2
Online Genomics & Bioinformatics Training Modules Date Topic Fee (INR) without GST Sequencing Technologies (Lectures/Demo/Hands-On) Module 1 18/05/2020 Introduction to Genomics Complementary Module 2 19/05/2020 Short Read Sequencing Technology: Illumina/IonTorrent 1,000 Module 3 20/05/2020 Short Read Sequencing Technology: Illumina/IonTorrent 1,000 Module 4 21/05/2020 Long Read Sequencing Technology – PacBio and Nanopore 1,000 Bioinformatics (Lectures/Demo/Hands-On) Module 5 22/05/2020 Introduction to Bioinformatics and NGS Data Analysis Complementary for Data Analysis Modules Module 6 23/05/2020 Whole Genome Sequencing (WGS) Analysis 3,000 Module 7 25/05/2020 Transcriptome/RNA Seq Analysis 3,000 Registration Together for Module 2 & 3 Phone No: +91-6364335551 Email: [email protected] ISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After receiving an outstanding response to our first online training Bengaluru Genomics Center happily announces the second online training-cum-workshop by Certified Medical Genomics Laboratory Organizing Secretaries: Fatima Tuz Zehra, Research Scientist Dr Sandeep C Naidu, Research Scientist Bengaluru Genomics Center (BGC) Program Director: Dr. Pruthvi Chakravarthi T, Chief Executive Officer Bengaluru Genomics Center (BGC) Photos: A glimpse of our first on - going online training program 18 th May 25 th May, 2020 Technology Partners and Industry Interaction: Premas Illumina Spinco - PacBio ThermoFisher Scientific - IonTorrent

Online Genomics & Bioinformatics Trainingbgc-genomics.com/BGC_OnlineTraining2_Brochure_2020_Rshd.pdfISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After

  • Upload
    others

  • View
    1

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Online Genomics & Bioinformatics Trainingbgc-genomics.com/BGC_OnlineTraining2_Brochure_2020_Rshd.pdfISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After

Online Genomics & Bioinformatics Training

Modules Date Topic Fee (INR) without

GST

Sequencing Technologies (Lectures/Demo/Hands-On)

Module 1 18/05/2020 Introduction to Genomics Complementary

Module 2 19/05/2020Short Read Sequencing Technology:

Illumina/IonTorrent1,000

Module 3 20/05/2020Short Read Sequencing Technology:

Illumina/IonTorrent1,000

Module 4 21/05/2020Long Read Sequencing Technology –

PacBio and Nanopore1,000

Bioinformatics (Lectures/Demo/Hands-On)

Module 5 22/05/2020Introduction to Bioinformatics and NGS

Data Analysis

Complementary

for Data Analysis

Modules

Module 6 23/05/2020Whole Genome Sequencing (WGS)

Analysis3,000

Module 7 25/05/2020 Transcriptome/RNA Seq Analysis3,000

Registration Together for

Module 2 & 3

Phone No:

+91-6364335551

Email:

[email protected]

ISO 15189:2012

“Bringing the Experts from Genomics and Computer Science”

After receiving an outstanding response to our first online training Bengaluru

Genomics Center happily announces the second online training-cum-workshop

by

Certified Medical Genomics Laboratory

Organizing Secretaries:

• Fatima Tuz Zehra, Research Scientist

• Dr Sandeep C Naidu, Research Scientist

Bengaluru Genomics Center (BGC)

Program Director:

Dr. Pruthvi Chakravarthi T,

Chief Executive Officer

Bengaluru Genomics Center (BGC)

Photos: A glimpse of our first on-going online training program

18th May – 25th May, 2020

Technology Partners and

Industry Interaction:

Premas Illumina

Spinco-PacBio

ThermoFisher

Scientific-IonTorrent

Page 2: Online Genomics & Bioinformatics Trainingbgc-genomics.com/BGC_OnlineTraining2_Brochure_2020_Rshd.pdfISO 15189:2012 “Bringing the Experts from Genomics and Computer Science” After

Theme:

The recent advancements in Genomics and Bioinformatics has

revolutionized the field of life sciences. This has led to the

development of various applications to dissect genome, metagenome,

transcriptome and epigenome of humans, animals, fungi, bacteria and

viruses. Today’s scenario in Life Sciences is that any organism can be

sequenced, either cultivable or non-culturable organisms.

There is an urgent need in the industry and the academia for trained,

skilled and committed human resource. BGC is aimed to train young

minds in the area of Genomics and Bioinformatics.

Genomics and Bioinformatics Training Program is the Brainchild of

Prof. Malali Gowda

Objectives:

1. To train skilled human resources towards rapid advancement in the

area of Genomics and Bioinformatics

2.To ignite Genomics research, education and handle big data analysis

Concluded Training Programs:

BGC-The University of Tran-Disciplinary Health Sciences & Technology (TDU): 15

BGC-Sapthagiri Institute of Medical Sciences and Research Centre (SIMSRC): 3

BGC-Adelbert Innovation Research (Cochin): 2

BGC-SelectBIO (Chandigarh): 1

BGC-TDU-ICRISAT (Crop Genomics): 1

BGC-Sir M Visvesvaraya Institute of Technology (Sir MVIT): 1

BGC-Vellore Institute of Technolog (VIT): 1

BGC-Ramaiah Institute of Technology: 1BGC Online “Genomics and Bioinformatics” Internship-Training-cum-Workshop: 1

Registration Link:

https://forms.gle/QWSSD46ngPwgJ9DQ7

Please send a copy of the transaction ID and your details to

[email protected]

Registration starts from: 30.04.2020 (Limited seats)

No refund for cancellation of registration

Payment Mode NEFT (Online):

Name: Bengaluru Genomics Center Pvt. Ltd.

Bank: State Bank of India

Branch: Sahakari Nagar, Bangalore-560092

Account Number: 35545121471

IFSC Code: SBIN0005191

Address:

P-40/2, 2nd Floor, Ramanashree California Garden,

Ananthapura Main Road, Yelahanka, Bangalore - 560064

Computer Support:

• Participants should have laptop with 2 to 4 GB RAM, 500 GB hard

disk, i5 or i7 core processor and Ubuntu 16 or above operating

system.

• Strong internet connection

• Headphones

• We will install all requirements in the Cloud ID. Participants can

access the cloud even if they have Windows operating system.

Website:

http://www.bgc-genomics.com

Organizing Secretary:Fatima Tuz Zehra

Bengaluru Genomics Center (BGC)

Flow Chart: Workflow of DNA Isolation, NGS and Data Analysis

Data Analysis

Sample collection

(Human)

Genomic DNA extraction

and library preparation

Sequencing using NGS

Platforms

ISO 15189:2012Certified Medical Genomics Laboratory

Why Online?

• Flexible learning through webinar on your laptop

• Experts’ guidance for Genomics, Next Generation Sequencing (NGS)

and Bioinformatics

• Easy to understand e-manual to expand your knowledge

• Boost your CV while staying at home

TargetAudience:

All stream of Medical Sciences, Ayurveda/AYUSH, Dental Science,

Neuroscience, Cardiology, Life Sciences, Agriculture, Animal

Husbandry, Wildlife, Pharmacy, Microbiology, Biochemistry,

Biotechnology, Allied Health Sciences and Computer Science

A Glimpse of our Achievements:

• BGC is affiliated with various institutes to conduct trainings on

Genomics and Bioinformatics.

• BGC has trained >1000 participants from India and abroad

(e.g. Germany, Italy, Thailand & Nepal etc.) since 2017.

• BGC has trained >100 interns across India.

We aim at up-regulating the learning potential, skill-sets and job

credibility of our participants through the transformation and

counselling in the fields of Bioinformatics and Genomics.

“Bringing the Experts from Genomics and Computer Science”

Registration Fee

Indian Participants International Participants

Module No.

Amount per Module (INR)

18% GST Total (INR) Amount per Module (USD)

2 to 4 1,000 180 INR 1,180 150

6 & 7 3,000 540 INR 3,540 200

All modules

9,000 1,620 10,620 850

Program Director:

Dr. Pruthvi Chakravarthi T, CEO, Bengaluru Genomics Center (BGC)

ATGCGGCTATGCTTGCGCGCCGCGCGCGATATATAGGGGCCTTAAGCATGCGGCTATGCTTGCGCGCCGCATAGGGGCCTTAAGATAGGGGCCTTAAGCGCGCGCCGCATAGGGGCCTTA

Participants will receive certificate for every module

Note: We regret that we can not give any technical or internet

connectivity assurance.

Module 1 is complementary for all and Module 5 is

complementary for Bioinformatics modules

Computer Programming

for Biologists

Print(DNA_string)

ATGCATGCGGAATTCCATATAGGCC

DNA_lst=list(DNA_string)DNA_lst.count("G")6GC_count=DNA_lst.count("G")+DNA_lst.count("C")

GC_fraction=float(GC_count)/len(DNA_lst)100*GC_frac

Technology Partners and

Industry Interaction:

Premas Illumina

Spinco-PacBio

ThermoFisher

Scientific-IonTorrent

by

18th May – 25th May, 2020

Email:

[email protected]

Phone No:

+91-6364335551