = 0.001, respectively). Our results indicate a significant increase in the percentage of secondary growing follicles in the VEGFA 165 and VEGFA 165 + fetuin groups compared with the control. From the histological evaluation, we observed that the percentage of atretic follicles significantly decreased in the culture groups supplemented with fetuin and fetuin + VEGFA 165 compared with the control group (Fig. 3). This result was confirmed by the percentage (number of viable follicles/number of total follicles (viable + dead)) of viable follicles, which was evaluated using calcein-AM/ethidium homodimer staining (Kruskal–Wallis, P < 0.01). The effects of the different supplementations on follicular viability are shown in Fig.  4. Calcein-AM/ethidium homodimer staining results show lower level of viable follicles in the culture groups after 6  days of culture compared to the

non-culture group, although the percentage of viable follicles was remarkably lower in the control and the VEGFA 165-supplemented groups compared with the non-culture group. Furthermore, we found a significant improvement

Figure 3Percentage of follicles at each stage of development in the ovarian fragments treated with VEGFA 165 and/or fetuin, control and the uncultured groups. The data have been given as median values (25th, 75th percentile). #P < 0.05 vs uncultured group, ##P < 0.01 vs uncultured group, ###P < 0.001 vs uncultured group. *P < 0.05 vs control group, **P < 0.01 vs control group, ***P < 0.001 vs control group.

Figure 4Comparison of the viability (percentage of viable follicles as determined by calcein-AM/ethidium homodimer staining) of ovarian cortical fragments between uncultured, fetuin-treated, VEGFA 165-treated, VEGFA 165 + fetuin-treated groups and the control group. The data have been given as median values (25th, 75th percentile).

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

213Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

in viability in the fetuin and VEGFA 165 + fetuin groups compared with the control group (Fig. 5).

Sex steroid secretion

17β-estradiol (E2) and progesterone (P4) concentrations in the culture medium of ovarian cortical fragments from the different groups are shown in Table 2. We observed a gradual increase in E2 and P4 levels in all groups during the culture period. We also observed that E2 concentration was considerably higher in the VEGFA 165 group at day six (P < 0.05) and from day four in the VEGFA 165 + fetuin group compared with the control group (P < 0.05 at day 4 and P < 0.01 at day 6). Even though E2 level was increased in the fetuin group compared with the control group at days 2, 4 and 6, their differences were not significant (P > 0.05). Our ELISA result indicates that P4 concentration remarkably increased in the VEGFA 165 group compared with the control group at days 4 and 6 (P < 0.05 and P < 0.01, respectively). In spite of the enhancement of P4 concentration in the other groups during the culture period, we could not find any significant relation when the VEGFA 165 + fetuin and fetuin groups were compared with the control group (P > 0.05) (Table 2).

Oxidative stress evaluation

ROS levels in the ovarian fragments in all groups after 6  days of culture are indicated in Fig.  6. We observed that ROS levels was significantly lower in the VEGFA 165 + fetuin and fetuin groups compared with the control

Figure 5A representative figure shows fluorescent staining with calcein AM-ethidium homodimer-1 after the 6 days culture period. Human ovarian cortical fragments were cultured as control or VEGFA 165 and/or fetuin. Control group (A, B and C), fetuin treated group (D, E and F), VEGFA 165 group (G, H and I), VEGFA 165 + fetuin group (J, K and L). Green color indicates viable follicles. Bright red color indicates dead follicles. Left panels show green staining. Middle panels indicate red staining. Right panels show merged red and green staining. Bar = 100 µm. A full colour version of this figure is available at http://dx.doi.org/10.1530/JOE-16-0368.

Table 2 Steroid (estradiol and progesterone) secretion

profiles of all groups’ follicles on the days 2, 4 and 6 of

culture.

Day

Parameters

Estradiol (p/mL) Progestron (n/mL)

2 73.78 ± 42.83 0.26 ± 0.09Control 4 85.78 ± 38.93 0.32 ± 0.11 6 93.35 ± 39.61 0.38 ± 0.12 2 82.57 ± 45.49 0.27 ± 0.15Fetuin 4 105.50 ± 46.23 0.34 ± 0.16 6 113.50 ± 39.14 0.45 ± 0.16 2 95.71 ± 29.11 0.40 ± 0.18VEGF 4 114.71 ± 29.67 0.48 ± 0.20* 6 143.14 ± 48.80* 0.63 ± 0.20** 2 110.14 ± 30.42 0.39 ± 0.14VEGF + fetuin 4 132.00 ± 43.00* 0.47 ± 0.14 6 152.42 ± 39.16** 0.56 ± 0.23

All data are mean values ± s.d.*P < 0.05 vs control group, **P < 0.01 vs control group.

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 214Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

group (P = 0.001 and P < 0.05, respectively). There was no significant difference in this value between the VEGFA 165 and control groups (P > 0.05). We observed similar results when the levels of malondialdehyde (marker of lipid peroxidation) in treatment groups were compared with the control group (Fig.  7). Malondialdehyde levels were found to be lower in the VEGFA 165 + fetuin and fetuin groups compared with the control group (P < 0.001 and P < 0.05, respectively). We did not find any significant change in the level of lipid peroxidation between the VEGFA 165 group and the control (P > 0.05).

Total antioxidant capacity levels

As shown in Fig. 8, addition of only fetuin or in combination with VEGFA 165 to the culture medium notably increased the total antioxidant capacity in the ovarian fragments compared with the control group (P = 0.001 and P < 0.05, respectively). However, supplementation of the culture medium with only VEGFA 165 had no significant effect on the total antioxidant capacity compared with the control group (P > 0.05).

Developmental and antioxidant gene expression levels

From the results of gene expression analysis, GDF9 and BMP15 mRNA expression in the ovarian fragments were found to be significantly increased over the culture period in all the treatment groups compared with the control group. We also observed an increased level of INHB mRNA expressions in all the treatment groups compared with the control, but the difference was not significant in the fetuin group. Antioxidant gene expression analysis showed a notably higher level of SOD1 and CAT mRNAs in the VEGFA 165 + fetuin and fetuin groups compared with the control group. We did not find any significant change in the level of expression of the other antioxidant genes in the treatment groups compared with control group (Fig. 9).

Discussion

For the first time, this study has shown that the addition of only VEGFA 165 or in combination with fetuin to a culture medium could lead to resting follicle activation and increased number of growing follicles in human ovarian cortical fragments. In the group supplemented with VEGFA 165, we found a significant increase in the concentration of 17β-estradiol at day 6 and progesterone from day 4 of the culture period. In the group supplemented with a combination of VEGFA 165 and fetuin, the level of 17β-estradiol was enhanced from day 4 of the culture period. We also observed that the levels of mRNA of follicle development genes BMP15, GDF9 and INHB were increased in all the treatment groups. A higher level of total antioxidant capacity, lower levels of ROS and lipid peroxidation and increased number of viable follicles were observed in the fetuin and fetuin + VEGFA 165 groups at the end of the culture period. Moreover, the

Figure 6Effects of the supplementation with VEGFA 165, fetuin or both during in vitro culture of human frozen-thawed ovarian cortical fragments on reactive oxygen species (ROS) status. All data are given as mean values ± s.d. *P < 0.05 vs control group, **P < 0.01 vs control group.

Figure 7Comparison of malondialdehyde (MDA indicator of lipid peroxidation) levels in human ovarian cortical fragments between VEGFA 165, fetuin and both supplemented groups and the control group. All data are mean values ± s.d. *P < 0.05 vs control group, **P < 0.01 vs control group.

Figure 8Effects of the supplementation of the culture medium with VEGFA 165, fetuin or both on total antioxidant capacity (TAC) levels of human ovarian cortical fragments. All data are given as mean values ± s.d. *P < 0.05 vs control group, **P < 0.01 vs control group.

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

215Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

level of expression of SOD1 and CAT genes were notably higher under the influence of only fetuin or in combination with VEGFA 165 after 6 days of culture of ovarian cortical fragments.

Previous studies have shown that vascular endothelial growth factor A is involved in primordial follicle activation and development in rats (McFee  et  al. 2009) and dogs (Abdel-Ghani et al. 2014). Yang and coworkers also reported that VEGFA 165 induces the transition of primary to secondary follicles in bovine (Yang & Fortune 2007). Some studies have suggested that VEGFA 165 could stimulate the growth of primordial and preantral follicles through increased cell permeability and transfer of nutrition, gonadotropins, growth factors, steroids and oxygen, which are essential factors for the growth of follicles both in vivo and in vitro. Also, VEGFA 165 directly induces follicles development via its receptors expressed in theca and granulosa cells (Yang & Fortune 2007, Araújo  et  al. 2011). Abir and coworkers indicated that VEGFA protein and its receptors are expressed in human oocytes, granulosa cells and stroma cells in primordial follicles (Abir et al. 2010a). In agreement with the results of Abir and coworkers, the results of our study show that the addition of VEGFA 165 to the culture medium led to the activation of resting follicles and increased the percentage of secondary growing follicles after 6  days of culture. It seems that in human primordial follicles, VEGFA 165 activates follicle maturation via the same mechanism previously explained for the other species.

Although we did not find any significant change in the percentage of viable follicles in the VEGFA 165 supplemented group compared with the control group, the proportion of viable growing follicles was increased in the presence of VEGFA 165. Our findings are consistent with the results of Yang and coworkers who reported that the addition of VEGFA 165 at concentrations 0, 1, 10 or 100 ng/mL to culture medium had no significant effect on the number of primordial and primary healthy follicles in bovine, but the number of secondary viable follicles were increased in all the treatment groups (Yang & Fortune 2007). Araújo and coworkers also indicated that VEGFA 165 increased the rate of healthy follicles and oocyte viability after 18-day culture period in preantral follicles (≥150 µm in diameter) (Araújo et al. 2011). It seems that the effects of VEGFA 165 on the viability of the follicle increases as the follicle develops and might be associated with the classic role of VEGFA 165 in angiogenesis of large follicle.

We observed the highest level of expression of GDF9, BMP15 and INHB genes during the culture period in the VEGFA 165 + fetuin group compared with the other groups. However, the level of expression of these genes, increased in all the treatment groups compared with the control group, though in the expression of INHB gene, the difference between the group supplemented with only fetuin and the control was not statistically significant. These results are consistent with a previous study, which reported that GDF9 and BMP15 play a major role in early

Figure 9Relative gene expression levels characterized by real-time PCR. At day 6 of culture, GDF9 and BMP15 expressions were significantly upregulated in the ovarian cortical tissues of the VEGFA 165 and/or fetuin groups. Expression of INHB increased significantly in the groups cultured with VEGFA 165 and VEGFA 165 + fetuin. SOD2 and CAT expression increased markedly over the culture period in the fetuin and VEGFA 165 + fetuin groups. Although SOD2, GPX1, GSTA3 and GSR expression levels were not significant in the treatment groups compared with the control. All data are given as mean values ± s.e.m. *P < 0.05 vs control group, ***P < 0.001 vs control group.

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 216Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

follicle growth and improve the viability of follicular cells (Knight & Glister 2006, Sadeu & Smitz 2008). In a similar study, Kedem and coworkers indicated that both GDF9 and BMP15 stimulate the activation of human primordial follicles in vitro, but GDF9 is more effective than BMP15, and its expression level was found to be related to that of E2 (Kedem et al. 2011). Liebenthron and coworkers also reported that the expression of GDF9 and INHB genes was significantly increased in human cortical fragments during a culture period in fluidic culture system (Liebenthron et al. 2013).

The results obtained in our study indicate that VEGFA 165 can improve the activation of resting follicles and increase the percentage of secondary growing follicles during culture, but the results were more remarkable in the presence of VEGFA 165 + fetuin than in the VEGFA 165 group. We speculate that these results are related to fetuin’s positive effects on ROS reduction and enhancement of TAC levels in ovarian cortical fragments during the culture period. There is a complicated interaction between antioxidants and pro-oxidants, which results in intracellular homeostasis maintenance. Disturbances in the intracellular homeostasis due to ROS overproduction or lack of antioxidant lead to cell injuries (Agarwal et al. 2005). Previous studies have suggested that oxidative stress may affect oocyte maturation, folliculogenesis (Behrman  et  al. 2001) and apoptosis of follicular cells (Tsai-Turton & Luderer 2006), and it is associated with ovarian follicle aging (Tatone et al. 2008).

Although antioxidant ability of fetuin has been reported previously (Sarıözkan et al. 2015a,b), its role in improving human follicular cells quality during culture is still undefined. In view of these, we investigated the changes in ROS levels, TAC, lipid peroxidation status and viability of follicles to evaluate the potential ability of the combination of fetuin and VEGFA 165 in regulating the survival and development of human follicles during the culture of frozen-thawed ovarian cortical tissues. In the present study, we found that fetuin reduces ROS levels in ovarian cortical tissues during the culture period. The results of the present study also indicate that fetuin can enhance TAC levels and also prevent the formation of MDA, which is an indicator of the detrimental effect of ROS on polyunsaturated fatty acid in cell membranes. These findings are in agreement with the observations of Sarıözkan and coworkers who indicated that supplementation of sperm freezing medium with fetuin or a combination of fetuin and hyaluronan decreased ROS levels and MDA formation in frozen-thawed spermatozoa

(Sarıözkan et al. 2015b). Sarıözkan and coworkers in another study showed that addition of fetuin (10 mg) to freezing solution increases superoxide dismutase and glutathione peroxidase activity in post-thawed bull spermatozoa. The hypo-osmotic swelling test results (sperm viability test) in their study suggest that there was a higher level of viable cells (intact membrane) in the presence of fetuin (10 mg) compared with the non-treated group (Sarıözkan  et  al. 2015a). Consistent with their results, we observed that fetuin notably increased the percentage of viable follicles during the culture period.

The increase in SOD1 and CAT gene expression observed in our study associated well with ROS and lipid peroxidation reduction in the ovarian cortical fragments in the presence of fetuin or a combination of fetuin and VEGFA 165. SOD converts superoxide anion radicals to oxygen and peroxide hydrogen, and catalase catalyzes the conversion of H2O2 into H2O thereby inhibiting oocytes and granulosa cell membrane damage resulting from these toxic anions. Based on our findings, high antioxidant genes expression level and total antioxidant capacity and low ROS and lipid peroxidation levels in human ovarian cortical fragments can be achieved when fetuin is added to culture medium. It seems likely that these positive effects are as the results of the antioxidant activity of fetuin (Sarıözkan et al. 2015a,b).

Although the levels of expression of the antioxidant genes (SOD2, GPX1, GSTA3 and GSR) were increased in the fetuin-treated group, the differences were not significant compared with the control. Probably prolonged culture period or high fetuin doses are required to stimulate higher expression of SOD2, GPX1, GSTA3 and GSR in ovarian fragments. Moreover, El Mouatassim and coworkers reported that glutathione peroxidase and MnSOD (SOD2) are expressed in metaphase II of oocytes, and they believe that these antioxidants are the markers of cytoplasmic maturation (El Mouatassim  et  al. 1999). Other studies have suggested that SOD1 rather plays important role in ovarian function in contrast to SOD2 (Tilly & Tilly 1995, Matzuk  et  al. 1998). In another study conducted by El-Shahat and coworkers, the concentrations of GSH and glutathione reductase in the follicular fluid of large follicles were higher than those of small follicles at the luteal phase of buffaloes. On the other hand, they reported that SOD concentration was higher in small follicles as compared to large follicles at the luteal phase (El-Shahat & Kandil 2012). We suspect that the developmental stages of follicles in ovarian cortex influence the expression levels of SOD2, GPX1,

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

217Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

GSTA3 and GSR genes in a culture system. Further studies are required to evaluate and clarify it.

The concentration of steroid hormones is another important factor related to follicle development. It has been established that E2 is an indicator of follicle maturity. E2 concentration is enhanced with the differentiation stage of follicles and the number of granulosa cells (Carlsson  et  al. 2006); however, the influence of progesterone on follicle development is yet unknown. It seems likely that increased progesterone levels in the early stages of follicle development could be an indicator of premature luteinization caused by oxidative stress (Xu  et  al. 2009). In the same study, the authors reported that conventional culture system led to increased progesterone level, which is a marker of premature follicle development. They suggested that the cause of the premature follicle luteinization might be related to the accumulation of toxic factors inside the culture medium or cultured tissues in this culture system compared to fluidical culture system (Liebenthron  et al. 2013). In support of these findings, the results of the present study show that steroid hormones are enhanced regularly during a culture period. 17β-estradiol level was significantly increased at day 6 in the group supplemented with VEGFA 165. However, high level of 17β-estradiol was observed in the group treated with a combination of fetuin and VEGFA 165 from day 4. In view of these findings, we speculate that the increase in 17β-estradiol level in the group treated with VEGFA 165 + fetuin is associated with resting follicle activation and the enhancement of secondary growing follicles, which is in agreement with previous studies (Scott et al. 2004, Xu et al. 2009).

We found that progesterone level was notably increased in the VEGFA 165 group. We speculate that this result is related to the higher level of ROS observed in the VEGFA 165 group as described earlier. Also, it seems that the lower level of progesterone in the VEGFA 165 + fetuin group is related to the effects of fetuin on the reduction of ROS levels in this group. Although ovarian tissue biopsy obtained from fertile donors undergoing Caesarean section is encouraged (Smitz  et  al. 2010), it remains to be tested whether pregnancy could affect the steroid hormone production of ovarian follicles during in vitro culture of ovarian cortical fragments.

In conclusion, the present study provides useful evidence that follicle parameters are enhanced by the supplementation of ovarian cortex culture systems with a combination of VEGFA 165 and fetuin. The observation that VEGFA 165 in combination with fetuin leads to resting follicle activation and development and increased

percentage of healthy secondary growing follicles would also be useful in the development of ovarian culture systems as an alternative option for fertility preservation in cancer patients in whom transplantation of ovarian cortical tissue is avoided.

Declaration of interestThe authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

FundingThis work was supported by the Tehran University of Medical Sciences (grant no. 25129).

ReferencesAbdel‐Ghani M, Shimizu T & Suzuki H 2014 Expression pattern of

vascular endothelial growth factor in canine folliculogenesis and its effect on the growth and development of follicles after ovarian organ culture. Reproduction in Domestic Animals 49 734–739. (doi:10.1111/rda.12357)

Abedelahi A, Salehnia M, Allameh A & Davoodi D 2010 Sodium selenite improves the in vitro follicular development by reducing the reactive oxygen species level and increasing the total antioxidant capacity and glutathione peroxide activity. Human Reproduction 25 977–985. (doi:10.1093/humrep/deq002)

Abir R, Fisch B, Zhang X, Felz C, Kessler-Icekson G, Krissi H, Nitke S & Ao A 2009 Keratinocyte growth factor and its receptor in human ovaries from fetuses, girls and women. Molecular Human Reproduction 15 69–75. (doi:10.1093/molehr/gan080)

Abir R, Ao A, Zhang XY, Garor R, Nitke S & Fisch B 2010a Vascular endothelial growth factor A and its two receptors in human preantral follicles from fetuses, girls, and women. Fertility and Sterility 93 2337–2347. (doi:10.1016/j.fertnstert.2009.01.111)

Abir R, Feinmesser M, Yaniv I, Fisch B, Cohen IJ, Ben-Haroush A, Meirow D, Felz C & Avigad S 2010b Occasional involvement of the ovary in Ewing sarcoma. Human Reproduction 25 1708–1712. (doi:10.1093/humrep/deq121)

Agarwal A & Allamaneni SS 2004 Role of free radicals in female reproductive diseases and assisted reproduction. Reproductive Biomedicine Online 9 338–347. (doi:10.1016/S1472-6483(10)62151-7)

Agarwal A, Gupta S & Sharma RK 2005 Role of oxidative stress in female reproduction. Reproductive Biology and Endocrinology 3 1–21. (doi:10.1186/1477-7827-3-1)

Araújo V, Silva G, Duarte A, Magalhães D, Almeida A, Gonçalves R, Bruno J, Silva T, Campello C & Rodrigues A 2011 Vascular endothelial growth factor-A165 (VEGF-A165) stimulates the in vitro development and oocyte competence of goat preantral follicles. Cell and Tissue Research 346 273–281. (doi:10.1007/s00441-011-1251-1)

Araújo VR, Duarte ABG, Bruno JB, Lopes CAP & de Figueiredo JR 2013 Importance of vascular endothelial growth factor (VEGF) in ovarian physiology of mammals. Zygote 21 295–304. (doi:10.1017/s0967199411000578)

Araújo V, Gastal M, Wischral A, Figueiredo J & Gastal E 2014 In vitro development of bovine secondary follicles in two-and three-dimensional culture systems using vascular endothelial growth factor, insulin-like growth factor-1, and growth hormone. Theriogenology 82 1246–1253. (doi:10.1016/j.theriogenology.2014.08.004)

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

Research 218Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

e asadi and others

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

Arnaud P & Kalabay L 2002 Alpha2‐HS glycoprotein: a protein in search of a function. Diabetes/Metabolism Research and Reviews 18 311–314. (doi:10.1002/dmrr.315)

Artac RA, McFee RM, Smith RAL, Baltes-Breitwisch MM, Clopton DT & Cupp AS 2009 Neutralization of vascular endothelial growth factor antiangiogenic isoforms is more effective than treatment with proangiogenic isoforms in stimulating vascular development and follicle progression in the perinatal rat ovary. Biology of Reproduction 81 978–988. (doi:10.1095/biolreprod.109.078097)

Asadi E, Shabani R, Ghafari S & Golalipour MJ 2013 Preventing effect of vitamin E on oocytes apoptosis in morphinetreated mice. International Journal of Morphology 31 533–538. (doi:10.4067/S0717-95022013000200029)

Behrman HR, Kodaman PH, Preston SL & Gao S 2001 Oxidative stress and the ovary. Journal of the Society for Gynecologic Investigation 8 S40–S42. (doi:10.1016/S1071-5576(00)00106-4)

Caires KC, de Avila JM, Cupp AS & McLean DJ 2011 VEGFA family isoforms regulate spermatogonial stem cell homeostasis in vivo. Endocrinology 153 887–900. (doi:10.1210/en.2011-1323)

Carlsson IB, Laitinen MP, Scott JE, Louhio H, Velentzis L, Tuuri T, Aaltonen J, Ritvos O, Winston RM & Hovatta O 2006 Kit ligand and c-Kit are expressed during early human ovarian follicular development and their interaction is required for the survival of follicles in long-term culture. Reproduction 131 641–649. (doi:10.1530/rep.1.00868)

Carvalho A, Faustino L, Silva C, Castro S, Lobo C, Santos F, Santos R, Campello C, Bordignon V & Figueiredo J 2014 Catalase addition to vitrification solutions maintains goat ovarian preantral follicles stability. Research in Veterinary Science 97 140–147. (doi:10.1016/j.rvsc.2014.05.006)

Cui T-G, Foster RR, Saleem M, Mathieson PW, Gillatt DA, Bates DO & Harper SJ 2004 Differentiated human podocytes endogenously express an inhibitory isoform of vascular endothelial growth factor (VEGF165b) mRNA and protein. American Journal of Physiology-Renal Physiology 286 767–773. (doi:10.1152/ajprenal.00337.2003)

Dell’Aquila ME, De Felici M, Massari S, Maritato F & Minoia P 1999 Effects of fetuin on zona pellucida hardening and fertilizability of equine oocytes matured in vitro. Biology of Reproduction 61 533–540. (doi:10.1095/biolreprod61.2.533)

Donnez J & Dolmans M-M 2013 Fertility preservation in women. Nature Reviews Endocrinology 9 735–749. (doi:10.1038/nrendo.2013.205)

Ducibella T, Anderson E, Albertini DF, Aalberg J & Rangarajan S 1988 Quantitative studies of changes in cortical granule number and distribution in the mouse oocyte during meiotic maturation. Developmental Biology 130 184–197. (doi:10.1016/0012-1606(88)90425-3)

El-Shahat K & Kandil M 2012 Antioxidant capacity of follicular fluid in relation to follicular size and stage of estrous cycle in buffaloes. Theriogenology 77 1513–1518. (doi:10.1016/j.theriogenology.2011.11.018)

El Mouatassim S, Guerin P & Menezo Y 1999 Expression of genes encoding antioxidant enzymes in human and mouse oocytes during the final stages of maturation. Molecular Human Reproduction 5 720–725. (doi:10.1093/molehr/5.8.720)

Eppig JJ & O’Brien MJ 1996 Development in vitro of mouse oocytes from primordial follicles. Biology of Reproduction 54 197–207. (doi:10.1095/biolreprod54.1.197)

Ergüder İB, Çetin R, Devrim E, Kılıçoğlu B, Avcı A & Durak İ 2005 Effects of cyclosporine on oxidant/antioxidant status in rat ovary tissues: protective role of black grape extract. International Immunopharmacology 5 1311–1315. (doi:10.1016/j.intimp.2005.03.016)

Fabbri R, Pasquinelli G, Keane D, Mozzanega B, Magnani V, Tamburini F & Venturoli S 2009 Culture of cryopreserved ovarian tissue: state of the art in 2008. Fertility and Sterility 91 1619–1629. (doi:10.1016/j.fertnstert.2009.03.109)

Feigin E, Freud E, Fisch B, Orvieto R, Kravarusic D, Avrahami G & Abir R 2008 Fertility preservation in female adolescents with malignancies. Cancer in Female Adolescents, pp 103–138. Hauppauge, NY, USA: Nova Science Publishers.

Ferrara N 2004 Vascular endothelial growth factor: basic science and clinical progress. Endocrine Reviews 25 581–611. (doi:10.1210/er.2003-0027)

Finkel T 2011 Signal transduction by reactive oxygen species. Journal of Cell Biology 194 7–15. (doi:10.1083/jcb.201102095)

Fisher T, Molskness T, Villeda A, Zelinski M, Stouffer R & Xu J 2013 Vascular endothelial growth factor and angiopoietin production by primate follicles during culture is a function of growth rate, gonadotrophin exposure and oxygen milieu. Human Reproduction 28 3263–3270. (doi:10.1093/humrep/det337)

Fujihara M, Comizzoli P, Keefer CL, Wildt DE & Songsasen N 2014 Epidermal growth factor (EGF) sustains in vitro primordial follicle viability by enhancing stromal cell proliferation via MAPK and PI3K pathways in the prepubertal, but not adult, cat ovary. Biology of Reproduction 90 86. (doi:10.1095/biolreprod.113.115089)

Fujii J, Iuchi Y & Okada F 2005 Fundamental roles of reactive oxygen species and protective mechanisms in the female reproductive system. Reproductive Biology and Endocrinology 3 43–50. (doi:10.1186/1477-7827-3-43)

Gougeon A 1986 Dynamics of follicular growth in the human: a model from preliminary results. Human Reproduction 1 81–87.

Gougeon A 1996 Regulation of ovarian follicular development in primates: facts and hypotheses. Endocrine Reviews 17 121–155. (doi:10.1210/edrv-17-2-121)

Høyer PE, Terkelsen OB, Byskov AG & Nielsen H 2001 Fetuin and fetuin messenger RNA in granulosa cells of the rat ovary. Biology of Reproduction 65 1655–1662. (doi:10.1095/biolreprod65.6.1655)

Kalab P, Schultz R & Kopf G 1993 Modifications of the mouse zona pellucida during oocyte maturation: inhibitory effects of follicular fluid, fetuin, and alpha 2HS-glycoprotein. Biology of Reproduction 49 561–567. (doi:10.1095/biolreprod49.3.561)

Kedem A, Fisch B, Garor R, Ben-Zaken A, Gizunterman T, Felz C, Ben-Haroush A, Kravarusic D & Abir R 2011 Growth differentiating factor 9 (GDF9) and bone morphogenetic protein 15 both activate development of human primordial follicles in vitro, with seemingly more beneficial effects of GDF9. Journal of Clinical Endocrinology and Metabolism 96 E1246–E1254. (doi:10.1210/jc.2011-0410)

Khosravi F, Reid RL, Moini A, Abolhassani F, Valojerdi MR & Kan FW 2013 In vitro development of human primordial follicles to preantral stage after vitrification. Journal of Assisted Reproduction and Genetics 30 1397–1406. (doi:10.1007/s10815-013-0105-z)

Knight PG & Glister C 2006 TGF-β superfamily members and ovarian follicle development. Reproduction 132 191–206. (doi:10.1530/rep.1.01074)

Li J, Kawamura K, Cheng Y, Liu S, Klein C, Liu S, Duan E-K & Hsueh AJ 2010 Activation of dormant ovarian follicles to generate mature eggs. PNAS 107 10280–10284. (doi:10.1073/pnas.1001198107)

Liang Y, Brekken RA & Hyder SM 2006 Vascular endothelial growth factor induces proliferation of breast cancer cells and inhibits the anti-proliferative activity of anti-hormones. Endocrine-Related Cancer 13 905–919. (doi:10.1677/erc.1.01221)

Liebenthron J, Köster M, Drengner C, Reinsberg J, van der Ven H & Montag M 2013 The impact of culture conditions on early follicle recruitment and growth from human ovarian cortex biopsies in vitro. Fertility and Sterility 100 483.e485–491.e485. (doi:10.1016/j.fertnstert.2013.03.046)

Luz HK, Santos RR, Wanderley LS, Faustino LR, Silva CM, Carvalho AA, Campello CC, Santos FW, Figueiredo JR & Rodrigues APR 2012 Catalase prevents lipid peroxidation and enhances survival of caprine preantral follicles cryopreserved in a 1,2-propanediol-freezing medium. Biopreservation and Biobanking 10 338–342. (doi:10.1089/bio.2011.0046)

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access

219Research e asadi and others Effect of VEGF and fetuin on human ovarian tissue

DOI: 10.1530/JOE-16-0368

Journ

alofEn

docrinology

http://joe.endocrinology-journals.org © 2017 Society for EndocrinologyPrinted in Great Britain

Published by Bioscientifica Ltd.

232:2

Manca ME, Manunta ML, Spezzigu A, Torres-Rovira L, Gonzalez-Bulnes A, Pasciu V, Piu P, Leoni GG, Succu S & Chesneau D 2014 Melatonin deprival modifies follicular and corpus luteal growth dynamics in a sheep model. Reproduction 147 885–895. (doi:10.1530/REP-13-0405)

Martinez-Madrid B, Dolmans M-M, Van Langendonckt A, Defrère S & Donnez J 2004 Freeze-thawing intact human ovary with its vascular pedicle with a passive cooling device. Fertility and Sterility 82 1390–1394. (doi:10.1016/j.fertnstert.2004.06.036)

Matzuk MM, Dionne L, Guo Q, Kumar TR & Lebovitz RM 1998 Ovarian function in superoxide dismutase 1 and 2 knockout mice. Endocrinology 139 4008–4011. (doi:10.1210/endo.139.9.6289)

McFee RM, Artac RA, McFee RM, Clopton DT, Smith RAL, Rozell TG & Cupp AS 2009 Inhibition of vascular endothelial growth factor receptor signal transduction blocks follicle progression but does not necessarily disrupt vascular development in perinatal rat ovaries. Biology of Reproduction 81 966–977. (doi:10.1095/biolreprod.109.078071)

McLaughlin M, Kinnell HL, Anderson RA & Telfer EE 2014 Inhibition of phosphatase and tensin homologue (PTEN) in human ovary in vitro results in increased activation of primordial follicles but compromises development of growing follicles. Molecular Human Reproduction 20 736–744. (doi:10.1093/molehr/gau037)

Pajovic S & Saicic Z 2008 Modulation of antioxidant enzyme activities by sexual steroid hormones. Physiological Research 57 801–809.

Picton H, Harris S, Muruvi W & Chambers E 2008 The in vitro growth and maturation of follicles. Reproduction 136 703–715. (doi:10.1530/REP-08-0290)

Re R, Pellegrini N, Proteggente A, Pannala A, Yang M & Rice-Evans C 1999 Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radical Biology and Medicine 26 1231–1237. (doi:10.1016/S0891-5849(98)00315-3)

Redmer D, Dai Y, Li J, Charnock-Jones D, Smith S, Reynolds L & Moor R 1996 Characterization and expression of vascular endothelial growth factor (VEGF) in the ovine corpus luteum. Journal of Reproduction and Fertility 108 157–165. (doi:10.1530/jrf.0.1080157)

Sadeu J & Smitz J 2008 Growth differentiation factor-9 and anti-Müllerian hormone expression in cultured human follicles from frozen–thawed ovarian tissue. Reproductive Biomedicine Online 17 537–548. (doi:10.1016/S1472-6483(10)60242-8)

Salama M, Winkler K, Murach K, Seeber B, Ziehr S & Wildt L 2013 Female fertility loss and preservation: threats and opportunities. Annals of Oncology 24 598–608. (doi:10.1093/annonc/mds514)

Sarıözkan S, Bucak MN, Tuncer PB, Büyükleblebici S, Eken A & Akay C 2015a Influence of fetuin and hyaluronan on the post-thaw quality and fertilizing ability of Holstein bull semen. Cryobiology 71 119–124. (doi:10.1016/j.cryobiol.2015.04.011)

Sarıözkan S, Tuncer P, Büyükleblebici S, Bucak M, Cantürk F & Eken A 2015b Antioxidative effects of cysteamine, hyaluronan and fetuin on post-thaw semen quality, DNA integrity and oxidative stress parameters in the Brown Swiss bull. Andrologia 47 138–147. (doi:10.1111/and.12236)

Schmidt K, Larsen E, Andersen CY & Andersen AN 2010 Risk of ovarian failure and fertility preserving methods in girls and adolescents with a malignant disease. BJOG 117 163–174. (doi:10.1111/j.1471-0528.2009.02408.x)

Scott JE, Zhang P & Hovatta O 2004 Benefits of 8-bromo-guanosine 3′,5′-cyclic monophosphate (8-br-cGMP) in human ovarian

cortical tissue culture. Reproductive Biomedicine Online 8 319–324. (doi:10.1016/S1472-6483(10)60912-1)

Smitz J, Dolmans M-M, Donnez J, Fortune J, Hovatta O, Jewgenow K, Picton H, Plancha C, Shea L & Stouffer R 2010 Current achievements and future research directions in ovarian tissue culture, in vitro follicle development and transplantation: implications for fertility preservation. Human Reproduction Update 16 395–414. (doi:10.1093/humupd/dmp056)

Tatone C, Amicarelli F, Carbone MC, Monteleone P, Caserta D, Marci R, Artini PG, Piomboni P & Focarelli R 2008 Cellular and molecular aspects of ovarian follicle ageing. Human Reproduction Update 14 131–142. (doi:10.1093/humupd/dmm048)

Taylor P, Wilson H, Hillier S, Wiegand S & Fraser H 2007 Effects of inhibition of vascular endothelial growth factor at time of selection on follicular angiogenesis, expansion, development and atresia in the marmoset. Molecular Human Reproduction 13 729–736. (doi:10.1093/molehr/gam056)

Tilly JL & Tilly K 1995 Inhibitors of oxidative stress mimic the ability of follicle-stimulating hormone to suppress apoptosis in cultured rat ovarian follicles. Endocrinology 136 242–252. (doi:10.1210/endo.136.1.7828537)

Titus S, Li F, Stobezki R, Akula K, Unsal E, Jeong K, Dickler M, Robson M, Moy F & Goswami S 2013 Impairment of BRCA1-related DNA double-strand break repair leads to ovarian aging in mice and humans. Science Translational Medicine 5 172ra121–172ra121. (doi:10.1126/scitranslmed.3004925)

Tremellen K 2008 Oxidative stress and male infertility—a clinical perspective. Human Reproduction Update 14 243–258. (doi:10.1093/humupd/dmn004)

Tsai-Turton M & Luderer U 2006 Opposing effects of glutathione depletion and follicle-stimulating hormone on reactive oxygen species and apoptosis in cultured preovulatory rat follicles. Endocrinology 147 1224–1236. (doi:10.1210/en.2005-1281)

Turrens JF 2003 Mitochondrial formation of reactive oxygen species. Journal of Physiology 552 335–344. (doi:10.1113/jphysiol.2003.049478)

Van Langendonckt A, Casanas-Roux F & Donnez J 2002 Oxidative stress and peritoneal endometriosis. Fertility and Sterility 77 861–870. (doi:10.1016/S0015-0282(02)02959-X)

Wallace WHB, Smith AG, Kelsey TW, Edgar AE & Anderson RA 2014 Fertility preservation for girls and young women with cancer: population-based validation of criteria for ovarian tissue cryopreservation. Lancet Oncology 15 1129–1136. (doi:10.1016/S1470-2045(14)70334-1)

Wiener-Megnazi Z, Vardi L, Lissak A, Shnizer S, Reznick AZ, Ishai D, Lahav-Baratz S, Shiloh H, Koifman M & Dirnfeld M 2004 Oxidative stress indices in follicular fluid as measured by the thermochemiluminescence assay correlate with outcome parameters in in vitro fertilization. Fertility and Sterility 82 1171–1176. (doi:10.1016/j.fertnstert.2004.06.013)

Xu M, Barrett SL, West-Farrell E, Kondapalli LA, Kiesewetter SE, Shea LD & Woodruff TK 2009 In vitro grown human ovarian follicles from cancer patients support oocyte growth. Human Reproduction 24 2534–2540. (doi:10.1093/humrep/dep228)

Yang M & Fortune J 2007 Vascular endothelial growth factor stimulates the primary to secondary follicle transition in bovine follicles in vitro. Molecular Reproduction and Development 74 1095–1104. (doi:10.1002/mrd.20633)

Received in final form 11 November 2016Accepted 16 November 2016Accepted Preprint published online 16 November 2016

Downloaded from Bioscientifica.com at 01/13/2020 07:42:57PMvia free access