Oncogenes I and II - Columbia University · 2019-09-11 · Oncogenes I and II Readings for both lectures: The Biology of Cancer (2nd edition, 2014) by Robert A. Weinberg Chapters

Oncogenes I and II

Readings for both lectures:

The Biology of Cancer (2nd edition, 2014)by Robert A. Weinberg

Chapters 3, 4, 10, and 11

Oncogenes I

Organization of today’s lecture

mammalian cell culture

telomere hypothesis

properties of malignantly-transformed cells

retroviruses

mechanisms of retroviral-induced tumorigenesis

Use of cell culture to study the malignant process

advantages: the properties of cells from normal tissues and from tumors

can be compared under controlled conditions.

cells from normal tissues can be experimentally“transformed” into cells with a more malignant phenotype.

in vitro cell transformation can be measured usingquantitative and reproducible assays.

the phenotypic differences between normal cells and theirtransformed counterparts can be correlated with their abilityto form tumors in vivo.

disadvantages: cell culture cannot recapitulate the entire malignant process

Acquired properties of cancer cells

Inappropriate cell proliferation

Inappropriate resistance to cell death

Failure of cellular differentiation

Invasiveness

Metastatic potential

Angiogenic capacity

to culture mammalian cells in vitro: tissue explants are dissociated to single cells (e.g.,

with trypsin) cells are incubated in a petri dish with a sterile

aqueous medium containing: amino acids salts glucose (energy source) serum (growth factors, survival factors, etc.)

cells adhere to the plate, and some may proliferate. “primary culture”

Culturing normal mammalian cells

Passaging cells in vitro

cells are incubated for a defined period. (e.g., 3 days)

the spent medium is removed, and the adhered cellsare dissociated (trypsin).

cells are counted, diluted in fresh media, and re-platedat a specific density (e.g., 3 x 105 cells/plate).

secondary culture “3 times 3” (3T3) passaging cells can be maintained in culture for long periods by

continual passaging.

Cultured fibroblasts If the explant is derived from a complex tissue (e.g.,

skin biopsies) it will contain a mix of epithelial andmesenchymal cells.

Within a few passages, fibroblasts overgrow the culture “cultured fibroblasts”

more immature than tissue fibroblasts often exhibit properties of mesenchymal stem cells; e.g., some

cultured fibroblasts can differentiate in vitro in response tocertain stimuli:

culturedfibroblasts

adipocytes (fat cells)

chondrocytes (cartilage)

myoblasts (muscle)

In vitro culture of epithelial cells

need to remove fibroblasts from the culture physical isolation of epithelial cells

dissection of explantpartial trypsinization of explant

preferential viability of epithelial cellsgrow in a serum-free medium

remember: serum is especially rich in PDGF and FGFs

provide other sources of epithelial growth factors(such as recombinant proteins)

human mammary epithelial cells (HMECs)– surgical discard from reduction mammoplastiesexplant

cut away fatty material digest with collagenase and hyaluronidase collect semi-pure epithelial clumps (“organoids”) on

a 100-mm filter (filtrate contains mainly fibroblasts)

epithelialorganoids

HMEC culture

seed onto a petri dish incubate in serum-free medium supplemented with:

rEGF, insulin, hydrocortisone bovine pituitary extract

adherent vs. non-adherent cells

fibroblasts and epithelial cells are adherent anchorage on a solid substratum is essential for growth adherent cells secrete matrix proteins:

fibronectins, laminins, collagen proper adherence is detected by signal pathways that

report to the central cell cycle regulatory pathways

hematopoietic cells can often grow in suspension in vivo, - blood cells are non-adherent - spleen and bone marrow cells are semi-adherent

Life span of human fibroblasts in culture human fetal fibroblasts undergo “replicative senescence”

or “early crisis” after ~ 60 population doublings (PDs). properties of senescent cells:

cells exist in a state of permanent growth arrest. resembles but distinct from quiescence (the G0 state)

cells are viable and metabolically active. large cytoplasm (“fried egg” appearance). express β-galactosidase (stain blue with Xgal). express the p16INK4a tumor suppressor (Rb pathway). display shortened telomeres. otherwise, senescent cells have a stable genome (diploid).

mortal cell cultures = “cells strains” immortal cells never emerge spontaneously from cultured

strains of human fibroblasts.

Life span of human fibroblasts in culture

the lifespan of a cell strain correlates inverselywith the age of the donor:

fetus 60 PDs40 yrs. 50 PDs80 yrs. 40 PDs


fetal cells

adult (40 yrs.) cells

adult (80 yrs.) cells

time in culture

PDs

60

40

Therefore, the lifespan of a cell strain is not dependentsolely on the number of cell divisions in culture. Instead, it reflects the number of cell divisions both in vivo

and in vitro.

Is there a mechanism that “counts” the number of celldivisions from conception ?


Experimental immortalization ofhuman fibroblast strains

disruption of Rb and p53 tumor suppressor pathways infection with DNA tumor viruses or transfection with the

transforming genes of these viruses: SV40 polyoma virus encodes: large T antigen (targets Rb and p53) adenovirus encodes: E1A protein (targets Rb)

E1B protein (targets p53) human papilloma virus (HPV) encodes: E7 protein (targets Rb)

E6 protein (targets p53)

virally-transformed cells bypass replicative senescence continued proliferation for ~ 20 PDs. cells experience a “genetic catastrophe” (late crisis).

Relevant aspects of genetic catastrophe

during the extended life span, proliferatingcells undergo further telomere erosion

gross genomic instability occurs: chromosome rearrangements aneuploidy (changes in chromosome number)

massive cell death ensues rare immortal variants can emerge…

giving rise to permanent “cell lines”.

early crisis (replicative senescence)

late crisis (genetic catastrophe; apoptotic)

extendedlifespan

time in culture

PDs

Immortalization of human fibroblast

60

80

immortalvariants

Cell lifespan and telomere function

The telomere hypothesis may explain the behavior ofhuman fibroblasts in culture

telomeres: specialized structures at the ends of alllinear chromosome

the functions of telomeres: solve the “end replication problem” of DNA replication. masks chromosome ends from cellular pathways that

recognize and repair double-strand DNA breaks. protect linear chromosomes from illegitimate recombination

(e.g., formation of end-to-end fusions).

End replication problem

5’3’

3’5’

5’

DNA polymerization occurs 5’ 3’ (with respectto the nascent strand).

Leading strand synthesis

5’3’

3’5’

5’

leading strand

lagging strand

leading strand synthesis occurs continuously (5’ 3’) toward replication fork

lagging strand synthesis cannot occur continuously

Lagging strand synthesis

5’3’

3’5’

3’5’

leading strand

lagging strand

lagging strand synthesis occurs discontinuously in short spurts of 5’ 3’ synthesis each spurt is newly primed with an RNA oligonucleotide generates an “Okasaki fragment” of DNA (200-400 bps) as the replication fork progresses, multiple RNA-primed

Okasaki fragments are produced.

Lagging strand synthesis

5’3’

3’5’

3’5’

leading strand

lagging strand

lagging strand synthesis DNA synthesis of new Okasaki fragment displaces the

RNA primer of the previous fragment. RNA primer degraded adjacent Okasaki fragments are ligated together


5’3’

3’5’

3’5’

leading strand

5’3’

3’5’

leading strand synthesis proceeds to end of template DNA


5’3’

3’5’

3’5’ lagging strand

5’3’

lagging strand synthesis proceeds by consecutive ligation ofOkasaki fragments.


5’3’

3’5’

3’5’ lagging strand

5’3’

5’3’

digestion of the last RNA primer leaves a gap at 5’ end 50-100 base pairs lost in each cell division (end replication problem!)

GAP

Telomere structure human telomeres contain a tandem repeat sequence (several

thousand base pairs in length):5’–TTAGGG–3’ / 5’–CCCTAA–3’

telomeres end in a 3’ single-stranded overhang of the G-richstrand (a few hundred nucleotides in length).

the telomere end folds back on itself to form a “T loop” protects the 3’ overhang (Figs. 10-17 and 10-19) renders the chromosome end less recombinogenic does not elicit a DNA damage response (local inhibition of ATM

and ATR by “shelterin” proteins that bind the T loop)

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAATCCCAATCCCAATCCCAATCCCAATCCC

3’-ssDNAoverhangdsDNA telomere repeat

– 3’chromosome

Telomere length note: the terminal DNA sequences lost at each cell

division are comprised entirely of telomere repeats

telomere length shortens during in vitro culture ofhuman fibroblasts: early passage fibroblasts = 18-25 kilobases (kb) at replicative senescent = 8-10 kb at genetic catastrophe = 1-2 kb

telomere attrition also occurs in vivo. how is telomere length restored in each new generation ?

Telomerase: an enzymatic complex that extends telomeres. since telomerase is highly active in germ cells, chromosomes

of the germline retain full telomere length.

Telomerase an enzymatic complex consisting of…

TERT (telomerase reverse transcriptase): a catalytic subunitthat uses an RNA template to synthesize tandem DNA copiesof the telomere repeat sequence.

TR (telomerase RNA): ssRNA molecule of 451 nucleotides contains a sequence that is complementary to the telomere repeat:

5’–CUAACCCUAA–3’ provides the template for synthesis of the telomere repeat.

Telomerase adds telomere repeat units (5’–TTAGGG–3’) to the3’–ssDNA overhang.

in humans, TERT expression is largely restricted to the germlineand to certain stem cells.

Telomere hypothesis Replicative senescence (early crisis)…

is induced by telomeric shortening below a threshold level(8-10 kb in human fibroblasts)

enforced by the p53 and Rb checkpoints Genetic catastrophe (late crisis)…

occurs when disruption of p53/Rb checkpoint (e.g., by viraloncogenes) allows continued proliferation despite impendingtelomere dysfunction.

further telomere erosion telomere dysfunction loss of telomere function genetic catastrophe

genomic instability massive cell death emergence of immortal variants

Short telomeres & genetic instability

when short telomeres become dysfunctional… chromosome ends behave like dsDNA breaks

highly recombinogenic induce the cellular DNA damage response

“breakage-fusion-bridge” cycles are initiated recombinogenic telomeres of two chromosome ends fuse to

form a dicentric chromosome during metaphase, the same chromatid of a dicentric can attach

to both spindle poles this chromatid may break during anaphase chromosome fragmentation (further rounds of breakage-fusion-bridge) non-reciprocal chromosome translocations loss of genetic material

“breakage-fusion-bridge” cycles I the recombinogenic telomeres of two chromosomes fuse to

form a dicentric chromosome…

telomere –>

centromere –>

recombinogenictelomere

fusion

dicentricchromosome

–>

“breakage-fusion-bridge” cycles II during metaphase, the same chromatid of a dicentric can attach to

both spindle poles …

sister chromatids of adicentric chromosome

spindlepole

spindlepole

As the chromosomes segregate, this chromatid will form an“anaphase bridge” (Figure 10.16B), and will eventually break.

The break sites of the two resulting broken chromatids will also berecombinogenic.

“breakage-fusion-bridge” cycles - III

The previous two slides show a breakage-fusion-bridge (BFB)cycle that is initiated by fusion between the recombinogenictelomeres of two different chromosomes.

Note: BFB cycles can also be initiated by fusion betweenrecombinogenic telomeres of the two chromatids of the samechromosome (in G2 phase). This is illustrated in Figure 10.15 ofWeinberg (2007).

Immortalization immortal variants arise by acquiring a genetic change

that stabilizes telomere length: ectopic expression of TERT activation of ALT (Section 10.8)

once telomere length has been stabilized, telomerefunction and genomic stability are restored

yet, these variants have sustained lasting genetic lesions karyotypic level: aneuploidy & rearranged chromosomes genetic level: functional alterations of unknown genes ? telomere-induced genomic instability is an important aspect of

human tumorigenesis. immortal variants emerge from human fibroblasts at a

reasonable rate (10-5 - 10-6)

Immortalization with TERT stably transfect early passage (“pre-crisis”) human

fibroblasts with an expression vector encoding TERT… telomere length is stabilized.

p53/Rb checkpoints are not activated.

replicative senescence and genetic catastrophe are averted.

cell are rendered immortal.

TERT immortalized cells have a stable diploid genome.

strong evidence that, in human fibroblasts, replicativesenescence and genetic catastrophe are telomere-dependent events

early crisis

late crisisextendedlifespan

time

PDsTERT-immortalization

Telomere hypothesis explains…

Replicative Senescence and Genetic Catastrophe

limited lifespan of cells in culture and in vivo provides a counting mechanism for each somatic cell

the effect of donor age on lifespan of cultured cells

the species-dependent behavior of cells in culture

But, why not express telomerase constitutively ?

telomere-induced replicative senescence a very useful mechanism to suppress tumor development,

especially in large and long-lived animals.

Suppose that… at least 20 cell divisions required to yield an oncogenic mutation at least 5 independent mutations are needed for malignancy:

at least 100 cell divisions necessary to produce a single malignant cell. telomere-induced senescence will severely limit the neoplastic

development of pre-malignant cells. consequently, telomere-induced senescence is a useful barrier to cancer

development in humans.

telomerase activation occurs in almost all human tumors

Telomere maintenance in the mouse

murine cells have much longer telomeres~ 50 kb (compared to 10-20 kb in human cells)

somatic expression of TERT is much morewidespread in mice than humans

telomere erosion is not a major barrier to thein vitro culture of mouse cells

In vitro culture of mouse fibroblasts after ~20 PDs, mouse embryo fibroblasts (MEFs)

undergo a “crisis” that resembles the replicativesenescence of human fibroblasts cells arrest in senescent state (metabolically active)

senescent MEFs maintain a stable diploid genome

senescence is established by the p53 checkpoint pathway

senescence is averted by disabling the p53 pathway

yet, after only ~20 PDs, telomeres are not significantly eroded

What triggers the p53/RB checkpoint ? Not known for certain. inadequate culture conditions; oxidative stress ?

mouse fibroblast cell lines

unlike human fibroblasts, MEF cultures routinelygive rise to immortal variants rare immortal variants arise during crisis (presumably due

to mutations in the p53 pathway), and these variantsovergrow the culture

“cell lines” MEF cell lines are diploid and have reasonably stable

genomes

the source of NIH-3T3 cells

cell lines derived from… explants of natural tumors

in vitro transformation of normal cells in culture

Culturing malignant cells

in vitro properties of malignant cells immortality

decreased growth factor requirements

altered morphology

loss of contact inhibition

loss of dependence on anchorage for cell growth

altered morphology rounded appearance (vs. the elongated, spindly shape

of normal fibroblasts) increased nuclear volume

RSV-transformed CEFnormal CEF


seed cells onto petri dish at low dilution cells attach to dish and start to proliferate

malignant cellsnormal cells


growing culture begins to form a monolayer some cells attain cell-cell contacts on all sides these cells normally experience “contact inhibition”

normal cells malignant cells


= contact-inhibited cell

in normal cells, contact inhibition causes cell cycle arrest. malignant cells are not affected by contact inhibition.


anchorage independence

normal cells will only grow if attached to petri dish. form a monolayer

malignant cells will grow on top of one another. anchorage-independence is an especially important

parameter of in vivo tumorigenicity


in vitro assays of cell transformation what happens to normal cultured cells that are

treated with agents that induce tumors in animals? - e.g., viruses, radiation, chemicals

they acquire some properties of malignant cells “in vitro cell transformation” can be measured

using quantitative assays: focus formation colony formation in soft agar

focus formation assay based on several features of transformed cells:

altered morphology loss of contact-inhibition loss of anchorage dependence

treat normal cells with oncogenic agent plate cells at low dilution progeny of rare transformed cells give rise to a

“focus” that can be visibly distinguished fromthe monolayer of normal cells.

focus formation assay• treat normal cell culture with tumorigenic agent• plate cells at low dilution

= transformed cell

• if transformed cells acquire…∆ altered morphology

• visible as a focus (light microscope at low magnification)• see Figure 3.5

focus formation assay• treat normal cell culture with tumorigenic agent• plate cells at low dilution

• if transformed cells acquire… loss of contact inhibition loss of anchorage dependence

• visible as a focus (more obvious - can see by eye!)

focus formation assay• the focus formation assay is ideal for quantitation• each original transformation event yields a single focus

• also, each focus can be individually picked and re-cultured• allows the isolation of a cell clone containing the progeny of

the original transformed cell.

colony formation assay based on:

loss of anchorage dependence

treat normal cells with oncogenic agent dilute cells in “soft agar” (0.3% agar) pour agar onto petri dish

cells are suspended in agar normal cells will not divide (insufficient anchorage)

progeny of rare transformed cells give rise to a “colony”of growing cells (visible by eye or under low magnification)

colonies can be counted and picked

in vivo tumorigenesis inject cultured cells into animals… look for and count tumors. common hosts:

adult mice fetal/newborn mice immature immune system “nude” mice no T cell immunity SCID mice no B or T cell immunity

correlations between in vitro properties and in vivotumorigenicity of transformed cells are not absolute.

Retroviruses

Key features of all retroviruses: an enveloped virion ssRNA genome all retroviral genomes have gag, pol, and env genes all encode a reverse transcriptase

Let’s consider Avian Leukosis Virus (ALV) asa prototype of an oncogenic retrovirus

Retroviral proteins Each retroviral gene encodes a single polyprotein

that is subsequently processed by proteolysis toform mature viral proteins. gag encodes – matrix protein (MA)

– capsid protein (CA)– nucleocapsid protein (NC)

pol encodes – reverse transcriptase (RT)– integrase (IN)– protease (PR)

env encodes – surface protein (SU)– transmembrane protein (TM)

Retroviral virionenvelope

(lipid bilayer)

matrix

capsid

nucleoproteincore

Retrovirus Virion

The virion of a retrovirus contains… envelope: a lipid bilayer containing viral env proteins matrix: a lattice of gag MA proteins attached to the

inner surface of envelope capsid: an icosahedral assembly of gag CA proteins nucleoprotein core:

2 copies of the ssRNA genome (~9000 nucleotides) the gag NC protein the pol gene products (reverse transcriptase and integrase) various host proteins and host tRNAs

Retroviral virionenvelope

(lipid bilayer)

env SUprotein

env TMprotein

matrix(gag MA)

capsid(gag CA)

nucleoproteincore

- 2 x ssRNA- gag NC- pol proteins

retroviral infection

host range of a retrovirus determined principally by the env protein species specificity: ALV infects chickens tissue specificity: ALV infects most cell types

early stages of infection env binds specific receptors on host cell membrane fusion of viral envelope and host cell membrane viral proteins enter cytoplasm

Reverse transcription Reverse transcription occurs in the cytoplasm

generates a dsDNA genome flanked by LTRs (long terminal repeats)

ssRNAviral RT

host DNA pol

ssDNA

dsDNA

5’-cap– AAAAAAR Rgag pol env

gag pol envLTR LTR

Proviral integration viral dsDNA migrates into the cell nucleus circularization of dsDNA integration of dsDNA into host genome

catalyzed by viral integrase protein site-specific with respect to the viral genome random with respect to the host genome generates a “provirus”

gag pol env

host cellchromosome

LTR LTR

Proviral transcription the provirus is an active transcription unit

each LTR contains – promoter– enhancer– polyA signal

pA enh. pr.

gag pol env

LTR LTR

Proviral transcription transcription products of the provirus

full-length RNAmRNA to encode gag and pol polypeptidesgenomic RNA for next generation of virions

spliced RNA (excises gag and pol sequences)mRNA for the env polyprotein

gag pol env

LTR LTR

Proviral replication

During cell division, the provirus is replicatedalong with the host genome all daughter cells inherit the provirus

Retroviruses can also infect germline cells(e.g., oocytes or spermatocytes). provirus then becomes part of the genetic material

of the species Endogenous retrovirus

constitute > 0.1% of mouse genome usually transcriptionally inactive

Virion production - I

env proteins processed through the secretory pathway and

inserted into host cell membrane.

pol proteins (RT, integrase, protease) associate with ssRNA genome to form the

nucleoprotein core (in cytoplasm).

gag proteins associate with the nucleoprotein to form a capsid

(in cytoplasm).

Virion production - II the capsid buds from the host cell membrane

while the capsid buds out, a segment of the env-impregnated cell surface encircles it and formsthe viral envelope.

ALV replication is not cytopathic Infected cell are difficult to distinguish from

uninfected cells. To do so may require… serological analysis to detect viral antigens electron microscopy to visualize intracytoplasmic

capsids and budding virions.

Retrovirus reproduction cycle

Transmission of retroviruses

Horizontal transmission (from another animal)

Vertical transmission (from parents) Genetic transmission

animal inherits endogenous provirus. rarely significant in oncogenesis (except in genetically

susceptible strains, such as AKR mice).

Congenital infection

Experimental transmission (by a scientist)

Horizontal transmission (ALV)

re. - ALV infects cells from a broad spectrum ofchicken tissues.

if chick is more than a few days old (post-hatching) at infection: transient viremia develops (virions in bloodstream) chick produces neutralizing antibodies viremia clears; chick immune to further infection chick does not develop virally-induced lymphoma

Congenital Infection (ALV)

mother infects her offspring chickens - infection of egg while in the female

reproductive organs mammals - transmission via placenta or milk

consequences of congenital infection with ALV: viremia occurs during embryonic development chick develops immunological tolerance to ALV viremia continues lymphomas develop during adulthood

Acutely Transforming Retroviruses

Acutely Transforming Retroviruses

Peyton Rous (Rockefeller University) observed a spontaneous sarcoma in a chicken in retrospect, we know that this chicken was from a

flock congenitally infected with ALV

Rous propagated the sarcoma cells by passagingfrom chicken to chicken.

sarcomaexplant

suspendedtumor cells

newsarcomadissociate inoculate

chick

Rous Sarcoma Virus (RSV) In 1911, Rous prepared a cell-free filtrate from

one of his sarcoma explants passed the dissociated explant through filter paper,

removing bacterial & eukaryotic cells inoculated chicks with the filtrate chicks developed sarcomas at site of injection!! Rous Sarcoma Virus (RSV)

sarcomaexplant

cell-freefiltrate

newsarcomafilter inoculate

chick

RSV is a powerful transforming agent

induces visible sarcoma in chicks within 2 weeks(ALV does not) . “acutely” transforming

even induces sarcomas in immuno-competentadult chickens (ALV does not)

causes focus formation in cultured chickfibroblasts (ALV does not)

Why is RSV so tumorigenic ?

especially compared with ALV RSV: “acutely-transforming retrovirus” ALV: “slowly-transforming retrovirus”

RSV and ALV: – structurally similar – infect similar cells

The v-src gene The RSV genome harbors additional sequences

of ~ 1,500 nucleotides (v-src, for “viral src”).

5’-cap– AAAAAAR Rgag pol envALV

9.0 kb

5’-cap– AAAAAAR Rgag pol env srcRSV

10.5 kb

Is v-src responsible for the increased malignantpotential of RSV ?

The origin of v-src sequences

v-src is absent from almost all other retroviralgenomes. Thus, where did it originate ?

in 1977, Bishop & Varmus reported thatgenomic DNA from normal, uninfectedchicken cells harbors a close homolog of v-src c-src (for “cellular src”) the c-src gene is conserved phylogenetically c-src functions in normal animal development

Retroviral transduction RSV originally appeared in a spontaneous sarcoma

from an ALV-infected chicken thus, it was proposed that RSV arose by incorporation

of c-src sequences into ALV acquisition of c-src converted a slowly-transforming

retrovirus (ALV) into an acutely-transformingretrovirus (RSV).

proto-oncogene(spliced)

“retroviral transduction”

oncogene(unspliced)

c-src v-src

other acutely transforming retroviruses havebeen identified in chickens, cats, mice, and rats(> 100 independent isolates).

retrovirusY73

MC29AMV

HarveyKirstenAbelson

tumorsarcomamyelocytomatosismyeloblastosissarcomasarcomaleukemia

v-oncv-yesv-mycv-myb

v-H-rasv-K-ras

v-abl

speciesavianavianavianmousemousemouse

> 40 different v-onc genes identified; all derived fromcellular (c-onc) genes by retroviral transduction.

How are transduced oncogenesrendered malignant?

Quantitative effects: inappropriate expression - the tranduced gene is

regulated transcriptionally by the LTR. elevated expression - LTR is a strong promoter.

Qualitative effects: oncoprotein can be expressed in a truncated or

fused form. transduced oncogenes can acquire point mutations

during viral replication (due to low fidelity of RT).

Slowly-transforming retroviruses

Slowly-transforming retroviruses chicks congenitally infected with ALV or inoculate eggs or young chicks with ALV

– immunological tolerance– persistent viremia

all adults develop enlarged livers and spleens,infiltrated with B-lymphoblasts

B cell lymphomas tumor cells contain integrated ALV sequences

Patterns of ALV proviral integration All cells within a particular tumor have the same pattern

of proviral insertion (i.e., each tumor is monoclonal) same # of proviruses inserted same integration sites within the chicken genome

Common integration sites were found in independenttumors from different chickens.

Hypothesis: ALV transforms cells by insertionalmutagenesis of a specific host gene.

molecular cloning ALV integration near c–myc in80% of ALV-induced lymphomas!! provirally altered c-myc alleles are transcribed at high rates

(due to integrated LTR sequences).

Activation of c-Myc by proviral insertion

Contrasting ALV- and RSV-induced transformation

insertional mutagenesis can explain differences inthe natural history of ALV- and RSV-inducedlymphomas

long latency of ALV-induced tumor formation ALV provirus integrates randomly in host genome only in a rare cell, does ALV integrate adjacent to a proto-

oncogene in a manner that activates its malignant potential

the monoclonality of ALV-induced lymphomas

the inability of ALV to transform cells in vitro

Other tumors induced by ALV chickens congenitally infected with ALV can

also develop other forms of cancer as adults. these forms usually develop later than lymphomas these forms become prominent in bursectomized

chickens (in which the bursa has been surgicallyremoved).

ALV-induced nephroblastomas: proviral integration at the c-H-ras proto-oncogene

ALV-induced erythroleukemias: proviral integration at the c-erbB proto-oncogene

Slowly-transforming retrovirusesin other species

chickens Avian Leukosis Virus (ALV)

mice Murine Leukemia Virus (MuLV) Mouse Mammary Tumor Virus (MMTV)

cats Feline Leukemia Virus (FeLV)

humans none?

Contrasting ALV- and RSV-induced transformation

insertional mutagenesis can explain differences inthe natural history of ALV- and RSV-inducedlymphomas

long latency of ALV-induced tumor formation ALV provirus integrates randomly in host genome only in a rare cell, does ALV integrate adjacent to a proto-

oncogene in a manner that activates its malignant potential

the inability of ALV to transform cells in vitro

Retroviral oncogenesisTwo major mechanisms identified in animals…

Retroviral Transduction mediated by the “acutely-transforming retroviruses”

Abelson Murine Leukemia Virus (A-MuLV) Rous Sarcoma Virus (RSV)

these retroviruses carry a transduced oncogene

Proviral Integration mediated by the “slowly-transforming retroviruses”

Murine Leukemia Virus (MuLV) Mouse Mammary Tumor Virus (MMTV) Avian Leukosis Virus (ALV)

normal retroviral genome (e.g., gag, pol, env)

Many proto-oncogenes identified in studies ofretroviral tumorigenesis in animals

retroviraltransduction H-ras

K-ras

SrcYesAblFosCbl

proviralintegration

EviWntLckPim

MycMyb

➔Are these proto-oncogenes involved in human cancer?

Documents

Oncogenes I and II - Columbia University · 2019-09-11 · Oncogenes I and II Readings for both lectures: The Biology of Cancer (2nd edition, 2014) by Robert A. Weinberg Chapters