Original Article Imbalance of Th1/Th2 and Th17/Treg promoting … · 2018. 8. 31. · 24 th week. Both of Th1/Th2 and Th17/Treg ratios were distributed as a bimodal pattern with peaks

Int J Clin Exp Med 2017;10(10):14290-14300www.ijcem.com /ISSN:1940-5901/IJCEM0054767

Original Article Imbalance of Th1/Th2 and Th17/Treg promoting schistosome egg granuloma formation

Shanshan Chen1,2*, Yongqiang Gao1,2,3*, Yu Liang1,2, Li Hu1,2,3, Jun Liu1,2, Li Peng1,2, Angui Feng1,2, Jianhua Xiao1,2,3

1Institute of Pathogenic Biology, Medical College, University of South China, Hengyang, China; 2Hunan Provincial Key Laboratory for Special Pathogens Prevention and Control, Hengyang, China; 3Hunan Province Cooperative Innovation Center for Molecular Target New Drug Study, Hengyang, China. *Equal contributors.

Received April 6, 2017; Accepted September 4, 2017; Epub October 15, 2017; Published October 30, 2017

Abstract: Objective: This research aimed to reveal the correlation between the liver pathology of schistosome egg granuloma and CD4+ T cell subsets through analyzing the dynamic changes of CD4+ T cell subset (Th1/Th2 and Th17/Treg) and their related cytokines. Methods: The BalB/c mice were infected with schistosoma japonicum cer-cariae to construct a model of schistosomiasis japonica. The blood samples and liver tissues were harvested at the 4th, 6th, 8th, 10th, 12th, 16th, 20th and 24th week, respectively. Flow cytometry (FCM) was conducted to evaluate the proportion of CD4+ T cell subsets including Th1, Th2, Th17 and Treg. Enzyme-linked immunosorbent assay (ELISA) was performed to assess the serum level of cytokines including IL-2, IFN-γ, IL-4, IL-10, IL-17, IL-23, IL-6, TGF-β and IL-1β; while the quantitative real-time PCR (qRT-PCR) was carried out to investigate the mRNA level of these cytokines in liver tissues. Finally, Haematoxylin and eosin (HE) staining and Masson staining were performed to assess the pathological characteristics of the liver. Results: Histopathological evaluation of liver in infected mice showed the dynamic changes of pathological features, such as inflammatory cell infiltration, schistosome egg granuloma forma-tion, liquefactive necrosis of eggs and eventually a lot of cavities formation. Masson staining also demonstrated that the collagen deposition increased before the 12th week, ultimately developed into hepatic fibrosis from the 16th to 24th week. Both of Th1/Th2 and Th17/Treg ratios were distributed as a bimodal pattern with peaks at the 4th and 16th week. At the same time, the levels of CD4+ T cell related nuclear transcription factors and cytokines showed similar dynamic changes as the percentages of T cell subsets. Conclusion: The imbalance of Th1/Th2 and Th17/Treg were closely related to the schistosome egg granuloma formation. The imbalance of CD4+ T cell subsets maybe play an important role in the schistosome egg granuloma formation.

Keywords: CD4+ T cell, Th1/Th2, Th17/Treg, schistosoma japonicum, egg granuloma

Introduction

Schistosomiasis is a severe zoonotic parasitic disease accompanied with immunological ab- normalities. As we know, the adult worms para-sitize in hepatic portal vein and mesenteric vein of the host, where the female worms release eggs lodging within sinusoids or intestinal tis-sues. The miracidia in eggs secret soluble egg antigen (SEA), which induces T cell mediated pathologic immune response, lead to the for-mation of egg granuloma and secondary fibro-sis in liver and intestine [1, 2].

T helper cells (Th cells), which include some subsets such as Th1, Th2, Th17, Treg cell and Tfh, play essential roles in schistosome egg granuloma formation. Generally, Th1/Th2 cells

and Th17/Treg cells keep dynamic balance and regulate the normal immune response [3, 4]. However, once the balance is upset, it will lead to pathological immune response and correlat-ed tissue damages. Th1 cells mainly secrete cytokines including IL-2, IFN-γ and IL-12, while Th2 cells secrete cytokines including IL-4, IL-5, IL-10 and IL-13 [5, 6]. In a mouse model of schistosome infection, both of Th1- and Th2- type immune responses and mutual regulatory mechanisms play important roles in maintain-ing immune homeostasis [7, 8].

However, the simple Th1- or Th2-type immune response is not enough to explain the excessive production of inflammatory cytokines and quick pathological development which is from acute inflammation to fibrosis in liver and intestine, at

http://www.ijcem.com

Imbalance of Th1/Th2 and Th17/Treg in schistosomiasis japonica

14291 Int J Clin Exp Med 2017;10(10):14290-14300

last, the pathological damages are represented as stellate cell proliferation and collagen depo-sition. On the other hand, Th17 and Treg cells have many obviously difference in differentia-tion and regulation mechanism. Th17 cells are derived from the naive Th cells induced by low concentrations of TGF-β and IL-6, while the Treg cells originate from the naive Th cells induced by high level of TGF-β. Th17 cells have protec-tive functions by secreting cytokines of IL-17 and IL-22, whereas the Treg cells play a critical role in immunosuppression through producing cytokines of IL-10 and TGF-β [9-12]. Normally, the balance of Th17/Treg is crucial to the main-tenance of immune homeostasis. Previous studies demonstrate that Th17/Treg imbalance plays an important role in the development of inflammatory diseases, autoimmune diseases and many other diseases.

In our study, we constructed a mouse model of schistosomiasis japonica to explore the dynamic changes of CD4+ T cell subsets and its influence on schistosome egg granuloma formation.

Materials and methods

Animals and treatment

Forty-five BalB/c mice (specific pathogen free-SPF; 6-8 w; 18-22 g) were purchased from Silaike-Jingda (Changsha, China); and thirty oncomelania snails carrying with schistosoma japonicum cercariae (Sj) were purchased from Jiangxi Institute of Parasitic Diseases (Jiangxi, China). All mice were randomly assigned to infected group (n=40) and control group (n=5). The mice in infected group were infected with 25-30 schistosoma japonicum cercariae by contacting their abdominal skin. The samples including orbital venous blood, spleen and liver tissues were harvested from the infected mice after anesthesia at the 4th, 6th, 8th, 10th, 12th, 16th, 20th and 24th week, respectively. The mice in control group were fed with a standard diet without any infection. All animal experiments were performed according to the ethical guide-lines of the University of South China.

Reagents

PerCP-Cy5.5 anti-mouse CD3 antibody, APC anti-mouse CD4 antibody, APC anti-mouse IL-4 antibody, FITC anti-mouse IFN-γ antibody, Alexa

Fluor 488 anti-mouse/Rat Foxp3 antibody, PE anti-mouse CD25 antibody, PE anti-mouse IL-17F antibody, FITC anti-mouse IL-17A anti-body, and ELISA kit for mouse IL-2, IFN-γ, IL-4, IL-10, IL-6, IL-23, IL-17, TGF-β, and IL-1β were acquired from eBioscience Inc. (San Diego, CA, USA). Hyaluronidase (Type V), DNase I, Collage- nase IV, and Collagenase I were bought from Sigma Co. LLC. (St Louis, MO, USA). Reverse transcription kit was purchased from Takara biotechnology (Dalian) Co., Ltd. (China). RT-PCR Kit was purchased from Shanghai Yanhuibiotech Co., Ltd. (China). Erythrocyte lysis solution was purchased from Tiangen Biotech (Beijing) Co., Ltd. (China). Foxp3 Fix/Prem buffer was pur-chased from Biolegend Inc. (San Diego, CA, USA). RPMI-1640 was purchased from Gibco BRL Co., Ltd. (Gland Island, NY, USA). Fetal bovine serum (FBS) was purchased from Hangzhou Sijiqing Bioengineering Material Co., Ltd. (China).

Histopathological analysis

The fresh specimens of liver tissue were obtained and fixed in 10% neutral formalin, fol-lowed by routine paraffin-embedding. The sec-tions (5 μm) were examined histologically by hematoxylin and eosin (H&E) and Trichrome -masson staining.

The preparation of single cell suspension

The single cell suspension of mouse’s liver and spleen lymphocytes were prepared by Ficoll-Hypaque density-gradient centrifugation. At first, liver or spleen tissues were homogenized with DMEM (2% FBS, 1% PS) and filtered by the nylon mesh screen (70 μm) with DMEM (2% FBS, 1% PS). The filtered solution was collected in a tube and centrifuged at 500 g for 5 mins. The supernatant was discarded. The precipi-tate was re-suspended in 1 mL enzyme mixture (Hyaluronidase V, DNase I, Collagenase IV, and Collagenase I) and 2 mL DMEM and incubated for 40 mins. Then 3 mL DMEM was added into it and incubated for 5 mins. The supernatant was pipetted into a centrifuge tube (50 mL) and centrifuged at 500 g for 5 mins. The precipitate was washed with 20 mL phosphate-buffered saline (PBS) twice, and then re-suspended with PBS to 20 mL. The cell suspension was slowly inflowed on the surface over the 50 mL Ficoll-Hypaque solution and centrifuged for 30 mins at 400 g with no brake. The mononuclear cells


14292 Int J Clin Exp Med 2017;10(10):14290-14300

located at the interface between the cell sus-pension (upper layer) and the Ficoll-Hypaque (bottom layer) were carefully removed into another centrifuge tube (50 mL). The mononu-clear cells were then diluted with PBS to 15 mL and centrifuged at 400 g for 7 mins. Finally, the mononuclear cells were resuspended in stain-ing buffer and adjusted to the density of 1×106/mL.

Flow cytometric analysis

For detection of Th1 and Th2 cells, 100 µL sin-gle cell suspension was added with 1 μL PerCP-Cy5.5-CD3 and 1 μL PE-CD4 and incubated for 15 mins without light, then added with 2 mL PBS and centrifuged at 100 g for 5 mins. After fixation and permeabilization with 1 mL 1×Fix-Perm buffer and 1 mL 1×Perm buffer for 30 mins, respectively, the cell suspension was centrifuged at 100 g for 5 mins. The superna-

tant was discarded and the precipitate of cells was resuspended and added with 1 μL APC-IL-4 and 1 μL FITC-IFN-γ antibodies, followed by incubation for 15 mins. The cells were washed again with 1 ml 1×Perm buffer and centrifuged at 100 g for 5 mins. Finally, the supernatant was discarded and the remained 100 μL stained cells were analyzed immediately using a Flow Cytometer (BD FACS Calibur). For detec-tion of Th17 cells, the antibodies were 1 μL PerCP-Cy5.5-CD3, 1 μL APC-CD4, 0.5 μL FITC-IL-17A, and 1 μL PE-IL-17F; while for detection of Treg, the antibodies were 1 μL APC-CD4, 1 μL PE-CD25, and 0.5 μL Alexa Floure 488-Foxp3. The flow cytometric analysis to Th17 and Treg cells were as the same as the above-mentioned method.

Quantitative real-time PCR (qRT-PCR)

The mRNA levels of related cytokines of T cell subsets, such as IL-2, IFN-γ, IL-12, IL-4, IL-10, IL-6, IL-23, IL-17, ROR-γt, Foxp3, TGF-β and IL-1β, were detected by the fluorescence quan-titative RT-PCR (SYBR Green), the internal con-trol was GAPDH. Firstly, the total RNA was extracted from liver tissue by Trizol (Invitrogen, USA) method. Secondly, the cDNA products were synthesized from 2 μg total RNA through using M-MLV Reverse Transcription Kit (Takara, Japan). The reverse transcription was per-formed in a 20 μL reaction volume and the reaction conditions were set as the follow: 25°C for 10 mins, 37°C for 120 mins, 85°C for 5 mins, and the reaction was terminated at 4°C. The cDNA products were stored at -20°C.

The primers for qRT-PCR were designed by the PRIMER software package (Clarke and Warwick, 1994) (Table 1), based on the cDNA sequence of cytokines in GenBank. All the procedures were performed by Invitrogen (Carlsbad, CA, USA). The qRT-PCR amplification (SYBR Green) was carried out by a SYBR Premix Ex TaqTM II kit (Takara, Dalian, China) with application to an ABI 7900HT Fast Real-Time PCR System instru-ment (Applied Biosystems).

Enzyme-linked immunosorbent assay

The serum samples were collected from the infected and normal mice and the levels of cytokines were detected through ELISA kit, according to manufacturer’s instructions.

Table 1. The Primers used for Real-time PCR analysisGene Primer Sequence (5’-3’)GAPDH Sense TGGAGAAACCTGCCAAGTATGA

Antisense CTGTTGAAGTCGCAGGAGACAAIL-1β Sense CAACCAACAAGTGATATTCTCCATG

Antisense GATCCACACTCTCCAGCTGCAIL-2 Sense GGAGCAGCTGTTGATGGACCTA

Antisense GCCTGCTTGGGCAAGTAAAAIL-4 Sense CATGGAGCTGCAGAGACTCTTTC

Antisense TGCATGATGCTCTTTAGGCTTTCIL-6 Sense AGATAAGCTGGAGTCACAGAAGGAG

Antisense CGCACTAGGTTTGCCGAG TAGIL-10 Sense ATTTGAATTCCCTGGGTGAGAAG

Antisense CACAGGGGAGAAATCGATGACAIL-12 Sense CACCCTTGCCCTCCTAAAC

Antisense CACCTGGCAGGTCCAGAGIL-17 Sense CCAGGGAGAGCTTCATCTGTGT

Antisense AAGTCCTTGGCCTCAGTGTTTGIL-23 Sense CACCAGCGGGACATATGAATCTA

Antisense CAGAACTGGCTGTTGTCCTTGAFoxp3 Sense ATGCGACCCCCTTTCACCTAC

Antisense TGGCGGATGGCGTTCTTCROR-γt Sense GCCTACAATGCCAACAACCACACA

Antisense ATTGATGAGAACCAGGGCCGTGTATGF-β Sense TGATACGCCTGAGTGGCTGTCT

Antisense TTTGCTGTCACAAGAGCAGTGAINF-γ Sense GGCACAGTCATTGAAAGCCTAGA

Antisense GTCACCATCCTTTTGCCAGTTC


14293 Int J Clin Exp Med 2017;10(10):14290-14300

Statistical analysis

Statistical analyses were performed by using Graphpad Prism 5.0 software package (Graph- Pad Software Inc., CA, USA). The continuous data were presented as mean ± SD. One-way analysis of variance was used to assess the dif-ferences between the infected mice group and the control mice group. Values of P < 0.05 were considered as statistically significant.

Results

Pathological changes of liver in infected mice

HE staining was performed to characterize the pathological changes of liver tissues in control group and infected group. In control group, there was normal liver lobule structure without inflammatory cell infiltration; the normal liver cells were polygonal and arranged densely, without deformation or necrosis; the sinusoids

were identical in shape (Figure 1A). In infected group, when the mice were at the 4th week, there were excessive infiltrations of inflamma-tory cells; whereas the hepatocytes and sinu-soids were normal (Figure 1B). At the 6th week and the 8th week, there were schistosome egg granuloma formation and inflammatory cell infiltration in liver tissues, companied with dis-torted liver cells (Figure 1C and 1D). At the 10th week and the 12th week, there were abundant formation of schistosome egg granuloma, inflammatory cells infiltration, and deformation of liver cells (Figure 1E and 1F) in liver tissue. At the 16th week, in addition to the previous pathological changes, hepatocytes deformation and necrosis were also observed (Figure 1G). At the 20th week, there were liquefactive necro-sis of egg nodules and massive necrosis of hepatocytes (Figure 1H). Finally, at the 24th week, besides the hepatocyte necrosis, there were abundant cavities appeared owing to liq-

Figure 1. HE staining for the pathological features of mouse liver tissue. A: Normal mice group (0 week). B: Mice infected by schistosoma japonicum (Sj) at the 4th week. C: Infected mice at the 6th week. D: Infected mice at the 8th week. E: Infected mice at the 10th week. F: Infected mice at the 12th week. G: Infected mice at the 16th week. H: Infected mice at the 20th week. I: Infected mice at the 24th week. Bar=100 μm.


14294 Int J Clin Exp Med 2017;10(10):14290-14300

uefactive necrosis of egg nodules (Figure 1I). These results demonstrated that the feature of liver pathological change from the 6th to the 12th week was the formation of schistosome egg granuloma companied with the infiltration of inflammatory cells in schistosome infected mice model.

Masson staining for hepatic fibrosis

Masson staining was carried out to evaluate the pathological characteristics of hepatic fibrosis in infected mice. In control group, there was relatively little collagen deposition in liver tissues and it was mainly in the wall of blood vessel, no collagen deposition was among the hepatocytes and sinusoids (Figure 2A). How- ever, when the infected mice were at the 4th week (Figure 2B) and the 6th week (Figure 2C) after schistosome infection, collagen deposi-tion increased especially in the hepatic portal

area and the central vein wall of hepatic lob-ules. From the 8th to the 12th week, the infected mice continued the pathological changes as in the preceding weeks, the collagen deposition was obviously increased in hepatic tissues (Figure 2D-F). At the 16th week, a thick fibrous scar was gradually formed around the collagen deposition part and began to develop into hepatic fibrosis (Figure 2G). Then, from the 20th to 24th week, there were continuous fibrous scar formation and hepatic fibrosis (Figure 2H and 2I). These results revealed that the liver fibrosis was the main pathological changes of schistosome infected mice from the 16th to 24th week.

Percentage of Th1 and Th2 subsets and changes of Th1/Th2 ratio

The CD4+ T cells in hepatic and splenic tissue were stained by various combinations of anti-

Figure 2. Masson staining for the pathological features of liver fibrosis. A: Normal mice group (0 week). B: Mice infected by schistosoma japonicum (Sj) at the 4th week. C: Infected mice at the 6th week. D: Infected mice at the 8th week. E: Infected mice at the 10th week. F: Infected mice at the 12th week. G: Infected mice at the 16th week. H: Infected mice at the 20th week. I: Infected mice at the 24th week. Bar=100 μm.


14295 Int J Clin Exp Med 2017;10(10):14290-14300

bodies of flow cytometry to detected the Th1 and Th2 subsets. The percentage of Th1 and Th2 cells were significantly higher in the liver

(Figure 3A) and spleen (Figure 3B) of the infect-ed mice group than in the control group (P < 0.05). At the 4th week, there were a highest pro-

Figure 3. FCM analysis for Th1 and Th2 cells in the liver and spleen tissues of the schistosomiasis mice. A: FCM chart and histogram showing the dynamic percentage changes of Th1 (CD3+CD4+IFN-γ+) and Th2 (CD3+CD4+IL-4+) cells in the liver tissues of the schistosomiasis mice at different time. B: FCM chart and histogram showing the dynamic percentage chang-es of Th1 (CD3+CD4+ IFN-γ+) and Th2 (CD3+CD4+IL-4+) cells in the spleen tissues of the schistosomiasis mice at different time. C: The dynamic changes of Th1/Th2 ratio in liver and spleen tissues of the schistosomiasis mice at different time. The normal mice at 0 week are the control group; compared with the control, *P < 0.05. **P < 0.01.


14296 Int J Clin Exp Med 2017;10(10):14290-14300

portion of Th1 cells and a rise of Th1/Th2 ratio in hepatic and splenic tissue of schistosomia-sis mice (Figure 3C). However, from the 6th to 12th week, the percentage of Th2 cells increased more than Th1 cells and caused a reverse of Th1/Th2 ratio in hepatic and splenic tissue, the two indexes were up to the maximum val-ues at the 8th week. Then from the 16th to 24th week, the percentage of Th1 cells increased more than Th2 cells and Th1/Th2 ratio recov-ered close to normal value. These results sug-gest that a large increase in Th2 cells and the immune responses mediated by Th2 cells from

the 6th to 12th week played an important role mediated immune responses occupied the main position in the pathological phase chang-es of schistosome egg granuloma formation and inflammatory cell infiltration.

Percentage of Th17 and Treg subsets and changes of Th17/Treg ratio

At the same time, the dynamic changes of Th17 and Treg subsets and the ratio of Th17/Treg were detected by Flow cytometry. Similarly, the percentage of Th17 and Treg cells in the liver

Figure 4. FCM analysis for Th17 (CD3+CD4+CD17A+ or CD3+CD4+ CD17F+) and Treg (CD3+CD25+ Foxp3+) cells in the liver and spleen tissues of the schisto-somiasis mice. A: FCM chart and histo-gram showing the dynamic percentage changes of Th17 (CD3+CD4+CD17A+ or CD3+CD4+ CD17F+) and Treg (CD3+CD25+ Foxp3+) cells in the liver tissues of the schistosomiasis mice at different time. B: FCM chart and histogram showing the dynamic percentage changes of Th17 (CD3+CD4+CD17A+ or CD3+CD4+ CD17F+) and Treg (CD3+CD25+ Foxp3+) cells in the spleen tissues of the schistosomiasis mice at different time. C: The dynamic changes of Th17/Treg ratio in liver and spleen tissues of the schistosomiasis mice at different time. The normal mice at 0 week are the control group; compared with the control, *P < 0.05. **P < 0.01.


14297 Int J Clin Exp Med 2017;10(10):14290-14300

(Figure 4A) and spleen (Figure 4B) was signifi-cantly higher in the infected mice group than in the control group (P < 0.05), and the percent-age of Th17 cells appeared two peak values at the 8th week and the 16th week. As it shown in Figure 4C, an imbalance of the ratio of Th17/Treg cells existed in infected mice. The ratio inversion of Th17/Treg cells reached the maxi-mum value at the 16th week and then gradually decreased at the followed weeks. These results demonstrated that the imbalance of Th17/Treg or the rapid increase of Th17 cells from the 12th to 24th week reduced inflammatory response in hepatic and splenic tissues, it was closely relat-ed to the pathomechanism of liver fibrosis.

The mRNA expression of cytokines secreted by CD4+ T cell subsets

qRT-PCR was conducted to evaluate the mRNA expression of cytokines secreted by CD4+ T cell subsets in the infected mice group. Our results demonstrated that, compared with the mice of control group, there was a significant increase about the expression of cytokines associated with T cell subsets, including IL-2, IFN-γ, IL-12, IL-4, IL-10, IL-6, IL-23, IL-17, ROR-γt, Foxp3, TGF-β and IL-1β (P < 0.05) (Figure 5). The mRNA expression level of IL-2, IL-12 and IFN-γ dis-played as bimodal pattern with the peak values at the 4th and 16th week (Figure 5A), whereas the mRNA expression level of other cytokines was up to the maximum values only at the 8th

week after infection (Figure 5B-E). These results showed that the dynamic percentage change of these cytokines associated with CD4+ T cell subsets were highly consistent with the change of related CD4+ T cells subsets.

Antigen levels of cytokines secreted by CD4+ T cell subsets

ELISA was performed to detect the antigen lev-els of cytokines associated with T cell subsets. Our finding revealed that, similar to the mRNA expression, there were a significant increase of cytokine levels in blood plasma of the infected mice group compared with the mice of control group (P < 0.05) (Figure 6), such as IL-2, IFN-γ, IL-4, IL-10, IL-6, IL-23, IL-17, TGF-β and IL-1β. The cytokine levels of IL-2, IL-10 and IFN-γ displayed as bimodal pattern with the peaks at the 4th and 16th week, whereas the cytokine levels of IL-4, IL-6, IL-23, IL-17 and TGF-β were up to the maximum values at the 8th week. The cytokine level of IL-1β also displayed as a bimodal pat-tern with the peaks at the 10th and 16th week (Figure 6). These results showed that the dynamic levels of the above cytokines in blood plasma were highly consistent with the process of schistosome egg granuloma formation and liver fibrosis.

Discussion

On the immunity of schistosome infection, the T cell-mediated immune response plays an im-

Figure 5. The mRNA expression levels of CD4+ T cell subsets related cytokines in liver are detected by qRT-PCR. A: The mRNA expression levels of IL-2, IFN-γ and IL-12. B: The mRNA expression levels of IL-4 and IL-10. C: The mRNA expression levels of IL-23, IL-17, and ROR-γt. D: The mRNA expression levels of Foxp3 and TGF-β. E: The mRNA ex-pression levels of IL-6 and IL-1β. Mice at 0 week are defined as the control; compared with the control, *P < 0.05. **P < 0.01.


14298 Int J Clin Exp Med 2017;10(10):14290-14300

portant role in both of the pathological response and protective immunity. In the mouse model of schistosomiasis, the immune responses medi-ated by Th1 cell has a protective benefit, while the immune responses mediated by Th2 cell has a pathological damage [13]. Meanwhile, T cell-mediated delayed type hypersensitivity also cause the schistosome egg granuloma for-mation and fibrosis in hepatic tissues. In recent years, we found that Th17 and Treg cells are involved in the immune process of schistoso-miasis, and closely related to schistosome egg granuloma and liver fibrosis.

To further investigate the actions of CD4+ T cell subsets and their related cytokines in the for-mation of schistosoma japonicum egg granulo-ma and liver fibrosis, we constructed a schisto-somiasis japonica mice model to check the dynamic changes of CD4+ T cell subsets (includ-ing Th1, Th2, Th17, and Treg cells) and their cytokines, and searched the relevance between these changes and the pathological features of liver. Our results demonstrated that Th1, Th2, Th17 and Treg cells were significantly increased in liver and spleen tissues of schistosomiasis japonica mice. Before the formation of egg granuloma, Th1 cells and its related cytokines significantly increased owing to Th1 type immune response. At the 4th week, there was the highest proportion of Th1 cells and the maximal Th1/Th2 ratio in hepatic and splenic tissues in infected mice; then the Th1 cells decreased from the 6th to the 12th week accom-

panied with the Th2 cells increased and the reversion of Th1/Th2 ratio; however, the per-centage of Th1 cells was significantly increased and Th1/Th2 ratio recovered to normal propor-tion from the 16th to the 24th week. We assumed that, the Th1 type immune response was firstly induced by schistosomula and adult worm at early stages; whereas the premunition and con-comitant immunity was triggered by schisto-some cercariae at later stages. As another proof, the percentage of Th2 cells in hepatic and splenic tissues was significantly increased and an inverse proportion of Th1/Th2 ratio occurred from the 6th to the 12th week. It was proposed that the Th2 type immune response was induced by soluble egg antigen (SEA) [14], the switch of Th1/Th2 type immune response was closely related to the occurrence and development of egg granuloma in mice liver [15-17].

Similarly, there was a significant increase in the percentage of Th17 and Treg cells in the hepat-ic and splenic tissues in infected mice. We found that there was a highest proportion of Treg cells at the 8th week and two peaks of per-centage of Th17 cells at the 8th and 16th week, and the inverse of Th17/Treg ratio was up to the maximum value at the 16th week and continue the trend till to the 24th week. Based on the pre-vious studies [18-20], we speculated that the phenomenon of two maximum values of Th17 cells was correlated with the level of IL-23. At the 8th week, the proliferative Th17 cells secret-

Figure 6. The plasma levels of related cytokines of the schistosomiasis mice are detected by ELISA. A: The plasma levels of IL-2 and IFN-γ. B: The plasma levels of IL-4 and IL-10. C: The plasma levels of IL-17 and IL-23. D: The plasma levels of TGF-β. E: The plasma levels of IL-6 and IL-1β. Mice at 0 week are defined as the control; compared with the control, *P < 0.05. **P < 0.01.


14299 Int J Clin Exp Med 2017;10(10):14290-14300

ed excessive IL-17 which was induced by high levels of IL-23; at the 16th week, the level of IL-17 was significantly influenced by the de- crease of IL-23, so it leaded to a compensatory increase of Th17 cell proliferation.

In addition, the dynamic changes of the per-centage of Treg cells were approximately nor-mal distributed and reached a peak value at the 8th week, which may be due to the intense immune response stimulated by SEA; mean-while, the proliferation of Treg cells were mobi-lized to suppress the excessive immune response for reducing the pathological damage. However, in the period of liver fibrosis after the 16th week, the major immuno-modulatory mechanism was given priority to the immune response mediated by Th17 cells [20, 21].

Finally, we tested the mRNA levels of CD4+ T cell related nuclear transcription factors in liver of schistosomiasis mice and the plasma cyto-kine levels. The results showed that the mRNA levels of IL-2, IL-12 and IFN-γ distributed as a bimodal pattern with the peaks at the 4th and 16th week, which were consistent with Th1 cell proliferation level; meanwhile, the mRNA levels of IL-4 and IL-10 were up to maximum values at the 8th week, which was correspond with the Th2 cell proliferation level and the progress of liver lesions. Similarly, the mRNA levels of IL-23, IL-17 and ROR-γt distributed as a bimodal pat-tern with the peaks at the 8th and 16th week, which was consistent with the level of Th17 cell proliferation. The mRNA levels of Foxp3 and TGF-β reached a peak value at the 8th week, which was correspond with the level of Treg cell proliferation. Unlike other cytokines, IL-1β and IL-6 levels increased rapidly after the schisto-some infection and respectively reached to their maximum values at the 8th week, 10th week and 16th week, which were also consis-tent with the liver pathological changes in infected mice. This may be due to that macro-phages and neutrophils were recruited to the schistosome eggs by IL-1β and IL-6 and then led to the formation of egg granuloma [22].

In summary, we provided some evidence to prove that the dynamic changes of CD4+ T cell subsets proliferation and imbalance of Th1/Th2 and Th17/Treg were closely related to immuno-pathological damage and egg granu-loma formation of liver in mice model with

schistosomiasis japonica, It promoted the path-ological change of egg granuloma formation effectively.

Acknowledgements

This work was supported by National Natural Science Foundation of China (No.30972576, No.81101274), the Foundation of Hunan Pro- vincial Key Laboratory for Special Pathogens Prevention and Control (No.2014-5), and the Hunan Province Cooperative Innovation Center for Molecular Target New Drug Study (2015- 351).

Disclosure of conflict of interest

None.

Address correspondence to: Dr. Jianhua Xiao, Insti- tute of Pathogenic Biology, Medical College, University of South China, Hengyang 421001, China. Tel: +86-13974739966; E-mail: [email protected]

References

[1] Wilson MS, Mentink-Kane MM, Pesce JT, Ramalingam TR, Thompson R and Wynn TA. Immunopathology of schistosomiasis. Immun- ol Cell Biol 2007; 85: 148-154.

[2] Chuah C, Jones MK, Burke ML, McManus DP and Gobert GN. Cellular and chemokine-medi-ated regulation in schistosome-induced hepat-ic pathology. Trends Parasitol 2014; 30: 141-150.

[3] Golubovskaya V and Wu L. Different subsets of T Cells, memory, effector functions, and CAR-T immunotherapy. Cancers (Basel) 2016; 8: 36.

[4] Zhang HL, Zheng XY and Zhu J. Th1/Th2/Th17/Treg cytokines in Guillain-Barre syn-drome and experimental autoimmune neuritis. Cytokine Growth Factor Rev 2013; 24: 443-453.

[5] Talaat RM, Mohamed SF, Bassyouni IH and Raouf AA. Th1/Th2/Th17/Treg cytokine imbal-ance in systemic lupus erythematosus (SLE) patients: correlation with disease activity. Cytokine 2015; 72: 146-153.

[6] Raphael I, Nalawade S, Eagar TN and Fors- thuber TG. T cell subsets and their signature cytokines in autoimmune and inflammatory diseases. Cytokine 2015; 74: 5-17.

[7] Stavitsky AB. Regulation of granulomatous in-flammation in experimental models of schisto-somiasis. Infect Immun 2004; 72: 1-12.


14300 Int J Clin Exp Med 2017;10(10):14290-14300

[8] Seki T, Kumagai T, Kwansa-Bentum B, Furu-shima-Shimogawara R, Anyan WK, Miyazawa Y, Iwakura Y and Ohta N. Interleukin-4 (IL-4) and IL-13 suppress excessive neutrophil infiltration and hepatocyte damage during acute murine schistosomiasis japonica. Infect Immun 2012; 80: 159-168.

[9] Wen X, He L, Chi Y, Zhou S, Hoellwarth J, Zhang C, Zhu J, Wu C, Dhesi S, Wang X, Liu F and Su C. Dynamics of Th17 cells and their role in schistosoma japonicum infection in C57BL/6 mice. PLoS Negl Trop Dis 2011; 5: e1399.

[10] Harrington LE, Mangan PR and Weaver CT. Expanding the effector CD4 T-cell repertoire: the Th17 lineage. Curr Opin Immunol 2006; 18: 349-356.

[11] Marwaha AK, Leung NJ, McMurchy AN and Levings MK. TH17 cells in autoimmunity and immunodeficiency: protective or pathogenic? Front Immunol 2012; 3: 129.

[12] Li P, Ji M, Park J, Bunting KD, Ji C and Tse W. Th17 related cytokines in acute myeloid leuke-mia. Front Biosci (Landmark Ed) 2012; 17: 2284-2294.

[13] Fairfax K, Nascimento M, Huang SC, Everts B and Pearce EJ. Th2 responses in schistosomia-sis. Semin Immunopathol 2012; 34: 863-871.

[14] Schramm G and Haas H. Th2 immune re-sponse against schistosoma mansoni infec-tion. Microbes Infect 2010; 12: 881-888.

[15] Wang Y, Cai R, Wang B and Xia CM. [Effect of immune response mediated by ICOS signaling pathway on hepatic fibrosis in mice infected with schistosoma japonicum]. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi 2013; 31: 329-336.

[16] Hou X, Yu F, Man S, Huang D, Zhang Y, Liu M, Ren C and Shen J. Polyinosinic-polycytidylic acid attenuates hepatic fibrosis in C57BL/6 mice with schistosoma japonicum infection. Acta Trop 2012; 121: 99-104.

[17] Schroder WA, Gardner J, Le TT, Duke M, Burke ML, Jones MK, McManus DP and Suhrbier A. SerpinB2 deficiency modulates Th1Th2 re-sponses after schistosome infection. Parasite Immunol 2010; 32: 764-768.

[18] Toussirot E. The IL23/Th17 pathway as a ther-apeutic target in chronic inflammatory diseas-es. Inflamm Allergy Drug Targets 2012; 11: 159-168.

[19] Zhong F, Cui D, Tao H, Du H and Xing C. IL-17A-producing T cells and associated cytokines are involved in the progression of gastric cancer. Oncol Rep 2015; 34: 2365-2374.

[20] Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ and Gurney AL. Interleukin-23 promotes a dis-tinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem 2003; 278: 1910-1914.

[21] Chen D, Luo X, Xie H, Gao Z, Fang H and Huang J. Characteristics of IL-17 induction by schistosoma japonicum infection in C57BL/6 mouse liver. Immunology 2013; 139: 523-532.

[22] Zhang N, Li W and Xiang J. [Dynamic changes of immune responses in BALB/c mice immu-nized with a recombinant Bb(pGEX-Sj14-3-3) vaccine of schistosoma japonicum]. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2013; 29: 685-689.

Documents

Original Article Imbalance of Th1/Th2 and Th17/Treg promoting … · 2018. 8. 31. · 24 th week. Both of Th1/Th2 and Th17/Treg ratios were distributed as a bimodal pattern with peaks