Upload
others
View
7
Download
0
Embed Size (px)
Citation preview
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
Professor Esa Hohtola
University Lecturer Santeri Palviainen
Postdoctoral research fellow Sanna Taskila
Professor Olli Vuolteenaho
University Lecturer Veli-Matti Ulvinen
Director Sinikka Eskelinen
Professor Jari Juga
University Lecturer Anu Soikkeli
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-1340-8 (Paperback)ISBN 978-952-62-1341-5 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1385
ACTA
Hanna-Leena K
elhälä
OULU 2016
D 1385
Hanna-Leena Kelhälä
THE EFFECT OF SYSTEMIC TREATMENT ON IMMUNE RESPONSES AND SKIN MICROBIOTA IN ACNE
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE
A C T A U N I V E R S I T A T I S O U L U E N S I SD M e d i c a 1 3 8 5
HANNA-LEENA KELHÄLÄ
THE EFFECT OF SYSTEMIC TREATMENT ON IMMUNE RESPONSES AND SKIN MICROBIOTA IN ACNE
Academic dissertation to be presented with the assentof the Doctoral Training Committee of Health andBiosciences of the University of Oulu for public defencein Auditorium 8 of Oulu University Hospital (Kajaanintie50), on 7 October 2016, at 12 noon
UNIVERSITY OF OULU, OULU 2016
Copyright © 2016Acta Univ. Oul. D 1385, 2016
Supervised byProfessor Antti LauermaDocent Riitta PalatsiProfessor Kaisa Tasanen-Määttä
Reviewed byProfessor Gregor JemecDocent Petteri Arstila
ISBN 978-952-62-1340-8 (Paperback)ISBN 978-952-62-1341-5 (PDF)
ISSN 0355-3221 (Printed)ISSN 1796-2234 (Online)
Cover DesignRaimo Ahonen
JUVENES PRINTTAMPERE 2016
OpponentDocent Jussi Liippo
Kelhälä, Hanna-Leena, The effect of systemic treatment on immune responses andskin microbiota in acne. University of Oulu Graduate School; University of Oulu, Faculty of MedicineActa Univ. Oul. D 1385, 2016University of Oulu, P.O. Box 8000, FI-90014 University of Oulu, Finland
Abstract
Acne is a common skin disease that affects nearly every teenager but in some cases it persists intoadulthood as a chronic disease. Acne severity ranges from mild comedonal to severe cystic andscarring disease. The pathogenesis of acne is multifactorial: increased sebum production,hormonal influences, the hypercornification of pilosebaceous ducts, overgrowth ofPropionibacterium acnes (P. acnes) and inflammation around pilosebaceous follicles areconsidered to be the main pathogenetic factors but few further details are known. The role ofinnate immunity in the pathogenesis of acne has been studied quite extensively, but thecontribution of adaptive immune responses is not well characterized. Although isotretinoin hasbeen the most potent medication for acne over 30 years, its mode of action is partially unknown.Furthermore, modern 16S ribosomal RNA (rRNA) gene amplicon sequencing based methodsallow quantification of the abundance of skin bacteria, but these culture-independent techniqueshave not yet been used to assess the effect of systemic treatments, isotretinoin and tetracyclineantibiotics on acne skin microbiota.
In this study the innate and adaptive immune responses in the skin of acne patients wereinvestigated. Skin biopsies were taken from early-stage acne lesions and from uninvolved skin ofacne patients, and the samples were examined for the expression of cytokines, chemokines,transcription factors and antimicrobial peptides, using real-time polymerase chain reaction (PCR).In addition, the skin biopsies were examined by immunohistochemistry and Luminex technology,which was also used in the determination of cytokine levels in acne patients’ serum samples. Theskin microbiota of swab samples was investigated using 16S rRNA gene amplicon sequencing.
We found that innate and adaptive immune responses, in particular the activation of the IL-17/Th17 axis, are involved in early-stage acne lesions. Furthermore, the expression of effectorcytokine TGF-β and transcription factor of regulatory T cells (Tregs) FoxP3 mRNA was reducedin acne patients’ uninvolved skin compared to normal skin of healthy controls. Isotretinoin has nodirect effect on innate and adaptive immune responses in newly formed acne lesions. It did,however, modify some innate immune responses: the expression of IL-1β and toll-like receptor 2(TLR2) mRNA was reduced in uninvolved skin of acne patients, and the number of CD68+macrophages increased in acne patients’ skin with isotretinoin treatment. After six weeks’treatment, the abundance of P. acnes was similarly reduced with either isotretinoin or lymecyclinetreatment. However, previous studies and clinical experience show that isotretinoin is moreclinically effective against acne than tetracyclines, probably because of the effect of isotretinoinon sebaceous glands and sebum excretion.
Acne is a disease, which at its worst results in significant scarring. Therefore it is important tounderstand the immunological factors behind its pathogenesis. Our findings show that bothadaptive and innate immunity play an important role. Isotretinoin, although currently the mostpotent anti-acne drug, does not directly affect the adaptive immune response and therefore newmedications are required to control the relevant immune responses, especially in severe cystic orfulminant acne.
Keywords: acne, adaptive immunity, innate immunity, isotretinoin, microbiota,Propionibacterium acnes, tetracycline
Kelhälä, Hanna-Leena, Systeemilääkitysten vaikutus akneihon immuunivasteisiinja bakteeristoon. Oulun yliopiston tutkijakoulu; Oulun yliopisto, Lääketieteellinen tiedekuntaActa Univ. Oul. D 1385, 2016Oulun yliopisto, PL 8000, 90014 Oulun yliopisto
Tiivistelmä
Akne on yleinen ihosairaus, joka koskettaa lähes jokaista teini-iässä ja jatkuu osalla kroonisenasairautena läpi aikuisiän. Aknen vaikeusaste vaihtelee lievästä vaikeisiin, arpeuttaviin tautimuo-toihin. Aknen patogeneesin tiedetään olevan monitekijäinen. Tärkeimmät aknen syntyyn vaikut-tavat tekijät ovat lisääntynyt talineritys hormonien, erityisesti androgeenien vaikutuksesta, tali-rauhaskarvatuppitiehyen tukkeutuminen, Propionibacterium acnes (P. acnes) -bakteerin liika-kasvu sekä tulehdusreaktio talirauhaskarvatupen ympärillä. Synnynnäisen immuniteetin rooliaaknen synnyssä on tutkittu paljon, sen sijaan hankittua immuniteettia huomattavasti vähemmän.Myöskään yli 30 vuotta käytössä olleen tehokkaimman aknelääkkeen, isotretinoiinin, vaikutus-mekanismia ei täysin tiedetä. Lisäksi systeemilääkkeiden, isotretinoiinin ja tetrasykliiniryhmänantibioottien, vaikutusta akneihon bakteeristoon ei ole tutkittu moderneilla, polymeraasiketjutut-kimuksiin (PCR) perustuvilla menetelmillä.
Tässä tutkimuksessa selvitettiin synnynnäisiä ja hankittuja immuunireaktiota aknea sairasta-vien ihossa ja isotretinoiinin vaikutusta näihin reaktioihin. Tutkimuksessa hyödynnettiin aknepo-tilaiden ihokoepaloja, joista tutkittiin sytokiinien, kemokiinien, transkriptiotekijöiden sekä anti-mikrobisten peptidien ilmentymistä reaaliaikaisella PCR-menetelmällä. Lisäksi ihokoepaloja tut-kittiin immunohistokemiallisilla värjäyksillä ja Luminex-menetelmällä, jota hyödynnettiin myössytokiini-tasojen määrittämiseen aknepotilaiden seeruminäytteistä. Aknea sairastavien ihon bak-teeristoa tutkittiin 16S ribosomaalisen RNA:n geenien sekvensointiin pohjautuvalla menetelmällä.
Väitöstutkimuksessa havaitsimme, että varhaisvaiheen aknemuutoksessa käynnistyvät sekäsynnynnäisen että hankitun immuniteetin vasteet. Erityisesti IL-17/Th17-akseli on aktivoitunut.Lisäksi aknea sairastavien terveellä iholla tulehduksen välittäjäaineen TGF-1β ja transkriptiote-kijän FoxP3 ilmeneminen oli alentunut verrattuna terveihoisiin kontrolleihin. Isotretinoiinilla eiole suoraa vaikutusta synnynnäisen ja hankitun immuniteetin reaktioihin jo olemassa olevissavarhaisen vaiheen aknemuutoksissa. Aknea sairastavien terveessä ihossa isotretinoiini muokkasiluontaisen immuniteetin vasteita mm. vähentämällä tollin kaltaisen reseptorin (TLR)- 2 ja tuleh-duksen välittäjäaineen IL-11β ilmenemistä sekä lisäämällä makrofagien kertymistä tulehduspai-kalle. Kuuden viikon hoito isotretinoiinilla tai lymesykliinillä vähentää yhtä tehokkaasti akne-alueilla P. acnes -bakteerin suhteellista osuutta ihon bakteeristosta. Isotretinoiini on kuitenkinantibiootteja tehokkaampi aknelääke ja lisäksi hoitovaste saavutetaan pitemmäksi aikaa, mikäjohtunee isotretinoiinin vaikutuksesta talirauhasiin ja talinerityksen vähentämisestä.
Aknen tulehdusmekanismien ymmärtäminen on tärkeää taudissa, joka pahimmillaan johtaamerkittävään arpeutumiseen. Tutkimuksemme perusteella hankittu immuniteetti on tärkeässäroolissa synnynnäisen immuniteetin aktivoitumisen rinnalla aknen synnyssä. Tehokkain aknelää-ke, isotretinoiini ei vaikuta hankittuun immuunivasteeseen, minkä vuoksi jatkossa tarvitaanuusia lääkkeitä isotretinoiinin rinnalle tulehduksen nopeaan hillitsemiseen vaikeissa aknemuo-doissa.
Asiasanat: akne, hankittu immuniteetti, isotretinoiini, mikrobiomi, propionibakteeri,synnynnäinen immuniteetti, tetrasykliini
To Kikka
8
9
Acknowledgements
This study was carried out at the Department of Dermatology, University of Oulu.
The work was financially supported by MRC Oulu Doctoral Program, Oulu
University Hospital VTR/EVO funding, the Finnish Dermatological Society and
Oulun Lääketieteellinen Tutkimussäätiö.
I am deeply grateful to my principal supervisor Professor Antti Lauerma, MD,
PhD. This work would not have been possible without your interest in the research
topic and your financial support. I warmly thank my supervisor Docent Riitta
Palatsi, MD, PhD, for the research ideas and bringing me to the complicated world
of immunology. Your friendship and support throughout the project have been
valuable. I would also like to express my deep gratitude to my third supervisor
Professor Kaisa Tasanen-Määttä, the Head of Department of Dermatology, MD,
PhD, for all the practical advice you have provided. Your guidance, positive attitude
and encouragement have been invaluable.
I would like to extend my gratitude to the pre-examiners of this thesis,
Professor Gregor Jemec, MD, PhD, and Docent Petteri Arstila, MD, PhD. I
appreciate your valuable comments, which helped to improve the final version.
I also thank Steve Smith for revising the English language of this thesis.
I would also like to acknowledge my follow-up group members, Docent Petri
Kulmala, MD, PhD, Päivi Hägg, MD, PhD, and Nina Kokkonen, PhD, for sharing
your time and taking an interest in my thesis.
I owe my deepest gratitude to all patients and other volunteers for their
contribution to this study.
I wish to thank warmly all collaborators and co-authors of the thesis project in
Helsinki, Berlin, Sophia Antipolis and Oulu. I would like to give my special thanks
to Docent Nanna Fyhrquist, PhD, for the great knowledge of immunology, to Velma
Aho, MSc, for the understanding of bioinformatics, and to Johannes Voegel, MD,
PhD, for the valuable co-operation. I also thank Professor Harri Alenius, PhD, and
Docent Petri Auvinen, PhD, for your interest and positive attitude towards this
project. I am also grateful to Docent Matti Kallioinen, MD, PhD, Juha Väyrynen,
MD, PhD, and Riitta Vuento for collaboration.
I want to express my gratitude to Minna Kubin, MD, for your help with
recruiting patients and collecting samples especially to the microbiome project
during my maternity leave. I also thank other PhD students Suvi-Päivikki
Sinikumpu, MD, and Anna-Kaisa Försti, MD, for providing important peer support
10
during PhD-project, and the excellent researcher Laura Huilaja, MD, PhD, for your
friendly assistance.
I also wish to thank Professor Emeritus Aarne Oikarinen, the former Head of
Department of Dermatology, MD, PhD, for providing me an opportunity to
specialize in dermatology and work at the clinic.
I thank the former Deputy Chief Timo Järvinen, MD, and the Deputy Chief
Päivi Hägg, MD, PhD, for organizing time for research work.
My thanks are owed to all former and present colleagues, nurses and secretaries
at the Department of Dermatology, Oulu University Hospital. It has been a privilege
to work with you and I am grateful for the support during the thesis project.
I also thank Mirja Kouvala for secretarial assistance and Seija Leskelä for
assistance in the illustration of this thesis.
Outi, Tarja, Päivi, Maarit and Helena are thanked for the stimulating, usually
non-scientific, discussions during coffee breaks.
I am privileged to have so many good friends around me to share the joys and
sorrows of life. Thank you all, Pauliina, Nina, Tanja, Eija, Anna-Stiina and Anu,
for your friendship.
I express my warmest thanks to my parents, Ritva and Leo, for your unfailing
love and support during my life. You have always believed in me. I am also grateful
to my brothers Antti and Matti, and the family members Miia, Anna, Niilo, Enni,
Noelia and Martin, for your support and all happy moments.
I also thank my parents-in-law, Anna-Maija and Veikko, for your help with
Emma and Rämä.
Finally, Dear Petri and Emma, thank you for your unconditional love and
support during this project, in good days and bad days. Petri has solved many
technical difficulties and should have deserved acknowledgements in all my papers.
And Emma, Mummy’s diamond, you are the joy of my life. I love you!
Oulu, August 25, 2016 Hanna-Leena Kelhälä
11
Abbreviations
AMP antimicrobial peptide
APC antigen presenting cell
CCL chemokine (C-C motif) ligand
CD cluster of differentiation
CXCL chemokine (C-X-C motif) ligand
DC dendritic cell
FFA free fatty acid
FoxP3 forkhead box P3
GM-CSF granulocyte macrophage colony-stimulating factor
HBD human β-defensin
hCAP-18 human cathelicidin
HLA human leukocyte antigen
IBD inflammatory bowel disease
IFN interferon
Ig immunoglobulin
IGF-1 insulin-like growth factor 1
IL interleukin
K6 keratin 6
LC Langerhans cell
LCN2 lipocalin 2
MMP matrix metalloproteinase
NLRP3 Nod-like receptor P3
OTU operational taxonomic unit
P. acnes Propionibacterium acnes PAR-2 protease-activated receptor-2 PCR polymerase chain reaction
PPAR peroxisome proliferator-activated receptors rRNA ribosomal RNA
Tc cytotoxic T cell
TGF transforming growth factor
Th T helper cell
TLR Toll-like receptor
TNF tumor necrosis factor
TRAIL TNF-related apoptosis-inducing ligand
Treg regulatory T cell
12
13
List of original publications
This thesis is based on the following publications, which are referred throughout
the text by their Roman numerals:
I Kelhälä HL, Palatsi R, Fyhrquist N, Lehtimäki S, Väyrynen JP, Kallioinen M, Kubin ME, Greco D, Tasanen K, Alenius H, Bertino B, Carlavan I, Mehul B, Déret S, Reiniche P, Martel P, Marty C, Blume-Peytavi U, Voegel JJ & Lauerma A. (2014) IL-17/Th17 pathway is activated in acne lesions. PLoS One 9(8): e105238.
II Kelhälä HL, Fyhrquist N, Palatsi R, Lehtimäki S, Väyrynen JP, Kubin ME, Kallioinen M, Alenius H, Tasanen K & Lauerma A (2016) Isotretinoin treatment reduces acne lesions but not directly lesional acne inflammation. Exp Dermatol 25(6):477-8.
III Kelhälä HL, Aho VTE, Fyhrquist N, Pereira PAB, Kubin ME, Paulin L, Palatsi R, Auvinen P, Tasanen K & Lauerma A. Effects of isotretinoin and lymecycline treatments on acne skin microbiome. Manuscript.
14
15
Contents
Abstract
Tiivistelmä
Acknowledgements 9 Abbreviations 11 List of original publications 13 Contents 15 1 Introduction 17 2 Review of the literature 19
2.1 General background of acne .................................................................... 19 2.1.1 Clinical picture of acne ................................................................. 19 2.1.2 Prevalence, comorbidities and psychosocial impact of
acne .............................................................................................. 21 2.1.3 Genetic factors in acne ................................................................. 21 2.1.4 Dietary factors in acne .................................................................. 22
2.2 Pathogenetic factors in acne .................................................................... 23 2.2.1 The effect of hormones in acne .................................................... 24 2.2.2 Sebum production and changes in lipid composition ................... 25 2.2.3 Hypercornification of the pilosebaceous duct and
comedogenesis ............................................................................. 26 2.2.4 Bacterial colonization in acne....................................................... 27
2.3 Histopathology of acne ........................................................................... 31 2.4 Immunopathogenetic factors in acne ...................................................... 32
2.4.1 Innate immune reactions in acne .................................................. 32 2.4.2 Cytokines in acne ......................................................................... 35 2.4.3 Adaptive immune reactions in acne .............................................. 36 2.4.4 Other factors contributing to the immunopathogenesis of
acne .............................................................................................. 40 2.5 Systemic medications for acne vulgaris .................................................. 41
2.5.1 Isotretinoin.................................................................................... 42 2.5.2 Tetracyclines ................................................................................. 43
3 Aims of the study 45 4 Materials and methods 47
4.1 Study subjects (I-III) ............................................................................... 47 4.1.1 Skin biopsy samples (I, II) ............................................................ 47 4.1.2 Serum samples (II) ....................................................................... 48
16
4.1.3 Swab samples (III) ........................................................................ 48 4.2 Ethical considerations ............................................................................. 48 4.3 DNA microarray analysis (I) ................................................................... 48 4.4 RNA isolation and real-time PCR analysis (I, II) .................................... 49 4.5 Cytokine profiling by Luminex technology (I) ....................................... 49 4.6 Immunohistochemistry (I, II) .................................................................. 50 4.7 Serum cytokine measurements (II) ......................................................... 51 4.8 DNA extraction, sequencing and sequence data analysis (III) ................ 51
4.8.1 DNA extraction, PCR amplification and 16S rRNA gene
sequencing .................................................................................... 51 4.8.2 Sequence data analysis and data trimming ................................... 52
4.9 Statistical analysis (I-III) ......................................................................... 53 5 Results 55
5.1 IL-17A/Th17- axis in clinically early inflamed acne lesions (I) ............. 55 5.2 Th1 and Treg cells in acne lesions (I) ..................................................... 55 5.3 The effect of isotretinoin treatment on immune responses in acne
(II) ........................................................................................................... 56 5.3.1 The effect of isotretinoin on Th17/Treg balance ........................... 56 5.3.2 The effect of isotretinoin on innate immune responses and
apoptosis markers ......................................................................... 57 5.4 Characterization of acne patients’ skin microbiota in typical acne
areas and the correlation of bacterial composition with acne
severity (III) ............................................................................................ 57 5.5 The impact of isotretinoin and tetracycline treatments on acne
patients’ microbiota and microbial diversity (III) ................................... 58 6 Discussion 61
6.1 The activation of IL-17A/Th17 axis in acne (I, II) .................................. 61 6.2 The effects of isotretinoin treatment in acne patients (II) ....................... 64 6.3 Skin microbiota of acne vulgaris patients and its correlation with
acne severity (III) .................................................................................... 67 6.4 Impact of systemic treatments on the acne skin microbiota (III) ............ 68 6.5 Limitations of the study .......................................................................... 69 6.6 Future perspectives .................................................................................. 70
7 Conclusions 75 References 77 Original publications 95
17
1 Introduction
Acne is a disease that affects almost every teenager, but it can also continue as a
chronic disease through adulthood. As well as being one of the most common skin
diseases, acne is also the eighth most prevalent disease worldwide (Tan & Bhate
2015). The clinical picture of acne varies from a mild manifestation to a severe
fulminant condition with systemic symptoms. It can cause both visible and also
mental scarring during teenage, a vulnerable stage of life. In addition to its
psychosocial impact, treatment of acne can also pose a significant financial burden
on the affected individual.
The pathogenesis of acne is multifactorial: increased sebum production,
hormonal influences, the hypercornification of pilosebaceous ducts, overgrowth of
Propionibacterium acnes (P. acnes) and inflammation around pilosebaceous
follicles are considered to be the main pathogenetic factors but few further details
are known (Williams et al. 2012). P. acnes is a normal skin commensal, especially
common in sebaceous areas (Grice et al. 2009) and its role as a factor in acne
pathogenesis is debated (Shaheen & Gonzalez 2011).
Acne is a human disease and the lack of animal model has challenged its
research. Many acne studies are performed in vitro by stimulating sebocytes,
keratinocytes or monocytes with P. acnes, but these approaches are far from
representative of real life. There are an estimated 1 x 106 T cells in every cm2 of
normal skin and an estimated 20 billion (2 x 1010) T cells in one adult’s entire skin,
twice the number found in the blood (Clark et al. 2006). This fact underlines the
importance of studying human skin samples to understand the immunopathogenetic
mechanisms of cutaneous diseases.
Immunological studies of acne have mainly focused on innate immune
responses, and the impact of systemic treatments on acne skin are not completely
understood. For example, isotretinoin is currently the most potent medication for
acne but its mechanism of action is not completely understood. Furthermore, the
effects of systemic treatments on acne skin microbiota have yet to be studied using
modern 16S ribosomal RNA (rRNA) gene amplicon sequencing based methods.
The present study was designed to examine the immune responses in acne
patients’ skin (I), the effects of isotretinoin treatment in acne skin (II), and the
impact of systemic acne medications on microbiota (III).
18
19
2 Review of the literature
2.1 General background of acne
2.1.1 Clinical picture of acne
Acne is a multifactorial, complex human disease, affecting areas rich in
pilosebaceous units, such as face, chest, shoulders and back. The clinical
characterization of acne ranges from a mild comedonal condition to one that can be
severe nodulocystic, scarring and even fulminant and systemic. Patients suffering
acne typically have seborrhea and non-inflammatory (open and closed comedones)
and inflammatory (papules and pustules) lesions and various degrees of scarring.
In addition, in severe forms of acne nodules and cysts are seen (Zaenglein &
Thiboutot 2012). Fig. 1 shows examples of different types of acne. Acne can also
be present in newborns (neonatal acne) and infants (Zaenglein & Thiboutot 2012) .
Acne is a common feature of many systemic endocrine disorders diseases like
congenital adrenal hyperplasia (CAH) and polycystic ovary syndrome (PCOS), or
nonendocrine disorders such as synovitis-acne-pustulosis-hyperostosis-osteitis
(SAPHO), pyogenic arthritis-pyoderma gangrenosum-acne (PAPA), pyoderma
gangrenosum-acne-suppurative hidradenitis (PASH), pyoderma gangrenosum-
acne-suppurative hidradenitis-axial spondylarhritis (PASS) and pyogenic arthritis-
pyoderma gangrenosum-acne-suppurative hidradenitis (PAPASH) syndromes
(Braun-Falco et al. 2012, Bruzzese 2012, Chen et al. 2011, Marzano et al. 2013).
The cause of acne can also be iatrogenic e.g. resulting from medication, especially
glucocorticoids.
Acne grading
There are several systems for grading acne. At least 31 outcome measures are used
in clinical trials (Barratt et al. 2009). The Leeds revised acne grading system used
in this study is based on photographic images comprising 12 facial, 8 chest and 8
back severity categories, and 3 facial grades for noninflamed acne (O'Brien et al. 1998). Another grading system used in the study was Global Evaluation Acne Scale
(Dreno et al. 2011), which is a 6-grade scale based on text descriptions.
20
Fig. 1. Clinical images showing examples of different types of acne. In comedonal acne
(a) mainly macrocomedones are present. In papulopustular acne (b-d) papules and
pustules predominate and scarring usually occurs. Nodules and cysts are the
characteristics lesions in severe acne (e-f) and scarring is evident.
21
2.1.2 Prevalence, comorbidities and psychosocial impact of acne
Prevalence
Acne is the eighth most prevalent disease worldwide, affecting an estimated 9.4%
of the global population, and is among the top three most prevalent skin conditions
(Vos et al. 2012). Approximately 85% of teenagers suffers from acne, but acne is
often a chronic disease that can persist into adulthood for unknown reasons (Bhate
& Williams 2013). The severity of acne seems to increase with pubertal maturation
in that comedonal acne predominates in preteens and inflammatory acne is likely
to develop during the teenage years (Tan & Bhate 2015).
Comorbidities
Severe acne among adolescents is associated with sinopulmonary and upper
gastrointestinal comorbidities (Silverberg & Silverberg 2014). A recent study
suggests that there is correlation between acne and inflammatory bowel disease
(IBD) (Alhusayen et al. 2013). Women with PCOS have increased risk of insulin
resistance and metabolic syndrome (Housman & Reynolds 2014). Interestingly,
postadolescent male acne patients more commonly have insulin resistance
compared with controls without acne (Nagpal et al. 2016).
Psychosocial impacts of acne
Acne may have many psychosocial implications including dissatisfaction with
personal appearance, social impairment, poor self-esteem and overall impaired
quality of life. Anxiety, depression and even suicidal ideation have all been
documented in patients with acne. Acne has a significant socioeconomic impact
resulting from its psychosocial effects (Bhate & Williams 2013, Halvorsen et al. 2011, Ramrakha et al. 2015).
2.1.3 Genetic factors in acne
Epidemiological data indicates 78% heritability of acne in first-degree relatives,
and more severe forms of acne and earlier occurrence of acne are associated with a
family history of the condition (Ballanger et al. 2006, Ghodsi et al. 2009, Wei et al. 2010). In addition, several twin studies have suggested a substantial genetic basis
22
to acne (Bhate & Williams 2013). Studies suggest polygenic background in acne
pathogenesis.
Interestingly, the increased frequency of the human leukocyte antigen (HLA)-
Cw6 allele, which is strongly associated with psoriasis (Perera et al. 2012,
Tiilikainen et al. 1980) is also found in patients with severe acne (Karvonen et al. 1995).
Recently several large genome-wide association studies (GWAS) have been
conducted on acne patients with severe disease. A GWAS performed in United
Kingdom identified three susceptibility loci: 11q13.1, 5q11.2 and 1q41, which
contain genes linked to the transforming growth factor-β (TGF-β) cell signalling
pathway (Navarini et al. 2014). In a Chinese population susceptibility loci at
11p11.2 and 1q24.2 were identified which involve genes related to androgen
metabolism, inflammation processes and scar formation (He et al. 2014). In
addition, the chromosomal locus 8q24, which has been previously associated with
several types of cancer, was found among European-American patients with acne
(Zhang et al. 2014).
Furthermore several candidate genes, which are known to regulate hormone
metabolism and innate immune functions, have been implicated in acne
pathogenesis, including those that code for tumor necrosis factor (TNF), tumor
necrosis factor receptor 2 (TNFR2), interleukin 1A (IL1A), toll-like receptor 2
(TLR2), androgen receptor (AR), insulin-like growth factor 1 (IGF-1), resistin,
cytochrome P450 family 1 subfamily A polypeptide 1 (CYP1A1), cytochrome
P450 family 17 subfamily A polypeptide 1 (CYP17A1) and cytochrome P450
family 21 subfamily A polypeptide 2 (CYP21A2) (He et al. 2006, Ostlere et al. 1998, Paraskevaidis et al. 1998, Tasli et al. 2013, Tian et al. 2010, Yang et al. 2014,
Yang et al. 2009, Younis & Javed 2014).
2.1.4 Dietary factors in acne
Conflicting data have been published concerning a relationship between diet and
acne (Bhate & Williams 2013). The absence of acne in non-Westernized
populations in Papua New Guinea and Paraguay, together with development of
acne in Inuit, Japanese and Chinese populations, following changes to nutrition
habits, suggest that high glycaemic load of the Western diet could have a role in the
pathogenesis of acne (Cordain et al. 2002, Zouboulis et al. 2005). In recent years
studies have been published concerning the role of a low glycaemic index (GI) diet
in attenuating acne (Kwon et al. 2012, Smith et al. 2007). A recent study showed
23
that acne patients had higher GI and glycaemic load levels than controls (Cerman et al. 2016).
Possible mechanisms behind the association between acne and diet have been
proposed in several recent papers by Melnik and co-workers (Melnik 2012, Melnik
& Zouboulis 2013). One such proposed mechanism is enhanced mechanistic target
of rapamycin complex (mTORC) signalling, resulting from increased
insulin/insulin-like growth factor 1 (IGF-1) signalling promoted by a diet
containing hyperglycaemic carbohydrates and insulinotropic/dairy products
(Melnik 2016). Recently mTOR expression and mTORC-S6K1 signalling have
been shown to be up-regulated in acne patients’ skin (Agamia et al. 2016,
Monfrecola et al. 2016).
2.2 Pathogenetic factors in acne
The main factors contributing to pathophysiology of acne are increased and/or
altered sebum production (supposed largely androgen-hormone mediated),
hypercornification of the pilosebaceous duct, follicular colonization with P. acnes
and inflammatory processes around pilosebaceous units (Fig. 2) (Williams et al. 2012).
Fig. 2. Histologic pictures of normal pilosebaceous follicle (a), comedone (b) and
inflammatory acne lesion with rupture of the follicular wall (c) (modified from Williams
et al. 2012).
24
2.2.1 The effect of hormones in acne
Acne does not develop without hormonal stimulation. Pilosebaceous units are
hormonally regulated. Several hormones that regulate sebum secretion are also
linked to acne e. g. androgens, estrogens, growth hormone (GH), insulin, IGF-1,
corticotropin-releasing hormone (CRH), melanocortins such as melanocyte-
stimulating hormone (MSH), and glucocorticoids (GCs) (Lolis et al. 2009).
Androgens, which are produced in the adrenal glands, gonads and skin, are the
most important regulators of sebaceous glands affecting sebaceous gland growth
and development. Androgens increase the size of sebaceous glands and stimulate
sebum production (Pochi & Strauss 1969). Testosterone and dihydrotestosterone
(DHT) are physiologically active hormones in skin. Androgen receptors (ARs)
have been localized to the sebaceous glands but the results of AR immunoreactivity
in the outer root sheath keratinocytes of hair follicles are inconsistent (Kariya et al. 2005, Liang et al. 1993). Several possible roles of androgens in acne development
have been proposed: a permissive role of androgens in acne initiation, localized
overproduction of androgens in acne sites, or elevated expression and
responsiveness of androgen receptors may each play a part (Kurokawa et al. 2009).
Elevated serum levels of adrenal dehydroepiandrosterone sulphate (DHEAS),
which is a precursor of testosterone, correlate with sebum production in both sexes
and with the presence of acne vulgaris in girls during the prepubertal period (Lucky et al. 1994, Stewart et al. 1992). Most patients with longstanding severe therapy-
resistant cystic acne have increased serum androgen levels (Marynick et al. 1983).
Female acne vulgaris patients usually have circulating androgen levels within the
normal range (Levell et al. 1989) but some patients with excessive androgen levels
e.g. those with congenital adrenal hyperplasia or women with PCOS, suffer from
acne (Housman & Reynolds 2014, Thiboutot et al. 1999). In addition, the intake of
androgenic-anabolic steroids leads often to so-called ‘bodybuilding acne’ (Melnik et al. 2007). Conversely, men who have non-functional androgen receptors do not
produce sebum and do not develop acne (Imperato-McGinley et al. 1993).
Furthermore, androgens locally produced in the skin by increased activity of steroid
metabolizing enzymes, especially 5α-reductase and 17β-hydroxysteroid
dehydrogenase, may contribute to androgen effects in acne patients (Thiboutot et al. 1999).
In addition to androgens, GH and IGF-1, are hormones also considered to be
important in the onset of acne. GH is maximally secreted and serum levels of IGF-
1 are highest in adolescents during the time when acne is most prevalent. Moreover,
25
conditions of GH excess, such as acromegaly, are associated with seborrhea and
development of acne. (Thiboutot 2004). Patients with Laron syndrome, which is
characterized by primary growth hormone insensitivity and inadequate production
of IGF-1 are devoid of acne (Klinger et al. 1998).
The complete CRH signalling pathway is active in acne-involved skin
especially in the sebaceous glands. CRH may activate lipid pathways leading to the
development and stress-induced exacerbation of acne by affecting immune and
inflammatory processes (Ganceviciene et al. 2009).
Treatment with GCs may cause acneiform eruptions and exacerbate pre-
existing acne. GCs increase toll-like receptor 2 (TLR2) expression in keratinocytes
and sebocytes (Lee et al. 2013, Shibata et al. 2009). The bioavailability of GCs is
regulated by isoenzymes of 11β-hydroxysteroid dehydrogenase type 1 (HSD11β1),
which catalyses the conversion of cortisone to active cortisol. HSD11β1 is
expressed in human skin in keratinocytes, fibroblasts and sebocytes and it is up-
regulated in acne lesions (Lee et al. 2013). HSD11β1 regulates GC-induced lipid
synthesis and TLR2 expression in sebocytes in vitro, and may play a key role in the
modulation of the action of GCs on sebocytes. This may partly explain the
pathogenesis of stress- and steroid-related acne (Lee et al. 2013).
Increased fibroblast growth factor receptor-2 (FGFR2) - signalling caused by
FGFR2-gain-of-function mutations is associated with acne in Apert syndrome. This
indicates that FGFR2-signaling also has a role in the pathogenesis of acne (Chen et al. 2011).
2.2.2 Sebum production and changes in lipid composition
It is generally accepted that increased sebum production by androgens is a major
pathogenic factor promoting acne. Many acne patients have increased levels of
sebum secretion, but some have normal sebum efflux and conversely,
hyperseborrhea does not always lead to the development of acne (Youn et al. 2005).
Interestingly, one study found that acne patients not responding to the antibiotic
treatment had a significantly higher mean sebum excretion rate (SER) than that of
matched untreated acne patients (Eady et al. 1988). Several studies have indicated
that sebum composition may be more important than its quantity. Human sebum
contains triglycerides, free fatty acids (FFAs), wax esters, squalene, cholesterol
esters and cholesterol. P. acnes-produced lipases are known to release FFAs from
triglycerides produced in sebaceous glands (Marples et al. 1971). Several
alterations in sebum composition have been described in acne patients. Those
26
considered most important are decreased levels of linoleic acid, an altered ratio of
saturated to unsaturated fatty acids, and squalene peroxidation products. These
alterations are suggested to be involved in the formation of, and inflammatory
changes in, comedones (Ottaviani et al. 2010). For example unsaturated FFAs ‒
oleic acid and palmitoleic acid ‒ in sebum are shown to alter the calcium dynamics
in epidermal keratinocytes and to induce abnormal follicular keratinization
(Katsuta et al. 2005). In addition, oleic acid has been shown to be comedogenic in
a rabbit ear model (Choi et al. 1997).
Peroxisome proliferator-activated receptors (PPARs) are nuclear transcription
factors involved in the control of lipid metabolism, cell proliferation, differentiation
and inflammatory responses that modulate skin homeostasis and pilosebaceous unit
function. PPARs are activated by endogenous ligands that are derived from the
metabolism of fatty acids, and by exogenous ligands developed as drugs for the
treatment of metabolic or inflammatory diseases. PPARs are widely expressed in
the epidermis, sebaceous glands and hair follicles (Trivedi et al. 2006a). PPAR
modulators are considered to be possibly beneficial in acne, particularly because of
their anti-inflammatory and lipogenesis-regulating properties (Ramot et al. 2015).
A recent study showed that PPARγ levels and signalling activity are decreased in
sebocytes from acne patients (Dozsa et al. 2016).
Nerve fibres expressing substance P (SP) are present around sebaceous glands
in acne patients’ skin. SP promotes both proliferation and differentiation of
sebaceous glands in vitro and induces its degrading enzymes, neutral
endopeptidases, implicating the pathologic significance of neurogenic and
psychogenic aspects in the disease process (Toyoda et al. 2002).
2.2.3 Hypercornification of the pilosebaceous duct and comedogenesis
Hyperproliferation of keratinocytes in the pilosebaceous follicle have been
demonstrated by immunohistochemical analysis of comedones. Increased
immunoreactivity of Ki-67, a cellular marker for proliferation and indicator of
active DNA synthesis, has been demonstrated in the intrafollicular and
interfollicular epidermis of acne patients (Knaggs et al. 1994).
Keratins K6, K16 and K17 are stress-inducible, and rapidly switched on e.g.
after injury and UV-irradiation. They are present also in inflammation and in
hyperproliferative disorders like in psoriasis (Moll et al. 2008). In normal human
skin K6 and K16 are expressed suprabasally in the outer root sheath below the
27
opening of the sebaceous duct. In addition K6 expression is detected in cells of the
sebaceous gland and duct. K17 is expressed suprabasally in the infrainfundibulum,
sebaceous duct, the outer root sheath below the opening of the sebaceous ducts and
in the companion layer (Kurokawa et al. 2011). The expression of K6, K16
suprabasally and K17 panepithelially is increased in comedones compared with
normal skin (Hughes et al. 1996). In psoriasis the high levels of expression of K17
in psoriatic lesions contribute to local abnormal immune reactions by forming a
K17/T-cell/cytokine autoimmune positive feedback loop (Jin & Wang 2014).
As are keratins, filaggrin, is a differentiation-specific marker for the epidermal
keratinization process. Filaggrin aggregates keratin filaments into macrofibrils
(Dale et al. 1985). Compared with normal skin the expression of filaggrin is more
pronounced in acne lesions in the lower parts of the sebaceous duct and the
infundibulum, indicating a disorder of the terminal phase of keratinocytic
differentiation in these areas (Kurokawa et al. 1988). There is also increased
expression of α2, α3 and α6 integrins in comedones and on basal keratinocytes of
the epidermis and follicle wall in acne patients’ uninvolved skin and in early lesions
(Jeremy et al. 2003). Integrins regulate the balance between proliferation and
differentiation (Watt 2002).
Akaza and colleagues suggested that P. acnes relates to acne pathogenesis by
influencing the differentiation of keratinocytes that may be dependent on the type
of bacteria (Akaza et al. 2009). All P. acnes strains used in their study increased
transglutaminase (TGase), K17 and decreased K1 and K10 mRNA expression
levels in normal human epidermal keratinocytes (NHEK) in vitro. Some P. acnes strains increased involucrin and K6 and decreased filaggrin, K6 and K16
expression levels.
Finally, the cytokine interleukin-1 (IL-1) is considered to have a central role in
hyperkeratosis of the pilosebaceous duct; this will be discussed later in chapter
2.4.2.
2.2.4 Bacterial colonization in acne
Skin microbiota
The fetal skin is sterile in utero but rapidly after birth, environmental microbes start
to colonize the skin forming a complex microbial ecosystem that is in homeostasis
with its host (Zeeuwen et al. 2013). An estimated 1 million bacteria reside per
28
square centimeter of skin for a total of over 1010 bacterial cells covering a human
(Grice et al. 2008). Modern molecular approaches including 16S rRNA gene
sequencing methods have revealed a greater diversity of organisms colonizing the
skin than previously estimated using earlier culture based methods. Most bacteria
of the skin, the gastrointestinal tract and the oral cavity bacteria belong to four phyla:
Actinobacteria, Firmicutes, Bacteroides and Proteobacteria but the proportions of
each differ widely depending on site (Grice & Segre 2011). The skin microbiota is
dependent on the physiology of the skin site in such a way that specific bacteria are
associated with moist, dry and sebaceous microenvironments (Fig. 3) (Grice et al. 2009). Bacterial genomic sequence data have showed that Propionibacteria and
Staphylococci species are the dominant bacteria in sebaceous areas of adult skin
(Grice et al. 2009, Staudinger et al. 2011). There are significant differences in
microbiota between children and adults. The shifts in the skin and nares microbiota
are puberty-dependent: The prevalence of Propionibacterium, Corynebacterium
and other lipophilic bacteria increases at puberty, when the sebaceous glands
mature and sebum secretion increases (Leyden et al. 1975a, Oh et al. 2012).
However, the bacterial flora of acne patients does not seem to differ from that
of unaffected persons. Earlier culture based methods have revealed that the
microflora in areas rich in sebaceous glands of both healthy adults and acne patients
consists mainly of the bacterial genera Propionibacterium, Staphylococcus and the
yeast Malassezia, and in lesser density Microsporum, aerobic coryneforms and
gram-negative bacteria (Marples et al. 1974, Numata et al. 2014, Till et al. 2000).
A recent study using 16S rRNA gene amplicon sequencing demonstrated a similar
relative abundance of P. acnes, Staphylococcus epidermis, Propionibacterium humerusii and Propionibacterium granulosum in the nose follicular casts from acne
patients and those from healthy individuals (Fitz-Gibbon et al. 2013).
29
Fig. 3. Characteristics of the adult skin and microbiota (modified from Grice et al. 2009,
Grice & Segre 2011).
30
Propionibacterium acnes
This short pleomorphic bacillus was detected in comedones as early as 1896 by
Unna, was later named as P. acnes (previously classified as Corynebacterium parvum) and is considered to be important in the pathogenesis of acne (Pochi &
Strauss 1961). P. acnes is gram-positive, nonmotile aerotolerant anaerobe which is
a normal inhabitant of human pilosebaceous units (Bojar & Holland 2004). There
are strong in vivo and in vitro data pointing to a prominent role of P. acnes in the
pathogenesis of acne. However, the role of P. acnes as a causal agent of acne is still
unclear (Shaheen & Gonzalez 2011), as is its correlation with acne severity.
Leeming and co-workers (1998) found that the count of viable bacteria within
follicles does not correlate with the severity of inflammation and that not all
inflamed lesions contain viable P. acnes (Leeming et al. 1988). In a recent study,
facial samples of acne patients presented a higher prevalence of follicular P. acnes
colonization, and extensive P. acnes macrocolonies were more common than in
control samples (Jahns et al. 2012).
Acne is not considered a classic infectious disease but immunologic reactivity
against P. acnes may contribute to the inflammation in acne. Decoding of the P. acnes genome has revealed the pathogenic potential of the bacterium including
factors involved in degrading host molecules (e.g. sialidases, neuraminidases,
endoglycoceramidases, lipases, and pore-forming factors), and in conferring cell
adhesion and/or mediating inflammation (e.g. heat shock proteins) (Bruggemann et al. 2004).
Recent studies have shown that certain strains of P. acnes were highly
associated with acne and other strains were enriched in healthy skin (Fitz-Gibbon et al. 2013). In addition to acne, P. acnes has been linked with other conditions e.g.
SAPHO, sarcoidosis and primary biliary cirrhosis. It can also cause infections such
as ocular and dental infections, endocarditis, prosthetic joint and orthopaedic
device-related infections (Perry & Lambert 2011). Acne has been associated with
P. acnes phylotype IA, ophthalmic infections IA1 and IA2, and soft tissue and
medical implant infections types IB, II and III (McDowell et al. 2012). The virulent
genes carried in disease-associated strains may explain the association of certain
strains with acne (Tomida et al. 2013). Moreover, different strains of P. acnes have
different inflammatory potential to modulate cutaneous innate immunity (Jasson et al. 2013)
The presence of P. acnes in macrocolonies or biofilms in sebaceous follicles is
more common in acne patients than in controls (Jahns et al. 2012). Biofilm
31
formation of P. acnes is associated with increased production of virulence factors
and increased resistance to antimicrobial agents (Coenye et al. 2007)
P. acnes bacteriophages have also been identified. They are highly
homogenous and show limited genetic diversity. Furthermore, these bacteriophages
have a broad killing activity against clinical isolates of P. acnes that is perhaps
related to the lipid-rich anaerobic environment where the phages’ bacterial hosts
reside (Marinelli et al. 2012). Interestingly, P. acnes phages may be candidates for
the development of a phage-based therapy for acne.
2.3 Histopathology of acne
The obstruction of pilosebaceous follicles causes microcomedones, subclinical
acne lesions, which are observed only under microscopic examination.
Keratinocytes accumulate particularly in the infrainfundibular region of the
pilosebaceous duct. The infundibulum is continuous with the epidermis but the
infrainfundibulum part differs from the epidermis, especially in that its granular
layer is inconspicuous and the horny cells it produces are fragile. The ducts of
sebaceous glands are similar to the infrainfundibulum. The microcomedone can
develop into either a non-inflammatory comedo or an inflammatory lesion, papule,
pustule, nodule or cyst (Kligman 1974).
In comedo formation the granular layer becomes more prominent and the cells
of the horny layer more distinct. The sebaceous ducts begin to go through similar
hyperkeratotic changes (Kligman 1974). Electron microscope examinations have
showed that the most striking difference between comedones and normal follicles
is the presence of intracellular lipid inclusions within keratinized and granular cells.
Lipid inclusions are not apparent in the normal mammalian epidermis but they have
been observed e.g. in parakeratotic psoriatic scales and in parakeratotic layers of
eczema (Knutson 1974). Increased numbers of desmosomes and tonofilaments are
seen in the follicular keratinocytes in comedones (Toyoda & Morohashi 2001).
As more keratinous material accumulates, the follicular wall continues to
distend and become thinner. Simultaneously sebaceous glands undergo progressive
atrophy and appear to dedifferentiate resulting in a fully developed comedo which
contains hardly any sebaceous cells. The lipid-forming lobules of the sebaceous
gland are shrunken while the undifferentiated cell pool becomes relatively larger.
However, small clusters of sebum-producing cells are always found. During
comedo formation the tiny hair follicle seems not undergo fundamental changes
(Kligman 1974). The follicular infundibulum is dilated and the attenuated wall of
32
the comedo is plugged with keratinized cells, sebum, hair and focal masses of
bacteria (Knutson 1974). If the follicular orifice remains normal in size, the comedo
closes but when it widens, an open comedo is formed. Comedones are associated
with mild mononuclear inflammation around vessels in the adjacent papillary
dermis (Ioffreda 2009).
In papules and pustules the inflammatory reaction consists of neutrophils and
macrophages, which localize intradermally in papules and more superficially
within the epidermis in pustules. Under electron microscope examination the
keratinized cells, macrophages and neutrophils contain lipid inclusions in the
inflammatory infiltrates (Knutson 1974).
In papules and nodules the neutrophilic inflammation is massive and the
remaining sebaceous lobules, pilary unit and epithelium may be totally destroyed.
The horny core containing the comedo, along with lipids, bacteria and hairs in the
dermis is removed by macrophages. Approximately 7‒10 days after follicular
rupture the neutrophils are replaced by lymphocytes, histiocytes and foreign-body
giant cells, creating granulation tissue and eventually leading to scar formation
(Kligman 1974).
2.4 Immunopathogenetic factors in acne
The immune system protects the skin against harmful microbial, chemical and
physical insults, and the activation of innate immunity provides the first rapid but
non-specific response against those harmful attacks. The activation of the adaptive
immune system is more specific due to immunologic memory (Schwarz 2012).
However, the activation of both innate and adaptive immunity are very early events
in the formation of acne lesions (Jeremy et al. 2003, Layton et al. 1998). Compared
with adaptive immune reactions, innate immune responses in acne pathogenesis
have been studied quite extensively.
2.4.1 Innate immune reactions in acne
Innate immune responses in acne are mediated by a variety of different cell types
including monocytes, macrophages, neutrophils and dendritic cells (DCs) as well
as nonimmune cells, such as keratinocytes and sebocytes. The possible contribution
of P. acnes in particular, in the activation of innate immune reactions has been
demonstrated by several in vitro studies in keratinocytes, sebocytes and in
peripheral blood monocytes (Graham et al. 2004, Jugeau et al. 2005, Kim et al.
33
2002, Li et al. 2014, Nagy et al. 2005, Qin et al. 2014, Schaller et al. 2005, Vowels et al. 1995). However the clinical relevance of in vitro data is partly unknown.
One of the earliest signs of skin inflammation in acne is the accumulation of
CD68+ macrophages in the uninvolved skin of acne patients and in early-stage (less
than 6 hours old) lesions together with CD3+, CD4+ T cells resembling a type IV
delayed hypersensitivity response (Jeremy et al. 2003). As the lesion matures, the
numbers of neutrophils and CD8+ cells increase (Layton et al. 1998, Norris &
Cunliffe 1988). After rupture of the follicular wall, the inflammatory response is
mediated mainly by neutrophils and later by macrophages and foreign-body giant
cells (Ioffreda 2009). It is possible but unusual for CD4+ T cells to accumulate in
the inflammation site before neutrophils.
Professional antigen-presenting cells (APCs) have not been extensively studied
in acne. It has been noted that CD1a+ cells have reduced density in the epidermis
and dermis around uninvolved follicles of acne patients (Jeremy et al. 2003).
However, in acne lesions aged 6 hours and more, CD1a+ cells are found within the
epidermis and follicle wall as well as in the periductal dermal infiltrates (Holland et al. 2004). CD1a is the major human CD1 protein expressed especially on
Langerhans cells (LCs). FFAs, squalene and wax esters have recently been
identified as autoantigens presented by CD1a and recognized by autoreactive T
cells (de Jong et al. 2014). Moreover, HLA-DR expression is not increased within
cellular infiltrates in uninvolved follicles of acne patients but in older lesions (6-72
h) HLA-DR expression is increased in perivascular and periductal infiltrates
including some basal keratinocytes (Jeremy et al. 2003, Layton et al. 1998). HLA-
DR is one of the major histocompatibility complex (MHC) class II molecules,
where antigenic peptide fragments are bound on APCs and presented to CD4+ T
cells. DCs, including LCs and dermal DCs, B cells and macrophages are the major
MHC II expressing APCs.
Complement activation
Complement is a key component of innate immunity but its role in the pathogenesis
of acne is not very well understood. In addition to its important role in cutaneous
defence against microbial infection, complement also mediates inflammation and
tissue injury (Panelius & Meri 2015).
Comedonal contents and P. acnes have been shown to activate complement via
both the classic and the alternative pathways (Webster et al. 1979). Complement-3
(C3) immunoreactivity has been detected in early-stage inflammatory acne lesions
34
in the walls of small dermal blood vessels and at the dermo-epidermal junction. In
late-stage inflammatory lesions C3 deposition is much less prominent (Dahl &
McGibbon 1979, Scott et al. 1979).
Antimicrobial peptides
Antimicrobial peptides (AMPs) are evolutionarily conserved molecules, which
protect the skin and other epithelia against pathogens and form a fast-acting
chemical barrier that also regulates the normal flora of the skin and mucosa. Several
AMPs are induced in acne, which suggests that they influence acne pathogenesis.
However, it is not clear whether AMPs have a beneficial or detrimental
antimicrobial effect by promoting inflammation (Harder et al. 2013).
The AMPs human β-defensin 1 and 2 (HBD 1 and 2), cathelicidin (hCAP18),
psoriasin (S100A7), koebnerisin (S100A15), lactoferrin, lysozyme, RNase7
granulysin, human neutrophil proteins 1-3 (HNP1-3) and neutrophile gelatinase-
associated lipocalin (NGAL; the product of the lipocalin 2 [LCN2] gene), are up-
regulated in acne vulgaris lesions (Borovaya et al. 2014, Chronnell et al. 2001,
Ganceviciene et al. 2006, Lumsden et al. 2011, Trivedi et al. 2006b). Gene
expression analysis of noninflamed skin of acne patients have shown that S100A7
and S100A9 are up-regulated during isotretinoin treatment (Nelson et al, 2008).
In addition, P. acnes is shown to induce HBD2 and hCAP18 in sebocytes and
keratinocytes in vitro (Lee et al. 2008, Nagy et al. 2005, Nagy et al. 2006).
Toll-like receptors
Pathogens or danger signals are recognized by the innate immune system via
pattern recognition receptors (PRRs) of which the most prominent group is the
TLRs (Bangert et al. 2011). The importance of the TLR-mediated immune response
in acne is supported by the presence of TLR2-expressing cells in acne lesions.
TLR2 is expressed in macrophages around pilosebaceous follicles and its
expression is increased during the evolution of the disease (Kim et al. 2002). The
expression of TLR2 and TLR4 is also increased in epidermal keratinocytes in
biopsies of inflammatory acne lesions (Jugeau et al. 2005).
P. acnes has been shown to trigger both TLR2 and TLR4 in monocytes,
keratinocytes or sebocytes in vitro (Jugeau et al. 2005, Kim et al. 2002, Nagy et al. 2005). In addition, the bacterial components of P. acnes, peptidoglycans and
35
lipoteichoic acid, are considered to act as possible activators of TLR2 and TLR4 in
acne (Jugeau et al. 2005).
2.4.2 Cytokines in acne
Soluble mediators of immunity and inflammation are actively secreted by immune
and nonimmune cells and they initiate, mediate and perpetuate inflammation and
tissue damage (Schwarz 2012). Several cytokines are involved in acne.
Cytokine IL-1 and inflammasome activation
IL-1 is the most common initiator of keratinocyte activation. Activated
keratinocytes are hyperproliferative and produce paracrine signals to alert
fibroblasts, endothelial cells, melanocytes and lymphocytes, as well as autocrine
signals to adjacent keratinocytes, thus maintaining the activated state (Freedberg et al. 2001). The role of IL-1 in the initiation of acne lesions is important. Comedones
in vivo are rich in IL-1α-like bioactivity and IL-1α immunoreactivity is shown in
early phase (<6 hours) papules and uninvolved acne skin (Ingham et al. 1992,
Jeremy et al. 2003). In the uninvolved skin of acne patients, increased IL-1α
labelling is detected in all layers of both the interfollicular and down the follicle
wall compared to controls. In the epidermis of inflamed lesions, significant
increases in IL-1α labelling is also observed compared with uninvolved skin but
down the follicular wall increased IL-1α labelling is only present in
infrainfundibular basal cells (Jeremy et al. 2003). Furthermore, exposure to IL-1α
causes hypercornification of the infundibulum similar to that seen in comedones in
isolated, cultured human infundibulum in vitro (Guy et al. 1996).
Inflammasomes are cytosolic protein complexes that recognize a diverse range
of inflammation-inducing stimuli including both exogenous and endogenous
signals e.g. microbial, stress and damage signals, and respond by activating
caspase-1 and producing proinflammatory cytokines IL-1β and IL-18 (Strowig et al. 2012). Recent reports support Nod-like receptor P3 (NLRP3)-inflammasome
activation in acne (Kistowska et al. 2014, Li et al. 2014, Qin et al. 2014).
Inflammasome proteins NLRP3 and caspase-1 are expressed in CD68+
macrophages and sebaceous glands in acne lesions in vivo, and P. acnes triggers
NLRP3- inflammasome activation in vitro resulting in IL-1β release from
sebocytes and monocytic cells but not from keratinocytes (Kistowska et al. 2014,
Li et al. 2014, Qin et al. 2014). Furthermore, mature-IL1β is expressed at the site
36
of cutaneous inflammation, in the presence of macrophages surrounding the
pilosebaceous unit and in sebaceous glands in acne lesions (Kistowska et al. 2014,
Li et al. 2014). P. acnes-induced inflammasome activation depends on the
internalization of the bacteria by antigen-presenting cells, lysosomal maturation,
activation of cathepsin B, generation of reactive oxygen species (ROS), and
potassium efflux (Kistowska et al. 2014).
Other cytokines
Analysis of skin biopsies from acne lesions using RT-PCR, gene array and
immunohistochemical staining techniques have demonstrated an increased
expression of the proinflammatory cytokines tumor necrosis factor-α (TNF-α), IL-
6, IL-8, IL-17A, interferon-γ (IFN-γ), IL-21 and the anti-inflammatory cytokine IL-
10 (Agak et al. 2014, Alestas et al. 2006, Kang et al. 2005, Kistowska et al. 2015,
Trivedi et al. 2006b). The concentration of IL-17, IL-4, IFN-γ and TNF-α is
elevated in serum samples of patients with moderate-to-severe nodulocystic acne
(Karadag et al. 2012).
In addition to cytokines IL-1α and IL-1β, P. acnes induces the production of
proinflammatory cytokines IL-6, IL-8, IL-12, IL-17A, TNF-α, IFN-γ and
granulocyte-macrophage colony-stimulating factor (GM-CSF) by human
monocytes, keratinocytes or sebocytes in vitro (Agak et al. 2014, Furusawa et al. 2012, Graham et al. 2004, Kim et al. 2002, Nagy et al. 2005, Nagy et al. 2006,
Schaller et al. 2005, Sugisaki et al. 2009, Vowels et al. 1995).
Based on data obtained from in vitro studies, it has been hypothesized that the
cytokine milieu simultaneously induces comedogenesis, and de-differentiation of
sebocytes into a keratinocyte-like phenotype and sebaceous gland atrophy (Downie et al. 2002). Proinflammatory cytokines also induce adhesion molecules on
endothelial cells to facilitate recruitment of inflammatory cells into the skin.
Subsequent to the proinflammatory stimulus by cytokines, expression levels of
intercellular adhesion molecule 1 (ICAM-1), E-selectin and vascular cell adhesion
molecule 1 (VCAM-1) are increased in early-stage inflammatory acne lesions
(Jeremy et al. 2003, Layton et al. 1998)
2.4.3 Adaptive immune reactions in acne
Antigen-specific T and B lymphocytes mediate adaptive immune responses. An
adaptive immune response corresponds to type and strength of the innate response
37
(Bangert et al. 2011). Activated B cells secrete immunoglobulins and are involved
in humoral immunity, whereas T cells are involved in cell-mediated immune
responses.
T cells
T cells are divided into two main groups, CD4+ helper T cells (Th) and CD8+
cytotoxic T cells (Tc), and they identify antigen-derived peptides by their antigen
receptor. Th cells recognize antigens bound to the MHC class II molecules
expressed on APCs. Most Tc cells recognize the endogenous antigens presented by
class I MHC molecules, which are expressed normally on all nucleated cells.
Recognition of foreign antigen –derived peptides by naïve T cells leads to a process
that includes massive proliferation and differentiation into distinct T cell subsets
according to the corresponding cytokine profile (Bangert et al. 2011, Zhu & Paul
2010). Th cells help B cells to produce antibodies, activate Tc cells, and recruit and
activate other immune cells. Tc cells act as killer cells, but like CD4+ cells, they
can also exert regulatory functions and produce different cytokines (Zhu & Paul
2010)
Th cells are the central players in the adaptive immune responses. Many types
of specialized Th cells have been identified. The main Th cell lineages are Th1,
Th2, Th17 and regulatory T (Treg) cells (Fig. 4). Th1 cells promote cell-mediated
immunity by activating macrophages and CD8+ T cells to kill viruses and other
intracellular pathogens. Th1 cells also contribute to the pathogenesis of
autoimmune diseases. Th2 responses are critical for IgE production and activation
of eosinophils, mast cells and basophils. Th2 are important for the elimination of
helminthic parasites but nowadays they are known better for their role in the
pathogenesis of asthma and other related allergic conditions (Schwarz 2012). Th17
cells recruit and activate neutrophils and contribute to the host defence against
extracellular bacteria and fungi. They contribute to chronic inflammation
associated with many inflammatory and autoimmune disorders (Beringer et al. 2016). Treg cells are immunosuppressive and maintain self-tolerance, prevent
autoimmunity and control immune responses during infection and cancer (Schwarz
2012). In addition to the four major lineages, other potential new Th lineages have
been proposed including Th3, Th9, Th22, follicular Th (Tfh) cells and type 1
regulatory (Tr1) cells. Since the signature cytokines produced by these Th cells are
also the products of Th1/Th2/Th17/Treg cells and the transcription factors they
38
express are not unique, it is possible that these cells represent subsets of the four
main lineages (Zhu & Paul 2010).
In addition to heterogeneity between different Th lineages, individual cells
within same lineage may display different patterns of cytokine production and
express transcription factors differentially. Moreover, Th cells are capable to switch
from one lineage to another or to a mixed phenotype suggesting that Th cells are
plastic. At early stage of Th differentiation, each Th lineage can be plastic but at
later stages, only the majority of Th17 and Treg cells may alter their cytokine
production profile (Zhu & Paul 2010).
The prevalence of T-cells and macrophages in early-stage acne lesions indicate
their key role in inflammation of acne. CD3+CD4+ T-cells are the major leukocytes
in the inflammatory infiltrates of early-stage (6‒72h) acne lesions and the number
of CD8+ T-cells increases with the age of the lesion (Norris and Cunliffe, 1988;
Layton et al, 1998). Additionally, the numbers of CD4+ T-cell (most of which are
CD45RO+ memory/effector cells) and CD68+ macrophages are elevated in the
uninvolved follicles of acne patients, and in acne lesions less than 6 hours old
compared with healthy skin controls, indicating that adaptive immune reactions in
acne begin even before microcomedo formation. (Jeremy et al. 2003).
Karvonen and co-workers (1994) have shown that specific cell-mediated
immunity to P. acnes increases during the course of severe inflammatory acne
(Karvonen et al. 1994). P. acnes has been shown to induce T-cell proliferation
(Jappe et al. 2002). In addition, P. acnes-reactive CD4+ T cells with an IFN-γ
cytokine profile have been found in early-stage papular inflammatory lesions
(Mouser et al. 2003) suggesting the presence of T helper 1 (Th1) cells in acne.
Recently cells with Th1 and Th17 profile have been found in inflammatory acne
lesions (Kistowska et al. 2015). Moreover, P. acnes has been shown to trigger Th17,
Th1 and mixed Th17/Th1 responses in peripheral blood mononuclear cells
(PBMCs) in vitro (Agak et al. 2014, Furusawa et al. 2012, Kistowska et al. 2015,
Sugisaki et al. 2009).
39
Fig. 4. The differentiation of T helper cells. The interaction of antigen presenting cell
(APC) with naïve CD4+ T cells in the various cytokine milieus induces certain
transcription factors in the T cells (Tbet, GATA3, RORγt, FoxP3), which direct
differentiation into Th1, Th2, Th17 and Treg cells.
Humoral immunity
As well as an increase in the number of Th cells, the number of B cells also seemed
to correlate with increased severity of acne in the peripheral blood (Holland et al. 1983). The antibody on the B cell recognizes the specific antigen and eventually
with the assistance of helper T cells, the B cell differentiates into antibody
producing plasma cells. Secreted immunoglobulins (Ig) bind to antigens and then
neutralize them or facilitate phagocytosis or complement activation (Bangert et al. 2011). Puhvel et al. (1966) found that complement-fixing antibody titres to P. acnes
are in the levels found for most adults with mild acne but titres increase with the
severity of inflammation (Puhvel et al. 1966). Increased total IgG has been
observed in patients with severe acne (Holland et al. 1986, Ingham et al. 1987) and
antibody titers to other skin organisms such as Staphylococcus epidermidis have
not been noticed (Ashbee et al. 1997). In severe acne the elevated antibody
40
response is directed against carbohydrate structures in the P. acnes cell wall
(Webster et al. 1985). Unfortunately, the studies about humoral immunity in acne
have not been published recently and therefore it is difficult to evaluate the role
humoral immunity in the pathogenesis of acne.
2.4.4 Other factors contributing to the immunopathogenesis of acne
PAR-2 and proteases
Protease-activated receptor-2 (PAR-2) is expressed by almost all cell types in the
skin, including keratinocytes, fibroblasts, sebocytes, endothelial cells, sensory
neurons and inflammatory cells, and is activated by endogenous or exogenous
ligands (Rattenholl & Steinhoff 2008). In the human skin PAR-2 is thought to
regulate the homeostasis of the permeability barrier, keratinocyte cornification/
differentiation, inflammation, pruritus, pigmentation and wound healing (Lee et al. 2015). In inflammatory acne lesions PAR-2 expression is increased in sebaceous
glands (Lee et al. 2015) and in the suprabasal layers of the follicular epithelium
lining of the comedone (Lee et al. 2010). PAR-2 activation has been shown to
mediate sebocyte differentiation and to induce lipogenesis and the proinflammatory
cytokines, HBD-2 and LL-37 in sebocytes and keratinocytes (Lee et al. 2010, Lee et al. 2015).
P. acnes produces proteases (Ingram et al. 1983) and via PAR-2 triggering P. acnes has been shown to stimulate the expression of IL-1α, IL-8, TNF-α, HBD-2,
LL-37 and several matrix metalloproteinases (MMPs), including MMP-1, -2, -3, -
9 and -13, in keratinocytes and sebocytes in vitro (Lee et al. 2010, Lee et al. 2015).
In cultured human dermal fibroblasts P. acnes increases the expression of pro-
MMP-2 through TNF-α (Choi et al. 2008)
MMPs are a family of zinc-dependent endopeptidases, which degrade
extracellular matrix components under both normal and inflammatory conditions
(Kähäri & Saarialho-Kere 1997) and several MMPs including MMP-1, -2, -3 and -
9 are up-regulated in acne lesions (Kang et al. 2005, Lee et al. 2010, Trivedi et al. 2006b). Facial sebum of acne patients also contains MMP-1, MMP-13 and tissue
inhibitors of metalloproteinases TIMP-1 and TIMP-2 which are supposed to
originate from keratinocytes and sebocytes (Papakonstantinou et al. 2005). The up-
regulated MMPs may contribute to acne pathogenesis by inducing inflammation
and tissue destruction (Lee et al. 2010). Increased MMP activity produces greater
41
amounts of degraded collagen in lesional acne skin (Kang et al. 2005). Matrix
breakdown is followed by its imperfect repair, which is thought to result in acne
scarring.
The roles of other endogenous proteases in acne have not been extensively
studied. Granzyme B is strongly up-regulated in inflammatory acne lesions (Trivedi et al. 2006b). Tcs and natural killer cells (NKs) have granzyme B in their granules
that they use to destroy target cells (Voskoboinik et al. 2015). Tregs can also secrete
granzyme A and B (Zhou et al. 2015). Protease inhibitor 3 or skin-derived
antileukoprotease (SKALP), which is an elastase-specific protease inhibitor, is also
up-regulated in acne patients’ skin (Trivedi et al. 2006b) as well as in the epidermis
of psoriatic skin and in Netherton syndrome (Raghunath et al. 2004).
The serine proteases pro-kallikrein 5 and kallikrein 7 are expressed in the
interfollicular epidermis, the pilary canal and secondary sebaceous ducts (Ekholm et al. 2000). Their expression in acne is largely unknown in contrast to rosacea, in
which the activity of kallikrein 5 is increased (Yamasaki et al. 2007). Both
kallikrein 5 and 7 control the activation of hCAP18 (Yamasaki et al. 2006), the
expression of which is elevated in acne lesions (Borovaya et al. 2014).
2.5 Systemic medications for acne vulgaris
Isotretinoin and systemic antibiotics, especially tetracyclines combined with
topical treatments (benzoyl peroxide, retinoids, azelaic acid), are recommended for
severe acne, and for milder forms of acne that are treatment-resistant or relapsing
(Nast et al. 2012, Zaenglein et al. 2016). The acne medications currently available
in Finland are presented in Table 1. There are global concerns about increasing
antibiotic resistance. Antibiotic resistance in acne may lead to treatment failures.
The resistance can also occur in more pathogenic organisms than P. acnes (Walsh et al. 2016). The use of oral erythromycin and other macrolides to treat acne is
recommended to be limited only to those acne patients who cannot use tetracyclines.
Antibiotics are not recommended for use as monotherapy and oral antibiotic use
should ideally last no longer than three months (Nast et al. 2012, Zaenglein et al. 2016). Moreover, combined oral contraceptives or spironolactone may be used in
the treatment of inflammatory acne in females.
42
Table 1. Acne medications available in Finland.
Topical Systemic
Benzoyl peroxide (BPO) 5% gel Tetracycline (500-1000 mg) 2
Adapalene 0.1% gel Doxycycline (100-200 mg) 2
Tretinoin 0.025% and 0.05% cream Lymecycline (300-600 mg) 2
Azelaic acid 20% cream, 15% gel Erythromycin (500-1000 mg) 2
Clindamycin 1% solution, emulsion Combined oral contraceptives
BPO 5% + Clindamycin 1% gel 1 Spironolactone (50-200 mg) 2
Clindamycin 1% + Tretinoin 0.025% gel 1 Isotretinoin (0.5-1.0 mg/kg) 2
Adapalene 0.1% + BPO 2.5% gel 1 Corticosteroids 1 Fixed combinations. 2 Daily dosage.
2.5.1 Isotretinoin
Although the anti-inflammatory drug isotretinoin (13-cis-retinoic acid, 13-cis RA)
has proven highly efficient in the treatment of acne over 30 years but its mode of
action is not completely understood. Isotretinoin is regarded as a prodrug, because
13-cis RA itself does not activate retinoic acid receptors (RARs) or retinoid X
receptors (RXRs). These receptors are activated by isotretinoin’s active metabolites,
including all-trans retinoic acid (ATRA) (On & Zeichner 2013). Isotretinoin
influences cell-cycle progression, cellular differentiation, cell survival and
apoptosis, resulting in reduced sebum production and alteration of the composition
of skin surface lipids (Landthaler et al. 1980, Nelson et al. 2006, Strauss et al. 1987)
and attenuated growth and proliferation of infrainfundibular keratinocytes
(Ganceviciene & Zouboulis 2010). Isotretinoin has no direct antimicrobial effects,
but causes the reduction of surface and ductal P. acnes (King et al. 1982) as a result
of the altered microenvironment due to reduced sebum production and smaller
sebaceous glands. The anti-inflammatory effects of isotretinoin are also considered
important. Isotretinoin and other retinoids down-regulate TLR2 expression on
monocytes (Dispenza et al. 2012, Liu et al. 2005). Furthermore, retinoids induce
Treg differentiation and down-regulate Th17 differentiation and neutrophil
migration (Elias et al. 2008, Wozel et al. 1991, Xiao et al. 2008) but it is unknown
whether these mechanisms are modulated by isotretinoin in acne. Isotretinoin also
down-regulates the expression of MMPs -9 and -13, which play a central role in
inflammatory matrix remodelling (Papakonstantinou et al. 2005). Finally, retinoids
stimulate the release of GM-CSF, monocyte chemotactic protein-1 (MCP-1) and
IL-10 (Wojtal et al. 2013) in cultured monocytes and macrophages.
43
2.5.2 Tetracyclines
Clinical use of oral antibiotics for acne seems to be based primarily on empirical
evidence, and clinical trials demonstrating dose-responses and comparative
efficacy are widely lacking (Larsen & Jemec 2003, Simonart et al. 2008).
Antibiotics reduce the number of inflammatory lesions but none clear acne
completely (Williams et al. 2012). Tetracycline, lymecycline and doxycycline are
the antibiotics of the tetracycline group used in Finland.
Tetracyclines are broad-spectrum antibiotics, effective against various
pathogens including rickettsiae, Gram-positive, and Gram-negative bacteria
(Griffin et al. 2010). The antimicrobial properties of tetracyclines are known to
reduce amount of propionibacteria and staphylococci on acne patients’ skin (Eady et al. 1990, Goltz & Kjartansson 1966, Mills et al. 1972, Oprica et al. 2007). In vitro studies have shown that tetracyclines also have anti-inflammatory effects that
could have an important role in acne. They inhibit MMPs, scavenge ROS and have
anti-apoptotic effects (Griffin et al. 2010). Tetracyclines may also down-regulate
proinflammatory cytokines such as IL-1β, TNF-α, IL-6 and the chemokines IL-8,
MCP-1, Chemokine (C-C motif) ligand 3 (CCL3) and CCL4 (Bender et al. 2008,
Krakauer & Buckley 2003) and inhibit neutrophil migration and degranulation
(Gabler & Creamer 1991).
44
45
3 Aims of the study
In this study, our aim was to clarify innate and adaptive immune responses in
clinically early-stage inflamed acne lesions and to examine the effects of
isotretinoin treatment on acne patients’ skin. The study was also designed to explore
the differences between the skin microbiota of normal and acne skin, and especially
the effects of systemic medications on acne patients’ skin microflora. The specific
aims were:
1. To investigate adaptive immune responses and identify the types of CD4+ T
cells in evolving acne lesions (I).
2. To explore how isotretinoin treatment affects innate immune reactions and T
helper cells in acne patients’ skin (II).
3. To characterize the microbiota at different acne skin sites (cheek and back),
and how it is affected by treatment with isotretinoin or lymecycline (III).
46
47
4 Materials and methods
4.1 Study subjects (I-III)
A total of 79 acne vulgaris patients (30 female and 49 male; age range 15-41 years
(mean 23.5 ± 5.4) were included in the study. We recruited patients with acne
vulgaris who attended the outpatient department of Oulu University Hospital in
Finland (I-III) or Charite Universitätsmedizin Berlin in Germany (I) for treatment.
Because study I was performed at two separate clinical centers ‒ Oulu and Berlin
‒ at which the patient cohorts were examined using partially different methods, the
terms “Finnish cohort” and “German cohort” are used to define the patient groups.
Severity of acne was assessed using the Leeds revised acne grading system
(O'Brien et al. 1998) in the Finnish cohort (I-III) and using the Global Evaluation
Acne Scale (Dreno et al. 2011) in the German cohort (I).
Patients were treated at their physicians’ discretion with isotretinoin or
lymecycline (II, III), and the treatment was allocated to each patient based on their
severity of acne and their previous medical history and treatment responses.
4.1.1 Skin biopsy samples (I, II)
Two punch biopsies were taken from the back or chest skin of each acne patient
under local anesthetic. The samples were taken from areas clinically identified as
early-stage inflammatory lesions (comedones with erythematous flare or small
papules). The 3 mm-diameter (German cohort) or 4 mm-diameter (Finnish cohort)
punch biopsies involved both the acne lesion at the centre, and surrounding non-
inflamed skin. One sample from each patient was embedded in paraffin for
immunohistochemistry analysis and the other was flash frozen in liquid nitrogen.
Biopsies from German cohort for the microarray analysis were stored in RNA
Stabilization Reagent. One six-millimeter biopsy was taken from each patient, from
an area of normal appearing skin at least 1 cm away from any acne lesion and the
sample was halved. One half was put in paraffin and another half in liquid nitrogen.
In addition, further skin biopsies were taken from each of the acne subjects
participating in study II approximately six weeks after the initiation of isotretinoin
treatment at a dose 0.4‒0.6 mg/kg/day. A third set of samples were taken from four
of these patients on average 40 weeks after completing isotretinoin therapy. The
control skin biopsies were taken from the back of psoriasis patients’ lesional and
48
non-lesional skin (used in study I) and from healthy volunteers’ back skin (used in
study I, II), and put in liquid nitrogen. All samples put in liquid nitrogen were stored
at -80 °C until total RNA isolation.
4.1.2 Serum samples (II)
Blood samples were taken before the onset of isotretinoin treatment, and 4‒7 weeks
later. Sera collected were stored at -20 °C until analysis.
4.1.3 Swab samples (III)
Skin washing, make-up, skin creams and deodorants were avoided for 24 hours
prior to sampling. Samples were taken from the cheek, back and armpit using sterile
cotton swabs and the sampler wore sterile gloves. A 4 cm2 skin area was rubbed 20
times with a cotton stick (10 times in one direction and 10 times perpendicular to
this direction). The swabs were put in phosphate-buffered saline solution and stored
at -20 °C until DNA extraction. Swab samples were taken before isotretinoin or
lymecycline therapy and approximately six weeks after the initiation of those
treatments.
4.2 Ethical considerations
All samples from study subjects were taken with informed and written consent. The
study plan considering this work was accepted by the Ethical committee of the
Northern Ostrobothnia Hospital District (I-III) and the Ethical committee of Oulu
University Hospital in Finland and the Charite Universitätsmedizin Berlin in
Germany (I). All clinical investigations were conducted in accordance with the
principles of the Declaration of Helsinki.
4.3 DNA microarray analysis (I)
Affymetrix was conducted at the Galderma Research and Development (R&D)
Center in the Sophia Antipolis technology park, France. For RNA extraction the
samples were homogenized in a Qiagen lysis buffer using a Potter-Elvehjem
homogenizer (Dominique Dutscher S.A, Brumath, France). Total RNA was
extracted using miRNeasy extraction kits (Qiagen, Hilden, Germany) according to
the manufacturer’s instructions. RNA quantity was measured using a NanoDrop
49
8000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and RNA
quality was controlled using an Agilent 2100 Bioanalyzer system (Agilent
Technologies, Waldbronn, Germany). Probes were synthesised and then hybridized
on Affymetrix U133 Plus 2.0 chips (Affymetrix, Santa Clara, CA, USA). All chips
were normalized using a Robust Multichip Average (RMA) method (Bolstad et al. 2003). Only Affymetrix identifiers (IDs) with expression ≥ 2exp6 in at least one
condition were selected. Data analysis was performed on Array Studio software
(OmicSoft, Cary, NC, USA). Mean expression levels were obtained by calculating
the geometrical means of the RMA-normalized data for involved and non-involved
sample groups, respectively.
4.4 RNA isolation and real-time PCR analysis (I, II)
The analyses were conducted in the Unit of Systems Toxicology of the Finnish
Institute of Occupational Health in Helsinki, Finland (I-II) and in the Galderma
R&D Center (I). Snap frozen skin biopsies were homogenized in TRIsure reagent
(Bioline, London, UK) and total RNA was extracted according to the protocol
provided by the manufacturer and used as a template for cDNA synthesized by
standard methods. Quantitative real-time PCR analysis was performed using an
Applied Biosystems 7500 Fast Real Time PCR-system (Applied Biosystems,
Foster City, CA, USA) in Finland and an Applied Biosystems 7900HT machine in
France using commercial primers and probes from Applied Biosystems. 18S RNA
was used as an endogenous control to ensure equal amount of RNA in each sample.
The relative unit (RU) for each sample was calculated as follows: the cycle
threshold value (CT) of a sample was determined according to the manufacturer’s
instructions (Applied Biosystems, CA, USA). Then the CT value of the 18S rRNA
sample was subtracted from that of the corresponding target cytokine to obtain the
ΔCT. Next, the average of 18S CTs of each sample was subtracted from the
calibrator CT value obtained from the "no template control" (NTC) to get the
calibrator ΔCT. The calibrator ΔCT was then subtracted from the ΔCT of each
experimental sample to obtain the ΔΔCT. Finally, the RU of the target was
calculated using the equation 2– ΔΔCT.
4.5 Cytokine profiling by Luminex technology (I)
Luminex assays were performed in the Galderma R&D Center. Cytokines were
extracted from the biopsies taken from German patients’ non-lesional and lesional
50
skin, which were crushed manually for 4 minutes with tissue grinder Potter-
Elvehjem (Dominique Dutscher S.A, Brumath, France) in 200 µL ice-cold
phosphate buffer saline (PBS) containing Triton X100 0.2% and protease inhibitors
(cOmplete, Mini, EDTA-free; Roche Applied Science, Mannheim, Germany).
Samples were stirred for 30 minutes at 1400 RPM and then centrifuged for 5
minutes at 10 000 RPM at 4 °C. Supernatants were harvested and the concentration
of proteins was determined using a colorimetric method (Bio-Rad DC Kit; Bio-Rad
Laboratories, Hercules, CA, USA). Cytokines were quantified in duplicate using
the following Luminex assays from Life Technologies, Carlsbad, CA, USA:
Human Cytokine, Premixed 23 Plex, Immunoassay Procarta kit and Milliplex
Human Cytokine, as well as the Premixed 42 Plex, Immunoassay kit (Merck
Millipore, Billerica, MA). Cytokine quantities were normalized to the total
concentration of protein.
4.6 Immunohistochemistry (I, II)
Immunohistochemical analysis were performed in the Department of Pathology,
University of Oulu and Oulu University Hospital (I, II) and in the Galderma R&D
Center (I). For the immunohistochemistry of Finnish patient samples, paraffin-
embedded 3.5 µm sections were deparaffinized and rehydrated. Heat-induced
antigen retrieval was performed in a microwave oven. Endogenous peroxidase
activity was neutralized. The sections were incubated with monoclonal mouse anti-
human antibodies to CD4 (1:50, Novocastra, Newcastle, UK), CD8 (1:200,
Novocastra), CD68 (1:10000, Dako, Copenhagen, Denmark), CD83 (1:25, Dako),
FoxP3 (1:100, Abcam Ltd., Cambridge, UK), Tbet (1:200, Abcam Ltd.) and goat
polyclonal anti-human antibody to IL17 (1:100, R&D systems, Minneapolis, MN,
USA). Bound antibodies were detected using the NovoLink Polymer detection
system (Leica Biosystems, Newcastle, UK), the EnVision system (Dako) or Goat-
HPR-Polymer kit (Biocare Medical, Concord, CA, USA). 3, 3’-Deaminobenzidine
(DAB) was used as the chromogen and hematoxylin as the counterstain.
Histological images were obtained with an Olympus DP25 camera (Olympus,
Center Valley, PA, USA) attached to a Nikon Eclipse E600 microscope (Nikon,
Tokyo, Japan) using x 20 objective. The positive cells were counted using ImageJ
software, as described previously (Väyrynen et al. 2012).
For the immunohistochemistry of German patient samples, deparaffinised
sections were treated for antigen retrieval in 10 mM citrate buffer, pH 6.0 at 98°C
for 20 minutes. Mouse antihuman CD3 (clone Ab-9, Thermo Scientific, Fremond,
51
CA) was used to detect T-lymphocytes. IL-17A was detected on the same section
with a goat polyclonal antihuman IL-17A antibody (R&D systems, Minneapolis,
MN). CD3 was detected with Alexa fluor 594 conjugated antibody and IL-17A was
revealed after amplification (Biotin Streptavidin FITC, Thermo Fisher Scientific,
Waltham, MA, USA). Positive cells were counted visually on slides scanned with
a NanoZoomer slide imaging system (Hamamatsu, Japan).
4.7 Serum cytokine measurements (II)
A human Th17 Magnetic Bead Panel (Merck Millipore, St. Charles, MO, USA)
was used for the detection of cytokines by Luminex technology following the
manufacturer’s instructions. Measurements were performed in the Unit of Systems
Toxicology at the Finnish Institute of Occupational Health in Helsinki.
4.8 DNA extraction, sequencing and sequence data analysis (III)
4.8.1 DNA extraction, PCR amplification and 16S rRNA gene
sequencing
The analyses were carried out at the DNA Sequencing and Genomics Laboratory
of the Institute of Biotechnology, University of Helsinki. Total DNA was extracted
using the FastDNA Spin Kit for Soil (MP Biomedicals, Santa Ana, CA, USA)
according to the manufacturer's instructions.
PCR amplification was conducted with an Arktik Thermal Cycler (Finnzymes
Diagnostics/Thermo Scientific, Vantaa, Finland) in two steps. The V1-V3 region of
the 16S rRNA gene was amplified using the universal bacterial primers pA
(AGAGTTTGATCMTGGCTCAG) (Lane 1991) and pD’ (GTATTACCGCGGC
TGCTG) (Edwards et al. 1989), with partial Illumina TruSeq adapters (Illumina,
San Diego, CA, USA) sequences added to the 5’ ends of the primers,
(ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and GTGACTGGA
GTTCAGACGTGTGCTCTTCCGATCT, respectively). Two 25 µl technical
replicates of each sample were run and subsequently pooled. The cycling
conditions were as follows: initial DNA denaturation at 98 °C, followed by 15
cycles at 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 10 s, and a final extension
for 5 min at 72 °C. Between 11 and 59 ng of template DNA was used in the reaction.
Each PCR run included a PCR blank with no template DNA. The PCR products
52
were purified with Exonuclease I (Thermo Scientific) and Thermosensitive
Alkaline Phosphatase (FastAP; Thermo Scientific). A second PCR was performed
with full-length TruSeq P5 and Index containing P7 adapters and 1‒5 ml from the
first PCR as a template. The cycling conditions were identical to the previous ones
except that 18 cycles were run.
The final PCR products were purified with Agencourt® AMPure® XP
magnetic beads (Agencourt Bioscience), pooled, and sequenced in two separate
runs on a MiSeq Sequencer (Illumina) using a v2 600 cycle kit paired-end (325 bp
+ 285 bp).
4.8.2 Sequence data analysis and data trimming
Preliminary quality control and primer removal were performed with cutadapt
software (Martin 2011). Due to the differing quality profiles of the two sequencing
runs, different parameters were used: -q 30 and -m 150 for the first run, -q 28, -m
100 and –e 0.2 for the second run. The sequence data were analyzed further using
mothur software (Schloss et al. 2009), as described in the MiSeq SOP
http://www.mothur.org/wiki/MiSeq_SOP (accessed 20 June 2015). The reads were
paired; all ambiguous nucleotides, reads over 550 bases in length and chimeras
were removed; the sequences were clustered into Operational Taxonomic Units
(OTUs), and taxonomical classifications were assigned. All singleton OTUs were
trimmed before further analysis.
The final tables with numbers of reads per taxon per sample were exported to
the phyloseq R package (McMurdie & Holmes 2013), which was used to trim the
data further. Several taxa deemed to be likely contaminants, based on their presence
in PCR blanks or previous experience and published results on contamination
(Salter et al. 2014), were removed. Samples in which more than 50% of sequence
reads consisted of likely contaminants were deemed unreliable and were excluded
from analyses. The numbers of the suspected contaminant taxa differed notably
depending on the sample location (armpit, back and cheek), sample group (control,
acne before and after treatment) and sequencing run, and NMDS ordination plots
showed clustering according to run even after contaminant removal. Because of
these differences, the data were further trimmed to include only those OTUs present
in both sequencing runs.
A representative sequence for Otu00001 was compared with Basic Local
Alignment Search Tool (BLAST) against the NCBI’s 16S rRNA collection and with
53
the Ribosomal Database Project’s (RDP) SeqMatch tool to determine whether
Otu00001 represented P. acnes.
4.9 Statistical analysis (I-III)
For microarray data, a two sided paired T test was performed using Array Studio
(OmicSoft Corporation, USA), to determine which genes were significantly
differentially expressed between involved and non-involved groups, and
Benjamini-Hochberg false discovery rate (FDR) multiple testing correction
(Benjamini & Hochberg 1995) was applied (I). Statistical analyses of RNA
expression levels were done with ANOVA, Student's t-test or, when variances were
significantly different, with a nonparametric Mann-Whitney U test using GraphPad
Prism software (GraphPad Software Inc., LaJolla, CA, USA) (I, II). For
immunohistochemical data statistical analysis, a two-tailed Mann-Whitney U test
was performed using IBM SPSS Statistics 19 (IBM, Chicago, IL) (I, II). For the
microbiota study most statistical analysis was performed using R. Alpha diversity
indices, which were calculated using the “estimate_richness” command of the
phyloseq package (McMurdie & Holmes 2013), and compared using the Wilcoxon
rank sum test (command pairwise.wilcox.test), with the multiple comparison
correction method “holm”. DESeq2 was used to compare the relative abundance of
bacterial taxa (Love et al. 2014) (III). For comparisons of acne grades, Wilcoxon’s
two-tailed signed rank test was performed (II, III). For all statistical comparisons,
p-values below 0.05 were considered statistically significant.
54
55
5 Results
5.1 IL-17A/Th17- axis in clinically early inflamed acne lesions (I)
In the German patient cohort a total of 904 genes were identified by the analysis of
gene expression, 509 were up-regulated and 395 were down-regulated in acne
lesions compared with uninvolved skin of acne patients. Interestingly, the
bioinformatic analysis of differentially modulated genes showed that the Th17-
derived cytokine network and the IL-17 signalling pathway were among the top-
four in gene enrichment analysis (I, Tables 3-4, Figure 3).
The findings of the RT-PCR analysis confirmed those of the Affymetrix results.
In acne lesions the main effector cytokine of Th17 cells, IL-17A mRNA was
significantly elevated compared with uninvolved skin, as were the other Th17 cell
products, IL-22, IL-26 and TNF-α. Moreover, the gene expression of the Th17
lineage inducing cytokines IL-1β, IL-6, transforming growth factor-β (TGF-β) and
IL-23p19 (IL-23a) were all up-regulated. mRNA levels of chemokines CSF2 and
CCL20, which both are induced by IL-17, were also elevated (I, Table 5, Figure 4).
At the protein level the increased expression of the markers and cytokines
characterizing the Th17 cell subtype were demonstrated using Luminex technology
in German samples (I, Table 6). Accordingly, immunohistochemical analysis
showed an increased number of IL-17A+ cells in the papillary dermis and around
pilosebaceous follicles in acne lesions compared with uninvolved skin of acne
patients. The IL-17A+ cells were scattered through the superficial and deep dermis
both in acne lesions and in normal skin. The IL-17A+ cells were identified mainly
as CD3+ lymphocytes but some of them were neutrophils and mast cells (I, Table
7, Figure 5).
5.2 Th1 and Treg cells in acne lesions (I)
Because CD4+ cells and CD68+ macrophages had previously been detected around
pilosebaceous follicles in the early phase of acne lesions formation (Jeremy et al. 2003, Layton et al. 1998), our aim was to analyze CD4+ cells most closely. To
investigate CD4+ cells other than Th17 cells we measured the expression of
signature cytokines and transcription factors of different Th lineages on the mRNA
level by quantitative RT-PCR (Finnish cohort) and by Affymetrix microarray
technology (German cohort).
56
As well as the Th17-polarized immune response, we found induction of Th1-
associated genes. The mRNA levels of effector cytokines of Th1 lineage, IFN-γ and
IL-12p40, were significantly elevated in acne lesions, as were those of the
transcription factor Tbet, the chemokine receptor CXCR3, and the chemokine (C-
X-C motif) ligand 9 (CXCL9), CXCL10 and CXCL11 (I, Figure 8, Table 10).
In addition to the Th1/Th17 immune response, Tregs were induced in acne
lesions in both cohorts according to the elevated mRNA levels of the transcription
factor FOXP3 and signature cytokines TGF-β and IL-10 (I, Figure 8, Table 11). In
contrast, in acne patients’ uninvolved skin the expression levels of TGF-β and
FOXP3 mRNA were lower than those in the skin of healthy control subjects (I,
Figure 8; II, Figure 1).
Regarding the effector cytokines of Th2 lineage, we detected IL-4 mRNA in
low levels in acne lesions, but found increased expression of neither IL-13 nor
transcription factor GATA3.
Finally, immunohistochemical stainings from Finnish patients’ samples were
performed to detect subtypes of CD4+ cells in inflammatory infiltrates of acne
lesions. T-bet+ and FoxP3+ cells were located in the papillary dermis and
perifollicularly in the same areas as CD4+ cells. The numbers of T-bet+ and
FoxP3+ cells were significantly higher in acne lesions compared with uninvolved
skin in papillary dermis but around pilosebaceous follicles the Tbet+ cell count was
elevated but not that of FoxP3+ cells. The presence of CD68+ macrophages, CD8+
cells and CD83+ DCs were also detected in acne lesions (I, Figure 5, Table 7).
5.3 The effect of isotretinoin treatment on immune responses in
acne (II)
5.3.1 The effect of isotretinoin on Th17/Treg balance
The mRNA expression levels of Th17 or Treg markers in early-stage lesions were
equally amplified in acne lesions before and during isotretinoin treatment (II,
Figure 2). Lesion immunohistochemistry found similar numbers of CD4+, IL-
17A+ and FoxP3+ cells in the upper dermis and around the sebaceous follicles
before and during treatment (II, Supplementary Table S2).
Finally, we analyzed serum levels of signature cytokines (IL-17A, IFN-γ, IL-
10) of different Th lineages. We observed slightly (but not significantly) higher
levels of IFN-γ and IL-17 in acne patients compared with healthy volunteers.
57
Isotretinoin treatment showed a trend of lowering the level of IL-17A and IFN-γ,
but not IL-10 in the serum (II, Supplementary Figure S6).
5.3.2 The effect of isotretinoin on innate immune responses and apoptosis markers
We observed a significant increase in the number of CD68+ cells in dermal
infiltrates of acne lesions (P=0.032) and in uninvolved skin of acne patients
(P=0.037) during isotretinoin treatment, compared with untreated skin (II,
Supplementary Table S2, Supplementary Figure S5).
Similar to the markers of adaptive immune responses, isotretinoin treatment
did not affect the expression of innate immune signals in newly-formed acne
lesions (II, Supplementary Figures S3 and S4). However, we observed that gene
expression of IL-1β mRNA expression was slightly up-regulated in acne patients’
uninvolved skin compared with healthy volunteers, and isotretinoin reduced IL-β
expression with a long-lasting effect (II, Figure 1). Similarly, TLR2 mRNA was
significantly decreased (P<0.001) in uninvolved skin during treatment (II, Figure
1). In contrast, psoriasin S100A7 and LCN mRNA levels were low in acne patients’
uninvolved skin at baseline but those levels returned to normal after isotretinoin
treatment (II, Figure I). Moreover, in acne lesions we observed close to significant
(p=0.058) elevation of the expression of TNF-related apoptosis-inducing ligand
(TRAIL) at the mRNA level during isotretinoin treatment, but the level of LCN2
mRNA was not modified by isotretinoin (II, Supplementary Figure S4).
5.4 Characterization of acne patients’ skin microbiota in typical acne areas and the correlation of bacterial composition with acne severity (III)
Four bacterial phyla dominated acne patients’ skin microbiota: Actinobacteria,
Firmicutes, Proteobacteria and Bacteroides. The predominant bacteria at the genus
level on the face and back were Propionibacterium, Staphylococcus,
Corynebacterium, Streptococcus and Micrococcus. In the armpit, the main genera
were Staphylococcus, Propionibacterium and Corynebacterium. The same
dominating phyla and taxonomic groups were present in controls at each location
(III, Figures 1 and 2a, Supplementary Table S4.)
Otu00001 (Propionibacterium) was the most abundant in both acne patient
and controls in cheek and back samples. Sequence comparisons suggested that
58
Otu00001 corresponded to P. acnes. Otu00002 (Staphylococcus) and Otu00001
(Propionibacterium) dominated in armpit samples from both acne patients and
controls (III, Supplementary Table S5).
Next, we analysed the differences in the abundance of specific bacteria
between acne patients and controls. Five OTUs were significantly less abundant in
the cheek samples of acne patients compared with those from controls: Otu00010
(Streptococcus), Otu00051 (Fusobacterium), Otu00046 (Gemella), Otu00080
(Granulicatella) and Otu00145 (Neisseria) (III, Figure 3b, Table 1). However, there
were no differences in either back or armpit samples.
Then we studied if bacterial taxa correlated with the acne severity grades. We
observed that Propionibacteria were significantly more abundant in cheek samples
of acne patients who had greater acne scores. In contrast, Corynebacteria on the
back was associated with lower grades (III, Supplementary Table S8).
5.5 The impact of isotretinoin and tetracycline treatments on acne
patients’ microbiota and microbial diversity (III)
Isotretinoin and lymecycline treatments significantly decreased cheek and back
acne severity, and both simultaneously seemed to decrease the relative abundance
of Propionibacteria in samples taken from same areas (III, Supplementary Figure
S1, Figure 1). In statistical comparisons both isotretinoin and lymecycline
significantly reduced the abundance of Otu00001 (Propionibacterium) in cheek
samples. In addition, the abundance of Otu00015 (Propionibacterium) was
significantly lower, whereas Otu00010 (Streptococcus), Otu00085
(Corynebacterium) and Otu00207 (unclassified genus, family Pasteurellaceae)
were significantly more abundant in cheek samples after isotretinoin treatment (III,
Table 1, Figure 3b). However, in back samples Propionibacteria were less abundant
among lymecycline-treated patients but not isotretinoin-treated patients (III, Table
1, Figure 3b). In armpit samples significant differences between untreated and
treated acne patients were not detected.
We used the inverse Simpson and Shannon indices to compare alpha diversity
between different sample groups and locations. Those indices take into account the
number of taxa present and their abundance in the community. Alpha diversity did
not significantly differ between controls and acne patients in separate body
locations. However, after both treatments the microbiota in cheek and back samples
of treated acne patients was more diverse than that of untreated patients. In contrast,
59
both treatments significantly decreased alpha diversity in the armpit samples (III,
Figure 2b).
60
61
6 Discussion
6.1 The activation of IL-17A/Th17 axis in acne (I, II)
Study I was designed to determine the adaptive immune responses (in particular, T
cell subsets), and the innate immune responses in the skin of acne vulgaris patients.
The most important finding was the activation of the IL-17A/Th17 axis in clinically
early-stage inflammatory acne lesions. This is currently an area of interest, as
demonstrated by the reporting of the presence of IL-17/Th17 cells in acne by two
other research groups (Agak et al. 2014, Kistowska et al. 2015) almost
simultaneously with the publication of our findings.
IL-17 may contribute to the pathogenesis of acne in different ways depending
on lesions age or type. The accumulation of IL-17 positive cells around typical
closed comedone-type acne lesions examined by immunohistochemistry indicates
that IL-17 might have role in early inflammatory events in acne (Agak et al. 2014).
The lesions investigated in our study were clinically early-stage inflammatory acne
lesions (comedones with erythematous flare or small papules) in which the
neutrophils were in a minority. The most prominent function of IL-17 is neutrophil
chemotaxis mediated by the production of granulocyte colony-stimulating factor
(G-CSF) and chemokines such as IL-8/CXCL8. IL-17 also induces
chemoattractants e.g. CCL20, GM-CSF for lymphocytes, DCs and monocytes, and
modulates the production of AMPs. Importantly, IL-17 synergizes with other
inflammatory cytokines in particular TNF-α, IL-1β, IL-22 and IFN-γ (Beringer et al. 2016).
In addition to its potential function to attract the neutrophils in early phases of
acne inflammation, IL-17 may account for the increased expression of AMPs in
acne lesions, which was also observed in our study. IL-17 together with IL-1 and
TNF-α may induce the production of several MMPs, whose expression is also
increased in acne (Agarwal et al. 2008, Kang et al. 2005). Acne pustules contain
large numbers of neutrophils which could for their part secrete more IL-17 and
intensify the inflammation. In more severe forms of acne with nodular or cystic
lesions there could be very intensive IL-17 reaction, because of massive
neutrophilic inflammation.
As well as by CD4+ cells and neutrophils, IL-17 can also be produced by
several other cell types including Tc cells, group 3 innate lymphoid (ILC3) cells,
γδT cells, NK cells, mast cells and macrophages (Isailovic et al. 2015).
62
Keratinocytes are the principal cellular target of IL-17A, but IL-17 receptors are
constitutively expressed on fibroblasts, osteoblasts, chondrocytes, macrophages,
DCs and endothelial cells (Maddur et al. 2012). In our study we noticed that IL-17
expressing cells were mainly lymphocytes with a minority of neutrophils and mast
cells.
The activation of the IL-23/IL-17/Th17 axis is considered to be important in
driving pathogenic inflammation in psoriasis (Di Cesare et al. 2009). Acne and
psoriasis have some histological features in common, namely keratinocyte
hyperproliferation that occurs in the pilosebaceous follicle in acne and in the
epidermis in psoriasis. Both diseases demonstrate elevated expression of both
TLR2 and AMPs, and neutrophilic inflammation. This is why we chose psoriasis
patients as a control group for quantitative RT-PCR. Indeed, we found that several
effector cytokines and markers of Th17, Th1 and Treg cells were induced both in
acne and in psoriasis, however usually to a greater extent in psoriasis. Interestingly,
the expression of cytokines IL-1β, TGF-β and IL-10 mRNA was higher in acne
lesions than in psoriasis samples. TLR2 mRNA was up-regulated in both acne and
psoriasis but the expression of TLR4 was only increased in acne. All examined
AMPs (human β-defensin 2 and 3, S100A7, S100A9 and cathelicidin, lipocalin 2)
were up-regulated to a significantly greater extent in psoriasis than acne except for
cathelicidin, which was similarly expressed in both diseases. The stronger up-
regulation of AMPs and many cytokines in psoriasis may be due to hyperplasia of
the epidermis. Moreover, in the biopsies taken from acne lesions there is also
healthy skin around the lesions whereas in psoriasis biopsies the whole skin is
affected. It is unknown if cathelicidin has a specific role in the pathogenesis of acne.
On the skin surface inactive precursors of cathelicidin are cleaved from the inactive
precursor to LL-37 by serine proteases of the kallikrein family. LL-37 and its
peptide fragments may be important in pathogenesis of rosacea (Steinhoff et al. 2013). In psoriasis LL-37 has shown to be crucial mediator of plasmacytoid DCs
(pDCs) activation. By formation of aggregates with self-DNA, LL-37 may initiate
an autoinflammatory cascade in psoriasis (Batycka-Baran et al. 2014).
IL-17/Th17 cells’ primary function is first line host defense at epithelial and
mucosal barriers against bacteria and fungi. In addition to psoriasis and psoriatic
arthritis, IL-17 contributes to the chronic inflammation associated with many
inflammatory and autoimmune disorders e.g. rheumatoid arthritis, ankylosing
spondylitis, IBDs and multiple sclerosis. The immunological mechanisms in the
other acne diseases, acne rosacea and hidradenitis suppurativa (HS), have recently
been studied. Th1/Th17 polarized inflammation and macrophage infiltration were
63
the hallmark in all subtypes of rosacea (Buhl et al. 2015), and the IL-1β-IL-
23/Th17/IL-17 pathway has also been implicated in the pathogenesis of HS (Lima et al. 2016, Schlapbach et al. 2011). Shared features of severe forms of acne,
rosacea and HS are the formation of inflammatory lesions and chronicity, but the
distinct roles of the microbiome may also contribute to the diseases. The formation
of Th17 memory cells in chronic acne, rosacea and HS may drive the chronic
relapsing-remitting nature of these diseases.
IL-1 is the key cytokine in the early phase of the inflammatory reaction in acne
(Jeremy et al. 2003) and recent data indicate the activation of inflammasome in
inflammatory acne (Kistowska et al. 2014, Li et al. 2014, Qin et al. 2014).
Inflammasome activation and active IL-1β potentiate Th17 cell-dominant immune
responses (Meng et al. 2009). In addition to Th17, active IL-1β together with other
cytokines drives the generation of adaptive immunity including Th1 effector cells.
It is probable that in severe forms of acne e.g. in cystic acne, the activation of
inflammasome and subsequent production of Th17 and Th1 cells contributes to the
powerful activation of adaptive immunity that is indicated by the increased levels
of IL-17 and IFN-γ in serum samples of moderate to severe nodulocystic acne
patients (Karadag et al. 2012). In our study (II) the lack of significance in the
differences in the values of IL-17 and IFN-γ in serum could be due to very low
levels of cytokines, which are challenging to measure accurately, and also due to
the small number of study subjects. However, the most likely explanation for the
low cytokine levels detected in our study, is that our patients did not suffer severe
forms of acne vulgaris. In psoriasis, serum IL-17 concentrations are highest in
pustular psoriasis and plaque psoriasis with PASI score>10 (Yilmaz et al. 2012). It
is possible that cytokine levels correlate with the severity of disease and the area of
skin inflammation also in acne.
There is strong in vitro evidence that P. acnes can induce Th17 and Th17/Th1
differentiation (Agak et al. 2014, Furusawa et al. 2012, Kistowska et al. 2015,
Sugisaki et al. 2009). P. acnes come into close contact to dermal DCs and
macrophages after the follicular wall of the pilosebaceous duct ruptures, initiating
the inflammatory cascades. It is reasonable to believe that P. acnes in severe acne
potentiates IL-17-mediated inflammation. The fact that patients with moderate and
severe acne have significantly higher titres of IgG antibodies to P. acnes than
patients with milder forms of acne (Ashbee et al. 1997, Holland et al. 1986) support
this view. In milder acne there are no differences between acne patients and controls
in the humoral response against P. acnes (Till et al. 2000).
64
P. acnes-induced Th17 and Th17/Th1 cell-mediated recall responses can be
observed in all healthy donors suggesting that such a pool of memory cells is
present in most healthy individuals (Kistowska et al. 2015). The reason for this
finding could be that almost everybody has acne at some point in their life.
6.2 The effects of isotretinoin treatment in acne patients (II)
In the second study of the thesis we investigated the effect of isotretinoin in acne
patients’ skin and serum samples. Isotretinoin is the most efficacious medication in
the treatment of acne, but despite of its wide use, its mode of action remains
incompletely understood. Since retinoids inhibit inflammatory Th17 responses, and
promote regulatory T cell responses (Elias et al. 2008, Mucida et al. 2007, Xiao et al. 2008), our working hypothesis was that systemic isotretinoin treatment might
influence the Th17/Treg balance in the skin. In contrast to our expectations,
isotretinoin treatment had no effect on adaptive immune responses in newly-formed
acne lesions. This indicates that when the inflammation is already initiated in an
acne lesion, isotretinoin cannot attenuate it. However, there was a slight (but
statistically non-significant) reduction of IL-17A and IFN-γ in the serum due to
reduced inflammation. As seen in acne, the IL-17/IL-23 axis contributes to the
pathogenesis of IBD (Catana et al. 2015). It has previously been suggested that
isotretinoin treatment could induce colitis in acne patients but recent studies have
demonstrated that the use of isotretinoin is not associated with increased risk of
IBD (Coughlin 2015, Lee et al. 2016, Racine et al. 2014, Rashtak et al. 2014). In
our study isotretinoin did not aggravate Th17 responses in acne patients, but at the
moment the effect of isotretinoin on the level of IL-17 in IBD patients’ intestine is
not known.
In acne lesions, the expression of both TLR2 and TLR4 is up-regulated (Jugeau et al. 2005, Kim et al. 2002). Accordingly, we also detected their increased
expression in our studies (I, II). In acne lesions TLR2 is expressed mainly by
keratinocytes and macrophages infiltrating around the pilosebaceous follicles
(Jugeau et al. 2005, Kim et al. 2002). TLRs represent an ancient front-line defense
system that enables the host to sense the presence of microbial components
(pathogen-associated molecular patterns; PAMPs) or endogenous danger signals
(danger-associated molecular patterns; DAMPs) within minutes, engaging
intracellular downstream cellular pathways followed by the production of pro-
inflammatory mediators (Schwarz 2012). The infiltration of TLR2+ cells is an early
event in the evolution of acne lesions (Kim et al. 2002), so it is unlikely that P.
65
acnes triggers innate immune responses before rupture of pilosebaceous follicles.
FFAs can act as possible DAMPs activating TLR2 and TLR4 (Lwin et al. 2014),
and initiate inflammation and the formation of acne lesions. Given its role in the
initiation of inflammation, the down-regulation of TLR2 expression might
represent one of the mechanisms by which isotretinoin therapy exerts its effects in
acne. Indeed, we observed that the expression of TLR2, but not TLR4, is
significantly reduced during isotretinoin treatment in uninvolved skin in acne
patients. This is in line with previous studies that demonstrated down-regulation of
TLR2 expression and function in all-trans ATRA- or isotretinoin-treated monocytes
in vitro (Liu et al. 2005) and in vivo (Dispenza et al. 2012).
One important, natural antimicrobial defense system is the production of AMPs,
several of which are induced in acne. Some AMPs (e.g. hBD-2, hCAP-18/LL-37,
RNAse7 and S100A7) efficiently limit the growth of P. acnes, but may at the same
time contribute to the formation of comedones by stimulating keratinocyte
migration and proliferation, and by activating immune cells (Harder et al. 2013).
In our work the levels of AMPs in the acne lesions were not affected by isotretinoin
treatment. Recently Borovaya and co-workers found that lesional expression of
many AMPs, including HBD-2 and S100A7 was decreased after 2 months of
isotretinoin treatment (Borovaya et al. 2014). The discrepancy between the results
of that study and ours might be due to different sampling methods: in our study we
took 4 mm punch biopsies but Borovaya and co-workers (2014) took shave biopsies.
Moreover, our biopsies were taken after 6 weeks’ isotretinoin treatment, whereas
in the other study they were taken after 2 months.
S100A7, one of the major skin AMPs, is expressed in keratinocytes and
sebocytes, and is highly induced in inflammatory skin diseases like atopic
dermatitis and psoriasis as well as wounds (Harder et al. 2010). The expression of
S100A7 is known to be increased at the ductus seboglandularis in acne comedones
(Ganceviciene et al. 2006). We found that the expression of S100A7 was lower in
the uninvolved skin of acne patients compared with that of non-acne controls.
Interestingly, systemic isotretinoin treatment resulted in the up-regulation of the
expression of S100A7 in acne patients’ uninvolved skin, reaching similar levels as
in healthy volunteers. We observed a similar trend for the expression of LCN2. A
previous gene expression study also revealed that LCN2, S100A7 and S100A9
were among the most highly up-regulated genes in acne patients’ uninvolved skin
after a week of isotretinoin treatment (Nelson et al. 2008), but the increase was no
longer detectable after 8 weeks of treatment (Nelson et al. 2009). In line with the
findings of the in vivo studies, it has been shown that LCN2 and S100A7 were up-
66
regulated by retinoic acid in cultured keratinocytes (Lee et al. 2009). LCN2 exerts
its antimicrobial effects by sequestering iron, thus limiting bacterial growth (Yang et al. 2002), but it also has a function in isotretinoin-induced sebocytes apoptosis
(Nelson et al. 2006). At the moment we cannot explain why the levels of S100A7
and LCN2 mRNA were slightly lower in uninvolved skin of our acne patients than
in controls. Nelson and co-workers hypothesized that the up-regulation of S100
proteins by 13-cisRA at the beginning of the treatment course could relate to the
“acne-flare” observed in some patients receiving retinoids (Nelson et al. 2009).
Taken together, it is clear that more studies, both clinical and experimental, are
required better to understand the effect of isotretinoin on the expression and
function of AMPs in acne.
Isotretinoin reduces the size of human sebaceous glands and their levels of
secretion, and induces many genes that in vitro studies demonstrate sebocyte
apoptosis and cell cycle control, including LCN2 (encodes NGAL), TNFSF10
(which encodes TRAIL) and FAS (Nelson et al. 2006, Nelson et al. 2008). TRAIL
is a type II transmembrane protein with a soluble form, and both the membrane and
soluble forms induce apoptosis in a variety of cell types via the activation of
apoptotic receptors on the cell surface receptors (Griffith et al. 1998). Recent data
suggest that TRAIL plays a key role in the sebocyte-specific effects of isotretinoin,
and that its expression is increased in acne patients’ skin acne after one week of
isotretinoin therapy (Nelson et al. 2011). We observed that TRAIL expression
remained slightly up-regulated in acne lesions after six weeks of isotretinoin
therapy i.e. at the time point when clinical improvement usually begins.
The presence of CD68+ macrophages is detectable already in the very early
stages of acne lesion development, even before microcomedo formation and
breakage of the follicular wall, suggesting a prominent role for macrophages in the
development of acne lesions (Jeremy et al. 2003). Isotretinoin therapy significantly
increased the number of CD68+ macrophages in both lesional and uninvolved skin
in our acne patients. All retinoids stimulate the release of IL-10, GM-CSF and
MCP-1 in monocytes and macrophages in vitro (Wojtal et al 2013). This stimulation
could explain the increased number of CD68+ macrophages in the acne skin in our
study and could also partly explain the increased amount of IL-10 during
isotretinoin treatment.
67
6.3 Skin microbiota of acne vulgaris patients and its correlation with acne severity (III)
In the third publication we analyzed the microbiota of acne patients and the effects
of systemic treatments on it, using 16S rRNA gene amplicon sequencing. With this
method a much wider variety of bacteria than just P. acnes can be investigated, but
so far only a few studies have utilized this method in acne. Results from a recent
exploration of the nose follicular casts from acne patients are in line with our data,
in that no difference was detected between acne patients and healthy controls in the
relative abundance of P. acnes (Fitz-Gibbon et al. 2013). In that study the other
common bacteria were Staphylococcus epidermidis, Propionibacterium humerusii and Propionibacterium granulosum (Fitz-Gibbon et al. 2013). The researchers also
used metagenomics shotgun sequencing, which allows for the identification of
microbes at the strain level, as well as the analysis of their functional potential. In
our study the taxonomical level used was OTU and only Otu00001
(Propionibacterium) was defined to correspond to P. acnes. In addition to P. acnes,
other most abundant bacteria in our study were Otu00002 (Staphylococcus),
Otu00010 (Streptococcus) and Otu00008 (Corynebacterium) in cheek samples of
acne patients and controls. In another study the pilosebaceous follicles of healthy
controls were exclusively colonized by P. acnes, whereas those of acne patients
contained mainly P. acnes, Staphylococcus epidermidis, with minor proportions of
other species (Bek-Thomsen et al. 2008). It is probable that a low number of study
subjects (three controls and five acne patients) may have influenced the results of
the latter study.
Our analyses showed that P. acnes dominates the sebaceous areas both in acne
patients and controls. However, Otu00010 (Streptococcus), Otu00051
(Fusobacterium), Otu00046 (Gemella), Otu00080 (Granulicatella) and Otu00145
(Neisseria) were significantly less abundant in the cheek samples of untreated acne
patients than in those of controls. These bacteria are facultatively or strictly aerobic,
occurring in skin, oral and respiratory track flora (Cargill et al. 2012, Davis 1996)
and may have lost to P. acnes the battle for the same ecological niche in acne
patients’ skin.
Interestingly, our data indicate that among patients with higher acne scores P. acnes is more abundant on the face and Corynebacteria is less abundant on the
back. Previous studies have not demonstrated the correlation between the amount
of P. acnes and acne severity (Cove et al. 1980, Leyden et al. 1975b). By contrast,
there was a trend for lower (but non-significantly lower) levels of P. acnes as the
68
severity of inflammation increased (Leyden et al. 1975b). Of note, 16S rRNA gene
amplicon sequencing is used for bacterial identification and essentially it is the
comparisons of relative abundances, but it does not provide information about the
amount of bacterial biomass or the absolute number of bacteria in the samples.
6.4 Impact of systemic treatments on the acne skin microbiota (III)
Previous studies have demonstrated that isotretinoin reduces the number of surface
and ductal P. acnes (King et al. 1982) and tetracycline treatments decrease the
numbers of P. acnes and Staphylococci in acne patients’ skin (Eady et al. 1990,
Goltz & Kjartansson 1966, Mills et al. 1972, Oprica et al. 2007). 16S rRNA gene
amplicon sequencing has not previously been used to determine the effect of
systemic acne treatments on the bacterial composition of acne patients’ skin. In
accordance with previous studies (Eady et al. 1990, Goltz & Kjartansson 1966,
King et al. 1982, Mills et al. 1972, Oprica et al. 2007), we found that six weeks’
treatment with isotretinoin or lymecycline significantly decreased the abundance
of P. acnes in cheek samples while also reducing the clinical severity of acne.
However, based on the findings of previous studies and clinical experience,
isotretinoin is more effective than tetracyclines in the treatment of acne, which is
probably due to the effect of isotretinoin on the sebaceous glands and sebum
excretion.
Interestingly, after isotretinoin treatment several OTUs such as Otu00010
(Streptococcus), Otu00085 (Corynebacterium) and Otu00207 (unclassified genus,
family Pasteurellaceae) were significantly more abundant in cheek samples than
before treatment, likely because of drier skin caused by isotretinoin. Surprisingly,
while lymecycline reduced the abundance of P. acnes in back skin samples,
isotretinoin did not, although acne was clinically improved by both treatments in
this area. However, the number of samples available for analysis from the back area
was lower than that from the face, which may have affected these conflicting results.
We also examined the armpit, since moist areas are known to have different
bacterial composition from sebaceous areas (Grice et al. 2009). Staphylococcus,
Propionibacterium and Corynebacterium were the main genera in armpit samples
from both acne patients and controls. This result is in line with previous work by
Grice and coworkers (2009) who found that Staphylococcus and Corynebacterium spp. are the most abundant organisms colonizing moist areas (Grice et al. 2009).
Systemic acne treatments are likely to influence the microbiota of non-acne skin
regions, such as the armpit. However, we could not detect significant differences in
69
the abundance of specific bacteria in armpit samples after isotretinoin or
lymecycline treatment. Thus our result is different to that of an older study, which
after one month of isotretinoin treatment, detected significant reductions in P. acnes
and gram negative bacteria counts in armpit samples, but an increase in that of S. aureus (Leyden et al. 1986).
6.5 Limitations of the study
In studies I and II the biopsied acne lesions were clinically early-stage lesions,
meaning comedones with erythematous flare or small papules. Many previous
studies (Holland et al. 2004, Jeremy et al. 2003, Kim et al. 2002, Layton et al. 1998)
have used the mapping technique described by Norris and Cunliffe (1988) to select
for biopsy lesions within accurately-determined specific age ranges (Norris &
Cunliffe 1988). Therefore our results are not directly comparable to those of
previous studies. However, the biopsied 6‒72 h lesions in the study of Norris and
Cunliffe (2008) had a morphology of small papules with a minimal surrounding
erythematous flare. Among these, lymphoid cells outnumbered neutrophils
(polymorphonuclear cells, PMNs) in the 6 h biopsies, with neutrophils becoming
increasingly numerous in the 24‒72 h lesions (Norris & Cunliffe 1988). The
morphology of biopsied lesions in our study was similar: we performed histological
analysis that showed that the biopsied lesions contained neutrophils, but follicular
wall rupture was not usually seen. Further, we widely measured mRNA levels (I,
II) but the fact that we did not delve into the protein expressions of many
inflammatory markers might be considered limitation of this study. However,
several cytokines, TLRs and antimicrobial peptides have already been studied in
acne and are known to be expressed at the protein level (Harder et al. 2013, Jugeau et al. 2005, Kim et al. 2002, Kistowska et al. 2014, Kistowska et al. 2015, Li et al. 2014, Lumsden et al. 2011).
In study III, contaminants presented a challenge for the analysis. This is a well-
known problem in skin microbiome studies, since bacteria exist everywhere and
completely aseptic conditions are difficult to attain during sample collection,
storage, preparation and processing. The problem is more obvious in so-called
lower biomass samples e.g. skin swabs and bronchoalveolar lavage (BAL) fluids
where fewer bacteria are present, compared with high biomass samples e.g. stool
(Aho et al. 2015). Furthermore, skin samples from low-diversity and high-biomass
sebaceous sites can offer greater sequence yields than those from dry or moist areas
(Oh et al. 2014). This is probably the reason why the contaminant-problem was
70
more obvious in the samples from isotretinoin-treated acne patients, whose skin
was drier because of treatment. Moreover, it has to be remembered that the 16S
rRNA gene amplicon sequencing approach does not differentiate living cells from
dead ones, and as mentioned earlier, it does not measure the absolute number of
bacteria, only relative abundances.
Finally, a greater number of samples for analysis, in particular in studies II and
III may have allowed us to confirm the results from serum samples and the effects
of systemic treatments.
6.6 Future perspectives
There are several aspects to the multifactorial pathogenesis of acne that need to be
clarified in future. Firstly, it would be interesting to know which cells contribute to
the secretion of the cytokines IL-1α, IL-1β, IL-17 and IL-22 in different types of
acne lesions. Another interesting question is whether the severity of disease
correlates with the serum levels of certain cytokines, such as IL-17 and IL-1β. It
has been shown that in patients with severe acne, requiring isotretinoin treatment,
serum levels of IL-1 did not differ from those of healthy volunteers (Dispenza et al. 2012), but the situation could be different in other forms of acne, such as acne
fulminans.
The pathogenesis of acne fulminans is unknown. It is a rare, severe ulcerative
form of acne with an acute onset and systemic symptoms, such as fever, chills and
musculoskeletal pain. Some patients also develop aseptic bone osteolysis and/or
myositis (Zaba et al. 2011). It is tempting to speculate that in severe nodulocystic
acne or acne fulminans there is powerful activation of inflammasome by P. acnes
in genetically predisposed patients. Acne fulminans primarily affects 13‒16 year-
old males (Zaba et al. 2011), an age when levels of P. acnes and androgens increase
(Leyden et al. 1975b). It is likely that IL-1β contributes to the osteolytic lesions
seen in acne fulminans, because IL-1β can induce the differentiation of bone-
resorbing osteoclasts (Schett et al. 2016). At the systemic level the main action of
IL-1β is the induction of the fever response by the hypothalamus, so IL-1β may
cause the fever present in acne fulminans (Sims & Smith 2010). Moreover, in the
ulcerative/necrotic skin lesions typical of acne fulminans large amounts of IL-1α
are probably liberated from dying cells. It would be interesting to investigate the
serum cytokine levels of IL-1α, IL-1β and IL-17A and other proinflammatory
cytokines in samples from acne fulminans patients and compare them to those
found in samples from patients suffering cystic acne or milder forms of acne.
71
Because of the skin ulceration seen in acne fulminans there may also be differences
between the bacterial microbiota of acne vulgaris and acne fulminans patients.
At the moment the function of Tregs in acne is largely unknown. Tregs are
characterized by expression of transcription factor Foxp3, and they comprise a
dynamic and heterogeneous population of cells, which controls immune responses,
prevents autoimmunity and participates in the resolution of inflammation. Tregs
exert their suppressive functions in several ways e.g. by releasing inhibitory
cytokines (IL-10, TGF-β, IL-35) or immunosuppressive metabolites such as
adenosine, or inducing apoptosis of target effector T cells via perforin or granzymes
(Zhou et al. 2015). To the best of our knowledge, our study was the first to show
the presence of FoxP3+ cells in acne lesions (I). Previously Dispenza and
coworkers (2012) have shown that peripheral proportions of CD4+, CD25+ and
FoxP3+ Tregs did not differ between acne patients and normal volunteers.
Furthermore, they found that isotretinoin treatment had no influence on peripheral
Tregs (Dispenza et al. 2012). Interestingly, we found decreased expression of TGF-
β and FoxP3 in acne patients’ non-lesional skin (II). It is possible that in mild acne
Tregs and macrophages works properly and demarcate acne lesions, but in severe
forms there might be aberrant function of these cells. Interestingly, dysregulated
TGF-β mediated signaling has been linked to the genetic susceptibility to severe
acne (Navarini et al. 2014). TGF-β is needed for the induction of induced Tregs
(iTregs) which develop from naïve T cells in peripheral tissues (Schwarz 2012).
However, Tregs are very heterogeneous cell group and, like other T cells, have
demonstrated plasticity that may complicate research.
The roles of macrophages and different DCs in acne could also be investigated
in more detail. Here we reported the presence of CD83+ cells in inflammatory
infiltrates of acne. CD83 is stably expressed on activated, mature DCs and studies
have indicated roles of CD83 in the modulation of antigen presentation and CD4+
T cell generation (Cao et al. 2005). In early-stage acne lesions an increased number
of CD1a+ cells, supposed to be Langerhans cells, has been detected mainly within
the epidermis and follicle wall, but some are also present in the periductal infiltrate
with isolated cells scattered through the papillary dermis (Holland et al. 2004). A
recent interesting study showed that the natural ligands of CD1a – FFAs, squalene
and wax esters ‒ activated autoreactive T cells. This discovery of the antigenic
properties of skin oils led the authors to speculate that alterations in lipid content
might influence diseases like atopic dermatitis and psoriasis (de Jong et al. 2014).
The altered amount and quality of sebum in acne is well known and Zouboulis et
al (2013) among others have suggested that alterations in sebum composition may
72
initiate acne lesions (Zouboulis et al. 2013), but this view has not been validated.
Actually human CD4+ T cells that produce IL-22 recognize CD1a-lipid complexes
on Langerhans cells (Colonna 2010). We found increased IL-22 mRNA expression
in acne lesions, whereas another group did not (Kistowska et al. 2015). The
production of IL-22 by Th22 or Th17 cells mediates multiple effects on
keratinocytes including hyperproliferation, differentiation, migration, and
proinflammatory cytokine and AMP production (Sabat & Wolk 2011). In future,
experiments designed to determine whether there are increased number of CD1a
activated autoreactive T cells or pDCs in acne could help to clarify if there is any
autoimmunity in acne.
Isotretinoin has been the most potent medication for acne over 30 years.
However, it does not rapidly ameliorate the skin symptoms that often lead to
scarring. This may be because, as revealed in our study, isotretinoin does not
directly affect adaptive immune responses in acne patients’ skin (II). It is essential
for acne medication to reduce sebum production and P. acnes simultaneously, thus
it would be ideal to combine isotretinoin with a medication that prevents the
adaptive immune responses. Indeed, immunosuppressive corticosteroids are
indicated in severe cystic or fulminant acne to control the skin and systemic
symptoms before starting isotretinoin therapy. In a recent Phase 2 study,
administration of a human monoclonal IL-1α antibody to patients with moderate-
to-severe acne vulgaris resulted in rapid improvement of skin lesions (Carrasco et al. 2015). There are also reports concerning beneficial effects of TNF-α blockade
in severe acne (Campione et al. 2006, Colsman & Sticherling 2008, Rispo et al. 2016), although TNF-α blockade is also associated with acneiform eruptions and
even cystic acne (Kashat et al. 2014, Steels et al. 2009). Further studies are also
needed to determine whether IL-17 antibodies are effective in the treatment of
severe forms of acne and whether it would be beneficial to combine low doses of
isotretinoin with biologicals.
Furthermore, it would be interesting to study the long-term effects of systemic
treatments on acne patients’ skin microbiota using 16S rRNA gene amplicon
sequencing. Antibiotics act on the gut microbiota by decreasing its diversity and
modifying its composition in a way that can last for months or even years (Becattini et al. 2016). Previous studies using culture-based methods showed that bacterial
populations were not significantly altered in patients whose acne responded to a 3-
month period of tetracycline treatment (Cove et al. 1980, Cunliffe et al. 1973).
Oprica and co-workers (2007) also showed that initially decreased levels of P. acnes started to increase after a 3‒4-month course of tetracycline treatment, and
73
returned to initial levels within two weeks of cessation of the antibiotic treatment
(Oprica et al. 2007). It would be interesting to discover why the effect of
tetracycline to the levels of P. acnes on sebaceous skin area is so temporary.
Finally, future research should focus on determining the differences between
the microbial functions in healthy and acne skin. The use of metatranscriptomics
and metaproteomics could provide more comprehensive functional information,
and further define the role of P. acnes and other microbes in acne.
74
75
7 Conclusions
The work presented in this thesis represents new findings about inflammatory
mechanisms in the skin of acne vulgaris patients, particularly regarding the
activation of the IL-17/Th17 axis, which may together with IL-1, be an essential
component in the immunopathogenesis of acne (I). It is probable that the magnitude
of innate and adaptive immune responses define the severity of acne. Furthermore,
our new findings obtained by analysing skin samples from isotretinoin-treated acne
patients show that isotretinoin does not directly affect adaptive immune responses.
The data also support the view that more effective treatments which influence
adaptive immunity e.g. biologicals may be useful in combination with isotretinoin,
in particular in severe acne (II). Moreover, our study is the first to investigate the
effect of isotretinoin and lymecycline treatments on acne patients’ skin microbiota
using 16S rRNA gene amplicon sequencing based methods (III). Based on our
results, we draw the following conclusions:
1. The IL-17/Th17- axis is activated in clinically early-stage acne lesions. The
inflammatory infiltrates contain the CD4+ cells that are Th1, Th17 and Tregs,
and also CD68+ macrophages, mature CD83+ DCs cells and CD8+ T cells.
2. The expression levels of TGF-β and FOXP3 mRNA are lower in acne patients’
uninvolved skin than in healthy controls’ normal skin.
3. Several innate immune signals such as TLR2 and TLR4, proinflammatory
cytokines and AMPs are activated simultaneously with adaptive immune
responses.
4. Isotretinoin treatment does not directly affect either innate or adaptive immune
responses in newly formed acne lesions except for macrophages, which are
abundant in acne patients’ skin. This implies that once a single acne lesion is
formed, isotretinoin does not effectively stop the inflammation.
5. Isotretinoin decreases the expression of TLR2, but not TLR4, seen in acne
patients’ nonlesional skin.
6. IL-1β is present in uninvolved skin of acne patients and its presence is reduced
by isotretinoin treatment.
7. Isotretinoin restores the low levels of S100A7 in uninvolved skin of acne
patients to the levels of normal skin controls.
8. The skin microbiota does not differ between acne patients and healthy skin
controls and the abundance of P. acnes correlates with greater acne scores.
76
9. Isotretinoin and lymecycline both diminish the relative abundance of P. acnes
in acne areas and the decreased dominance of P. acnes increases the diversity
of the microbiota.
77
References
Agak GW, Qin M, Nobe J, Kim MH, Krutzik SR, Tristan GR, Elashoff D, Garban HJ & Kim J (2014) Propionibacterium acnes Induces an IL-17 Response in Acne Vulgaris that Is Regulated by Vitamin A and Vitamin D. J Invest Dermatol 134(2): 366-373.
Agamia NF, Abdallah DM, S Sorour O, Morad B & Younan DY (2016) Skin expression of mammalian target of rapamycin (mTOR), forkhead box transcription factorO1 (FoxO1) and serum insulin-like growth factor-1 (IGF-1) in patients with acne vulgaris and their relationship with diet. Br J Dermatol .
Agarwal S, Misra R & Aggarwal A (2008) Interleukin 17 levels are increased in juvenile idiopathic arthritis synovial fluid and induce synovial fibroblasts to produce proinflammatory cytokines and matrix metalloproteinases. J Rheumatol 35(3): 515-519.
Aho VT, Pereira PA, Haahtela T, Pawankar R, Auvinen P & Koskinen K (2015) The microbiome of the human lower airways: a next generation sequencing perspective. World Allergy Organ J 8(1): 23-015-0074-z. eCollection 2015.
Akaza N, Akamatsu H, Kishi M, Mizutani H, Ishii I, Nakata S & Matsunaga K (2009) Effects of Propionibacterium acnes on various mRNA expression levels in normal human epidermal keratinocytes in vitro. J Dermatol 36(4): 213-223.
Alestas T, Ganceviciene R, Fimmel S, Muller-Decker K & Zouboulis CC (2006) Enzymes involved in the biosynthesis of leukotriene B4 and prostaglandin E2 are active in sebaceous glands. J Mol Med (Berl) 84(1): 75-87.
Alhusayen RO, Juurlink DN, Mamdani MM, Morrow RL, Shear NH, Dormuth CR & Canadian Drug Safety and Effectiveness Research Network (2013) Isotretinoin use and the risk of inflammatory bowel disease: a population-based cohort study. J Invest Dermatol 133(4): 907-912.
Ashbee HR, Muir SR, Cunliffe WJ & Ingham E (1997) IgG subclasses specific to Staphylococcus epidermidis and Propionibacterium acnes in patients with acne vulgaris. Br J Dermatol 136(5): 730-733.
Ballanger F, Baudry P, N'Guyen JM, Khammari A & Dreno B (2006) Heredity: a prognostic factor for acne. Dermatology 212(2): 145-149.
Bangert C, Brunner PM & Stingl G (2011) Immune functions of the skin. Clin Dermatol 29(4): 360-376.
Barratt H, Hamilton F, Car J, Lyons C, Layton A & Majeed A (2009) Outcome measures in acne vulgaris: systematic review. Br J Dermatol 160(1): 132-136.
Batycka-Baran A, Maj J, Wolf R & Szepietowski JC (2014) The new insight into the role of antimicrobial proteins-alarmins in the immunopathogenesis of psoriasis. J Immunol Res 2014: 628289.
Becattini S, Taur Y & Pamer EG (2016) Antibiotic-Induced Changes in the Intestinal Microbiota and Disease. Trends Mol Med .
Bek-Thomsen M, Lomholt HB & Kilian M (2008) Acne is not associated with yet-uncultured bacteria. J Clin Microbiol 46(10): 3355-3360.
78
Bender A, Zapolanski T, Watkins S, Khosraviani A, Seiffert K, Ding W, Wagner JA & Granstein RD (2008) Tetracycline suppresses ATP gamma S-induced CXCL8 and CXCL1 production by the human dermal microvascular endothelial cell-1 (HMEC-1) cell line and primary human dermal microvascular endothelial cells. Exp Dermatol 17(9): 752-760.
Benjamini Y & Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. Roy. Statist. Soc. Ser. B. (Methodological) 57: 289-300.
Beringer A, Noack M & Miossec P (2016) IL-17 in Chronic Inflammation: From Discovery to Targeting. Trends Mol Med 22(3): 230-241.
Bhate K & Williams HC (2013) Epidemiology of acne vulgaris. Br J Dermatol 168(3): 474-485.
Bojar RA & Holland KT (2004) Acne and Propionibacterium acnes. Clin Dermatol 22(5): 375-379.
Bolstad BM, Irizarry RA, Astrand M & Speed TP (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19(2): 185-193.
Borovaya A, Dombrowski Y, Zwicker S, Olisova O, Ruzicka T, Wolf R, Schauber J & Sardy M (2014) Isotretinoin therapy changes the expression of antimicrobial peptides in acne vulgaris. Arch Dermatol Res 306(8): 689-700.
Braun-Falco M, Kovnerystyy O, Lohse P & Ruzicka T (2012) Pyoderma gangrenosum, acne, and suppurative hidradenitis (PASH)--a new autoinflammatory syndrome distinct from PAPA syndrome. J Am Acad Dermatol 66(3): 409-415.
Bruggemann H, Henne A, Hoster F, Liesegang H, Wiezer A, Strittmatter A, Hujer S, Durre P & Gottschalk G (2004) The complete genome sequence of Propionibacterium acnes, a commensal of human skin. Science 305(5684): 671-673.
Bruzzese V (2012) Pyoderma gangrenosum, acne conglobata, suppurative hidradenitis, and axial spondyloarthritis: efficacy of anti-tumor necrosis factor alpha therapy. J Clin Rheumatol 18(8): 413-415.
Buhl T, Sulk M, Nowak P, Buddenkotte J, McDonald I, Aubert J, Carlavan I, Deret S, Reiniche P, Rivier M, Voegel JJ & Steinhoff M (2015) Molecular and morphological characterization of inflammatory infiltrate in rosacea reveals activation of Th1/Th17 Pathways. J Invest Dermatol .
Campione E, Mazzotta AM, Bianchi L & Chimenti S (2006) Severe acne successfully treated with etanercept. Acta Derm Venereol 86(3): 256-257.
Cao W, Lee SH & Lu J (2005) CD83 is preformed inside monocytes, macrophages and dendritic cells, but it is only stably expressed on activated dendritic cells. Biochem J 385(Pt 1): 85-93.
Cargill JS, Scott KS, Gascoyne-Binzi D & Sandoe JA (2012) Granulicatella infection: diagnosis and management. J Med Microbiol 61(Pt 6): 755-761.
Carrasco D, Stecher M, Lefebvre GC, Logan AC & Moy R (2015) An Open Label, Phase 2 Study of MABp1 Monotherapy for the Treatment of Acne Vulgaris and Psychiatric Comorbidity. J Drugs Dermatol 14(6): 560-564.
79
Catana CS, Berindan Neagoe I, Cozma V, Magdas C, Tabaran F & Dumitrascu DL (2015) Contribution of the IL-17/IL-23 axis to the pathogenesis of inflammatory bowel disease. World J Gastroenterol 21(19): 5823-5830.
Cerman AA, Aktas E, Altunay IK, Arici JE, Tulunay A & Ozturk FY (2016) Dietary glycemic factors, insulin resistance, and adiponectin levels in acne vulgaris. J Am Acad Dermatol .
Chen W, Obermayer-Pietsch B, Hong JB, Melnik BC, Yamasaki O, Dessinioti C, Ju Q, Liakou AI, Al-Khuzaei S, Katsambas A, Ring J & Zouboulis CC (2011) Acne-associated syndromes: models for better understanding of acne pathogenesis. J Eur Acad Dermatol Venereol 25(6): 637-646.
Choi EH, Ahn SK & Lee SH (1997) The changes of stratum corneum interstices and calcium distribution of follicular epithelium of experimentally induced comedones (EIC) by oleic acid. Exp Dermatol 6(1): 29-35.
Choi JY, Piao MS, Lee JB, Oh JS, Kim IG & Lee SC (2008) Propionibacterium acnes stimulates pro-matrix metalloproteinase-2 expression through tumor necrosis factor-alpha in human dermal fibroblasts. J Invest Dermatol 128(4): 846-854.
Chronnell CM, Ghali LR, Ali RS, Quinn AG, Holland DB, Bull JJ, Cunliffe WJ, McKay IA, Philpott MP & Muller-Rover S (2001) Human beta defensin-1 and -2 expression in human pilosebaceous units: upregulation in acne vulgaris lesions. J Invest Dermatol 117(5): 1120-1125.
Clark RA, Chong B, Mirchandani N, Brinster NK, Yamanaka K, Dowgiert RK & Kupper TS (2006) The vast majority of CLA+ T cells are resident in normal skin. J Immunol 176(7): 4431-4439.
Coenye T, Peeters E & Nelis HJ (2007) Biofilm formation by Propionibacterium acnes is associated with increased resistance to antimicrobial agents and increased production of putative virulence factors. Res Microbiol 158(4): 386-392.
Colonna M (2010) Skin function for human CD1a-reactive T cells. Nat Immunol 11(12): 1079-1080.
Colsman A & Sticherling M (2008) Psoriasis vulgaris associated with acne vulgaris: differential effects of biologicals? Acta Derm Venereol 88(4): 418-419.
Cordain L, Lindeberg S, Hurtado M, Hill K, Eaton SB & Brand-Miller J (2002) Acne vulgaris: a disease of Western civilization. Arch Dermatol 138(12): 1584-1590.
Coughlin SS (2015) Clarifying the Purported Association between Isotretinoin and Inflammatory Bowel Disease. J Environ Health Sci 1(2): 10.15436/2378-6841.15.007.
Cove JH, Cunliffe WJ & Holland KT (1980) Acne vulgaris: is the bacterial population size significant? Br J Dermatol 102(3): 277-280.
Cunliffe WJ, Forster RA, Greenwood ND, Hetherington C, Holland KT, Holmes RL, Khan S, Roberts CD, Williams M & Williamson B (1973) Tetracycline and acne vulgaris: a clinical and laboratory investigation. Br Med J 4(5888): 332-335.
Dahl MG & McGibbon DH (1979) Complement C3 and immunoglobulin in inflammatory acne vulgaris. Br J Dermatol 101(6): 633-640.
Dale BA, Resing KA & Lonsdale-Eccles JD (1985) Filaggrin: a keratin filament associated protein. Ann N Y Acad Sci 455: 330-342.
80
Davis CP (1996) Normal Flora. In: Baron S (ed) Medical Microbiology. Galveston (TX), The University of Texas Medical Branch at Galveston: Chapter 6. Available from: http://www.ncbi.nlm.nih.gov.pc124152.oulu.fi:8080/books/NBK7617/.
de Jong A, Cheng TY, Huang S, Gras S, Birkinshaw RW, Kasmar AG, Van Rhijn I, Pena-Cruz V, Ruan DT, Altman JD, Rossjohn J & Moody DB (2014) CD1a-autoreactive T cells recognize natural skin oils that function as headless antigens. Nat Immunol 15(2): 177-185.
Di Cesare A, Di Meglio P & Nestle FO (2009) The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J Invest Dermatol 129(6): 1339-1350.
Dispenza MC, Wolpert EB, Gilliland KL, Dai JP, Cong Z, Nelson AM & Thiboutot DM (2012) Systemic isotretinoin therapy normalizes exaggerated TLR-2-mediated innate immune responses in acne patients. J Invest Dermatol 132(9): 2198-2205.
Downie MM, Sanders DA & Kealey T (2002) Modelling the remission of individual acne lesions in vitro. Br J Dermatol 147(5): 869-878.
Dozsa A, Mihaly J, Dezso B, Csizmadia E, Keresztessy T, Marko L, Ruhl R, Remenyik E & Nagy L (2016) Decreased peroxisome proliferator-activated receptor gamma level and signalling in sebaceous glands of patients with acne vulgaris. Clin Exp Dermatol .
Dreno B, Poli F, Pawin H, Beylot C, Faure M, Chivot M, Auffret N, Moyse D, Ballanger F & Revuz J (2011) Development and evaluation of a Global Acne Severity Scale (GEA Scale) suitable for France and Europe. J Eur Acad Dermatol Venereol 25(1): 43-48.
Eady EA, Cove JH, Blake J, Holland KT & Cunliffe WJ (1988) Recalcitrant acne vulgaris. Clinical, biochemical and microbiological investigation of patients not responding to antibiotic treatment. Br J Dermatol 118(3): 415-423.
Eady EA, Cove JH, Holland KT & Cunliffe WJ (1990) Superior antibacterial action and reduced incidence of bacterial resistance in minocycline compared to tetracycline-treated acne patients. Br J Dermatol 122(2): 233-244.
Edwards U, Rogall T, Blocker H, Emde M & Bottger EC (1989) Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Res 17(19): 7843-7853.
Ekholm IE, Brattsand M & Egelrud T (2000) Stratum corneum tryptic enzyme in normal epidermis: a missing link in the desquamation process? J Invest Dermatol 114(1): 56-63.
Elias KM, Laurence A, Davidson TS, Stephens G, Kanno Y, Shevach EM & O'Shea JJ (2008) Retinoic acid inhibits Th17 polarization and enhances FoxP3 expression through a Stat-3/Stat-5 independent signaling pathway. Blood 111(3): 1013-1020.
Fitz-Gibbon S, Tomida S, Chiu BH, Nguyen L, Du C, Liu M, Elashoff D, Erfe MC, Loncaric A, Kim J, Modlin RL, Miller JF, Sodergren E, Craft N, Weinstock GM & Li H (2013) Propionibacterium acnes strain populations in the human skin microbiome associated with acne. J Invest Dermatol 133(9): 2152-2160.
Freedberg IM, Tomic-Canic M, Komine M & Blumenberg M (2001) Keratins and the keratinocyte activation cycle. J Invest Dermatol 116(5): 633-640.
81
Furusawa H, Suzuki Y, Miyazaki Y, Inase N & Eishi Y (2012) Th1 and Th17 immune responses to viable Propionibacterium acnes in patients with sarcoidosis. Respir Investig 50(3): 104-109.
Gabler WL & Creamer HR (1991) Suppression of human neutrophil functions by tetracyclines. J Periodontal Res 26(1): 52-58.
Ganceviciene R, Fimmel S, Glass E & Zouboulis CC (2006) Psoriasin and follicular hyperkeratinization in acne comedones. Dermatology 213(3): 270-272.
Ganceviciene R, Graziene V, Fimmel S & Zouboulis CC (2009) Involvement of the corticotropin-releasing hormone system in the pathogenesis of acne vulgaris. Br J Dermatol 160(2): 345-352.
Ganceviciene R & Zouboulis CC (2010) Isotretinoin: state of the art treatment for acne vulgaris. J Dtsch Dermatol Ges 8 Suppl 1: S47-59.
Ghodsi SZ, Orawa H & Zouboulis CC (2009) Prevalence, severity, and severity risk factors of acne in high school pupils: a community-based study. J Invest Dermatol 129(9): 2136-2141.
Goltz RW & Kjartansson S (1966) Oral tetracycline treatment on bacterial flora in acne vulgaris. Arch Dermatol 93(1): 92-100.
Graham GM, Farrar MD, Cruse-Sawyer JE, Holland KT & Ingham E (2004) Proinflammatory cytokine production by human keratinocytes stimulated with Propionibacterium acnes and P. acnes GroEL. Br J Dermatol 150(3): 421-428.
Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, NISC Comparative Sequencing Program, Bouffard GG, Blakesley RW, Murray PR, Green ED, Turner ML & Segre JA (2009) Topographical and temporal diversity of the human skin microbiome. Science 324(5931): 1190-1192.
Grice EA, Kong HH, Renaud G, Young AC, NISC Comparative Sequencing Program, Bouffard GG, Blakesley RW, Wolfsberg TG, Turner ML & Segre JA (2008) A diversity profile of the human skin microbiota. Genome Res 18(7): 1043-1050.
Grice EA & Segre JA (2011) The skin microbiome. Nat Rev Microbiol 9(4): 244-253. Griffin MO, Fricovsky E, Ceballos G & Villarreal F (2010) Tetracyclines: a pleitropic family
of compounds with promising therapeutic properties. Review of the literature. Am J Physiol Cell Physiol 299(3): C539-48.
Griffith TS, Chin WA, Jackson GC, Lynch DH & Kubin MZ (1998) Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J Immunol 161(6): 2833-2840.
Guy R, Green MR & Kealey T (1996) Modeling acne in vitro. J Invest Dermatol 106(1): 176-182.
Halvorsen JA, Stern RS, Dalgard F, Thoresen M, Bjertness E & Lien L (2011) Suicidal ideation, mental health problems, and social impairment are increased in adolescents with acne: a population-based study. J Invest Dermatol 131(2): 363-370.
Harder J, Dressel S, Wittersheim M, Cordes J, Meyer-Hoffert U, Mrowietz U, Folster-Holst R, Proksch E, Schröder JM, Schwarz T & Gläser R (2010) Enhanced expression and secretion of antimicrobial peptides in atopic dermatitis and after superficial skin injury. J Invest Dermatol 130(5): 1355-1364.
82
Harder J, Tsuruta D, Murakami M & Kurokawa I (2013) What is the role of antimicrobial peptides (AMP) in acne vulgaris? Exp Dermatol 22(6): 386-391.
He L, Wu WJ, Yang JK, Cheng H, Zuo XB, Lai W, Gao TW, Ma CL, Luo N, Huang JQ, Lu FY, Liu YQ, Huang YJ, Lu QJ, Zhang HL, Wang L, Wang WZ, Wang MM, Xiao SX, Sun Q, Li CY, Bai YP, Li H, Zhou ZC, Zhou FS, Chen G, Liang B, Qi J, Yang XY, Yang T, Zheng X, Sun LD, Zhang XJ & Zhang YP (2014) Two new susceptibility loci 1q24.2 and 11p11.2 confer risk to severe acne. Nat Commun 5: 2870.
He L, Yang Z, Yu H, Cheng B, Tang W, Dong Y & Xiao C (2006) The relationship between CYP17 -34T/C polymorphism and acne in Chinese subjects revealed by sequencing. Dermatology 212(4): 338-342.
Holland DB, Gowland G & Cunliffe WJ (1983) Lymphocyte subpopulations in patients with acne vulgaris. Br J Dermatol 109(2): 199-203.
Holland DB, Ingham E, Gowland G & Cunliffe WJ (1986) IgG subclasses in acne vulgaris. Br J Dermatol 114(3): 349-351.
Holland DB, Jeremy AH, Roberts SG, Seukeran DC, Layton AM & Cunliffe WJ (2004) Inflammation in acne scarring: a comparison of the responses in lesions from patients prone and not prone to scar. Br J Dermatol 150(1): 72-81.
Housman E & Reynolds RV (2014) Polycystic ovary syndrome: a review for dermatologists: Part I. Diagnosis and manifestations. J Am Acad Dermatol 71(5): 847.e1-847.e10; quiz 857-8.
Hughes BR, Morris C, Cunliffe WJ & Leigh IM (1996) Keratin expression in pilosebaceous epithelia in truncal skin of acne patients. Br J Dermatol 134(2): 247-256.
Imperato-McGinley J, Gautier T, Cai LQ, Yee B, Epstein J & Pochi P (1993) The androgen control of sebum production. Studies of subjects with dihydrotestosterone deficiency and complete androgen insensitivity. J Clin Endocrinol Metab 76(2): 524-528.
Ingham E, Eady EA, Goodwin CE, Cove JH & Cunliffe WJ (1992) Pro-inflammatory levels of interleukin-1 alpha-like bioactivity are present in the majority of open comedones in acne vulgaris. J Invest Dermatol 98(6): 895-901.
Ingham E, Gowland G, Ward RM, Holland KT & Cunliffe WJ (1987) Antibodies to P. acnes and P. acnes exocellular enzymes in the normal population at various ages and in patients with acne vulgaris. Br J Dermatol 116(6): 805-812.
Ingram E, Holland KT, Gowland G & Cunliffe WJ (1983) Studies of the extracellular proteolytic activity produced by Propionibacterium acnes. J Appl Bacteriol 54(2): 263-271.
Ioffreda MD (2009) Inflammatory diseases of hair follicles, sweat glands, and cartilage. In: Elder DE, Elenitsas R, Johnson BLJ, Murphy GF & Xu X (eds) Lever´s histopathology of the skin. Philadelphia, USA, Lippincott Williams & Wilkins: 459-461.
Isailovic N, Daigo K, Mantovani A & Selmi C (2015) Interleukin-17 and innate immunity in infections and chronic inflammation. J Autoimmun 60: 1-11.
Jahns AC, Lundskog B, Ganceviciene R, Palmer RH, Golovleva I, Zouboulis CC, McDowell A, Patrick S & Alexeyev OA (2012) An increased incidence of Propionibacterium acnes biofilms in acne vulgaris: a case-control study. Br J Dermatol 167(1): 50-58.
83
Jappe U, Ingham E, Henwood J & Holland KT (2002) Propionibacterium acnes and inflammation in acne; P. acnes has T-cell mitogenic activity. Br J Dermatol 146(2): 202-209.
Jasson F, Nagy I, Knol AC, Zuliani T, Khammari A & Dreno B (2013) Different strains of Propionibacterium acnes modulate differently the cutaneous innate immunity. Exp Dermatol 22(9): 587-592.
Jeremy AH, Holland DB, Roberts SG, Thomson KF & Cunliffe WJ (2003) Inflammatory events are involved in acne lesion initiation. J Invest Dermatol 121(1): 20-27.
Jin L & Wang G (2014) Keratin 17: a critical player in the pathogenesis of psoriasis. Med Res Rev 34(2): 438-454.
Jugeau S, Tenaud I, Knol AC, Jarrousse V, Quereux G, Khammari A & Dreno B (2005) Induction of toll-like receptors by Propionibacterium acnes. Br J Dermatol 153(6): 1105-1113.
Kähäri VM & Saarialho-Kere U (1997) Matrix metalloproteinases in skin. Exp Dermatol 6(5): 199-213.
Kang S, Cho S, Chung JH, Hammerberg C, Fisher GJ & Voorhees JJ (2005) Inflammation and extracellular matrix degradation mediated by activated transcription factors nuclear factor-kappaB and activator protein-1 in inflammatory acne lesions in vivo. Am J Pathol 166(6): 1691-1699.
Karadag AS, Ertugrul DT, Bilgili SG, Takci Z, Akin KO & Calka O (2012) Immunoregulatory effects of isotretinoin in patients with acne. Br J Dermatol 167(2): 433-435.
Kariya Y, Moriya T, Suzuki T, Chiba M, Ishida K, Takeyama J, Endoh M, Watanabe M & Sasano H (2005) Sex steroid hormone receptors in human skin appendage and its neoplasms. Endocr J 52(3): 317-325.
Karvonen SL, Rasanen L, Cunliffe WJ, Holland KT, Karvonen J & Reunala T (1994) Delayed hypersensitivity to Propionibacterium acnes in patients with severe nodular acne and acne fulminans. Dermatology 189(4): 344-349.
Karvonen SL, Rasanen L, Soppi E, Hyoty H, Lehtinen M & Reunala T (1995) Increased chemiluminescence of whole blood and normal T-lymphocyte subsets in severe nodular acne and acne fulminans. Acta Derm Venereol 75(1): 1-5.
Kashat M, Caretti K & Kado J (2014) Etanercept-induced cystic acne. Cutis 94(1): 31-32. Katsuta Y, Iida T, Inomata S & Denda M (2005) Unsaturated fatty acids induce calcium
influx into keratinocytes and cause abnormal differentiation of epidermis. J Invest Dermatol 124(5): 1008-1013.
Kim J, Ochoa MT, Krutzik SR, Takeuchi O, Uematsu S, Legaspi AJ, Brightbill HD, Holland D, Cunliffe WJ, Akira S, Sieling PA, Godowski PJ & Modlin RL (2002) Activation of toll-like receptor 2 in acne triggers inflammatory cytokine responses. J Immunol 169(3): 1535-1541.
King K, Jones DH, Daltrey DC & Cunliffe WJ (1982) A double-blind study of the effects of 13-cis-retinoic acid on acne, sebum excretion rate and microbial population. Br J Dermatol 107(5): 583-590.
84
Kistowska M, Gehrke S, Jankovic D, Kerl K, Fettelschoss A, Feldmeyer L, Fenini G, Kolios A, Navarini A, Ganceviciene R, Schauber J, Contassot E & French LE (2014) IL-1beta Drives Inflammatory Responses to Propionibacterium acnes In Vitro and In Vivo. J Invest Dermatol 134(3): 677-685.
Kistowska M, Meier B, Proust T, Feldmeyer L, Cozzio A, Kuendig T, Contassot E & French LE (2015) Propionibacterium acnes promotes Th17 and Th17/Th1 responses in acne patients. J Invest Dermatol 135(1): 110-118.
Kligman AM (1974) An overview of acne. J Invest Dermatol 62(3): 268-287. Klinger B, Anin S, Silbergeld A, Eshet R & Laron Z (1998) Development of
hyperandrogenism during treatment with insulin-like growth factor-I (IGF-I) in female patients with Laron syndrome. Clin Endocrinol (Oxf) 48(1): 81-87.
Knaggs HE, Holland DB, Morris C, Wood EJ & Cunliffe WJ (1994) Quantification of cellular proliferation in acne using the monoclonal antibody Ki-67. J Invest Dermatol 102(1): 89-92.
Knutson DD (1974) Ultrastructural observations in acne vulgaris: the normal sebaceous follicle and acne lesions. J Invest Dermatol 62(3): 288-307.
Krakauer T & Buckley M (2003) Doxycycline is anti-inflammatory and inhibits staphylococcal exotoxin-induced cytokines and chemokines. Antimicrob Agents Chemother 47(11): 3630-3633.
Kurokawa I, Danby FW, Ju Q, Wang X, Xiang LF, Xia L, Chen W, Nagy I, Picardo M, Suh DH, Ganceviciene R, Schagen S, Tsatsou F & Zouboulis CC (2009) New developments in our understanding of acne pathogenesis and treatment. Exp Dermatol 18(10): 821-832.
Kurokawa I, Mayer-da-Silva A, Gollnick H & Orfanos CE (1988) Monoclonal antibody labeling for cytokeratins and filaggrin in the human pilosebaceous unit of normal, seborrhoeic and acne skin. J Invest Dermatol 91(6): 566-571.
Kurokawa I, Takahashi K, Moll I & Moll R (2011) Expression of keratins in cutaneous epithelial tumors and related disorders--distribution and clinical significance. Exp Dermatol 20(3): 217-228.
Kwon HH, Yoon JY, Hong JS, Jung JY, Park MS & Suh DH (2012) Clinical and histological effect of a low glycaemic load diet in treatment of acne vulgaris in Korean patients: a randomized, controlled trial. Acta Derm Venereol 92(3): 241-246.
Landthaler M, Kummermehr J, Wagner A & Plewig G (1980) Inhibitory effects of 13-cis-retinoic acid on human sebaceous glands. Arch Dermatol Res 269(3): 297-309.
Lane D (1991) 16S/23S rRNA sequencing. In: Stackebrandt E & Goodfellow M (eds) Nucleic Acid Techniques in Bacterial Systematics. New York, Wiley: 115-175.
Larsen TH & Jemec GB (2003) Acne: comparing hormonal approaches to antibiotics and isotretinoin. Expert Opin Pharmacother 4(7): 1097-1103.
Layton AM, Morris C, Cunliffe WJ & Ingham E (1998) Immunohistochemical investigation of evolving inflammation in lesions of acne vulgaris. Exp Dermatol 7(4): 191-197.
Lee DD, Stojadinovic O, Krzyzanowska A, Vouthounis C, Blumenberg M & Tomic-Canic M (2009) Retinoid-responsive transcriptional changes in epidermal keratinocytes. J Cell Physiol 220(2): 427-439.
85
Lee DY, Yamasaki K, Rudsil J, Zouboulis CC, Park GT, Yang JM & Gallo RL (2008) Sebocytes express functional cathelicidin antimicrobial peptides and can act to kill propionibacterium acnes. J Invest Dermatol 128(7): 1863-1866.
Lee SE, Kim JM, Jeong MK, Zouboulis CC & Lee SH (2013) 11beta-hydroxysteroid dehydrogenase type 1 is expressed in human sebaceous glands and regulates glucocorticoid-induced lipid synthesis and toll-like receptor 2 expression in SZ95 sebocytes. Br J Dermatol 168(1): 47-55.
Lee SE, Kim JM, Jeong SK, Choi EH, Zouboulis CC & Lee SH (2015) Expression of Protease-Activated Receptor-2 in SZ95 Sebocytes and its Role in Sebaceous Lipogenesis, Inflammation, and Innate Immunity. J Invest Dermatol 135(9): 2338.
Lee SE, Kim JM, Jeong SK, Jeon JE, Yoon HJ, Jeong MK & Lee SH (2010) Protease-activated receptor-2 mediates the expression of inflammatory cytokines, antimicrobial peptides, and matrix metalloproteinases in keratinocytes in response to Propionibacterium acnes. Arch Dermatol Res 302(10): 745-756.
Lee SY, Jamal MM, Nguyen ET, Bechtold ML & Nguyen DL (2016) Does exposure to isotretinoin increase the risk for the development of inflammatory bowel disease? A meta-analysis. Eur J Gastroenterol Hepatol 28(2): 210-216.
Leeming JP, Holland KT & Cuncliffe WJ (1988) The microbial colonization of inflamed acne vulgaris lesions. Br J Dermatol 118(2): 203-208.
Levell MJ, Cawood ML, Burke B & Cunliffe WJ (1989) Acne is not associated with abnormal plasma androgens. Br J Dermatol 120(5): 649-654.
Leyden JJ, McGinley KJ & Foglia AN (1986) Qualitative and quantitative changes in cutaneous bacteria associated with systemic isotretinoin therapy for acne conglobata. J Invest Dermatol 86(4): 390-393.
Leyden JJ, McGinley KJ, Mills OH & Kligman AM (1975a) Age-related changes in the resident bacterial flora of the human face. J Invest Dermatol 65(4): 379-381.
Leyden JJ, McGinley KJ, Mills OH & Kligman AM (1975b) Propionibacterium levels in patients with and without acne vulgaris. J Invest Dermatol 65(4): 382-384.
Li ZJ, Choi DK, Sohn KC, Seo MS, Lee HE, Lee Y, Seo YJ, Lee YH, Shi G, Zouboulis CC, Kim CD, Lee JH & Im M (2014) Propionibacterium acnes activates the NLRP3 inflammasome in human sebocytes. J Invest Dermatol 134(11): 2747-2756.
Liang T, Hoyer S, Yu R, Soltani K, Lorincz AL, Hiipakka RA & Liao S (1993) Immunocytochemical localization of androgen receptors in human skin using monoclonal antibodies against the androgen receptor. J Invest Dermatol 100(5): 663-666.
Lima AL, Karl I, Giner T, Poppe H, Schmidt M, Presser D, Goebeler M & Bauer B (2016) Keratinocytes and neutrophils are important sources of proinflammatory molecules in hidradenitis suppurativa. Br J Dermatol 174(3): 514-521.
Liu PT, Krutzik SR, Kim J & Modlin RL (2005) Cutting edge: all-trans retinoic acid down-regulates TLR2 expression and function. J Immunol 174(5): 2467-2470.
Lolis MS, Bowe WP & Shalita AR (2009) Acne and systemic disease. Med Clin North Am 93(6): 1161-1181.
86
Love MI, Huber W & Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15(12): 550.
Lucky AW, Biro FM, Huster GA, Leach AD, Morrison JA & Ratterman J (1994) Acne vulgaris in premenarchal girls. An early sign of puberty associated with rising levels of dehydroepiandrosterone. Arch Dermatol 130(3): 308-314.
Lumsden KR, Nelson AM, Dispenza MC, Gilliland KL, Cong Z, Zaenglein AL & Thiboutot DM (2011) Isotretinoin increases skin-surface levels of neutrophil gelatinase-associated lipocalin in patients treated for severe acne. Br J Dermatol 165(2): 302-310.
Lwin SM, Kimber I & McFadden JP (2014) Acne, quorum sensing and danger. Clin Exp Dermatol 39(2): 162-167.
Maddur MS, Miossec P, Kaveri SV & Bayry J (2012) Th17 cells: biology, pathogenesis of autoimmune and inflammatory diseases, and therapeutic strategies. Am J Pathol 181(1): 8-18.
Marinelli LJ, Fitz-Gibbon S, Hayes C, Bowman C, Inkeles M, Loncaric A, Russell DA, Jacobs-Sera D, Cokus S, Pellegrini M, Kim J, Miller JF, Hatfull GF & Modlin RL (2012) Propionibacterium acnes bacteriophages display limited genetic diversity and broad killing activity against bacterial skin isolates. MBio 3(5): 10.1128/mBio.00279-12. Print 2012.
Marples RR, Downing DT & Kligman AM (1971) Control of free fatty acids in human surface lipids by Corynebacterium acnes. J Invest Dermatol 56(2): 127-131.
Marples RR, Leyden JJ, Stewart RN, Mills OH,Jr & Kligman AM (1974) The skin microflora in acne vulgaris. J Invest Dermatol 62(1): 37-41.
Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet journal 17, 1: 10-12.
Marynick SP, Chakmakjian ZH, McCaffree DL & Herndon JH,Jr (1983) Androgen excess in cystic acne. N Engl J Med 308(17): 981-986.
Marzano AV, Trevisan V, Gattorno M, Ceccherini I, De Simone C & Crosti C (2013) Pyogenic arthritis, pyoderma gangrenosum, acne, and hidradenitis suppurativa (PAPASH): a new autoinflammatory syndrome associated with a novel mutation of the PSTPIP1 gene. JAMA Dermatol 149(6): 762-764.
McDowell A, Barnard E, Nagy I, Gao A, Tomida S, Li H, Eady A, Cove J, Nord CE & Patrick S (2012) An expanded multilocus sequence typing scheme for propionibacterium acnes: investigation of 'pathogenic', 'commensal' and antibiotic resistant strains. PLoS One 7(7): e41480.
McMurdie PJ & Holmes S (2013) phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One 8(4): e61217.
Melnik B, Jansen T & Grabbe S (2007) Abuse of anabolic-androgenic steroids and bodybuilding acne: an underestimated health problem. J Dtsch Dermatol Ges 5(2): 110-117.
Melnik BC (2012) Diet in acne: further evidence for the role of nutrient signalling in acne pathogenesis. Acta Derm Venereol 92(3): 228-231.
87
Melnik BC (2016) Western diet-induced imbalances of FoxO1 and mTORC1 signalling promote the sebofollicular inflammasomopathy acne vulgaris. Exp Dermatol 25(2): 103-104.
Melnik BC & Zouboulis CC (2013) Potential role of FoxO1 and mTORC1 in the pathogenesis of Western diet-induced acne. Exp Dermatol 22(5): 311-315.
Meng G, Zhang F, Fuss I, Kitani A & Strober W (2009) A mutation in the Nlrp3 gene causing inflammasome hyperactivation potentiates Th17 cell-dominant immune responses. Immunity 30(6): 860-874.
Mills OH,Jr, Marples RR & Kligman AM (1972) Acne vulgaris. Oral therapy with tetracycline and topical therapy with vitamin A. Arch Dermatol 106(2): 200-203.
Moll R, Divo M & Langbein L (2008) The human keratins: biology and pathology. Histochem Cell Biol 129(6): 705-733.
Monfrecola G, Lembo S, Caiazzo G, De Vita V, Di Caprio R, Balato A & Fabbrocini G (2016) Mechanistic target of rapamycin (mTOR) expression is increased in acne patients' skin. Exp Dermatol 25(2): 153-155.
mothur. Standard Operating Procedure for MiSeq sequenced 16S rRNA gene data. URI: http://www.mothur.org/wiki/MiSeq_SOP.
Mouser PE, Baker BS, Seaton ED & Chu AC (2003) Propionibacterium acnes-reactive T helper-1 cells in the skin of patients with acne vulgaris. J Invest Dermatol 121(5): 1226-1228.
Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Kronenberg M & Cheroutre H (2007) Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science 317(5835): 256-260.
Nagpal M, De D, Handa S, Pal A & Sachdeva N (2016) Insulin Resistance and Metabolic Syndrome in Young Men With Acne. JAMA Dermatol 152(4): 399-404.
Nagy I, Pivarcsi A, Kis K, Koreck A, Bodai L, McDowell A, Seltmann H, Patrick S, Zouboulis CC & Kemeny L (2006) Propionibacterium acnes and lipopolysaccharide induce the expression of antimicrobial peptides and proinflammatory cytokines/chemokines in human sebocytes. Microbes Infect 8(8): 2195-2205.
Nagy I, Pivarcsi A, Koreck A, Szell M, Urban E & Kemeny L (2005) Distinct strains of Propionibacterium acnes induce selective human beta-defensin-2 and interleukin-8 expression in human keratinocytes through toll-like receptors. J Invest Dermatol 124(5): 931-938.
Nast A, Dreno B, Bettoli V, Degitz K, Erdmann R, Finlay AY, Ganceviciene R, Haedersdal M, Layton A, Lopez-Estebaranz JL, Ochsendorf F, Oprica C, Rosumeck S, Rzany B, Sammain A, Simonart T, Veien NK, Zivkovic MV, Zouboulis CC, Gollnick H & European Dermatology Forum (2012) European evidence-based (S3) guidelines for the treatment of acne. J Eur Acad Dermatol Venereol 26 Suppl 1: 1-29.
Navarini AA, Simpson MA, Weale M, Knight J, Carlavan I, Reiniche P, Burden DA, Layton A, Bataille V, Allen M, Pleass R, Pink A, Creamer D, English J, Munn S, Walton S, Acne Genetic Study Group, Willis C, Deret S, Voegel JJ, Spector T, Smith CH, Trembath RC & Barker JN (2014) Genome-wide association study identifies three novel susceptibility loci for severe Acne vulgaris. Nat Commun 5: 4020.
88
Nelson AM, Cong Z, Gilliland KL & Thiboutot DM (2011) TRAIL contributes to the apoptotic effect of 13-cis retinoic acid in human sebaceous gland cells. Br J Dermatol 165(3): 526-533.
Nelson AM, Gilliland KL, Cong Z & Thiboutot DM (2006) 13-cis Retinoic acid induces apoptosis and cell cycle arrest in human SEB-1 sebocytes. J Invest Dermatol 126(10): 2178-2189.
Nelson AM, Zhao W, Gilliland KL, Zaenglein AL, Liu W & Thiboutot DM (2008) Neutrophil gelatinase-associated lipocalin mediates 13-cis retinoic acid-induced apoptosis of human sebaceous gland cells. J Clin Invest 118(4): 1468-1478.
Nelson AM, Zhao W, Gilliland KL, Zaenglein AL, Liu W & Thiboutot DM (2009) Isotretinoin temporally regulates distinct sets of genes in patient skin. J Invest Dermatol 129(4): 1038-1042.
Norris JF & Cunliffe WJ (1988) A histological and immunocytochemical study of early acne lesions. Br J Dermatol 118(5): 651-659.
Numata S, Akamatsu H, Akaza N, Yagami A, Nakata S & Matsunaga K (2014) Analysis of facial skin-resident microbiota in Japanese acne patients. Dermatology 228(1): 86-92.
O'Brien SC, Lewis JB & Cunliffe WJ (1998) The Leeds revised acne grading system. J Dermatol Treat 9: 215-220.
Oh J, Byrd AL, Deming C, Conlan S, NISC Comparative Sequencing Program, Kong HH & Segre JA (2014) Biogeography and individuality shape function in the human skin metagenome. Nature 514(7520): 59-64.
Oh J, Conlan S, Polley EC, Segre JA & Kong HH (2012) Shifts in human skin and nares microbiota of healthy children and adults. Genome Med 4(10): 77.
On SC & Zeichner J (2013) Isotretinoin updates. Dermatol Ther 26(5): 377-389. Oprica C, Emtestam L, Hagstromer L & Nord CE (2007) Clinical and microbiological
comparisons of isotretinoin vs. tetracycline in acne vulgaris. Acta Derm Venereol 87(3): 246-254.
Ostlere LS, Rumsby G, Holownia P, Jacobs HS, Rustin MH & Honour JW (1998) Carrier status for steroid 21-hydroxylase deficiency is only one factor in the variable phenotype of acne. Clin Endocrinol (Oxf) 48(2): 209-215.
Ottaviani M, Camera E & Picardo M (2010) Lipid mediators in acne. Mediators Inflamm 2010: 10.1155/2010/858176. Epub 2010 Aug 25.
Panelius J & Meri S (2015) Complement system in dermatological diseases - fire under the skin. Front Med (Lausanne) 2: 3.
Papakonstantinou E, Aletras AJ, Glass E, Tsogas P, Dionyssopoulos A, Adjaye J, Fimmel S, Gouvousis P, Herwig R, Lehrach H, Zouboulis CC & Karakiulakis G (2005) Matrix metalloproteinases of epithelial origin in facial sebum of patients with acne and their regulation by isotretinoin. J Invest Dermatol 125(4): 673-684.
Paraskevaidis A, Drakoulis N, Roots I, Orfanos CE & Zouboulis CC (1998) Polymorphisms in the human cytochrome P-450 1A1 gene (CYP1A1) as a factor for developing acne. Dermatology 196(1): 171-175.
Perera GK, Di Meglio P & Nestle FO (2012) Psoriasis. Annu Rev Pathol 7: 385-422.
89
Perry A & Lambert P (2011) Propionibacterium acnes: infection beyond the skin. Expert Rev Anti Infect Ther 9(12): 1149-1156.
Pochi PE & Strauss JS (1961) Antibiotic sensitivity of Corynebacterium acnes (Propionibacterium acnes). J Invest Dermatol 36: 423-429.
Pochi PE & Strauss JS (1969) Sebaceous gland response in man to the administration of testosterone, delta-4-androstenedione, and dehydroisoandrosterone. J Invest Dermatol 52(1): 32-36.
Puhvel SM, Hoffman IK & Sternberg TH (1966) Corynebacterium acnes. Presence of complement fixing antibodies to corynebacterium acnes in the sera of patients with acne vulgaris. Arch Dermatol 93(3): 364-366.
Qin M, Pirouz A, Kim MH, Krutzik SR, Garban HJ & Kim J (2014) Propionibacterium acnes Induces IL-1beta secretion via the NLRP3 inflammasome in human monocytes. J Invest Dermatol 134(2): 381-388.
Racine A, Cuerq A, Bijon A, Ricordeau P, Weill A, Allemand H, Chosidow O, Boutron-Ruault MC & Carbonnel F (2014) Isotretinoin and risk of inflammatory bowel disease: a French nationwide study. Am J Gastroenterol 109(4): 563-569.
Raghunath M, Tontsidou L, Oji V, Aufenvenne K, Schurmeyer-Horst F, Jayakumar A, Stander H, Smolle J, Clayman GL & Traupe H (2004) SPINK5 and Netherton syndrome: novel mutations, demonstration of missing LEKTI, and differential expression of transglutaminases. J Invest Dermatol 123(3): 474-483.
Ramot Y, Mastrofrancesco A, Camera E, Desreumaux P, Paus R & Picardo M (2015) The role of PPARgamma-mediated signalling in skin biology and pathology: new targets and opportunities for clinical dermatology. Exp Dermatol 24(4): 245-251.
Ramrakha S, Fergusson DM, Horwood LJ, Dalgard F, Ambler A, Kokaua J, Milne BJ & Poulton R (2015) Cumulative mental health consequences of acne: 23-year follow-up in a general population birth cohort study. Br J Dermatol .
Rashtak S, Khaleghi S, Pittelkow MR, Larson JJ, Lahr BD & Murray JA (2014) Isotretinoin exposure and risk of inflammatory bowel disease. JAMA Dermatol 150(12): 1322-1326.
Rattenholl A & Steinhoff M (2008) Proteinase-activated receptor-2 in the skin: receptor expression, activation and function during health and disease. Drug News Perspect 21(7): 369-381.
Rispo A, Musto D, Imperatore N, Testa A, Rea M & Castiglione F (2016) Dramatic improvement of severe acne pustolosa after adalimumab in a patient with ulcerative colitis. Clin Case Rep 4(4): 348-350.
Sabat R & Wolk K (2011) Research in practice: IL-22 and IL-20: significance for epithelial homeostasis and psoriasis pathogenesis. J Dtsch Dermatol Ges 9(7): 518-523.
Salter SJ, Cox MJ, Turek EM, Calus ST, Cookson WO, Moffatt MF, Turner P, Parkhill J, Loman NJ & Walker AW (2014) Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol 12: 87-014-0087-z.
Schaller M, Loewenstein M, Borelli C, Jacob K, Vogeser M, Burgdorf WH & Plewig G (2005) Induction of a chemoattractive proinflammatory cytokine response after stimulation of keratinocytes with Propionibacterium acnes and coproporphyrin III. Br J Dermatol 153(1): 66-71.
90
Schett G, Dayer JM & Manger B (2016) Interleukin-1 function and role in rheumatic disease. Nat Rev Rheumatol 12(1): 14-24.
Schlapbach C, Hanni T, Yawalkar N & Hunger RE (2011) Expression of the IL-23/Th17 pathway in lesions of hidradenitis suppurativa. J Am Acad Dermatol 65(4): 790-798.
Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA, Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ & Weber CF (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75(23): 7537-7541.
Schwarz T (2012) Immunology. In: Bolognia JL, Jorizzo JL & Schaffer JF (eds) Dermatology. , Elsevier Limited: 63-79.
Scott DG, Cunliffe WJ & Gowland G (1979) Activation of complement-a mechanism for the inflammation in acne. Br J Dermatol 101(3): 315-320.
Shaheen B & Gonzalez M (2011) A microbial aetiology of acne: what is the evidence? Br J Dermatol 165(3): 474-485.
Shibata M, Katsuyama M, Onodera T, Ehama R, Hosoi J & Tagami H (2009) Glucocorticoids enhance Toll-like receptor 2 expression in human keratinocytes stimulated with Propionibacterium acnes or proinflammatory cytokines. J Invest Dermatol 129(2): 375-382.
Silverberg JI & Silverberg NB (2014) Epidemiology and extracutaneous comorbidities of severe acne in adolescence: a U.S. population-based study. Br J Dermatol 170(5): 1136-1142.
Simonart T, Dramaix M & De Maertelaer V (2008) Efficacy of tetracyclines in the treatment of acne vulgaris: a review. Br J Dermatol 158(2): 208-216.
Sims JE & Smith DE (2010) The IL-1 family: regulators of immunity. Nat Rev Immunol 10(2): 89-102.
Smith RN, Mann NJ, Braue A, Makelainen H & Varigos GA (2007) The effect of a high-protein, low glycemic-load diet versus a conventional, high glycemic-load diet on biochemical parameters associated with acne vulgaris: a randomized, investigator-masked, controlled trial. J Am Acad Dermatol 57(2): 247-256.
Staudinger T, Pipal A & Redl B (2011) Molecular analysis of the prevalent microbiota of human male and female forehead skin compared to forearm skin and the influence of make-up. J Appl Microbiol 110(6): 1381-1389.
Steels E, Peretz A & Vereecken P (2009) Infliximab-induced acne: a new case and review of published reports. J Dermatolog Treat 20(1): 59-60.
Steinhoff M, Schauber J & Leyden JJ (2013) New insights into rosacea pathophysiology: a review of recent findings. J Am Acad Dermatol 69(6 Suppl 1): S15-26.
Stewart ME, Downing DT, Cook JS, Hansen JR & Strauss JS (1992) Sebaceous gland activity and serum dehydroepiandrosterone sulfate levels in boys and girls. Arch Dermatol 128(10): 1345-1348.
Strauss JS, Stewart ME & Downing DT (1987) The effect of 13-cis-retinoic acid on sebaceous glands. Arch Dermatol 123(11): 1538a-1541.
91
Strowig T, Henao-Mejia J, Elinav E & Flavell R (2012) Inflammasomes in health and disease. Nature 481(7381): 278-286.
Sugisaki H, Yamanaka K, Kakeda M, Kitagawa H, Tanaka K, Watanabe K, Gabazza EC, Kurokawa I & Mizutani H (2009) Increased interferon-gamma, interleukin-12p40 and IL-8 production in Propionibacterium acnes-treated peripheral blood mononuclear cells from patient with acne vulgaris: host response but not bacterial species is the determinant factor of the disease. J Dermatol Sci 55(1): 47-52.
Tan JK & Bhate K (2015) A global perspective on the epidemiology of acne. Br J Dermatol . Tasli L, Turgut S, Kacar N, Ayada C, Coban M, Akcilar R & Ergin S (2013) Insulin-like
growth factor-I gene polymorphism in acne vulgaris. J Eur Acad Dermatol Venereol 27(2): 254-257.
Thiboutot D (2004) Regulation of human sebaceous glands. J Invest Dermatol 123(1): 1-12. Thiboutot D, Gilliland K, Light J & Lookingbill D (1999) Androgen metabolism in
sebaceous glands from subjects with and without acne. Arch Dermatol 135(9): 1041-1045.
Tian LM, Xie HF, Yang T, Hu YH, Li J & Wang WZ (2010) Association study of tumor necrosis factor receptor type 2 M196R and toll-like receptor 2 Arg753Gln polymorphisms with acne vulgaris in a Chinese Han ethnic group. Dermatology 221(3): 276-284.
Tiilikainen A, Lassus A, Karvonen J, Vartiainen P & Julin M (1980) Psoriasis and HLA-Cw6. Br J Dermatol 102(2): 179-184.
Till AE, Goulden V, Cunliffe WJ & Holland KT (2000) The cutaneous microflora of adolescent, persistent and late-onset acne patients does not differ. Br J Dermatol 142(5): 885-892.
Tomida S, Nguyen L, Chiu BH, Liu J, Sodergren E, Weinstock GM & Li H (2013) Pan-genome and comparative genome analyses of propionibacterium acnes reveal its genomic diversity in the healthy and diseased human skin microbiome. MBio 4(3): e00003-13.
Toyoda M & Morohashi M (2001) Pathogenesis of acne. Med Electron Microsc 34(1): 29-40.
Toyoda M, Nakamura M, Makino T, Kagoura M & Morohashi M (2002) Sebaceous glands in acne patients express high levels of neutral endopeptidase. Exp Dermatol 11(3): 241-247.
Trivedi NR, Cong Z, Nelson AM, Albert AJ, Rosamilia LL, Sivarajah S, Gilliland KL, Liu W, Mauger DT, Gabbay RA & Thiboutot DM (2006a) Peroxisome proliferator-activated receptors increase human sebum production. J Invest Dermatol 126(9): 2002-2009.
Trivedi NR, Gilliland KL, Zhao W, Liu W & Thiboutot DM (2006b) Gene array expression profiling in acne lesions reveals marked upregulation of genes involved in inflammation and matrix remodeling. J Invest Dermatol 126(5): 1071-1079.
Väyrynen JP, Vornanen JO, Sajanti S, Bohm JP, Tuomisto A & Mäkinen MJ (2012) An improved image analysis method for cell counting lends credibility to the prognostic significance of T cells in colorectal cancer. Virchows Arch 460(5): 455-465.
92
Voskoboinik I, Whisstock JC & Trapani JA (2015) Perforin and granzymes: function, dysfunction and human pathology. Nat Rev Immunol 15(6): 388-400.
Vowels BR, Yang S & Leyden JJ (1995) Induction of proinflammatory cytokines by a soluble factor of Propionibacterium acnes: implications for chronic inflammatory acne. Infect Immun 63(8): 3158-3165.
Walsh TR, Efthimiou J & Dreno B (2016) Systematic review of antibiotic resistance in acne: an increasing topical and oral threat. Lancet Infect Dis 16(3): e23-33.
Watt FM (2002) Role of integrins in regulating epidermal adhesion, growth and differentiation. EMBO J 21(15): 3919-3926.
Webster GF, Indrisano JP & Leyden JJ (1985) Antibody titers to Propionibacterium acnes cell wall carbohydrate in nodulocystic acne patients. J Invest Dermatol 84(6): 496-500.
Webster GF, Leyden JJ & Nilsson UR (1979) Complement activation in acne vulgaris: consumption of complement by comedones. Infect Immun 26(1): 183-186.
Wei B, Pang Y, Zhu H, Qu L, Xiao T, Wei HC, Chen HD & He CD (2010) The epidemiology of adolescent acne in North East China. J Eur Acad Dermatol Venereol 24(8): 953-957.
Williams HC, Dellavalle RP & Garner S (2012) Acne vulgaris. Lancet 379(9813): 361-372. Wojtal KA, Wolfram L, Frey-Wagner I, Lang S, Scharl M, Vavricka SR & Rogler G (2013)
The effects of vitamin A on cells of innate immunity in vitro. Toxicol In Vitro 27(5): 1525-1532.
Wozel G, Chang A, Zultak M, Czarnetzki BM, Happle R, Barth J & van de Kerkhof PC (1991) The effect of topical retinoids on the leukotriene-B4-induced migration of polymorphonuclear leukocytes into human skin. Arch Dermatol Res 283(3): 158-161.
Xiao S, Jin H, Korn T, Liu SM, Oukka M, Lim B & Kuchroo VK (2008) Retinoic acid increases Foxp3+ regulatory T cells and inhibits development of Th17 cells by enhancing TGF-beta-driven Smad3 signaling and inhibiting IL-6 and IL-23 receptor expression. J Immunol 181(4): 2277-2284.
Yamasaki K, Di Nardo A, Bardan A, Murakami M, Ohtake T, Coda A, Dorschner RA, Bonnart C, Descargues P, Hovnanian A, Morhenn VB & Gallo RL (2007) Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nat Med 13(8): 975-980.
Yamasaki K, Schauber J, Coda A, Lin H, Dorschner RA, Schechter NM, Bonnart C, Descargues P, Hovnanian A & Gallo RL (2006) Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin. FASEB J 20(12): 2068-2080.
Yang J, Goetz D, Li JY, Wang W, Mori K, Setlik D, Du T, Erdjument-Bromage H, Tempst P, Strong R & Barasch J (2002) An iron delivery pathway mediated by a lipocalin. Mol Cell 10(5): 1045-1056.
Yang JK, Wu WJ, Qi J, He L & Zhang YP (2014) TNF-308 G/A polymorphism and risk of acne vulgaris: a meta-analysis. PLoS One 9(2): e87806.
Yang Z, Yu H, Cheng B, Tang W, Dong Y, Xiao C & He L (2009) Relationship between the CAG repeat polymorphism in the androgen receptor gene and acne in the Han ethnic group. Dermatology 218(4): 302-306.
Yilmaz SB, Cicek N, Coskun M, Yegin O & Alpsoy E (2012) Serum and tissue levels of IL-17 in different clinical subtypes of psoriasis. Arch Dermatol Res 304(6): 465-469.
93
Youn SW, Park ES, Lee DH, Huh CH & Park KC (2005) Does facial sebum excretion really affect the development of acne? Br J Dermatol 153(5): 919-924.
Younis S & Javed Q (2014) The interleukin-6 and interleukin-1A gene promoter polymorphism is associated with the pathogenesis of acne vulgaris. Arch Dermatol Res .
Zaba R, Schwartz R, Jarmuda S, Czarnecka-Operacz M & Silny W (2011) Acne fulminans: explosive systemic form of acne. J Eur Acad Dermatol Venereol 25(5): 501-507.
Zaenglein AL, Pathy AL, Schlosser BJ, Alikhan A, Baldwin HE, Berson DS, Bowe WP, Graber EM, Harper JC, Kang S, Keri JE, Leyden JJ, Reynolds RV, Silverberg NB, Stein Gold LF, Tollefson MM, Weiss JS, Dolan NC, Sagan AA, Stern M, Boyer KM & Bhushan R (2016) Guidelines of care for the management of acne vulgaris. J Am Acad Dermatol 74(5): 945-973.e33.
Zaenglein AL & Thiboutot DM (2012) Acne vulgaris. In: Bolognia JL, Jorizzo JL & Schaffer JF (eds) Dermatology. , Elsevier Limited: 545-560.
Zeeuwen PL, Kleerebezem M, Timmerman HM & Schalkwijk J (2013) Microbiome and skin diseases. Curr Opin Allergy Clin Immunol 13(5): 514-520.
Zhang M, Qureshi AA, Hunter DJ & Han J (2014) A genome-wide association study of severe teenage acne in European Americans. Hum Genet 133(3): 259-264.
Zhou X, Tang J, Cao H, Fan H & Li B (2015) Tissue resident regulatory T cells: novel therapeutic targets for human disease. Cell Mol Immunol 12(5): 543-552.
Zhu J & Paul WE (2010) Heterogeneity and plasticity of T helper cells. Cell Res 20(1): 4-12.
Zouboulis CC, Eady A, Philpott M, Goldsmith LA, Orfanos C, Cunliffe WC & Rosenfield R (2005) What is the pathogenesis of acne? Exp Dermatol 14(2): 143-152.
Zouboulis CC, Jourdan E & Picardo M (2013) Acne is an inflammatory disease and alterations of sebum composition initiate acne lesions. J Eur Acad Dermatol Venereol .
94
95
Original publications
I Kelhälä HL, Palatsi R, Fyhrquist N, Lehtimäki S, Väyrynen JP, Kallioinen M, Kubin ME, Greco D, Tasanen K, Alenius H, Bertino B, Carlavan I, Mehul B, Déret S, Reiniche P, Martel P, Marty C, Blume-Peytavi U, Voegel JJ & Lauerma A. (2014) IL-17/Th17 pathway is activated in acne lesions. PLoS One 9(8): e105238.
II Kelhälä HL, Fyhrquist N, Palatsi R, Lehtimäki S, Väyrynen JP, Kubin ME, Kallioinen M, Alenius H, Tasanen K & Lauerma A. (2016) Isotretinoin treatment reduces acne lesions but not directly lesional acne inflammation. Exp Dermatol 25(6):477-8.
III Kelhälä HL, Aho VTE, Fyhrquist N, Pereira PAB, Kubin ME, Paulin L, Palatsi R, Auvinen P, Tasanen K & Lauerma A. Effects of isotretinoin and lymecycline treatments on acne skin microbiome. Manuscript.
Reprinted with permission from John Wiley and Sons (II).
Original publications are not included in the electronic version of the dissertation.
96
A C T A U N I V E R S I T A T I S O U L U E N S I S
Book orders:Granum: Virtual book storehttp://granum.uta.fi/granum/
S E R I E S D M E D I C A
1368. Krökki, Olga (2016) Multiple sclerosis in Northern Finland : epidemiologicalcharacteristics and comorbidities
1369. Mosorin, Matti-Aleksi (2016) Prognostic impact of preoperative andpostoperative critical conditions on the outcome of coronary artery bypasssurgery
1370. Pelkonen, Sari (2016) Frozen embryo transfer : early pregnancy, perinataloutcomes, and health of singleton children
1371. Pohjanen, Vesa-Matti (2016) Toll-like receptor 4 and interleukin 6 genepolymorphisms in Helicobacter pylori related diseases
1372. Hekkala, Anne (2016) Ketoacidosis at diagnosis of type 1 diabetes in childrenunder 15 years of age
1373. Kujanpää, Tero (2016) Generalized anxiety disorder and health care utilization
1374. Hintsala, Hanna-Riikka (2016) Oxidative stress and cell adhesion in skin cancer
1375. Lehtonen, Ville (2016) Dental and otologic problems in cleft lip and palatepatients from Northern Finland : cleft associated problems
1376. Koivukangas, Jenni (2016) Brain white matter structure, body mass index andphysical activity in individuals at risk for psychosis : The Northern Finland BirthCohort 1986 Study
1377. Väyrynen, Sara (2016) Histological and molecular features of serrated colorectaladenocarcinoma and its precursor lesions
1378. Kujanpää, Kirsi (2016) Mechanisms behind stem cell therapy in acute myocardialinfarction
1379. Törmälä, Reeta-Maria (2016) Human zona pellucida abnormalities – a geneticapproach to the understanding of fertilization failure
1380. Pinola, Pekka (2016) Hyperandrogenism, menstrual irregularities and polycysticovary syndrome : impact on female reproductive and metabolic health from earlyadulthood until menopause
1381. Haghighi Poodeh, Saeid (2016) Novel pathomechanisms of intrauterine growthrestriction in fetal alcohol syndrome in a mouse model
1382. Helminen, Olli (2016) Glucose metabolism in preclinical type 1 diabetes
1383. Raatiniemi, Lasse (2016) Major trauma in Northern Finland
UNIVERSITY OF OULU P .O. Box 8000 F I -90014 UNIVERSITY OF OULU FINLAND
A C T A U N I V E R S I T A T I S O U L U E N S I S
Professor Esa Hohtola
University Lecturer Santeri Palviainen
Postdoctoral research fellow Sanna Taskila
Professor Olli Vuolteenaho
University Lecturer Veli-Matti Ulvinen
Director Sinikka Eskelinen
Professor Jari Juga
University Lecturer Anu Soikkeli
Professor Olli Vuolteenaho
Publications Editor Kirsti Nurkkala
ISBN 978-952-62-1340-8 (Paperback)ISBN 978-952-62-1341-5 (PDF)ISSN 0355-3221 (Print)ISSN 1796-2234 (Online)
U N I V E R S I TAT I S O U L U E N S I S
MEDICA
ACTAD
D 1385
ACTA
Hanna-Leena K
elhälä
OULU 2016
D 1385
Hanna-Leena Kelhälä
THE EFFECT OF SYSTEMIC TREATMENT ON IMMUNE RESPONSES AND SKIN MICROBIOTA IN ACNE
UNIVERSITY OF OULU GRADUATE SCHOOL;UNIVERSITY OF OULU,FACULTY OF MEDICINE