THE UNZVERSITY OF CALGARY

The hpert ies of 8-Galactosidases h m Escherichia coli With Substitutions for

Glycine 794 and Tryptophan 999

Shamina Hakda

A THESIS

SUBMlTTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

DEPARTMENT OF BIOLOGICAL SCIENCES

CALGARY, ALBERTA

AUGUST, 1997

O Shamina Hakda 1997

National Library of Canada

Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395, rue Wellington Ottawa ON K1A ON4 Ottawa ON K i A O N 4 Canada Canada

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distrhute or seil copies of this thesis in microfonn, paper or electronic formats.

The author retains ownershp of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/Eilm, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantieIs de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.

Substitution of Ala for Gly-794 is thought to lock the loop made up of

residues 793 to 804 near to the active site. This substituted enzyme caused

poor binding of hydrophobic groups ta the glucose site compared to the wild

type enzyme. Some transition state analog inhibitors bound better to this

substituted enzyme. Some galactosylation rates were also better. In addition,

glucose bound to the free form of the substituted enzyme much better than to

the free form of the wild type enqnne, The locking of the position of the loop

seems to change the conformation of the enzyme fiom the free form to the

conformation of the enzyme after the glycosidic bond is cleaved. Glucose also

bound much better to the galactosyl form of the enzyme but reacted more

poorly to form allolactose.

Substitution of Phe or Gly for Trp-999 in the aglycone site or glucose

subsite of B-galactosidase caused dramatic decreases of the hydrop hobicity of

this glucose subsite. In addition D-glucose bound much more poorly in both the

fkee form and the galactosyl form. This is probably due to the loss of the

hydrophobic stacking interactions that Trp-999 provides for the hydrophobic

side of glucose. The reaction to form allolactose was rapid, but poor binding at

the aglycone subsite resulted in low allolactose production. In some cases the

galactosylation rate with PNPG was increased

1 would like to sincerely thank m y supervisor, Dr. RE. Huber for his

kindness, advice, guidance, insight, patience and generosity throughout the

years working in his laboratory. His encouragement and enthusiasm made

working under his supemision a rewarding learning experience. His evaluation

of this thesis was greatly appreciated.

1 would also like to express m y gratitude ta a couple of people who made

direct contributions to this thesis: Tien Phan for her help with the purification

and partial kinetic analysis of W999F-B-galactosidase; and Mark Britton for

the purification and partial kinetic anal+ of W999G-B-galactosidase.

1 also thRnk Jasmine Ahmed, Heather Seidle and Beatrice Rob and for

their discussions, suggestions, friendship and support. 1 would also like to

express m y gratitude to Dr. KJ. Stevenson for his kindness, support and

generosity.

Finally, 1 would like to thank m y family for their continuous love,

support and encouragement.

Dedicated to m y parents

Approval page i . *

Abstract xx

Acknowledgments iv

Dedication v

Table of Contents vi

List of Tables xii.

List of Figures xv

List of Abbreviations and Symbols xi3

...................................................................................................... 1. INTRODUCTION 1

1.1 Glycosidases ................................................................................................. 1

1.1.1 Mechanism of Action for Retaining Glycosidases ............... -2 1.2 B-Galactosidase: a Brief Description ............... .. ................................... 4

.............................. 1.2.1 Reactions Catd yzed by &galactoçidase.. -5

1.2.1.1 Hydrolytic and Thmgalactosylic Reactions with

F ................................................................................... Lactose... .*.u

1.2.1.2 Hydmlytic and Trançgalactosylic Reactions with

Synthetic Substrates ......,............ .... ..... L

1.2.1.3 ReversionReactions ..................................................... 9 ................................................................................ 12.2 Binding Sites 10

1.26.1 The Galactose Subsite ........................... t... ............... 10 1.2.2.2 The Glucose Subsite ................................................... 13

1.2.3 Reaction Mechanism of l3-Galactosidase .............................. 15 .................... 1.2.3.1 General Description ....... .................... 1 5

1.2.3.2 Evidence for a Two Step Mechankm ...................... 15

1.2.3.3 Reaction Pathwa~r: Evidence for a Common

Intmmedkte ............................................................................... 16

1.2.3.4 Evidence for a Covalent Galactosyl Enzyme

............................................................................... Intermediate 17

................................. 1.2.3.5 Nature of the Transition State 18

1.2.3.6 The Distinction Between Transition States and

.......................... Covalent Enzyme htennediates d

1.2.4 Mg2+ Requirement of Malactosidase ........ .... .................... 20 1.2.5 The p H Profile of eGalactosidase ........................................... 22

1.2.6 The Structure of eGalactosidase ...... .. ................................... 24

......................................... 1.3 Robing the Active Site of 8-Galactosidase 26

....................................................................... 13.1 Inhibitor Studies -26

1.3.1.1 Determination of Ki and Z(iW ...................................... 28

1-32 Site Dù.ected Mutagenesis ....................................................... 28

1.3.2.1 Reaction Profiles ......................................................... 30

1.4 Active Site Groups of &Galadosidase ......... ,. ................................... 32

1.4.1 Active Site Histidine Residues: His.357, His.391, His.540,

His-450 and His-418 ............................................................................. 32

1.4.2 Glu416 ......................................................................................... 36

1.4.3 Glu-537 ......................................................................................... 37

1.4.4 Met-502 ........................................................................................ 38

......................................................................................... 1.4.5 Tyr-503 38

1.4.6 Glu-461 ......................................................................................... 39 1.4.6.1 Glu-461 as an AQd Base Catalyst .......................... 39 1.4.6.2 R d e of Glu461 in Mg2+ Binding ............................... 40 1.4.6.3 Role of Glu-461 in Transition State

vii

. . Stabiùzation .......................titi. -... ............................................... 41

1.4.6.4 NucleophiIic Activation of B-Galactosidases w i t h

Substitutions for Glu-46 ï. ....................................................... 42 1.4.7 Trp-999 .............................. ,..

........................................................................................ 1.4.8 Gly.79 4. 44

1.4.8.1 Gly-794 and h o p Movement .................................... 4t

2 . O ~ C T I V E S ............................................................................................... .. 48 .... ........................................................................................................ 2.1 Gly-794 -4t

2 2 Trp-999 ........................................ .. ........................................................... 4a 3 . MATERIALS .......................................................................................................... 50

3.1 Biochemical Reagents ...................... ,. ..................................................... 5(

3.2 Plasmi& ....................................................................................................... 51 - ........................................................................... 3.3 Oligonucleotide Rimers 31

..................................................................... 3.3.1 SequencingPrirner 51

............................................................... 3.3.2 Mutagenesis Primers -51

3.4 E.mli Bacterial Strains ................. ... ........................................................ 53 3.5 B a c t e A Growth Media and Conditions .............................................. -53

3 .5 . 1 Bacterial Gmwth in LB Media.. .............................................. 53

3.5.2 Bacterial Growth in Minimd Glucose Media ........................ 5 4

3.5.3 Bacterial Gmwth in Minimal Lactobionic Acid Medi a. ........ 54 ...................................................................................................................... 4 . Methods 56

4.1 Plasmid Preparation .......................... - 5

4.2 Restriction Eiizyme Digestion ................................................................ 57

.................................................................... 4.3 Agamse Gel Electrophoresis 58

4.4 PCR Baçed Site Directed Mutagenesis ............ .- ................................... 58

4.4.2 Polymerase Châip Reaction .......................... ..... ...... -59

4.4.2.1 Sample Reactio n. ..................................................... 59

............................. 4.42.1.1 Oligonucieotide Prime= 59

4.4.2.1.2 Phosphorylation of the Primers ................ 63

4.4.2.1.3 Reation Set Up: Production of G794A-l3-

Galactosidase ................................................................. 63

4.4.3 The E R Reaction ..................................................................... 64

4.4.4 Digesting and Polishing the PCR M u c t .............................. 64

...................... 4.4.5 Ligation of the PCR Produ& .......... ................... 65

................................... 4.4.6 Preparation of Competent E.coli Cells 66

......................................... 4.4.7 Trançformation of the E.coli Cells 66

4.4.7.1 Transformation of the E . d i Ce& with the LLigated

PCR Produ ct. .............................................................................. 67

........................................... 4.4.8 Sel- for the G794.A Mutant ôû

4.4.9 wenc ing ............................ .. 4.5 Problem Solving ProtocoL ........................................................................ 69

...................................................................... 4.5.1 General ûverview -69

4.5.2 Purification of DNA Fragments From Agarose Gels ........... 72

................................................... 4.5 -3 Ligation of DNA Fragments. -72

4.6 Isolation of O-Galactosidase ..................................................................... 72

4.6.1 C d Gmwth ................................................................................. 72

4.6.2 Purikation of the l3-Galactosidases ....................................... 73

4.6.3 SDS-PAGE ................................................................................... 75

4.6.4 Determination of the f3-Galactosidase Concentration ....... 75

4.7 Kinetic Characterization of the 13-Galactosidases .............................. 75

4.7.1 General Assay Conditions ...................... ........ ................. 75

4.7.2 & and V, Values ..................................................................... -76

4.7.3 pH profiles .................................................................................... 76

4.7.4 Determination of Inhibition Constants (Ki values) ............. 77

4.8 Gas Liquid Chromatography ................................................................ -78

...................................................... 4.8.1 Samp1e Reactio n. ......... ...... 78

4.8.2 Gas Liquld Chromabgraphy Conditions ......... .. ................. 79

5.0 Results ..................................................................................................................... 80

....................................................................................... 5.1 Plasmid Isolation, BO

5.2 P a Based Site Dllected Mutagenesis ...................... ... ................... 80

.............................................................. 5.2.1 Control PCR Reaction 80

5.2.2 Production of G794A-13-Galachsidase ................................... 80

5.3 Sequencing Results .................................................................................... 82

........................................................ 5.4 The Km of G794A-f3-GalactoSdase 82

5.5 Recombining Two Plasmids ........................... .. ...................................... û3

........... 5.6 Sequencing Results and the & value for The New Plasmid 84

...................................................... 5.7 Purification of the eGaIactosidases û4

........................................................... 5.7.1 G794A-f3-Galactosidase -86

...... 5.7.2 W999F-8-Galactosidase and W999G13.Galactosidase 86

......................................................................................... 5.8 Kinetic Analysis 86

5.8.1 pH Profiles .................................................................................... 86

5.8.1.1 G794A.eGalactosidase ............................................. 91

....................... ............................ 5.8.1.1.1 ONFG .... 91

...................... ............................ 5.8.1.1.2 PNPG .... 91

5.8.1.1.3 Ratios of Km and norrnalized kcat values

..... with ONPG and PNPG as a F'unction of the pH 91

5.8.1.2 W999F.i3-Galactosid ase. ....................................... 98

.................................. 5.8.12.1 ONFG

5.8.1.2.2 PNPG ............................................................. 98 5.8.1.2-3 pH profiles of the cornparison of & and

normalized kcat values w i t h ONPG and PNPG as a

F'unction of the p IT, ................................................ 106

5.82 & and & values (pH 7.0) ............................................. 106

.................................... 5.8.2.1 G794A-13-Galactosidase 106

5.8.2.2 W999F43-Galactosidase ................................... 106

................................. 5.8.3 Alcohol Acceptors ............................ ... 1 0 8

........................................... 5.8.3.1 G794A.B-Galacbsidase 108

5.8.3.2 W999F-B-Gatactosidase .......................................... 109

5.8.4 Acœptor Studies ...................................................................... 110

.............................. 5.8.4.1 Acceptor Studies with Alcohols 110

........................... 5.8.4.1. 1 G794A-13-Galactasidase 110

........................... 5.8.4.1.2 W999F-B-Galactosidase I l2

.......................................... 5.8.5 Inhibitor Studies ...................... .., 112

......................................... 5.8.5.1 G794A-eGalactosidase 114

5.8.5.2 W999F-13-Galactosidase and W999G-B-

....................................................... Galactosidase ........... ... 115

.................. 5 A5.3 DGlucose, D-Xylose and L-Arabinose 116

5.8.5.3.1 Plots of Apparent W A p p a r e n t kat As A

Function of the InhibitorIAcceptor

Concentration. .......................................................... 116

5.8.5.3.1.1 G794A-13-Galactosidase ............ 117

5.8.5.3.1.2 W999F-bGalactosidase ........... 117

5.8.6 Acceptor Studies with Sugars ........................ .,. ................ 117

5.8.6.1 G794A4-Galactosidase ........................................ 117

5.8.6.1.1 D-Glucose Study ........................................ 117

5.8.6.1.2 D-Xylose Study .......................................... ................... 5.8.6.2 W999F43Gdactosidase A 3

........................................ 5.8.6.2.1 D-Glucose Study 123

5.8.6.2.2 D-Xylose Study ................................. 2 6

............................................ ........... 5.9 Gas Liquid Chromatography .... 126

5.9.1 SugarStandards ....................................... .. 5.9.2 WildType13-Galactosidase ..................................................... El3

....................................................... 5.9.3 G794A-&Galactosidase 133

.............................................. .. 5.9.4 W999F.B-Galactosidase .....-. 133

. 6 Discussion ............................................................................................................... 135

6.1 G794A-Walactosidase ........................................................................ 135

6.2 W999F-&Galachsidase and W999GeGdactosidase ..... .. ........ 151 6.3 The Aglyame Site of B-Galactosidase ................................................. 160

7 . Referenœs ............................................................................................................... 162

xii

Table 3.1.

Table 4.1.

Table 5.1.

Table 5.2.

Table 5.3.

Table 5.4.

Table 5.5.

Table 5.6.

Table 6.1

Oligonucleotide primers used for sequencing the mutated region of

the lacZ gene and the primers required for PCR ......................,.... 53

The extinction coefficients of oNP arid pNP at various pH

d u e s ....*.............,.....................*......*............*...... ...........*.....*................. *..77

The &, & and k&Km values for wild type 13-galactosidase and

the substituted B-galactosidases using ONPG and PNPG as the

substrates .......... .. ............................................................................ 108 The efKect of various alcohols on the Km and kt values of the

substituted &galactosidases ............................................................ 109

The slope and interœpt values for the plots on Figure 5.20 and

521 ............................................................................................................ li.2

The inhibitm comtants (Ki values) for various substrate analog

and transition state analog inhibitors using different l3-

galactosidases ..... ........................................................................ 1 15

The intercept values and slopes for the plots of apparent k t vs.

(apparent / [Sugar Acceptor] for G794A-13-

gaIactosidase ........................................................................................... 123

The intercept and slope values for the plots of apparent kt vs.

(apparent bt-bt) / [Sugar Acceptor] for W999F-13-

gaiactosidase ............ .. .......................................................................... î26

The calculated kinetic constants for galactosylation and

degalactosylation (k2 and k3 respectively), k4 &' and & for

G794A-13-galactosidase and the literature values of k2 and k3, k4

.......... Ri" and & for the wild type enzyme ............................ ., 1 4 0

xiii

Table 6.2 The (rate constant for the reaction of the acceptor with the

galactosyl form of the enzyme) and the &" [the dissociation

constant for the sugar h m the galactosyl form of the enzyme)

for G794A-13-galactosidase with D-glucose and D-xylose as the

acceptors as estimated by studies with ONPG and PNPG .-......... 148 Table 6.3 The calculated khetic constants for galactosylation and

degalactosylation (k2 and k3 respectively), k4 5" and IC, for

W999F-8-galachsidase and the liéerature values of k2 and k3, k4

g" and H, for the wïld type enzyme ..................... .. ....... - .---..-......... 1B

Table 6.4 The k4 (rate constant for the reaction of the acceptor with the

galactosyl form of the enzyme) and the &" (the dissociation

constant for the sugar from the galahsyl form of the enzyme)

for W999F-i3-gdactosidase with D-glucose and D-xylose as the

acceptors as estimated by studies with ONPG and PNPG ........... 159

xiv

Figure 5.4.

FXgure 5.5.

Figure 5.6.

Figue 5.7.

Figure 5.8.

FigLlre 5.9.

Figure 5.10.

Figure 5.11.

EIgwe 5.12.

Figure 5.13.

Figure 5.14.

SDS-PAGE analysis of the purification of W999F-&

ga~actosidase ....................................................................................... 89

SDS-PAGE analysis of the puriûmtion of W999GS

galactosidase ................................................................................... -90

pH profile of the & values for the wild type enqme and

............................................ G794.A-i3-galactosidase with ONPG. -92

pH profle of the normalized bt values for the wild type

enzyme and G794A-B-galactosidase with ONPG ...................... 9 3

pH profile of the normalized && values for the wild type

enzyme and G794A-B-galactosidase with ONPG ........................ 94

pH prone of the I(, values for the wild type enzyme and

............... ............................ G794G-&gaIactosidase with PNPG .. 95

pH profle of the normalized kcat values for the wild Spe

enzyme and G794A-Bgdactosidase with PNPG ......................... 96

pH profle of the normalized k&& values for the wild

enzyme and G794A-i3-galactosidase with PNPG ......................... 97

pH profles of the ratio of Km values wi th ONPG & ONPG)

and the Km values with PNPG (Rm PNPG) for G794A-13-

galactosidase and pH profles of the ratio of kt values with

ONPG ONPG) and the kt values with PNPG kt PNPG) for G794A-8-galactosidase ..,.. ... ................................ 99

pH profile of the &, values for the wiId type enzyme and

W999F-0-galactosidase with ONPG ...........-............................. 100

pH profle of the normalized kt values for the wild type

.................... enzyme and W999F-&galactosidase with ONPG -101

Figure 5.15.

Figure 5.16.

Figure 5.17.

Figure 5.18.

Figure 5.19.

Figure 5.21.

Figwe 5.20.

Figure 5.22.

Figure 5.23.

Figure 5.24.

pH pmnle o f the normalized &JRm values for the wild type

enzyme and W999F-B-galactosidase with ONPG ..................... 102 pH profile of the & values for the wild type enzyme and

W999F-B-galactosidase with PNPG ............................................ 103 pH profile of the normalized Lt values for the wrld type

enzyme and W999F-&galactosidase with PNPG ...................... 104 pH profile of the normalid b t , values for the wild tgpe

enzyme and W999F-B-galactosidase with PNPG ...................... 105 pH proEles of the ratio of & values with ONPG (Km ONPG)

and the Km values with PNPG (Km PNPG) for W999F-B-

galadsidase pH profiles of the ratio of bt values with ONPG

kt OONPG) and the Lt values wi th PNPG (kt PNPG) for

W999F-B-gaiactosidase ......................... . . . . . . . . . . . . .... . .. ..... 107 The acceptor study for G794A-B-galadsidase using methanol

as the acceptor and ONPG and PNPG as the substrate. ........ 111 The acceptor study for W999F-13-galactosidase using 1.4-

butanediol as the acceptor and ONPG and PNPG as the

substrate ........................ .............................................. ...................... Il3 Plots of apparent / apparent kcat as a fundion of the D-

glucose concentration for G794A-13-galactosidaçe ........ .......... 118 Plots of apparent Hm /apparent bat as a h c t i o n of the

acceptorfinhibitor concentration for G794A-B-galactosidase

ushg PNPG as the substrate .................... .. ....... ... ................ 119

Plots of the apparent Km / apparent kcat as a h d i o n of the D-

glucose concentration for W999F-B-galachsidase .tra.tratratratratra.......... ..........A20

xvii

F'Sgure 5.27.

Figure 5.28.

Figure 5.29,

Figure 5.30.

Figure 5.31.

Figure 5.32.

Figure 5.33.

Figure 6.1

Figure 6.2

Figure 6.3

Plots of the apparent &, / kt as a function of the

acceptorfinhiiiiitor concentration for W999F-13-

galactosidase. ... .. ... ..... ... . .. .... . .a.-. ............ .m.-a... ..a. .a.. ........-. ..- -.. . --.--..--. 12 1

The acceptm study for G794A-B-galactosidase using D-glucose

as the acceptor and ONPG and PNPG as the substrate .......,. 124 The acceptur study for G794A-B-gdactosidase using D-xylose

as the acceptor and ONPG arid PNPG as the substrate ......... 124 The acceptor study for W999F-l3-galactosidase using D-glucose

as the acceptur and PNPG as the substrates ............................ 125 The acceptor study for W999F-O-galactosidase using D-xylose

as the acceptor and PNPG as the substrate .............................. 125 A Srpical gas chromatography elution profile of l3-galactosidase

reachg with lactase ............... ... ......... ...... ....................................... 12: Standard curve for the peak ratios as a h c t i o n of the

combined concentrations of D-glucuse and D-galactose ... ... ..... l3C

Standard m e for the peak ratios as a function of the lactose

concentrations. ... ..... . ... ... .... ... .. . ...... . . . . . . . . . . . . . 1 3 1

Cornparison of the amount of glucose + galactose and

dolactose pmduced per pg for the wild type enzyme ............... 132 Hypothetical reaction CO-ordinate for wild type and G794A-8-

galactosidase with ONPG and PNPG ............................. .. ........ 142

Aiignment of nitrophenol groups in the aglymne subsite -..-..... 14-4 Diagram of the loop held close to the active site in the G794A-B

galactosidase ...... ...,., ......................................................................... 149

xviii

Amp: ampiciIlin

ATP: adenosine triphosphate

bp: base pair

DEAE: diethylaminoethyl

DMF: N,N-dimethylformamide

DNA deoxyribonucleic acid

d N T P s : deoxynudeotide triphosphates

ds DNA: double stranded deoxyribonudeic acid

MT ditbiotbreitol

EM'A: e~ylenediaminotetraacetic acid

EGTG: ethyleneglycol-bis-(f3-mioethyl ether) Na-tetraacetic acid

FPLC: fast protein liquid chromatography

g standard gravity

HMDS: hexame thyldisilazane

IPTG: isopropyl-thid-D-galactopyranoside

kb: 103 bases or base pairs

kDa: 103 Dalton

LB: Luria-Bertaini

OD280: optical density at 280 nm

OD260: optical density at 260 n m

ONPG: enibphenyl-B-D-galactopyranoside

PAGE: pdyacrylamide gel electrophoresis

xix

PCR: polymerase chain reaction

PETG: phenylethyl-thid-D-galactopyranoside

PEG: polyethylene glycol

P m . phenylmethylsulfonyl fluoride

PNPG: p-nitrophenyl-0-D-galactopyranoside

psi: pounds per square inch

rpm: revolutions per minute

SDS: sodium dodecyl sulfate

ss DNA: single stranded deoxyribonucleic acid

TAE: Tris acetate EDTA

TE: Tris EDTA

TES: N-Tris(hydroxymetb1)methyl-2-Rminoethme sulfonic acid

TMCS: trimethylchlorosilane

Tris: ~s(hydroxymethyI)&omehe

UV: ultraviolet

Wx volt hour

X-gai: 5-bromo4chloro-3-indolyl-13-D-galactopyranoside

1. INTRODUCTION

1.1 GLYCOSIDASES

Proteins and emgmes that bind carbohydrates are present in all living

cells and play a central role in a myriad of important biological fiinctions.

Glycosidases are a large and diverse class of carbohydrate binding enzymes.

They catalyze the hydrolysis of glycosidic bonds. Glycosidases are of

significant interest in medicine and biokchnology. Severe inherited diseases

such as Pompe disease, Fabry disease and Gaucher's disease are caused by

defects in lysosomal glycosidases (Neufeld 1991). Glycosidases are

usedcommercially in the biotechnology industry for a wide variety of processes.

They are used for food processing, bio-stonhg of denim and textiles and bio-

b1eachi.q in the pulp and paper industry and for degradation of biomass into

liquid bels (Coughlan and Hazelwood, 1993). Glycosidases such as B-

galactosidase are important commercially because of problerns involved in the

disposal of agro-industrial wastes such as whey (Compagne et al., 1993; Gekas

and Lopez-Leiva, 1985; Kosaric and Asher, 1985). B-Galactosidase is of

significant interest in medicine because of the lactose intolerance experienced

by some individuals.

To date more than 480 glycosidases have been classified based on amino

acid sequence similarities (Henrissat, 1991; Henrissat and Bairoch, 1993) and

on their catalytic mechanism. Mechanistic classification divides glycosidases

into two main groups. Those that hydrolyze the glycosidic bond with net

inversion of configuration at the anomeric carbon are called inverting

glycosidases. Those that hydrolyze the glycosidic bond with net retention of

configuration are called retaïning glycosidases. In this study l3-galactosidase of

2

Escherichia cdi was investigated. Mfalactosidase h m E.coLi is an ideal model

for the study of glycosidases because it is readily isolated in large amounts. l3-

Galactosidase is a retaining glycosidase. Therefore, the discussion presented

hem will focus only on this gmup of glycosidases.

1.1.1 Mechanism of Action for Retaining Glycosidases

The generally accepted mechanism of action for a retaining glycosidase

is shown in Figure 1.1. The mechanism is believed to involve a double

displacement reaction facilitated by a general acidmase catalyst. In the first

step a general acid catalyst donates a proton to the glycosidic bond and

thereby weakens it. Subsequent cleavage of the glycosidic bond generates a

glycosyl enzyme intermediate and results in the release of the aglycone or

sugar. This k t reaction is represented by k2 in Figure 1.1 and is called the

glycosylation reaction. The second reaction is a hydrolysis reaction. A water

molecule is activated by a general base catalyst. It attacks the anomeric

carbon of the glycosyl enzyme intermediate resulting in release of the glycone

product. This step is represented by k3 in Figure 1.1 and is referred to as the

deglycosylation or hydrolysis step. Both steps in the mechanism proceed via

an oxocarbonium ion trrinsition state, This transition state is beliwed to be an

intermediate that is either covalently bound ta the enzyme or bound by an ion

pair. Withers and Street. (1988) investigated mechanism based inactivation of

glycosidases that involved trapping of a covalent glycosyl enzyme

intermediate. 0-Glucanase from A. fecalis, bgalactosidase from E.coli, A.

oryzm and A. niger and exoglucanase h m C. fimi were found to be inactivated

in this way providing strong evidence for the formation of a covalent

intermediate in these retaining glycosidases. Lysozyme h m hen egg white is

c?; FA- cm-

Figure 1.1. The mefhanism of the retaining glycosidase 8-galactosidase. Hem k2 is the rate constant for the galactosylation or hydrolysis reaction and Ir3 is the rate constant for the degalactosylation reaction, $ Possible transition states.

an exception. The oxocarbonium ion intermediate here is long Lived and is

believed to be stabilized electrostatically rather thRn by covalent stabilization,

The positive charge on the oxocarbonium ion is stabilized by the ionized

negatively charged group of Asp-52. The q s t a l structue of hen egg white

lysozyme suggests that the Asp-52 is too far away fkom the Cl of the sugar

substrate to form a covalent bond (Strynadka and James, 1991). Formation

of a covalent intermediate would disrupt many of the interactions (hydmgen

bonds) formed by Asp-52 and result in dramatically changing the conformation

of the supporting strands in the 0-sheets.

Catalytic residues are often conserved withïn families of glycosyl

hydrolases (Henrissat and Bairoch, 1993). Sequence cornparisons of

hydrolases have revealed conserved Asp and Glu residues in each family

(Henrissat and Bairoch, 1993). These residues can act as proton donors in

their protonated form or as a nudeophile o r oxocarbonium stabilizing agent in

their charged form (Sinnott, 1990). These hdings suggest that the acidhase

catalyst in the mechanism of retaining glycosidases may be a conserved Glu or

Asp residue in the active site.

1.2 IEGALACTOSIDASE: A BRIEF DESCRIPLTON

The B-galachsidase produced in Escherichia coli was instrumental in the

development of the operon mode1 and today is one of the most commonly used

enzymes in molecular biology. I3-Galactosidase is produced in Emli by the

lac2 gene, one of the four protein coding genes comprising the lactose (lac)

operon (Jacob and Monod, 1961). &Galactosidase fkom E.coli is readily

isolated in relatively large quantities making it an ideal mode1 for the study of

disaccharidases. B-Galactosidase is important physiologically for the

5

hydrolysis of B-galactosides. The hydrolysis of lactose in milk or whey is

important commercially because of the lactose intolerance experienced by

sorne individuals and because of problems involving the industrial disposal of

whey (Gekas and Lopez-Leiva, 1985; Kosaric and Asher, 1985). 0-

Galactosidase is also important because of its widespread use as a marker in

molecular biology and its use in medical diagnostics.

Most of the enzyme's overall physical and chernical characteristics are

known and the regdation of B-galactosidase synthesis has been extensively

studied (Jacob and Monod, 1961). The primary structures of botfi the la&

gene and its protein product, &galactosidase, have been determined (Ralnins et

al., 1983; Fowler and Zabin, 1978). The x-ray crystal structure of this protein

has also been determined (Jacobsen et al., 1994). The active form of B-

galactosidase is a homotetramer consisting of four identical monomers. Each

monomer is comprised of a single peptide chain containing 1023 amino acids,

and has a moledar weight of 116 353 (Kalnins et al,, 1983). The enzyme

requires Me+, or Mh2+ and Na+ or K+ for full catalyiic activity.

1 2 1 Reactions Catalyzed by B-Galactosidase

1.2.1.1 Hydmlytic and Transgalactosylic Reactioas with Lactuse

O-Galactosidase is known to carry out hydrolytic and transgalactosylic

reactions Wallenfels and Wiel, 1972; Huber et al., 1976). In the hydrolytic

reaction, the B(1-4) linkage in the lactose is cleaved in the presence of water tu

yield glucose and galactose. The transgalactosylic reaction involves deavage

of the a(1-4) linkage and the formation of a 13(1-6) linkage. This results in

transiferring the galactose from carbon 4 to carbon 6 of the glucose ta give

allolactose (Jobe and Bourgeois, 1972; Huber et al., 1976). The mechanism of

6

action of O-galactosidase on lactose is shown in Figure 1.2. Aiiolactose is the

natural physiologîcal inducer of the lactose operon (Jobe and Bourgeois, 1972).

When B-galadosidase utrlizes lactose as the substrate, approximately 50% of

the substrate moledes are converted by transgalactosyfis to allolactose

(Huber et al., 1976). However, dolactose is only a transient product of R

galactosidase because it is also a substrate of this enzyme Wallenfels et al.,

1960; Huber et al., 1975).

Since bgalactosidase is a retaining glycosidase it does not result in a

change in the configuration at the glycosidic bond carbon of galactose. The

hydrolytic reaction produces glucopyranose (either a or 13) and l3-

galactopyranose. When or-lactose is the substrate a-glucose or a-allolactose

are produced by the hydrolytic o r transgalactosylic reactions, respectively

(Huber et al., 1976). When B-lactose is the substrate of B-galactosidase, B-

glucose and B-allolactose are produced by the hydrolytic or transgalactosylic

reactions respectively CHuber et al., 1976).

12.12 Hydrolytic Reactions with Synthetic Substrates

Although lactose is the natural substrate of B-galactosidase, this

enzyme can also hydrolyze a variety of other SD-galactopyranosides such as

O-nitrophenyl-13-D-galactopyranoside (ONPG), and p-nitrophenyl-0-D-

galactopyranoside CPNPG). These synthetic substrates are commonly used as

substrates for &galactosidase for in vitro enzyme assays and kinetic studies.

The mechanism of B-galactosidase action o n these synthetic substrates is

shown in Figure 1.3. Al1 of these substrates have two constituents; an

aglycone moiety attached via a glycosidic linkage to a glycone moiety

GA-GL

Figure 12. The mechanism of B-galachsidase action on its natural substrate lactose. & is the dissociation constant for lactose. k2 is the rate constant for the breaking of the 0(1-4) Zinkage in the lactose. Ki" is the dissociation constant for the release of GL h m the E GA. GL complex and is the rate constant for the hydrolysis (addition of water) of galactose. The release of galactose is such a fast step that it is kinetically irrelevant. Ir4 is the rate constant for the formation of allolactose. GA is galactose, GL is glucose, and GAIGL is either Iactuse or allolactose.

Figure 1.3. The mechanism of 13-gdactosidase action on synthetic substrates (ONPG) and (PNPG). Ks is represents the dissociation constant for the dissociation of the synthetic substrate (ONPG or PNPG) fiom the enzyme. k2 is the rate constant for the breaking of the a(1-4) linkage between galactose and the aglycone moiety. This reaction is also called the galactosylation reaction since the enzyme becomes galactosylated. & is the rate constant for the hydrolysis (addition of water) of galactose. This reaction is also c d e d the degalactosylation reaction, The releases of nitrophen01 and galactose are such fâst steps that they are kinetically irrelevant. GA is galactose and HOR is the aglycone portion of the substrate.

9

(galactose). When ONPG or PNPG are used as substrates for B-galactosidase,

the hydrolytic readion results in deavage of the substrate into galactose and

an aglycone moiety.

1.2.1.3 Reversion Reactions

If D-galactose and D-glucose are incubated with B-galactosidase,

reversion reactions (the formation of B-galactosides) do occur to a s d extent

Wailenfels et al. 1959). The reversion reaction only occurs in the presence of

the enzyme. The enzyme probably uses a mechanism of reaction similar to

the one used for the forward reaction except that the anomeric hydroxyl is

removed and the reaction to form the product is with a hydroxyl of glucose.

With high concentrations of D-galactose (1.5 M) and D-glucose (1.5 Ml many

different isomers of B-galactosyl-glucose and Rgalactosyl-galactose were

pmduced muber and Hurlburt, 1986). When B-galactosidase was incubated

with low concentrations of D-galactose (250 mM) and a high concentration of

glucose (1.5 M) only 13-galactosyl-glucoses were formed (Huber and Hurlburt,

1986). This is because at Iow concentrations of galactose, galactose binds to

the glucose subsite pmrly. In the reaction with low galactose and high glucose,

allolactose was the ody disaccharide produced initially but as time progresse&

other Rgalactosyl-glucoses appeared. At equilibrium, allolactose made up

about 50% of the total disaccharide products. These fïndings suggest that the

enzyme has a much faster rate for the production of allolactose than for the

production of other disaccharides and that allolactose is inherently more stable

than other i3-galactosyl-glucoses. This is important since allolactose is the

true inducer of the lac operon. Although the reversion reactions are slower

than the forward reactions, the enzyme has a dehi te reactivity for the

production of dolactose in both the forward and the reversion reactions.

1.2.2 Binding Sites

There are four subssate binding sites per B-galactosidase tetramer (one

on each monomer). Each active site has been shown to function

independently. The structure of the active site of the enzyme has a dynamic

conformation which changes with the various steps of the reaction pathway

(Deschavanne et al., 1978). Catalysis involves two distinct binding sites or

subsites: the galactose subsite and the glucose or aglycone subsite

(Deschavanne et al., 1978). The free form of the enzyme is mainly specifk for

the galactose portion of the substrate. After glycosidic bond cleavage and

release of the aglycone moiety, the 'galactosyl' form of the enzyme has a

dif5erent conformation and a second subsite capable of binding glucose tightly

is then formed. This glucose subsite seems to be mainiy absent in the fiee

enzyme form.

1.2.2.1 The Galactose Subsite

The galactose subsite of f3-galactosidase is much more specific than is

the glucose subsite. The galadose subsite has good aEinity for galactose (Ki of

about 20 mM) by itself but binds more tightly if the galactose has a

hydrophobie or sugar group attached via a l3-glycosidic bond. The Ki for IPTG

is 0.085 mM and the Km for lactose is 1.35 mM (Deschavanne et al., 1978;

Huber et al., 1976). Inhibition studies performed by Huber and Gaunt (1983)

showed that the hydroxyls at the C3, C4, and C6 positions of the galactose

were required for tight binding of the sugar to the fiee enzyme. This study

showed that the absence of a hydmxyl group at any of these positions or a

change in the orientation of a hydroxyl group (equatorial to axial or visa versa)

decreased binding dramatidy. kibibitors which lacked hydrorcyl groups at the

C3 or C4 position or had hydroxyl groups misoriented in these positions

resulted in very poor binding. This suggests that the presence and proper

configuration of the hydroxyls at positions 3 and 4 is critical for binding. The

hydroxyl at position C6 is also important but has lesser effects (Huber and

Gaunt, 1983). Studies regarding the ring oxygen of galactose were inconclusive

(Huber and Gaunt, 1982). Huber and Rurlburt (1986) also showed that the

presence and proper configuration of the hydroxyls at position C3 and C4 is

absolutely critical for catalysis whereas the hydroxyl at the C6 position is not

as crucial for catalysis. In reversion reaction studies with a large number of

sugars and polyhydro& alcohols (Huber and Hurlburt, 1986) D-galactose

could be replaced only by Larabinose which is like D-galactose but has no

hydroxymethyl group (in the pyranose form with an a-bond equivalent to a J3-

bond for a D-sugar) and D-fucose (is like galactose but does not have a C6

hydrorryl group). These differ h m galactose at the C6 position of the pyranose

ring. The C6 hydroxyl is therefore not totally essential for activity.

The hydroxyl at the C2 position doesn't seem to be very important in

terms of binding at the galactose subsite but it is believed to be important for

catalysis (Wallenfels and Wiel, 1972; Huber and Gaunt, 1983). Tnhibitor

studies using D-talose show that D-talose bound better to the galactose

subsite than did D-galactose itself even though the hydroxyl group at the C2

position is axial in D-talose and equatorial in D-galactose (Huber and Gaunt,

1982). This suggests that the hydroxyl at the C2 position is not important for

binding. Later studies done by Huber and Hurlburt (1986) show that dthough

13

restnicturing between the ground state and the transition state. As a result

the most important interactions wodd be expected to occur at the C2 position

Interactions at the other three hydroxyls at positions C3, C4 and C6 would

only need to be suEcient in total to hoid the rest of the ring in position

A cornmon feature of enzyme active sites is that they are more

complementary to the transition state than to the ground state. This enables

enqmes to form stronger interactions with the transition state than the

ground state. This reduces the activation energy needed to reach the

transition state. As a result, it seems logical that the hydroxyl at the C2

position of galactose forms weak interactions with the enzyme in the ground

state Buber and Gaunt, 1983) and strong interactions in the transition state

(Huber and Hurlburt, 1986; McCarter et al., 1992)

12.23 The Glucose Subsite

In the free form of the enzyme, D-glucose binds very poorly (the

dissociation constant, &, is about 300 m m . There must, however, be some

binding advantage since lactose binds 20-fold better than does D-galactose

(Deschavanne et al., 1978; Huber and Gaunt, 1983). Once the substrate has

been hydrolyzed and the aglycone has diffused away, the resulting galactosyl

form of the enzyme can bind glucose tightly (ICd = 17 mM vs. about 300 mM in

the fiee enzyme). Thus, the confamation must change (Deschavanne et al.,

1978). Other cornpounds with hydroxyls (called acceptors) also bind at the

glucose subsite of the galactosyl form of the enzyme and these can react to

form transgalactosylic pmducts. Acceptor studies have shown that six carbon

sugars with structures somewhat nmilar to D-glucose (in the pyranose forml

have a good binding capacity at the glucose subsite (Huber et al., 1984).

14

Sugars that dser from D-glucose in the orientation of the hydroxyl groups at

the C4, C3 and C2 position have s i g n i f i d y reduced binding capacities at the

glucose subsik. This suggests that the presence and proper configuration of

these hydroxyl groups are important for binding a t the glucose subsite.

Futhermore, sugars and alcohols that have structures which match the 6-

hydroxymethyl end of D-glucose bound better than compounds whose

structures did not match and the absence of a hydroxyl at the C6 position

resulted in a decrease in bindinp at the glucose subsite (Huber et al., 1984).

These findings suggest that the presence and proper configuration of the

hydroayl at the C6 position of D-glucose is important for binding at the glucose

subsite,

The glucose subsite also has hydrophobic specificity. Hydrophobie

sugars and alcohols were found to bind better than did less hydrophobic

moledes auber et al., 1984). This suggests that the glucose subsite itself is

quite hydrophobic. It is this hydrophobic character which is believed to allow

synthetic substrates w i t h hydrophobic aglycone moieties such as ONPG and

PNPG to be utilized for kinetic studies CYde and De Bruyne, 1978). The

presence of this hydrophobic region can be explained by examining models of

sugar rings. One side of the sugar ring has significant hydrophobic character.

The hydmphobic residues in the glucose subsite form stacking interactions

with the hydrophobic sides of sugars. Studies done by Tenu et al. (1971) show

that PNPG binds better than ONPG or MNPG. This indicates that the exact

nature of the hydrophobic aglycone also plays a d e in binding at the glucose

subsite.

1.23 ReactionM 7 ofRGaIaetosidase

1.2.&1 Generd Description

BGalactosidase is a retnining glycosidase. Its mechanism of action

involves a double displacement reaction in which a covalent galactosyl-e-e

intermediate is formed and hydrolyzed via a planar oxocarbonium-ion-like

transition state (Figure 1.1). The formation of the covalent intermediate is

cded galactosylation (kz) because the enqme becomes galactosylated, and

the hydrolysis step is c d e d degalactosylation (k3) because the enzyme

becomes degalactosylated.

12.33. Evidence for a Two Step Mechanism

Sinnott and Viratelle (1973) studied the effects of adding the acceptor,

methanol, to B-galactosidase with several dXferent substrates (O, m and p-

nitrophenyl-i3-D-galactoside, p-aminophenyl-B-D-galactopyranoside and o-

nitrophenyl-a-Larabinoside). This is called nucleophilic cornpetition and is

used to identifir different kinetic steps during the enzymatic hydrolysis of B-D-

galactosides. The rate limiting step, the rate constant and the Km for each

substrate were determinecl and they reasoned that if k2 is the rate determining

step of substrate hydrolysis, there should be no variation of the kcat value as a

fiuiction of the nudeophile concentration if the acceptor reaction is very fast.

Conversdy, if k2 and ka are of the same order of magnitude the bt should

increase as a fundion of the nudeophile concentration (again if the acceptor

maciion is very fast). The Lt for some substrates (O- and m-nitrophenyl-B-D-

galachsides) increased with increasing methanol concentrations up to a

e u m value and then levelled off. This suggests that k2 and k3 are of the

same order of magnitude for these substrates. For other substrates (phenyl-,

pnitrophenyl-, O-aminophenyl- and phophenyl-B-D-galactotides) the k,

value did not change as a function of the methanol concentration- This

suggested that ka is the rate limiting step for these substrates. These resultr

suggest the existence of two potentially rate. determining steps Ck2 and k3) K

the mechanism of &gaiadosidase action (Figure 1.1). From the hdings of t h i s

study, a scheme containing two catalytic steps (galactosylation and

degalactosylation) and the formation of a galactosyl-enzyme intermediate was

proposed. Galactosylation (k2) is the rate determining step for PNPG and

therefore methanol has no effect on the kCat for the breakdown of this

substrate. Degalactosylation (k3) is pârtially rate limiting when ONPG is the

substrate and for this reason the kat for ONPG changes in the presence ol

methanol.

1.2.3.3 Reaction Pathway: Evidence for a Common Intermediate

Stokes and Wilson (1972) wanted to determine if a common

intermediate was present during the hydrolysis of various -1-B-galactosides

by B-galactosidase. They used a series of substrates which varied only in the

identity of the aglycone. They reacted these substrates and added either

methanol or ethanol. Aicohols such as methanol or ethanol are far better

nudeophiles than water and they compte with water to act as acceptors for

the galactose of the galactosyl form of the enzyme. Methanol and ethanol do

not denature the enzyme even at high concentrations (ShifiZn and Hum,

1969 1. Reaction of an aglycone-0-galactosyl substrate with water results in

the production of the aglycone and galactose. Reaction of l3-galactosides in the

presence of either methanol or ethanol results in the production of the fkee

aglycone and the B-galactosyl adducts methyl-B-galactoside or ethyl-6-

galactoside, respectively. If substrates wi th diEerent aglycone groups react in

such a way as to produce a cornmon intermediate that can react with water

and an added acceptor, the ratio of galactose to i3-galactosyl adducts should be

the same regardless of the leaving group (Sbkes and Wilson, 1972). (This

assumes that the same amount of ethanol or methano1 are added.)

Cunversely, if no common intermediate is formed, the leaving group will

infiuence the relative ability of two substrates to serve as acceptors. This

method has been used to demonstrate a common enzyme intermediate in

reactions catalyzed by chymotrypsin apand and Wilson, 19631, trypsin and

alkaline phosphatase (Barrett et al., 1969). The aglycone group for d

substrates could be quantilied spectrophot~metridy~ The amount of methyl-

&galactoside or ethyl-li-galactoside was measured radiometrically using 14C

labeled methanol and ethanol. The amount of galactose was determined by the

difference. Stokes and Wilson (1972) found that a constant ratio of products

(galactose : 8-galactosyl adducts) was obtained for al1 the substrates with

methanol as the added acceptor and also a (different) constant ratio when

ethanol was the acceptor. This is s b n g evidence that a common galactosyl-

enzyme intermediate is involved in the reahon mechanism for the enzymatic

hydrolysis of Pgalactosidase. Although these studies provide strong evidence

for the existence of a common intermediate they codd not reveal the nature of

the intermediate. The authors (1972) proposed that it was either a stabilized

carboniun ion intermediate or a galactosyl enzyme intermediate.

1.2.3.4 Evidence for a Covaient GalactosyI Enzyme Intermediate

Withers and Street (1988) were able to trap a covalent glycosyl enzyme

intermediate using a mechanism based inhibitor (2-deoxy-2-fluoro-D-

glycosylfluoride). This novel approach to mechanism based inhibition 04

glymsidases not only pmvided evidence of a covalent enzyme intermediate but

also helped to iden- Glu-537 as the nucleophilic srnino acid in the active site

of 8-galactosidase (Gebler et al., 1992). The inactivator reacted wi th Glu-537

to form a 2-fluorogalactosyl ester. This suggests that the reaction mechaninm

of B-galactosidase must involve a covalent galactosyl ester intermediate with

Glu-53 7.

1.2.3.5 Nature of the Transition State

In order to catalyze reactions efficiently enzymes must lower the

activation energy of a chernical reaction. Enzymes are believed to do this by

transition state stabilization, A common feature of the architecture of

enzymes is that their active site is complementary to the transition state. As

a result they bind the transition state more tightly than the substrates or

products. This results in increasing the reaction rate. Although the transition

state does ercist it cannot be isolated and it can only be studied and

characterized indirectly. Transition state analogs are compounds that

resemble the transition state of an enzyme and bind more tightly to the

enzyme than do compounds with structures resembiing the ground state of the

substrate. Therefore, transition state analogs are usefid for studying the

nature of the transition state.

Studies done by Huber and Gaurit (1982) show that amino groups

dramatically improved (10-30 fold) the abLli@ of sugars and alcohols to interact

with free B-galactosidase in cornpetition with substrate - especially if the

structures of the s u g a r s or alcohols resembled D-galactose. The amho groups

on the sugars and alcohols have a positive charge. Elimination of this positive

19

charge eliminates their inhibitory effect. A plausible explanation for these

f h d . s is that there is a negative charge near the galactose binding site of 6-

galactosidase. Huber and Gaunt (1982) found that 1-aminogalactose (Ki =

0.029 mM) was a much better inhibitor than 2-aminogalactose (Ri = 1 mM)

and both of these amino inhibitors inhibited much better thiin D-galactose (Ki

= 34 mM). This suggests that the negative charge in the active site m u t be

close to the position that the anomeric carbon of galactose binds on the

enzyme. These inhibitors are believed to bind tightly because the positive

charge of the amho group is stabilized by a negative charge in the active site

which normally stabilizes an oxocarbonium ion transition state of O-

galactosidase. These hdings suggest that the transition state has a positive

charge that is stabjlized by a negative charge in the active site.

Studies done with mutant B-galadosidases with substitutions for Glu-

461 show that binding of the positively charged transition state analog 2-

aminogalactose was dramatically reduced when Gly. Gh, His and Lys were

substituted for Glu-461 (Cupples et al., 1990). However, when Asp was

substituted for GIu-461 this inhibitor bound even better than did the wild type

enzyme. Since both Asp and Glu are negatively charged, this suggests that

Glu-461 electrostatically interacts with a positively charged galactosyl

transition state intermediate,

Huber and Brockbank (1987) have carried out studies with planar

compounds that have hydroxyl orientations equivdent to D-galactose (L-ribose

and D-galactonolactone). The results of these studies show that these planar

inhibitors bound tightly to the enzyme and were better inhibitors than D-

galactose. This suggests that the transition state may have a planar

structure.

Taken together the resdts of these inhibitor studies suggest that the

transition state has a planar structure and a positive charge near to the

anomeric carbon, Site specific mutation studies with residues that are

believed to bind the transition state support the proposed transition state

structure.

1.2.3.6 The Distinction Between Transition States and Covalent

Enzyme Intermediates

When discussing the transition state and the covalent enzyme

intermediate involved in the Rgalactosidase reaction it is important to make

the distinction between transition s t a t e s and intermediates. The transition

s t a t e occurs at a maximum high energy point on a reaction profile. The

transition state pmbably has bonds that are partially broken andlor others

that are partidy formed. An intermediate contains covalent bonds or salt

links and resdts in a local minimum on the energy profile. The intermediate

can resemble the transition state because of their proximity on the reaction

profile. However, they are not the same, Transition states are very unstable

whereas intermediates are relatively more stable.

1.2.4 Mg2+ Requllement of B-Galactosidase

The la& 8-galachsidase of E.coZi requires Mg2+ for maximal activity

(Tenu et al., 1972; Huber et al., 1979). Equilibrium dialysis revealed that one

Mg2+ per monomer correlated with maximum activity (Case et al., 1973;

Huber et al., 1979). Although B-galachsidase requires Mg2+ for full activity it

is known that &IO% of the normal bgalactosidase activity is leR at pH 7.0 in

the absence of Mg2+ (Strom et al., 1971; Case et al., 1973; Tenu et al., 1971,

21

1972; Huber et al., 1979). The exact role of Mg2+ is unknown and remains

somewhat controversid. It has b e n proposed that the active site Mg2+ may

either stabilize a favorable conformation of the enzyme (Case et al., 1973) or

to act as an electrophilic catalyst ( S h o t t et al., 1975). It has also been

suggested that Mg2+ may not be directly involved in catalysis but might play

an indirect role in orienting the residue believed ta be the acid catalyst

WirateIIe and Yon 1973; Richard et al., 19%).

Selwood and Sinnott (1990) found that the solvent-kinetic-isotope

effects are negligible for hydrolysis of 4-nitrophenyl-I3-D-galactopyranoside

(PNPG) by the M$+ free enzyme suggesting that acid catalysis or electrophilic

catalysis was absent in the Mg2+ f+ee enzyme. The Mg2+ saturated enzyme,

however, had a pronounced solvent isotope effect on kCat with PNPG. They

showed that this arose h m the trader of a single proton. Since ht is equal

to kz (gdactosylation) for the hydmlysis of PN'PG they suggested that proton

trausfer must be occufiing during galactosylation.

When 3,4-DNPG was used as the substrate, the hydrolysis of the

glycosyl enzyme intermediate (k3) was the slow step. There was no solvent

isotope effect observed on the kcat when 3,4DNPG was used as the substrate

suggesting that proton transfer (base catalysis in this case) is probably not

o a x m h g during degalactosytation (ka), Based on the findings fiom the solvent

isotope effects, Selwood and Sinnott (1990) proposed that electrophilic rather

than acid catalysis is operating in the galactosylation step (k2) and that Mg2+

is acting as the electrophilic catalyst in fhgalactosidase. They suggest that

Mg2+ forms a Lewis type of interaction with water cauçing the water to a d as

an acid catalyst. They proposed that Mg2+ facilitates this interaction by

electrostaticdy stabilizing the hydroxide formed fkom the water upon acid

22

hydrolysis. The hydroxide is then able to act as the nucleophile in

degaiactosylation.

1.2.5 The pH Profile of &Gaïactosidase

8-Galactosidase of E-coli is stable between pH 5.5 and 10.5 but

irreversibly denatures at pH values Iess than 5.0 and greater than 10.5.

Several studies have been done to investigate the pH dependence of the

galactosylation step (k2) and the degalactosylation step (ka) for the 8-

galadosidase reaction. Studies done by Huber et al. (1983) have shown that

the pH optimum of the enzyme is 7.0 with ONPG as the substrate (k3 is the

rate determinïng step) and 7.6 w i t h PNPG or lactose as the substrate &2 is

the rate determining step). Early studies (Tenu et al., 1971) have suggested

that at 1 mM Mg2+, the rate limiting step is not the same at acidic as at

neutral pH values. The limiting rate constant for ONPG was found to be k2 in

the acidic range (pH < 5 ) in 1 mM Mg2+. At pH values higher than 5, k2 was

found to rapidly increase with pH and become the same order of magnitude as

k3 at pH 7.0. Furthermore, the Km value for B-gdactosidase was found to

increase as the pH decreased. These studies also showed that, as the pH

declined below 7.0, the bt decreased for the enzyme in the presence of 1 mM

Mg2+. It was suggested that a concentration of 1 mM Mg2+ is not sufEiQent to

saturate the enzyme and to promote d a 1 activation at pH values below

pH 6.0. This possibilim has recently been investigated by Martinez-Bilbao and

Huber (1996). When the concentration of Mg2+ was kept high, the Lt values

also remained high even at low pH values down to pH 5.0. However, the

concentration of Mg2+ required to activate the enzyme increased dramatidy

as the pH decreased. Although the pH optimum with ONPG as the substrate

23

is 7.0, the resdts of this study show that as long as the Mg2+ is present in

sufficient concentration to bind, the catalytic activity should rernain at the

m&mum level even at pH values as low as 5.0. The fact that the kat remained the same at d pH values suggests that k2 and ka must remain the

same between pH 5.0 and 7.6 as long as Mg2+ is saturating (since kt = (kz

k3)/(kz + k3). Furthemore, when PNPG was used as the substmte, the results

were almost identical to those obtained with ONPG over the same pH range.

Since k2 is rate Iimiting for PNPG, k2 does not change over that pH range. In

this study it was also show11 that when Mg2+ is saturating, the Km values at

all pH values had similar low values of about 0.13 mM. This finther supports

the h d i n g that the k2 and fr3 values do not change with pH at saturating

concentrations of Mg2+ (Martinez-Bilbao and Huber, 1996).

It has been suggested that the activity of 8-galactosidase is controlled

by at least one unprotonated group which ionizes in the acidic range and by a

protonated group which ionizes in alkaline pH range. The pH behavior of B-

galactosidase is influenced by Mg2+ in the alkaline pH range. The bat decreases as the pH is increased fkom 7 to 9 with a pKa of 8.4 in Mg2+ enzyme

and a pK of 6.5 in Mg2+ fiee m e .

In the alkaline region (pH > 7.0) the pH behavior depends upon which

step, gdactosylation (ks) or degalactosylation (k3) is rate determinhg (Huber

et al,, 1983). Tenu et al. (1971) report that k2 and k3 decrease in a parallel

m e r with pH. Shnott and Viratelle (1973) have reported that ka has a

pRa of 9.3 and has a pKa of 8.9 and they have suggested that the ciifference

between these two values is not big enough to be significant and thus consider

the values to be the same. The studies done by Huber et al. (1983) suggest

that k2 and ka vary differently with pH. When ONPG was used as the

substrate k2 and ka are roughly equal and partially rate determining. The Lt vs. pH cwcve for ONPG was very narrow. The activity was maximal at pH 7.0

and steadily dropped as the pH was increased h m 7.0 to 10. This m e had

an idection point at pH 8.6. When PNPG or l a d s e are used as substrates k2

is rate determining. The Lt vs. pH curve for PNPG or lactose was found to be

broad with a pH optimum at 7.6. The activity decreased only at pH values

greater than 8.0. The curve had an infiection point at 9.4, These studies

suggest that k2 and k3 have dserent pKa dependencies.

i f a residue is acting as a generd acid/'base catalyst, k2 should decrease

as the pH is increased (since the aQd catalyst m u t be protonated to deave

the glycosidic bond). On the other hand the ka value is expected to increase as

the pH is increased (since the base catalyst must be unprotonated ta remove a

proton from the water molecule). However, the above studies showed that the

values of both kz and k3 decreased as the pH was increased from 7 ta IO.

Perhaps another pH controlled factor may be k l v e d in k3. This factor may

result in a large rate reduction that masks a smaller base catalytic rate

increase. Unpublished results from Dr. Huber's lab suggest that this pH

controlled factor could be the donation of a proton h m T~T-503 to the covalent

galactosyl-enqme intermediate ta facilitate deavage of this intermediate.

1.2.6 The Structure of l3-Galactosidase

The x-ray crystal structure of this enzyme (Jacobsen et al., 1994)

provided a great deal of information about the stmcture of B-galactosidase.

Each polypeptide chah folds into five compact sequential domains dong with

50 additional residues at the N-terminus. The monomers make two different

types of monomer-monomer contacts when they interact t o form the

tetrameric protein. The two contacts are referred to as the activating

interface and the long interface. The 50 additional residues at the N-terminw

form an extended segment (the a-peptide) which contributes to the activating

interface. The activating interface involves interactions with the N-terminal

segment and domRins 3,4 and 5.

A jelly roll &barre1 comprises the first domain, The first and third

strands of the &barre1 are comected by a segment of the peptide that forms a

pmtmding loop (residues 272-288) that extends across the activating interface

to a neighboring monomer. Tbe second domain contains a fibronectin type El

fold. The third domain consists of a distorted TIM barrel and contains t he

catalytic active site. This is refemed to as a distorted TZM barrel because

typical TIM barrels consist of eight dl3 repeats. The distorted TIM barrel on

the other hand lacks the fifth h e k and the sixth p d e 1 strand of the barrel is

distorted This irregulariQ creates a hole or a space. This space is occupied by

the Ioop (residues 272-288) that extends fiom the second domain of a

neighboring monomer. This loop contributes to the integrity of the active site.

It stabilizes the main chain in the vicinity of the Mg2+ binding ligands. The

f o h domain consists of residues 628-736 and it is topologically similar to the

second domain. The core of the fWh dornain consists of a novel 18-stranded

antiparallel sandwich. The Gfth domain contains an kegular arrangement of

segments positioning -999 at the active site. Domain 5 also donates a loop

near the active site that contains Gly-794. This loop is mobile and it is believed

to cover the active site when a substrate is bound. Studies of these two

residues are the focus of this report.

The C-terminal ends of the B-sheet strands of the distorted TIM barrel

form a deep pit. The three dimensional structure of B-galactosidase shows

26

that Glu-461, Tyr-503 and Glu-537 are found close together within the pit.

Several studies, induding kinetic studies and affinity labeling studies have

suggested that these h e e residues are important in the active site and are

important for catalysis. Therefore, this pit is the proposed location of the

active site. The active site contains two Glu (Glu461 and Glu-537) that are

positioned across h m one another in the active site and bot , have their side

chain carboxyls extendhg into the active site. The carboxylate side chain of

Glu-537 appears ta be aligned through hydrogen bonds with the hydroxyl group

of Tyr-503 and the guanidino group of Arg-388. The active site also contains

many other potential hydrogen bond acceptms and donors; Asn-102, Asp-201,

His-357, His-391, His-540 and Asn-604. The active site has a hydropbobic

region and the hydrophobic w d s making up part of the active site are

contributed by Met-502, Trp-568, Trp-999 and Phe-601. The side chRins of

Glu-461, His 418 and Glu-416 appear to co-ordinate the Mg2+ at the active

site.

1.3 PROBING THE ACTLVE SITE

1.3.1 Inhibitor Studies

There are two main types of reversible inhibitors of enzymes: substrate

analog inhibitors and transition state analog inhibitors. Substrate Rnslog

inhibitors have their gdactosyl moiety in the pyranosyl chair conformation

and thus resemble the galactosyl moiee of B-D-galactopyranosyl substrates.

IPTG and PETG and Iactose are examples of substrate analog inhibitors.

IPTG and PETG contain a i3-thio-galactosyl bond which cannot be hydrolyzed

by B-galactosidase. Although lactose is the natural substrate for 0-

galactosidase, its inhibition constant can be detennined because of its very

slow catalytic breakdown compared to the synthetic substrate, ONPG.

There are two main types of transition state analog inhibitors. The firçt

class resemble galactose but have a planar shape around the anomeric

carbon. Furanoses (in the envelope conformation) and lactones (in the half

chair conformation) are examples of this class of inhibitors (Huber and

Brockbank, 1987). D-Galactal and D-galactonolactone are strong inhibitors of

8-galactosidase (Huber and Brockbank, 1987; Lee, 1969). They are believed to

inhibit B-galactosidase because they mimic the planar oxocarbonium ion

transition state. The furanose form of L-ribose is a potent inhibitor of 13-

galactosidase. It is predominantly in the envelope conformation which is

planar about its anomeric carbon. The orientations of the hydroxyls at

positions C3 and C4 are equivdent to the hydroxyls at the C3 and C4 positions

of galactose. The second class of transition state analog inhibitors have a

positively charged group in the vicinity of the anomeric carbon (Huber and

Gaunt, 1982). The fa& that these compounds have a positive charge makes

them resemble the oxocarbonium transition state and, as a result, these

inhibitors bind tightly to 6-galactosidase. 2-Amino-galactose is an example of

this type of transition state analog inhibitor.

Both types of transition state analog inhibitors bind tightly to 13-

gdactosidase. This is because they resemble the planar galactosyl

oxocarbonium ion that is probably formed as a transition state during

reactions.

28

1.3.1.1 Determination of El and Kin V a l ~ e ~

The reaction of B-galactosidase with compounds wbich are both

competitive inhibitors and acceptors is shown in Figure 1.4. If the inhibitor

binds to the fke form of the enzyme it results in competitive inhibition and this

is measured by the R, value. If the inhiiitor binds to the galactosyl form of the

enzyme, it acts as an acceptor during degalactosylation and this is measured

by the Ki" value. Studies have shown that inhibitors bind well only to the

galactose subsite of the fkee enzyme. Huber and Gaunt (1983) found that

inhibitors that closely resembled galactose bound better to the £ree enzyme

(lower Ki value). Glucose binds poorly to the free enzyme but it binds well to

the galactosyl form of the enzyme suggesting that the glucose subsite is

mainly absent in the free form of the enzyxie (Deschvanne et al., 1978) but is

important in the galactosyl form of the enzyme. It is believed that a

conformational change probably occurs &r cleavage of the glycosidic bond

and after the aglycone has difiùsed away, the glucose subsite of the galactosyl

form of the enzyme binds glucose tightly. The acceptors can only bind to the

galactosyl form of the enzyme since it is the only form that has a site for

binding glucose (glucose subsite) present.

1.3.2 Site Directed Mutagenesis

Site directed mutagenesis is a fundamental bol used by researchers to

study protein structure and firnction. At least one nucleotide in a DNA

sequence is specifically changed so that proteins which have single amino acid

Figure 1.4: The mechanism of B-galactosidase action on compounds which are hth cornpetitive inhibitors and acceptors. & is the dissociation constant for lactose. k2 is the rate constant for the breaking of the 13(1-4) hkage in the lactose. kg is the rate constant for the release of the galactose portion of the lactose after hydrolysis and is the rate constant for the release of the acœptor-galactose complex. Ki is the dissociation constant fo i the inhibitor (A) and Ki" is the dissociation constant for the acceptor (A). A is both the acceptor and cornpetitive inhibitor, GA is galactose, GA-A is the acceptor- galactose complex, and BOR is the aglycone portion of the substrate. E is the k e enzyme, E *A is the enzyme-inhibitor complex, E GA-OR is the enzyme- lactose cornplex, E ,GA is the galactosyl form of the enzyme and E * GAoA is the gdactosyl form of the enzyme with an acceptor bound.

30

substitutions at a desired site in the protein are produced, The method was

introduced by a l l er and Smith (1982). At the end of 1982 three papers were

published reporting site directed mutagenesis of amino acid residues in

enzymes of defked mechanism Wlter et al., 1982; Dalbadie-MiFarland et al.,

1982; Sigal et al., 1982). Since then literally thousands of papers have been

published that use the bol.

Fersht and mworkers have used site directed mutagenesis to study the

importance of transition state stabifization in enzyme reactions. The

transition state of some enzymes is stabilized primarily through hydrogen

bonding. One reason for this is that the hydrogen bond strength is highly

dependent on the orientation and distance between the donor and acceptor and

thus is highly discriminating between the ground state (substrates) and the

transition state (Fersht et al,, 1984). Mutation of each of the hydrogen bonding

residues in the active site gives an idea of their contribution to the binding of

the transition state. Carefüi kinetic analyses of these mutants sheds light on

the role of the substituted residue in catalysis, binding substrates and binding

transition states. Kinetic analysis of the mutant enqmes in combination with

the high resolution structural data provided by x-ray crystallography allow

direct measurements on the relationships between structure and fûnction.

133.1 Reaction Pmfiles

A typical energy profile for a simple kinetic scheme is shown beIow.

In this energy diagram E represents the free enzyme and S represents the free

substrate. ES represents the enzyme-substrate mmplex and ES* represents

the transition state. The fiee energy of activation for bond making and bond

breaking is represented by A&. AGs represents the substrate binding energy.

The free energy change between the transition state (ES$) and the free

enzyme and the substrate (in the gmund state) is represented by AG^^ The

& value is related to AG,* by the following equation N

R is the gas constant, T is the absolute temperature, k~ is Boltzmann's

constant, h is Plank's constant (Fersht, 1974) and k ~ T / h is the fkequency at

which the activated complex breaks apart. The kca& value is a measure of

transition state stabilization in Rgalactosidase. The greater its value, the

more stable is the transition state (ES*). When an amino acid in the wild type

32

enzyme is replaced with another by site directed mutagenesis the difference of

the energetic contribution between the substituted side cha;n "Rs and the wild

type enzyme (MG& to transition state stabilization can be found:

1.4 ACTIVE SITE GROUPS OF ISIGALACTOSIDASE

Before the structure (Jacobsen et al., 1994) became available, studies

involving affinity labeling, mechanism based inhibitor studies and site specific

mutagenesis followed by detailed kinetic analysis of the mutants were carried

out. This has helped to identm active site residues and to determine their

d e s . The crystal structure of the active site is shown in Figure 1.5.

1.4.1 Active Site Histidine Residues: His-357, His-39 1, His-450, His-540

and Eis-418

Each B-galactosidase monomer has 34 histidines (Kalnins et al., 1983).

Sequence alignment studies of related &galactosidases show that four of these

His residues (His-357, His-391, His-450 and His-540) are conserved in al1 the

related i3-galactosidases that have been sequenced to date (Kalnins et al.,

1983; Stokes et al., 1985; Buvinger and Riley, 1985; Schmidt et al., 1989;

Schroeder e t al., 1991; Burchardt and Bahl, 1991; David et al., 1992; Fanning

et al,, 1994; Leahy and Roth, unpublished observations; Hancock et al,, 1991;

Poch et al., 1992). The imidazole side chah of His has a pKa near neutral and

therefore it can gain or lose protons as a result of small changes in the local

environment of the enzyme. Thus, His is often found within the active site as

an acidhase catalyst (at physiological pH), as a metal chelator or as a

Figure 1.5. The crystal structure of the active site of B-galactosidase (Jacobsen et al., 1994). In this figure the purple bal1 represents Mg2+ . The three Mgz+ binding ligands (Glu-461, Glu-416 and His-418) are shown in dark pink The loop extending h m residues 793 to 804 is shown in red with Gly-794 labeiled in green. The active site nudeophile Glu-537 is shown in purple dong with Tyr-503. The active site His residues are also shown in purple. Trp999, located in the glucose subsite, is shown here in yellow.

nudeophile. His is also able to act as a hydrogen bond donor or acceptor for

substrate bïnding and transition state sbbilization. Roth (1995) and Roth et

al. (1995) investigated the d e s of the conserved His residues using mutant B-

galactosidases with site directed substitutions at these positions. The Lt and Km values of H450F- and H45OEl3-galactosidases were essentially the same

as the kt and Km of the wild type enzyme. This suggests that His-450 is not

important for catalytic activiQ and has only a very small effect on stability

(30th 1995). Es-540 is believed to be important for buiding substrates and

stabilizing the transition state of the reaction by interacting with the C6

hydmxyl of gdactose (Roth and Nuber, 1996). Overall the results of substrate

analog inhibitor studies imply that His-357 and His-391 are probably not

required for the binding of galactose (in the gmund state) in 8-galactosidase but

are required for stabfization of the transition state. The galactosylation step

(k2) was much more affected than the degalactosylation step (k3) by

substitution for His-357. It was found that both the substituted enzymes

bound a transition sta te inhibitor that lacked a C3 hydroxyl group (L-

mannonolactone) as well as the wild type enzyme (unpublished hdings fiom

Dr. Huber's lab). This suggests that His-391 and His-357 interact with the C3

hydroxyl group of the transition state. This can be explained by preliminary

structural evidence that places His-391 and Es-357 near to the C3 hydroxyl

group of the transition state (Doug Juers and Brian Matthews, personal

cornunication with Dr. Huber).

Another highly conserved His residue is His418. His-418 is conserved

in eight of the nine related B-gdactosidases sequenced to date (Kalnins et al.,

1983; Stokes et al., 1985; Buvinger and Riley, 1985; Schmidt et al., 1989;

Schroeder et al,, 1991; Burchardt and Bahl, 1991; David et a., 1992; Fanning

36

et al., 1994; Leahy and Roth, unpublished observations; Hancock et al., 1991;

Poch et al., 1992) exœpt that h m Clostridium thnnosulfurogenes (Burchardt

and Bahl, 1991). Using site directed mutagenesis Roth and Huber (1994)

determined the effect of substitutions of His-418 by Phe (H418F-13-

galactosidase) and by Glu (H41SE-13-galactosidase). The H418F-8-

galactosidase was unable to bind Mg2+ and had kinetic properties sîmilar to the

metal-free wild type enqme whereas H418E-B-gdactosidase retained the

ability to bind Mg2+. These results suggest that His-418 may be an inner

sphere ligand for AC$+. The cryst. structure of B-galactosidase showed that

His-418 is indeed an inner sphere ligand to Mg2+ (Jacobson et al., 1994).

1.4.2 Glu416

Glu-416 is wnserved in seven of the nine 6-gdactosidases sequenced to

date (Kalnins et al., 1983; Stokes et ai., 1985; Buviager and Riley, 1985;

Schmidt et al., 1989; Schroeder et al., 1991; Burchardt and Bahl, 1991; David

et al., 1992; Fnrining et al., 1994; Leahy and Roth, unpublished observations;

Hancock et al., 1991; Poch et al., 1992). The crystal structure of B-

galactosidase (E.coli) indicates that Glu-461, E s 418 and Glu-416 are

positioned in such a way that they could act as metal ligands at the active site

(Jacobson et al., 1994). Both E416Q- and E416V-13-galactosidases have

dissociation constants between 1 and 20 mM Mg2+. This is much higher than

the Mg2+ dissociation constant (1 pM) for the wild type enzyme (Roth and

Huber, 1995) and strongly suggests that Glu-416 is a ligand to the active site

Mg2+ of B-galactosidase (E.coli).

37

L4.3 Glu-537

(311-537 is conserved in al1 nine of the homologous B-galactosidases

( K a h h et al., 1983; Stokes et al., 1985; Buvinger and Riley, 1985; Schmidt et

al., 1989; Schroeder et al., 1991; Burchardt and Bahl, 1991; David et al., 1992;

F M g et al., 1994; Leahy and Roth, unpublished observations; Hancock et

al., 1991; Poch et al., 1992). Studies using the mechanism based inhibitor 2'-4'-

dinitrophenyl-2-deorty-2-fluoro-0-D-gade (2F-DNPG) have shown

that Glu-537 is the active site nucleophile (Gebler et al., 1992).

Inactivation by 2F-DNPG was a result of the accumulation of a stable

covalent 2-deoxy-2-fluoro-galactosyl ester enzyme intermediate. This

intermediate became trapped. It was, however, catalytically competent since

it c d d be slowly hydrolyzed. The substitution of an electronegative fluorine

atom for a hydroxyl group at the C2 position results in destabilizing the

transition state since the C2 hydroxyl is involved in transition state

stabilization. This results in a decrease in both the rates of galactosylation

(k2) and degalactosylation (k3). If degalactosylation (k3) is sdliciently slow

compared to galactosylation (k2) the glycosyl enzyme intermediate can be

trapped and the enzyme is thereby inhibited. The presence of the good leaving

group 2,4-dinitrophenol as the aglycone in 2F-DNPG results in increasing the

galactosylation step (k2) allowing it to take place. The fluorine at the C2

position of the galactosyl-enzyme intermediate results in inductive

destabilization of the transition state. These factors keep the

degalactosylation rate (kg) slow relative to the galactosylation rate (k2)

resulting in the accumulation of the intermediate.

Using site directed mutagenesis, Glu-537 of B-galactosidase was

replaced by Asp, Gln and Val (Yuan et al., 1994). The enzymes with GIn

38

(E537Q) and Val (E537V) substitutions were totally inactive. The Asp

substituted enzyme (E537D) did have activity but the bt was 100 fold lower

than for the wild type enzyme (Yuan et al., 1994). This suggests that Glu-537

is essential for the activity of B-galactosidase fiom E.coli.

L4.4 Met-502

Studies using alkylating reagents have demonstrated that these

reagents inactivate 8-galactosidase by akylating a single methionyl residue

near the active site of the enzyme (Yariv et al., 1971; Naider et al., 2972). This

inactivation is reversible in the presence of mercaptoethanol. Naider et al.

(1972) substituted al1 of the Mets of B-galachsidase with norleucine. This

substituted enzyme was active and was not inactivated by N-bromoacetyl-l3-

D-galactosamine (alkylating reagent) suggesting that this Met residue is not

necessary for catalytic activity. Chernical modification of B-galactosidase by

&D-galactopyranosyImethyI4nitrophenyl~~e identified Met-502 as an

active site residue (Sinnott and Smith, 1978). Met-502 is conserved in seven of

the nine related B-galactosidases sequenced to date. The c r y s t d s t r u m of

l3-galachsidase reveals that Met-502 is indeed in the active site (Jacobsen et

al., 1994). Although Met-502 is in the active site, it is not required for

catalysis. This finding led to the suggestion that Tyr-503, which is adjacent to

Met-502 in the active site, may be involved in the catalytic action of l3-

galactosidase.

1-45 -503

Sequence andysis bas revealed that all of the related B-galactosidases

had a conserved Tyr at position 503 (Halnins et al., 1983; Stokes et al., 1985;

39

Buvinger and Riley, 1985; Schmidt et al., 1989; Schroeder et al., 1991;

Burchardt and Bahl, 1991; David et al., 1992; Fanning et al., 1994; Leahy and

Roth, unpublished observations; Hancock et al., 1991; Poch et al,, 1992)

suggesting that Tyr-503 may be catalytically active. Ring et al. (1985) studied

m-fluorotyrosine substitution in B-galactosidase and found that a Tyr in the

active site of &galactosidase may be acting as a general acidhase catalyst in

the hydrolytic reaction. Using site directed mutagenesis Tyr-503 was replaced

with Phe (Ring et al., 19881, His, Cys and Lys (Ring and Huber, 1990). The

activities of the substituted enzymes were greatly reduced compared to the

wild type enzyme and Y503K-O-galactosidase was essentidy inactive (Ring

and Huber, 1990). These suggested that Tyr-503 is indeed important for the l3-

galactosidase mechanism. The rrystal structure of B-galactosidase (Jacobsen

et al., 1994) indicates that Tyr-503 may play a role in positioning Glu-537 (the

nudeophile) in the active site and a d as an acid catalyst to facilitate the

breakage of the galactosyl ester intermediate in the degalactosylation (hl

&p. Unpublished findings h m Dr. Huber's lab support this latter role.

1.4.6 G l u 4 1

1.4.6.1 Glw461 as an Acid Base Catalyst

Glu-461 is completely consemed in al1 homologous glycosidases

sequenced to date (Halnins et al., 1983; Stokes et al., 1985; Buvinger and Riley,

1985; Schmidt et al., 1989; Schroeder et al., 1991; Burchardt and Bahl, 1991;

David et al., 1992; Fanning et al., 1994; Leahy and Roth, unpublished

observations; Hancock et al., 1991; Poch et al., 1992). Herrchen and Legler

(1984) showed that Glu-461 is important for B-galactosidase activity using the

active site directed irreversible inhibitor, conduritol C cis-epoxide. This

inhibitor reacts exclusively with Glu461 and inactivates i3-galactosidase

(Herrchen and Legler, 1984).

It has been suggested that Glu-461 is a general acidhase catalyst which

protanates the leaving group and deprotomtes the attacking water molede

(Gebler et al., 1992). Site directed substitutions for Glu461 cause dramatic

reductions in enzyme activity (Bader et ai,, 1988; Cupples et al., 1988; Cupples

et al. 1990). The Km values of the substituted B-galactosidases (with ONPG

and PNPG) ruled out poor substrate binding as a possible cause for the low

activity. The 3-dimensional structures of different glycosidases have been

determined by x-ray crystallography (Blake et al., 1965; Boel et al., 1990;

Rouvinen et al., 1990) and in all of these enzymes, the likely acidhase catalyst

has been identified as the carborrylic acid side chain of an aspartic or glutamic

acid residue, supporting the suggestion Glu-461 may be an acid-base catalyst.

Cupples et al. (1990) found that both the rate of galactosylation and the rate of

degalactosylation was afTected by the substitution. Substitution of Glu461 by

Asp, Gly or Gln resulted in very large changes in the rate of galactosylation

(k2) with lactose as the substrate but relatively small changes in the kz value

with the synthetic substrates, ONPG and PNPG. Studies done by Richard et

al. (1996b) also suggest that Glu-461 functions directly as an acidhase

catalyst at the leaving group nudeophile and that Mgz+ plays a secondary role

in ensuring that such catalysis is optimal.

1.4.6.2 Role of Glu461 in ~ g 2 + Binding

Edwards et al. (1990) substituted negatively charged Glu-461 (0-

galactosidase) with other amino acids (Gln, Gly, Lys and His) and found that

the &ni@ of the substituted enzymes for Mgz+ significantly decreased

compared to the wild type enzyme. However, when Asp was substituted for

Glu-461, the substituted enzyme showed no clifference in binding Mg2+. These

resdts suggest that the negatively charged side chah of Glu-461 is important

for divalent cation binding ta B-galactosidase and a change in the charge at this

position dramatically affects Mg2+ interactions. Recent s t m c t u r a f work shows

that indeed Glu461 dong with His-418 and Glu416 are ligands to Mg2+

(Jacobson et al., 1994). Acid catalysis and metd liganding are mutually

exclusive roles since Glu461 would have to be protonated if it is to act as an

acid catalyst while metd liganding r e q e s a deprotonated species (Martinez-

Bilbao and Huber, 1996). However, it is possible that Glu-461 is released fkom

Mg2+ upon binding of the substrate so that it can pick up a proton and act as

an acid catalyst. The simplest proposal that recondes these apparently

conflictuig conclusions is that the enzyme-bound Mg2+ functions to ensure

optimal acidhase caîalysis by Glu-461. Richard et al. (1996a) have shown

that the carboxylic acid side chain of Glu-461 undergoes a substantial decrease

in the pXa upon conversion of the wild type enzyme to the galactosylated bm. .

They proposed that the change in pK, is caused by movement of the bound

Mg2+ toward Glu-46 1 on proceeding to the galactosylated enzyme.

1.4.6.3 Role of Glu461 in Transition State Stabilization

Cupples et al. (1990) found that substitution of Gh, Gly, His o r Lys for

GIu-461 resdted in mutant B-galactosidases with reduced ability to bind 2-

aminogalactose. When Asp was substituted for Glu-461 the substituted

enzyme bound 2-aminogalactose better than the wild type e n w e . Since 2-

aminogalactose is a positively charged transition state analog inhibitor these

hdings suggest that Glu461 may function to stabilize the transition state.

The negative charge on the Glu side chain may act to stabilize the positivelg

charged galactosyl transition state via an electrostatic interaction. Im

addition, it is now believed that Glu-461 also binds the hydroxyl at the C2

position of the transition state, this further helps to stabilize the transition

state (Juers and Matthews, personal communication with Dr. Huber).

Martinez-Bilbao et al. (1995) studied E46i.H-f3-galact~sidase. E46i.H--15

Galactosidase had very different divalent metal interactions than the wild type

enzyme. This substituted enzynie was inactivated by Mg2+. This inactivation

was found to be reversible and pH dependent. These results suggest that Glu-

461 may function to stabilize and to position a galactosyl cation intermediate

and that Mg2+ might align and modulate the efEect of Glu-461.

1.4.6.4 Nucleop hilic Activation of &Galactosidases with Substitutions

for Glu461

Neutra1 (Gln o r Gly) or positively charged (Lys) substitutions for Glu-

461 result in mutant i3-galactusidases that can be activated by nucleophiles

(Buber and Chivers, 1993). Azide was the best activator (Huber and Chivers,

1993) for the three substituted 13-galadosidases. h i d e is a small molede

with some positive character but one net delocalized negative charge. Ahmed

(1996) also showed that azide or acetate ions restored some of the ability of

E461GO-galactosidase to bind and stabilize the transition state.

Substitution of Glu-461 with neusal or positively charged amino acid

residues produced mutant 13-galactosidases which are not only activated by

nucleophiles but also produce adducts between D-galactose and the

nucleophiles. The adducts were B-galactosyl adducts suggesting that the

nucleophile is not directly replacing the aglycone. If direct replacement

occurred, a-adducts should be produced. A probable reason that l3-adducts are

formed is that Glu-537 displaces the aglycone of the substrate and forms an a-

bond to the galactose. The added nucleophiles then displace Glu-537 to form l3-

linked adducts. The production of B-D-galactosyl adducts by these substituted

emqmes is important because it provides an easy way to produce 13-D-

galactosyl adducts without protection of the other hydroxyl groups. Ahmed

(1996) investigated the abiliw of some of these substituted enzymes (E461Q-,

E46lK- and E461Gi3-galactosidase) to form &galactosyl adducts.

The activation of E461G-8-galactosidase by nucleophiles results not

only h m the nucleophile acting as an acceptor forming B-galactosyl adducts

but also because the nucleophile is complexed by Mg2+ (Ahmed, 1996). This

interaction enables the nucleophile to stabilize the carbonium ion transition

state.

1.4.7 Trp-999

Trp-999 is located in the hydrophobic region of the active site (Jacobsen

et al., 1994). It is believed to be located in the glucose subsite in a hydrophobic

region &ed the hydrophobic wd. Hydrophobie regions are not unusual in

carbohydrate binding proteins (Quiocho, 19%) and carbohydrates probably

interact with the protein by hydrogen-bonding and hydrophobic interactions.

Examination of a sugar ring reveals that sugar rings have one face with

significant hydrophobic character. Amino acid residues with aromatic side

chwns (primady tryptophan and tposine) are hydrophobic and are believed to

stack against the hydrophobic sugar face. The role of conserved Trp residues

in the cellulose binding domain of xylanase (Pseudomorurs t1mresen.s) has been

investigated (Poole et al., 1993). The consemed Trp was replaced by Ala and

Phe by site directed mutagenesis. The Ala substituted enzyme binds cellulose

much more poorly than the wild type enzyme or the Phe substituted enzyme

suggesting that Trp residues play an important role in the hydrophobie

interactions with cellulose (Poole et al., 1993).

-999 of B-galactosidase (E. coli) is in the Eth domain of the monomer

and is positioned at the active site of B-galactosidase. Using site directed

mutagenesis, several mutant &galactosidases with substitutions of Trp-999

have been produced (Dr. Cupples, Concordia University, Montreal). -999

may be important for binding glucose and retaining it at the active site so that

it can attack the galactosyl enzyme intermediate and form allolactose. This

hypothesis will be discussed in this thesis.

1.4.8 Gly-794

In experiments camied out by Langridge (1968,1969) and Langridge and

Campbe11 (l968), E. coli K12 was treated with N-methyl-Nt-nitro-N-

nitrosoguanidine to produce a variety of mutants. Mutants with increased 13-

galactosidase activity were isolated. Three of these mutants were found to

contain B-galactosidase with higher thermosensitivity, altered substrate

binding constants and a greatly increased ability to hydrolyze lactose and

lactobionic acid (Langridge, 1969). The enzymes were not purified and the

molecular structure which caused the activity changes was not identified

(Langridge, 1969). Martinez-Bilbao et al. (1991) have reported the formation

and the isolation of mutants using methods similar to those described by

Langridge (1969). They found that some of the mutants contained enhanced 13-

galactosidase activity with lactose o r lactobionic acid as the substrate. The

lac2 gene fiom one of these mutants (E-coli REH4) was cloned into a

Bluescriptm plasmid and its entire sequence was determined- The results of

this study showed that the enhRnced activity with lactose arose h m a single

substitution of the Gly at position 794 by an Asp. The f3-galachsidase with

Gly-794 substituted by Asp had dramatically increased activity (5 to 6 fold)

with lactose as the substrate. The kt value for G794D-B-galactosidase was

lower than the kt for the wild type enzyme with ONPG and PNPG as the

substrates. The & value of G794D-&galactosidase was similar with ONPG,

to the Km value of the wild type enzyme. The Km value of the substituted

enzyme was higher with PNPG than the Km value of the wild type enzyme

with this substrate. The substituted enzyme had an increase in the value of k2

(galactosylation) with ONPG, PNPG and lactose as the substrate. The

increase was about 25 fold with lactose as the substrate. However, G794D-8-

galactosidase had a decrease (4 fold) in the ks value (the hydrolysis o r

degalactosylation step) with all of the substrates. The substituted enzyme

bound substrate analog inhibitors (IPTG and lactose) less well than the wild

type enzyme whereas G794D-&galactosidase bound transition state ana log

inhibitors better than the wild type enzyme (Martinez-Bilbao et al., 1991). The

transition state analog inhibitor 2-amino-galactose was the exception. G794D-

J3-galachsidase bound tbis positively charged transition state analog inhibitor

as well as the wild type enzyme. These properties of the G794D-13-

galactasidase were suggested to be due to the presence of a larger side cha.in at

position 794 and not to the presence of a negative charge, To further

investigate the role of Gly-794, Martinez-Bilbao and Huber (1994) constn;icted

several mutant J3-gdactosidases with site directed substitutions for Gly-794

(G794N-, G794E- and G794K-B-galactosidases). The Km values for G794N-

and G794E-B-galactosidases with ONPG as the substrate were similar to the

46

Km values for the wild type enzyme with this substrate. The Km values for

G794N- and G794E-13-galactosidase with PNPG were, however 4 6 times

larger than the normal enzyme. G794K-13-galactosidase had larger Km values

with both ONPG and PNPG than the wild type enzyme. All three substituted

enzymes bound substrate analog inhibitors l e s w d thsn the wild type enzyme

and they bound plansr transition state d o g inhibitors better than the wild

type enzyme. All three substituted fi-galactosidases also showed increased ka

values with PNPG as the substrate. The kz values mered for each enzyme

with ONPG o r lactose as the substrates. Martinez-Bilbao and Huber (1994)

suggested that these properties of the substituted enzyme were due ta the

presence of longer side chah at position 794.

1.4.8.1 Gly 794 and XIoop Movement

Gly-794 is located in one of the only two relatively conserved stretches

in the C-terminal third of the enzyme structure. The x-ray crystal structure of

B-galactosidase (Figure 1.5) has shown that Gly-794 is located at the bottom of

a loop that is adjacent to the active site (Jacobsen et al., 1994). The Ioop is in

contact with an area of the enzyme involved in substrate and transition state

binding. It is located on the opposite side of the active site h m the location of

Glu 461. It does not seem to be in contact wi th any of the peptide ch& on

which the catalytic residues are atbched The loop extends h m residues 793

to 804. Gly-794 seems ta form a hinge for this loop that allows it to be moved

away fiom the active site when no substrate is present. This hinge enables

the loop to make a large swing back to the active site and it covers over the

active site when substrate is present (Juers and Matthews, personal

communication). In the absence of substrate, Gly-794 is in the lower right of

the Ramahdran plane and in a region not avadable to a non-Gly, non-Pn

residue (phi=6O, psi=-135) (Brian Matthews and Doug Juers, personaj

comments). In the presence of substrate, Gly-794 is scattered in the L regior

of the Ramachandran plot. Replacing Gly-794 wi th a non-Pro residue woulè

result in restriction of the movement of the loop and should favor th€

conformation with the loop over the active site (closed conformation). Wïth the

loop in the closed conformation, the enzyme seems to bind substrate andogs

more poorly and transition state analogs better (Martinez-Bilbao et al., 1991).

This movement of the loop could also alter the glucose binding site and thus

allolactose production codd be afEected and alter the glucose to allolactose

ratio. These hypotheses will be investigated in this thesis.

The objective of this study was to investigate the effects of

substitutions for residues Gly-794 and -999 in B-galactosidase from E. coli.

21 Gly-794

The objectives of the study to see the effects of substitution for Gly-794 were :

1. To produce a 0-galactosidase mutant with an Ala substituted for Gly at

position 794 using a PCR-based mutagenesis method.

2. To determine the eEects that this substitution has on B-galactosidase

activity and on the ability of 6-galactosidase to bind its substrates and

inhilitors.

3. To determine the eEects of this substitution on the ratio of products:

galactose/glucose : dolactose ratio.

In addition, Dr. Matthews lab at the University of Oregon (Eugene,

Oregon) wishes to do 3-dimensional studies on the substituted enzyme ta see

whether movement of the loop is indeed restricted in the substituted enzyme.

The plasmid with Ala substituted for Gly-794 in the lac2 gene has been

supplied to that lab.

2.2 Trp-999

B-Galactosîdases with substitutions for Trp-999 were a gi f t fiom Dr.

Claire Cupples (Concordia University, Montreal). There were three major

objectives for this part of the project:

1. To determine the effects of these substitutions on B-galactosidase activity.

49

2. T o obtain information about the effects of these substitutions on binding al

the glucose and galactose subsites of the fkee enzyme and of the glucose

subsite of the galactosyl form of the enzymes.

3. To determine the eEects of these substitutions on the ratio of products:

galactose/glucose : allolactose ratio.

3.1 BIOCHEMICAL REAGENTS

TES, ONPG, PNPG, L-ribose, PETG, 2-aminogalactose, lactose

galactose, EDTA, EGTA, D-galactonolactone, 1,2-propanediol

mercaptoethanol, PMSF, glucose, methionine, Triton X-100, agarose, HMDE

TMCS, CaC12, i-inositol, bromophenol blue, sodium azide, lactobionic acid, D

xylose, D-glucose, D-mannose, D-lyxose and phenyl-6-D-glucoside were fima

Sigma. NaCl, glycerol, NaOH, methanol, MgS04-7H20, m f l O 4 , KOH, agar

PEG 8000, and glacial acetic acid were all fkom BDH. Yeast extract ant

tryptone were from BDH or Difico while D-galactai was from Koch-Ligh

Laborabries. 1,4-Butanediol and 1,3-propanediol were fimm Aldrich Chemica

Co. Tris (Ultra Pure) and ~ I 2 S O 4 (Ultra Pure) were h m ICN Biomedidi

Inc. while FeS04-7H20 and MgS04-7H20 were from Fischer Scientific

Completem (protease tablets), ampicillin, IPTG, RNase A (fiom bovinc

panmeas), X-gal and proteinase K were fiom Boehringer Mannheim. TA

Polynudeotide kinase, Hinf 1, Sca I, Hird ID, Pst, EcoRI, Acc 1, BssH II and TL

DNA ligase were purchase fiom Gibco-BRL Life, Technologies Inc., Pharma&

Biotech hc., or Boehringer Mannheim. DMF was fiom J.T. Baker or VWR

Tris-HC1, buffer saturated phenol, ultra pure agarose, and ethidium bromidi

were acquired h m Gibco-BFL Life Technologies Inc. The Genecleanm ki

was from Bio/Can Scientific Inc. The ExSitem PCR Site Directec

Mubgenesis kit was obtained h m Strategene.

51

3.2 PLASMlDS

The pIP 101 plasmid was used as the double stranded DNA template for

the site directed mutagenesis. It is a 5.2 kb expression vector derived h m

pBR322 vectors (Ruther et al., 1982). It contains the complete la& gene and

an ampicillin (Amp) resistance marker F i g u e 3.1).

The Trp 999 mutants were on a lac2 gene that is on an F' episome

(single copy, Figure 3.1). The F' episome also contains the ZacY, lac& and

pm&B (this was done by Dr. Claire CuppIes, Conmrdia University, Montreal).

These genes were deleted from the E.coli chromosome and consequently there

was no recombination between the episomal and chromosomal ZacZ genes.

3.3 OLIGONUCLEOTIDE PRIMERS

3.3.1 Sequencing Primer

The sequencing primer was required for sequencing the plasmid obtaîned

h m the PCR reaction (Table 3.1). This primer was designed to anneal to one

of the strands of the plasmid. It was 24 bp long, and was located 80 bp

downçtream £rom the mutated site. The sequencing primer was purchased

h m Dr. Maloney's laboratory (University of Calgary).

3.32 Mutagenesis himers

The oligonucleotide primers required for PCR (mutagenic primer and

primer 2 in Table 3.1) were also obtained h m Dr. Maloney's lab (University

of Calgary).

lczcA and &Y

Figure 3.1: Plasmids used for expression of the mutant &gaiactosidase enqmes. a.) F' episome w i t h the lacZ, ZacY, lm& pmAJ3 genes and an Amp resistanœ marker. This episome was used for the expression of the Trp 999 mutants. b.) pIP 101 plasmid mntaining the complete lac2 gene, an Amp resistance marker (bla gene), and the origin of replication ColEl. This plasmid was used as the double stranded template for PCR-based site directed mutagenesis to produce the G794A-fi-galadosidase.

Table 3.1: The oligonucleotide primer used for sequencing the mutated region of the lacZ gene and the primers required for PCR.

3.4 E. COU BACTERLAL !3TRAlNS

JM108: ara, A(lucproB), thi, rpsL. The pIP 101 plasmid containing the

mutated lac2 gene encoding for G794A-B-galacfnsidase was used ta transform

this strain of E.coZi for expression of this substituted B-galactosidase enzyme.

Primer Name

sequen- primer

mutagenic primer

primer 2

S90c: ara ARacproB) thi, rpsL cefls. This strain is Fm. The F' episome

containing the mutated lac2 gene encoding for W999F-B-galactosidase dong

with the lacY, l a d , and proA,B was used to transform this strain for the

expression of this substituted B-galactosidase (Cupples et al., 1988).

Rimer Sequence

S'TCAGCACCGCATCAGCAAGTGTGTAT3'

5'ATAACGACATTwCGTAAGTGAAGC3'

5'CCAGCGGTGCACGGCTGAAC3'

3.5 BACTER.IAL GROWTH MEDIA AND C O N D ~ Q N S

3.5.1 Bacteriaï Growth in LB Media

The E.coli cultures were grown at 37OC in LB media. Liquid LB media

contains 1% (wlv) NaCl, 1% (w/v) tryptone, and 0.5% (wlv) yeast extract at pH

7.5. The media was autoclaved (120°C, 22 psi) for 20 o r 35 min before use

(depending on the volume). Agar plate media (LB media with 1.5% agar) was

autoclaved as above and then 20 - 25 mL aliquots of the LI3 liquid media were

poured into petri dishes, When required, Amp (50 mg/mL), IPTG (0.02% [wkl),

54

and X-gal(0.002% [wh]) were added to the surface of the solidified aga. plates

and spread over the surfàce of the plate wïth a glass spreader. The plates were

dried in a 37°C incubator and used the same day.

33.2 Bacterial Growth in Minima Glucose Media

Minimal media containhg methionine and glucose (as the carbon source)

were used to grow the S90c strain containing B-galactosidase with

substitutions for Trp-999. Liquid minimal media consisted of RH2P04 (13.6

fi), (NH4)2S04 (2 g/L), FeS04*7H20 10.05%) and M#$0407H20 (0.26 g/L) at

p H 7.0. The media was autoclaved (120TC. 22 psi) for 20 min, Before use

sterile solutions of glucose (final concentration of 20%) and methionine (final

concentration of 2 rng/mL) were added. Mi.rilmal * . . agar plate media (minimal

media w i t h 1.5% agar) was autoclaved as above. Sterile solutions of glucose

(final concentration of 20%) and methionine (M concentration of 2 mg/mL)

were added to the cooled autoclaved Iiquid agar before pouring into petri dishes.

When required, Amp (50 mg/mL), IPTG (0.02% [w/v]), and X-gal(0.002% [wh])

were added to the surface of the sofidified agar plates and spread over the

surface of the plate with a glass spreader. The plates were dried in a 37OC

inabator and used the same day.

3.5.3 Bacterial Growth in Minimal Lactobionic Acid Media

Minimal media agar plates containing lacto bionate (as the carbon

source) were used to gmw the JMlO8 cens contâining f3-galactosidase with Gly-

794 substituted with an Ma. The media consisted of KH2P04 (13.6 g/L),

(NH4)2S04 (2 g/L), FeS04*7H20 (0.05%), MgS04* 7H20 (0.26 g/L),

lactobionate (0.2% w/v) and agar (1.5%) at pH 7.0. The media was autoclaved

and the cooled autoclaved liquid agar was poured into petri dishes. When

required, Amp (50 mg/mL), IPTG (0.02% [w/v]), and X-gal(0.002% [whl) were

added to the surface of the solidified agar plates and spread over the surface of

the plate w i t h a glus spreader. The plates were dried in a 37°C incubator and

used the same day.

4.1. PLASMID PREPARATION

Wild m e pIP 101 plasmid was isolated according to a modifiec

procedure outlined in the Biochemistry 541 Laboratory manual (Dept. oj

Biological Sciences University of Calgary). A single bacterial colony was usec

to inoculate 100 mL of LB media. The cultue was grown overnight at 37OC

and continuously shaken (150 rprn). The d s were cbilled on ice for 15 min

and harvested by centrifugation at 6000 rpm for 20 min. at 4OC. The

supernatant was poured off and the cells were resuspended in 20 mL of 0.1 14

Tris-acetate w i t h 0.2 M NaCl at p H 8.0 (autoclaved). The centrifbgation w a

repeated and the cells were resuspended in 2 mL of ice cold sucrose-Tris-

acetate solution (10% [w/v] sucrose, 0.05 M Tris-acetate, pH 8.0, autoclaved).

The cells were lysed by the addition of 0.2 ml; of a 2 mg/mL lysozyme solution,

The resulting solution was gently mixed and kept on ice for 5 min. To furthel

lyse the ceIls, 2 mL of cold Triton X-100 solution (2% Triton X-100 [w/v]:

autoclaved) was added. The contents were mixed by gentle inversion of the

closed centrifuge tube. An immediate increase in the viscosity was noted

indicating that ceIl lysis had occmd. The plasmid DNA was separated from

the chromosoma1 DNA and cellular debris by centrifugation (15000 rpm for 15

min. at 4OC). The supernatant containing the plasmid DNA was slowly poured

into a glass Corex centrifuge tube at room temperature. Degradation oi

contaminating RNA was achieved by the addition of 100 pL RNase A solution

(1 &mL RNase A in 10 mM Tris-HCl and 15 rnM NaCl, at pH 7.4, heated f o ~

15 min.). To remove contRminating proteins, 100 pL of proteinase K (10

was added and the '

' ure was dowed to digest for 30 min. at room

57

temperature. TE saturated phenol(2 mL) was then added and the resulting

solution was mixed by slow vortexing for 2-3 min. It was then centrifûged

(1000 rpm, for 5 min.) at 4OC. The aqueous layer was carefully removed and

its volume was measured. ' h o and one hatfvolumes of DNA precipitation mix

(4 mL of 2.5 M NaOAc in 100 mL of 95% ethanol) was added to precipitate the

plasmid DNA. The resulting mixture was incubated at -70°C to allow the

plasmid DNA to precipitate. The following day the contents were allowed to

just thaw and this was then centzifuged (10 min. at 10 000 rpm) at 4°C. The

supernatant was discarded and 5 mL of cold (-20°C) 70% ethanol was added ta

the DNA pellets ia remove any residual traces of salt. The mixture was again

centrifbged for 5 min. (10 000 rpm). The supernatant was decanted and any

remaining ethanol was removed by d q h g in a vacuum desiccator. Once dried,

the plasmid DNA was redissolved in 400 pL of TE b a r (10 mM Tris-Ha, 0.1

mM EDTA at pH 8.0). The integrity and concentration of the plasmid was

determined by restriction enzyme digestion followed by agarose gel

electrophoresis and ultraviolet (UV) visualization.

4.2 EESTRICTION ENZYME DIGESTION

Restriction enzyme digestions were camed out in several different

buffers. The b d e r used for a given digestion was the one recommended by the

manufacturer and usually it was supplied by the manufacturer of the

restriction enzyme. The total volume of the restriction e n m e digestion

mixtures was 10 pL. The restriction enzyme was added to a maximum of 10%

of this total volume. The digestion was incubated for 2-3 hr. at the

temperature recommended by the manufacturer. The reactions were then

stopped by adding 2 pL of dye mix (0.25% [wlv] bromophenol blue, 40% [v/v]

58

glycerol, and 0.1 M EDTA pH 8.0). The resulting mixtures were incubated at

68-70°C for 5 min. and this was then run on an agarose gel or stored at -20°C.

These restriction enzyme digestions were cârried out for several purposes:

quantification of DNA, isolation of DNA hgments, and determination of

plasmid sizes.

4.3 AGAROSE GEL EZECTROPHORESIS

The restriction digested DNA was analyzed by agarose gel

electrophoresis. A 0.7% (wh) agarose gel in TAE bufEer 10.04 M Tris-acetate, 2

mM EDTA, pH 8.0) was used. Ethidium bromide (3% [v/v]) was added to the

warm liquid agamse before the gel was poured. The DNA samples (digested

with restriction enzymes) were then loaded onto the gel dong with Hind III

digested lambda DNA (1.1 mg/mL) which served as a double stranded DNA

marker. The gel was electrophoresed at 12 V ovemight or at 100 V for 2.0 - 2.5

hr. (until the dye front was about 3 cm h m the end). The DNA was visualized

by ethidiwn bromide fluorescence under UV light and scanned using an Eagle

III gel scanner.

4.4 PCR-BASED SITE DIRECTED MUTAGENESIS

44.1 General OveIView

Several methods of performing site directed mutagenesis have been

developed. These methods usually require single stranded DNA (ssDNA)

templates. These templates oRen are obtained by subcloning into Ml3

bacteriophage vectors and then ssDNA is obtained by ssDNA rescue (5). A

novel in vitro PCR-Based site direded mutagenesis kit has b e n developed by

Strategene (Costa et al., 1995). This kit allows site specifïc mutation in

virtually any double stranded plasmid and eliminates the requirement for

ssDNA The protocol consists of five major steps (Figure 4.1): 1, Primer design

and phosphorylation; 2. Polymerase chah reaction (PCR); 3. Digesting and

polishing the product; 4. Ligating the PCR product; and 5. Transformation of

the rompetent cells with the ligated PCR product.

4.4.2 Polymerase Chain Reaction (PCR)

To prepare the control reaction, 2 pL of pWhitescriptm control

template was combined with: 2.5 pL of 10X mutagenesis b s e r ; 1 pL of dNTP

mix (25 mM); 2 pL of each control oligonucleotide primer (15 pmol -150 ng) and

W y 14.5 pL of double deionized water to a final volume of 24 pL, This

contml was performed with al l mutagenesis reactions to ensure the integritp of

the dNTP mixture and of all the -es provided in the kit.

64.2.1 Sample Reaction

4.4.Z. 1.1 Oligonucleotide Rimers

The sequences of the two primers employed for the site directed

mutagenesis are shown in Table 3.1. The mutagenic primer contains the codon

which bas been changed, (shown in bold print). The altered base has been

underlined. The second primer (primer 2) is also shown in Table 3.1. These two

primers were designed to anneal ta opposite strands of the plasmid. They are

adjacent to each other and do not overlap (Figure 4.2a). Both primers are 2 20

bases in Iength and both of the ptimers were phosphoryiated at their 5' ends

More use.

Figure 4.1. A schematic of the PCR protocol used to obtain the G794A-l3- galactosidase. Step 1 involves annealing of the oligonucleotide primers and the PCR reaction. In Step 2 the linear PCR pmduct is digested and polished using the restriction enzymes Dpn 1, and Pfu DNA polymerase. Step 3 involves the lïgation of the PCR product using T4 DNA ligase to circularize the PCR product. Finally, step 4 involves the transformation of E.coli cells with the iigated P a product.

Template pIPlOl DNA oligonucleotide

primer #2

Template dsDNA

STEP 1: Primer design

V mutagenic primer

Linear ds DNA PCR p d u c t containing the desired mutation

(pIPG794A)

1 Dpn 1 restriction enzgme Cloneci Pfii DNA polymerase 1

Dpn 1-digested template and hybrid DNA

STEP 2

Cloned ffi DNA polymerase-polished hear DNA

STEP 3

O Recirdarised PCR product

a. Single site mutation

b. Deletion

c. Insertion

Figure 4.2. Schematic for the design of the two primers used for PCR-based site directed mutagenesis. a.) The two primers lie on opposite strands, are adjacent to one another, and do not overlap. This is the desired primer design for site directed muhgnesis (point mutations at a single site). b.) If the two primers are not adjacent, this primer design would result in a deletion. c.) If one primer has a region that overlaps the other primer, this would result in an insertion in this region. The primers were purchased h m Dr. Maloney's laboratory (University of Calgary) and phosphorylated at their 5' ends before use.

4.4Z12 Phosphorylation of the Primeis

The protocol followed for phosphorylation of the primers was exactly as

described by Sambrook et al. (1989). The oligonucleotide primers were

phosphorylated at their 5' ends by combining 200 pmol of the oligonucleotide

with: 3 pI, of Tris-HCl(1 M, pH 8.0); 1.5 pL of MgCl2 (200 mM); 1.5 pL of DTT

(100 mM); 3 pL of ATP (5 mM1 into a rnimfuge tube. Sterile water was then

added to a total volume of 30 pL. This mixture was vortexed and 1 pL of T4

polynucleotide kinase (10 U/&) was added, Following a 45 min. incubation at

37OC, the reaction was stopped by heating at 65OC for 10 min. The final

concentration of the phosphorylated oligonucleotide was 67 pmoVjL.

4.4.2.13 Reaction Set Up: Fbduction of G794A-B-galactosidase

The DNA template used in the PCR reactions to produce G794A-6-

galactosidase was the 5.2 kb pIP 101 plasmid This plasmid contains the lac2

gene which encodes a fiinctional B-galachsidase enzyme. This normal (wild

type) B-galactosidase enzyme contains a Gly residue at position 794 in the

primary amino acid sequence. The mutagenic primer codes for an Ala

substituted for Gly-794. Four separate sample reactions were prepared for the

mutagenesis reaction. Each of the sample readions contained a different 10X

reaction b&er (i.e. either the Opti-Prime 10X buEers #3 (100 mM Tris-HC1,35

mM MgCi2,250 mM Ka, at p H 8.31, #7 (100 mM Tris-Ha, 35 mM MgCl2,250

mM K a , at pH 8.8), #11(100 mM Tris-HCl, 35 mM MgC12, 250 mM KCl, at

pH 9.2) or the mutagenesis b d e r (200 mM Tris-Ha, 100 mM KC1, 100 mM

(NH&S04, 20 mM MgS04, 1% (vh) Triton X-100, 1 mg/mL bovine serum

albumin @SA) at pH 8.751. In each of the 4 sample reactions, 0.5 pmol of

template DNA was combined with: 2.5 fi of one of the four 10X reaction

(3

bders (Strategene), 1 pL of dNTP mix (25 mM), 15 pmol of each primer, and

double deionized water to a final volume of 24 pL. The volume of template

DNA used was calculated using a formula provided by Strategene (0.5 pmol of

template DNA = C0.33 pgkb x the size of the template(kb)Ythe concentration

of the template (Mm). Strategene also provided a formula for determining

the volume of primer to use for the mutagenesis reaction (15 pmol = [5 ng/base

x size of the primer (baseslYconcentration of primer (ng1pL)).

4.43 The PCR Reaction

Once the control and the four sample reactions were set up, 0.5 of

Taq DNA polymerase (5 U/pL) and 0.5 pL of the Taq Extender PCR additive (5

U/pL) were added to each reaction. The Taq extender PCR additive is a

polymerase adjunct that iacreases the efficiency and reliability in creating Taq

DNA polymerase-generated PCR products. The entire mixture was overlaid

with mineral oil and the DNA was thermocycled using 8 amplification cycles.

The reduced cycling number and hi& template concentration used in this

probcol serve to reduce the potential second site mutations during the PCR.

4.4.4 Digesting and Polishing the PCR Pmduct

Following PCR, the reaction was cooled on ice for 2 min. One pL of Dpn 1

restriction enzyme (10 U/Cù;), and 0.5 pL of cloned P f i DNA polymerase (2.5

U/pL) were then added to the 25 pL PCR reaction mixture below the mineral oil

fayer. This mixture was gently and thomughly mixed by pipetting the mixture

up and dom sweral times. The microfùge tube was centrifuged for 1 min. and

incubated at 37OC for 30 min. Following this, the reaction was incubated at

72OC for 30 min. The DNA found in alrnost all E.coli strains is dam

65

methylated Dpn 1 is specific for methyhted and hemimethylated DNA and is

used to digest the parental DNA template and to select for the amplified DNA

that contains the mutation. Any bases extended onto the 3' ends of the

product by Taq DNA polymerase are removed by DNA polymerase.

4.4.5 Ligation of the PCR Product

Double deionized water (100 fi), 10 pL of 10X mutagenesis buffer, and 5

pL of rATP (10 mM) were added to the Dpn 1 cloned P f i DNA polymerase

treated PCR product. The solution was mixed by gently pipetting the mixture

up and down several times. The mixture was then centnfuged for 1 min.

Before continuing with the ligation, 10 pL of the ligation reaction mixture was

removed for gel analysis and the remahder of the reaction was stored on ice.

The samples (the control reaction, and the 4 sample reactions) were analyzed

by agarose gel electrophoresis using Hind III digested lambda DNA markers

as size markers. To verie the integrity of the PCR product, Sca 1 or Pst 1

digested wild type pIP 101 was used as a marker representing the linearised

template and the size of a fidl length PCR product. The sample lane containing

a PCR product of the desired size (the same size as the linearised template)

was chosen for the ligation reaction, Ten pL of the selected mixture was

aliquoted into a Çesh microcentrifuge tube and 1 p.L of T4 DNA ligase (4 UIpL)

was added. This mixture was incubated on ice for 1 hr. at 37OC. This reaction

results in circularia the plasmid DNA and enables the plasmid containing

the desired mutation to be transformed inta E.coli d s .

66

4.4-6 Preparation of Comptent EcoZi cells

The competent tells were prepared according to the method descxibed bg

Sambrook (1989). When preparing competent cens, the ceiis must be handled

v e r - gently in order to ensure maximum compehncy. A single colony of celle

was used to inoculate 20 mL of LB media and this was grown overnight at

37OC. This overnight growth was used ta inoculate 100 mL of LB media The

culture was grown a t 37°C until the ODsoo value reached 0.3 (about 3 hr.).

The cells were then chilled o n ice for 5-10 min. The cooled cens were then

distributed in stede centrifirge tubes and were pelleted by centrifugation (5

min., 2 000 x g) at 4"s. The supermatant was decanted and the cells were

resuspended in 25 mL of ice cold MgCl2 solution (100 mM MgC12, 5 mM Tris-

Ha, p H 8.0). The cells were centrifuged again (5 min., 2 000 x g) at 4°C and

the supernatant was decanted. The pdeted cells were resuspended in several

mL of ice cold CaC12 solution (100 mM CaC12, 5 rnM Tris-HC1, pH 7.5). Once

all of the cells were resuspended, CaC12 was added to a h a i volume of 25 mL.

The tubes containing the cells were covered and incubated on ice for 45 min.

The competent cells were centrifkged (5 min., 2000 x g, 4%), and the

supernatant was decanted. The pelleted cells were gently resuspended in I II&

of ice cold CaC12/glycerol solution (100 mM CaC12, 5 mM Tris-HC1, 14%

glycerol, pH 7.5). These competent cells were aliquoted into cooled sterile

mimfùge tubes and stored at -70°C untd required

4.4.7 Transformation of the E-coli cells

The transformation of the competent E.coli cells was perforxned

according to the method described by Sambrook (1989). A microhge tube

containing competent cells was removed h m the -70°C freezer and gently

67

thawed on ice- One to two of the DNA was measured into a sterile

microfige tube and overlaid with 30 pL of competent E.co2i cells and this was

mixed by gently pumpiing the cells up and down with a pipette. This

transformation mixture was dowed to sit on ice for 45 min. before heat

shocking for 2 min, at 4T€. The transformation mixture was then incubated

for 5 min. on ice. Following this, 70 pL of LB broth was added to the

transformation mixture and this was incubated at 37"€ for 30 min. with

occasional gentle shaking. This mixture was then plated on LB-agar plates

which rontained Arnp, IPTG and X-gal and the plates were incubated overnight

at 37°C. Two controls were used in the transformation protocol: a negative

control transformation and a positive control transformation. The negative

control transformation did not contain any DNA. Conversely, the positive

control transformation contained a known quantity of plasmid DNA These

control transformations ensured the integrity of the Amp and the Amp

sensitivity of the competent cells, as weil as the efficiency of the competent

ceil preparation.

4.4.7.1 Transformation of the E-coli ceils with the Ligated PCR

Product

The ligase treated PCR product (2 pL,) was added to E.coli JM 108 cells

and the JM 108 cells were transformed as described above. As a positive

control0.1 ng of pUC18, a plasmid provided by Strategene, was added to the

competent tek This mixture was transformed as described in section 4.4.7.

The control plates were incubated at 3'7% for 2 16 hr. Typically greater than

60% of the mutagenised control colonies contain the mutation and appear as

blue colonies on the agar plates. Usually greater than 80% of the colonies for

68

the pUC18 positive control transformation have a blue phenotype. The

mutagenesis efficiency (ME) for the pWhitescriptm control plasmid was

calculated according to the following formula: ME = number of blue colony

forming units / total number of colony forming units. The ME for the

pWhitescriptm c o n h l phsrnid was found to be 76%.

44.8 Selecting for the G794A Mutant

To select for the mutant that produced G794A-B-galactosidase, 3 blue

colonies were taken fkom the agâr plate containing celis trançformed with the

ligated PCR product. These colonies were streaked on three separate minimal

media plates containing lactobionic acid as the carbon source as well as Amp,

X-gal and IPTG. These plates were incubated overnight at 37"€. The plates

with growth were assumed to contain G794A-B-galactosidase because o d y

ce& having highly active enzyme should grow. As a control, JM 108 cells were

transformed with wild type pIP 101. The transformation mixtures were piated

on mjnimal media plates containhg lactobionic acid as a carbon source. Since

wild type B-galactosidase can not use lactobionic acid as a carbon source, no

growth should O- on these plates.

64.9 Sequencing

Two blue colonies were isolated from the agar plates containing the

E-coli cells transformed with the pIP 101 plasmid produced by the PCR

reaction. Each colony was grown separately in 100 mL of LB media with 100

pL of ampicillin and the plasmids were purifled. Ten pL aliquots of the

plasmids (5 pg/lO pL in two microfige tubes), and 10 p L of the sequencing

69

primer (3.2 pmoVpL, 5 pL are required per sequencing reaction) were sent to

the Univemie Core DNA services (University of Calgary) for sequencing.

4.5 PROBLEM SOLVING PROTOCOL

4.5.1 G e n d Overview

The desired result of the PCR-based site k t e d mutagenesis was to

substitute an Ala for a Gly at position 794 of &galactosidase. Even though a

high template concentration and low cycling number was used for the PCR

protocol, a second site mutation did occur in another part of the mutant

plasmid. The second site mutation was detected by an unexpected Km value

for the B-galactosidase that was obtained. The exact position of tbis mutation

could not be determined since it was not in the portion of tbe plasmid that was

sequenced. To overcome this problem the mutant p P 101 plasmid and the

wild type pIP 101 plasmid were purified and each plasmid was digested with

Acc 1 and BssH II in separate reactions (Figure 4.3). These restriction

enzymes produce a 1.1 kb fragment of the lac2 gene and a larger 4.1 kb

fitagrnent consisting of the rest of the plasmid. The 1.1 kb fragment of the lac2

gene contains the codon for the residue in position 794. The fragments were

separated by agamse gel electrophoresis, and the bands were detected using

UV light. The portion of the agarose gel containing the DNA of interest was

excised. The portion of the gel containing the 1.1 kb fi.agment fiom the mutant

plasmid was removed and the portion of the gel containing the 4.1 kb m e n t

h m the wild type plasmid was also removed. The DNA was recovered h m

the agarose gel using Geneclean (section 4.5.2). The 1.1 kb fragment of the

lac2 gene fiom the mutant plasmid was then ligated to the 4.1 kb fragment of

the wild type pIP 101 plasmid (Figure 4.3). This new plasmid was sequenced

Figure 4.3: Restriction cleavage of pIP (G794A) and pIP 101 tu produce a new mutant plasmid. Both pIP (G794A) and pIP 101 were digested using the restriction enzymes Acc 1 and BssH II. In both cases, each enzyme cleaved the plasmid o d y once within the lu& gene. The result of each digestion was the production of 2 fragments, a 1.1 kb fragment and a 4.1 kb fragment. The 1.1 kb fragment from the pIP (G794A) plasmid contained the G794A mutation. This fiagrnent was ligated to the 4.1 kb fkagment h m the pIP 10 1 digestion. This yielded a new plasmid containing only one mutation, the G794A mutation. The presence of this mutation was confïrmed by sequencing.

1 Acc 1 & BssH II 1 Acc I & BssH

BssH II

1.1 kb fragmenl rJ-

72

again to confirm the presence of the G794A mutant. E-coli cells were then

transformed with this mutant (as described above in section 4.4.7) and the Km

value (section 4.7.2) found for this new plasmid was in the expected range.

4.5.2 Purification of DNA Fragments h m Agarose Gels

DNA fragments were removed and then pvified fiom the agarose gels

using the Genedean kit (Bio 101,1988). The protocol folIowed was exactly as

dehbed in the instructions supplied by the manufacturer.

4.5.3 Ligation of DNA Fragments

The ligation of DNA hgments was performed according to the methods

of Sambrook et al. (1989) and Roth (1995). The molar ratio of fragment DNA

to vector DNA was approximately 3:l. T4 DNA ligase (2.5 pL, 1 U/pLd, 5pL of

5X DNA ligase Reaction Buffer (Gibco-BRL), 2.5 pL of ATP (10 mM), and

water up to a total volume of 25 pL were al1 added to the DNA mixture. The

reaction was incubated at 25% for 3-8 hr. before transformation into

competent cells.

4.6 ISOLATION OF RGAtACTOSIDASE

4.6.1 Ce11 Growth

LB media (50 mL) containing 50 mL of Amp (50 mglmL) was indated

with a single colony of the bacteria and grown (150 rpm) at 37°C overnight. A

5% i n o d u m of this overnight growth was used to inoculate 100 mL of LB

media. Growth took place (150 rpm) for 8-10 hr. at 3TC. Fernbach flasks

containing 1500 mL of LB media were inoculated with the 100 mL culture and

73

gmwn (150 rpm) for 18 hr at 37°C. The ceUs were harvested by centrifuging at

4500 x g, for 20 min- The cells were stored at -70°C until required.

46.2 Purification of the B-Galactosidase

The purification protocol which was followed was described by Roth

(1995). The cells were resuspended in breakhg b d e r (50 mM K H S O 4 , l mM

EGTA, 0.04% (w/v) NaN3, pH 7.3, at 4°C) and stirred until homogenous. Just

before breakage PMSF (protease inhibitor) was dissolved in methanol and was

added to the resuspended d s ta a t;nal concentration of 0.5 mM. A protease

bblet called 'Completem" (Boehringer Mannheim) was sometimes used

instead of PMSF for the purification of the substituted B-gdactosidases. The

ceil suspensions were broken by 2 passes Mugh an Aminco French Press at

1500 psi. Cellular debris was removed by centrif@ing (13 000 x g, 20 min.,

4°C). A small sample of the supernatant was then diluted and the OD280 was

determined. The rest of supernatant was then diluted with breaking b d e r to

an OD280 of 130. Streptomycin sulphate (5% [w/v]) was then added to the

supernatant to precipitate the DNA and the pH of the mixture was adjusted to

7.3. This mixture was stirred for a minimum of 3 hr. at 4OC. Following this, the

DNA-streptomycin sulphate cornplex was removed by centrifuging the mixture

at 24 000 x g for 30 min. at 4OC. A s d sample of the extract was diluted and

the 0D2a0 was determined. The rest of the extract was further diluted witb

breaking buffer to an 0D2a0 of 35. Some of the contaminating proteins were

then removed by slowly bringing the exfxact to 25% saturation of ammonium

sulphate (at 4°C) while main- the pH at 7.3 with ammonium hydroxde.

ARer stirring the solution for 30 min. at 4"C, the solution was centrifuged (24

000 x g) at 4°C for 30 min. and the pellet was discarded. The supernatant was

brought to 45% saturation of ammonium sulphate at 4O€ while keeping the pE

at 7.3 with ammonium bydroxide. After stirring the solution for 30 min. at 4 T

the solution was centrifiiged (24 000 x g) at 4" for 30 min. The pelle

(containing 13-galactosidase and contaminatirtg proteins) was resuspended in ; - . murmal volume of Tris Column B e e r (80 mM Tris, 1 mM MgCl2, 1 mM O

mercaptoethanol, 0.1 mM EDTA, pH 7.5, at 4°C). This suspension was placet

into Spectrapor dialysis tubing (molecular weight cut off = 12-14 kDa). Thc

cellular extract was dialyzed against Tris Column B S e r for 1 hr. Followïq

this, the b s e r was changed and it was dialyzed for 4 hr., and finnlly the bdei

was changed again and the extract was dialyzed overnight. A 3 x 16 cm DEAI

BioGel agarose column was pre-equilibrated with Tris Coliimn Buffer and thc

dialyzed sample was loaded onto this column. The column was then washec

with 0.09 M NaCl in Tris Column BufEer mtil the part of the extract that dic

not bind was washed off. An 800 mL gradient of 0.09-0.18 M NaCl in Tri!

Column Bder was used to elute the proteins at a flow rate of 1.5 &min. T h 6

eluant was collected in 10 mL fractions. The location of the B-galactosidasc

was monitored using spot tests for activity and the fractions containing i3

galactosidase a t iv ie and high protein concentrations were examined by SDS

PAGE to determine the purity of the enzyme. The tubes containing the

highest concentrations of B-galactosidase were pooled and brought to 50%

ammonium sulphate saturation. The sample was centrifuged (24 000 x g) foi . 30 min. at 4% and, if necessary, resuspended in a muunal volume of Tris

Colirmn Buffer, dialyzed, and run through the DEAE BioGel column a second

time as described above. When the sample was clean enough, the ammoniun:

sulphate pellet was resuspended in storage bdfer (TES b d e r with 0.04%

sodium azide) and stored at 4% u n d required. Before use, the enzyme wam

75

purifïed to a single band and desdted by passage through a Superose 12 and a

Superose 6 FPLC column arranged in series and pre-equilibrated with the

appropriate b d e r . The enzyme sample was then applied in a maximum

volume of 0.5 mL at a fiow rate of 0.2 mUmin, Fractions were collected in 1.0

mL volumes and the tubes conbining 13-galactosidase were visualized by SDS-

PAGE and only the tubes containing pure B-galactosidase were further used for

enzyme analysis

4.6.3 SDSIPAGE

Al1 SDS-PAGE of proteins were done using Pharmacia's PhastSystem-

The protein samples were prepared and iui on Phastgel8-25 (stackhg gel - 8%

T, 3% C, separating gel - 8-25% T, 2% C) according to the manufacturers

instructions (Pharmada, 1986a). The protein samples were loaded using 8-1

(8 lanes - 1 sample applied) sample applicators. The gels were stained,

destained, and presemed using a Coomassie Blue stâining protocol as describecl

by the manufacturer Pharmacia, 1986b).

4.6.4 Determination of the fbGalactosidase Concentration

The concentrations of the B-galactosidase enqmnes were determined by

measuing the O&~Q of the sample and using an extinction coefficient of 2.09

cmZ/mg at 280 nm (Wallenfels and Weil, 1972).

4.7 KINETIC CHARACTERIZATION OF THE 8-GALACTOSID-S

4.7.1 General Assay Conditions

The synthetic substrates ONPG and PNPG were used t o assay B-

galachsidase. The substrate solutions were prepared in TES Assay B e e r (30

mM TES, 145 mM NaCl, 1 mM MgS04, pH 7.0, at 25°C). The substrate

solutions were pre-eqrulibrated in a water bath held at 25% beefore enzyme

addition. The volume of enzyme used in the assays was 50 pL and the bal

assay volume was 1 mL for ail the assays performed. Assays were run at

25°C in a Shimadzu UV 2101PC spectrophotometer equipped with a CPS 260

temperature controiled multi-cell changer. The spectrophotometer was

interfaced to a Packard bell 386SX-II computer with UV-210if3101PC

Software (version 2.0). The assays were 3 min. in length using a single cell.

When ONPG waç the substrate used in the assay, an extinction coefficient

(&O) of 2.65 mM-lcm-1 (pH 7.0,25%) was used. If the substrate used in the

assay was PNPG, an extinction coefficient (E4S0) of 6.7 mM-hm-1 (pH 7.0,

25°C) was used.

6'7.2 Km and Vm V d ' z ~ e ~

Using both ONPG and PNPG, the V, and the Km values were

dekrmined for the wild type and the substituted B-galactosidases. The assays

were performed in duplicate at six different substrate concentrations (usudy

three concentrations above and three concentrations below the Km value of

the enzyme). The A&0/min. values obtained for each substrate

concentration were averaged and the data analyzed using the Enzyme Kinetics

software program (Version 1.4) developed by Trinity software and based uwn

Eadie-Hofstee graphical analysis.

67.3 pH probiles

The & and the kt values were determineci as described in the preMous

section over a pH range of 6.5 to 10. The b a e r used over this pH range

contained 30 mM TES, 50 mM histidine, 145 mM NaCl and 1 mM MgS04. Thc

pH values were adjusted at 25°C. This bufEer is merent from the TES buffe~

used in enzyme assays because it must be able ta maintain its bufTerin4

capacity over the whole pH range. Substrate solutions (30th ONPG anc

PNPG) were also prepared in tbis b a e r and adjusted to the appropriate pH

The extinction coefficients for both substrates at various pH values are shom

in Table 4.1.

Table 4.1. Extinction Coefficients for oNP and pNP at various pH values.

97.4 Determination of Inhibition Constants (Xi values)

The apparent Ki values for various inhibitors were determined as

described in section 4.7.1 except that the assays were performed in the

presence of a constant concentration of inhibitor. The inhibitor concentrations

7t

used were always close to the Ki d u e . The & values were determuleci usin(

the fonowing equation :

The apparent Km and apparent Vmax values are those in the presence of thé

inhibitor. The Km and V- values are those in the absence of inhibitor and CT

is the inhibitor concentration (which is close to the Ki value). This equation

aocounts for the ability of some inhibitors to act as acceptors and gives true Kj

values.

4.8 GAS UQUID CHROMATOGRAPEY

4A.1 Sample Preparation

The samples are prepared in microfuge tubes (1.5 mL) with holes drrlled

into the caps. One hundred pL of intenial standard solution (7 mM beta-

phenyl-D-glucoside and 2.0 mM i-inositd) were put into the tubes and this was

h z e n in liquid nitmgen. One hundred @ of the sample was then added to this

while keeping the microfùge tube in liquid nitrogen. The fiozen tubes were

cap@ and lyopbilized overnight. Various concentrations of glucose, galactose,

and lactose were used as standards. These were lyophilized overnight. All

enzyme assays by gas liquid chromatography were done using lactose (50 mM

h a l concentration) as the substrate. One hmdred pL samples were removed

at given time intervals and added to the mimfiige tubes containing the frozen

intemal standard while the microfbge tubes were in the liquid nitrogen. The

tubes were stored a t -70°C until required. Freezing the sarnples in liquid

79

nitrogen and lyophilising them serves to stop the enzymatic reaction The

samples were then silylated to make the sugars volatile. The silylation was

camed out in the fume hood wearing safety goggles and gloves.

DirnethyKormamide CDMF) (600 &) was added to each tube of lyophilized

sample ta dissolve the sugars. Following this, 300 pL of hexamethyldisilazane

(HMDS) was added to each tube. Finally, 150 pL aliquots of

trichloromethylsilane CI'MCS) was added to each tube. The tubes were capped

firmly immediately &r the addition of these reagents and the contents were

mixed by inverting the microfige tube several times. The tubes were lefi to sit

for 30 min. before mixing again. The samples were leR at room temperature in

the fume hood for about 2 days. A phase separation becomes apparent after

the first day. Because the silylation reaction is not complete until the second

&y they were allowed ta incubate for 2 days.

4.û.2 Gas Liquid Chromatography Conditions

The column used was an Econo-Cap capillary column. The injection

temperature was 250°C. The oven was initially held at 90°€ for 2 min. The

temperature was increased at a rate of 20"€/min. to 250°C and was held at

this temperature for 20 min. The flame ionization detector temperature was

300°C. The flow rate of the carrier gas (helium) was 1 mUmin. The amounts

of glucose, galactose, and allolactose formed at various times during the assay

were determined. The quantitation and identification of the silylated sugars

were accomplished by means of the standards and the interd standards. One

pL samples of the upper of the two layers present in the microee tube was

injected (injection temperature was 300 "C).

5. RESULTS

5.1 PLASMID ISOLATION

The DNA template for the PCR reaction (pIP 101) was p d e d and the

sample was pure by agarose gel electrophoresis. No contaminating

chromosomal DNA was visible. The integrity of the pIP 101 plasmid was

determined by subjecting it to restriction enzyme digestion. The restriction

enzymes (Hinf 1, Pst, Sca 1, and EcoRI) used were those whose number oi

cleavage sites in pIP 101 are known. All of the correct cleavage sites appeared

to be present.

5.2 PCR-BASED SITE DIRECTED MUTAGENESIS

5.2.1 Control PCR Reaction

The ds DNA template for the control PCR reaction of the ~ x s i t - e ~ PCR-

based site directed mutagenesis protocol was the 5.7 kb pWhitescriptm.

Following PCR, the Dpn 1 and Pjù DNA polymerase treated DNA was analyzed

by agarose gel electrophoresis and a 5.7 kb PCR produd (as determined using

lambda DNA markers) was obtained f rom the control reaction. This

represents a fidl length pWhitescriptm.

53.2 Pmduction of G794A1EGalactosidase

The pIPlOl plasmid containhg the mutation in the lac2 gene for the

production of G794A-B-galactosidase was produced and ampmed using the

~ x s i t e ~ PCR-based site directed mutagenesis protocol. The Dpn I and Pfu

DNA polymerase treated DNA was analyzed by agarose gel electrophoresis.

The PCR produds were compared with d d type pIP 101 digested with Pst.

Pst cleaves the wild tSrpe pIP 101 plasmid only once and the resulting cleavage

product represents fidl length linear pIP 101. When compared with Pst

digested wild type pïP 101, the PCR products pmduced using the mutagenesis

bufFer, b d e r #3, and b d e r #7, each pmduced a s&cient amount of full length

plasmid. Buffer #Il, however, did not produce any plasrnid. The PCR products

h m the mutagenesis buffer, b&er #3, and bufîer #7 were each diluted 5 fold

and treated wi th T4 DNA ligase. This ligated the blunt ends. Following a 1 hr.

incubation period, each ligation mixture was used to transform E.coli JMlO8

competent cells. The transformed cells were plated onto LB plates and . .

minimal media plates (containing lactobionic acid as a carbon source) wi th X-

gal, LPTG and Arnp. E.coli cells containing wild type B-galactosidase are not

able to utilize lactobionic acid as a carbon source while cells containing B-

galactosidase with substitutions for Gly-794 are able to u.tilize lactobionic acid

as a carbon source (Martinez-Bilbao et al., 1991). Blue colonies were detected

on the LB and minimal . . media plates containing the cells transformed with

DNA PCR product fkom the mutagenesis buffer (plate 1) and buffer #7 (plate

2). No white colonies were present on either of these plates. The plates

containing the cells with the PCR product produœd in bufTer #3 did not contain

any colonies at all. The minimal media plates required over 24 hr. incubation

at 37% before blue colonies were visible. No blue colonies were present on a

control minimal media plate (with lactobionic acid) streaked with cells

containing wild type B-galactosidase. Two colonies fhm plate 2 were selected

and each was used to inoculate 100 mL of LB media containing 100 JLL of Amp

and this was grown overnight. The plasmids h m each growth were purified

and the inkgri@, concentration, and purity of each was determined by agarose

gel electrophoresis. The resulting plasmids dong w i t h the s e q u e n a primer

were sent away to the University Core DNA Services to be sequenced.

5.3 SEQUENCING RESULTS

Both plasmids were found to contain the desired mutation in the lac2

gene (having the codon corresponding to Gly-794 changed h m GCC to WC).

Plasmid 2 was transformed into E-coli JM 108 cells and these were plated onto

LB and minimal media plates (with lactobionic acid) containing Amp, IPTG,

and X-gal. Several blue colonies were obtained on both plates.

5.4 THE Km OF G794A-B-GALACTOSXDASE

Before doing a large scale growth and purification of the G794A-B-

galactosidase, 100 mL of LB media was inodated with a single blue colony

(con- the mutant plasmid). This was grown for 8-10 hr. and the cells

were collected by centrifugation (6000 rpm), resuspended in breaking buffer,

and French pressed to break the cells. The cell free extract was centrifuged

and the supernatant, contairing the substituted enzyme, was used to

determine the Km value for this enzyme using PNPG as the substrate. The

Km value was determined to be 28 This value was significantly different

h m the Km value for other i3-galactosidases with substitutions for Gly-794

which typïcally have higher Km values (about 200 CLM) with PNPG (Martinez-

Bilbao and Huber, 1994). This unexpected result indicated that there could be

a second (unintended) mutation in another part of the plasmid. If so, this

mutation was in a portion of the plasmid which was not sequenœd.

5.5 BECOMBINING 'IWO PLASMIDS

The plP 101 plasmid contâins a single Acc 1 restriction site and a single

BssH Iï restriction site. When p P 101 is treated with these two restriction

enzymes the result is a 1.1 kb m e n t and a 4.1 kb fragment. The 1.1 kb

m e n t is the £kagrnent of the lac2 gene that contains the codon for residue

794. The 4.1 kb fragment contains the remainder of the pIP 101 plasmid.

Assuming that the second mutation is in the 4.1 kb m e n t , the unwanted

mutation discussed above can be eliminated. The pIP (G794A) plasmid

contâining the mutations and the wild type pIP 101 plasmid were p d e d and

both plasmids were treated with Acc 1 and BssH II. The fragments produced

by these digestions were separated by agarose gel electrophoresis. The 1.1 kb

fiagrnent fiom the mutant plasmid ( p P G794A) digest and the 4.1 kb

fragment fkom the wild type plasmid digest were excised from the gel. The

DNA of each was p d e d and the two fragments were Ligated using T4 DNA

ligase. This ligation mixture was transformed into E.coli JM 108 cells and

these cells were plated onto agar plates containing Amp, X-gal, and IPTG. A

mixture of blue and white colonies were obtained (the majority were blue).

From this plate a blue colony was selected and used to inoculate 100 mL of LB

media containhg 100 p.L of Amp. This was grown ovemight and a srnail

portion of this ceii culture was stored (at -70°C) and the rest was used ta puri.@

the plasmid. The purity of the plasmid was determined by agarose gel

electrophoresis. In order t o be absolutely certain that the mutation was

present after these manipulations, the plasmid dong with the sequencing

primer were sent to University Core DNA Services to be sequenced by cycle

çeque~cing.

5.6. SEQUENCING RESULTS And The Km VALUE FOR The NEW

PLASMID

The new plarrrnid was found to amtain the desired mutation (a GCC was

changed to a GGC) in the ZucZ gene. A small aliquot of the fiozen culture was

then plated onto an LB plate and a minimal medium plate (with lactobionic

acid) containing Amp, IPTG, and X-gal. A blue colony was sele-d from this

plate and used to inoculate 100 mL of LI3 media contâining 100 pL of Amp.

This was grown for 8-10 hr. and the cells were collecteci by centrifugation,

resuspended in breaking b d e r , and French pressed. The extract was

centrifuged and the supernatant, containing the substituted enzyme, was used

in a series of assays to determine the Km value for the enzyme. From the

Eadie-Hofstee plot, the Km value for the G794A-B-galactosidase was

determined to be 0.22 m M using PNPG as the substrate and 0.20 mM with

ONPG as the substrate. These values are within the range of Km values found

for other Ggalactosidases with substitutions for Gly-794 (Martinez-Bilbao et

al., 1994).

5.7 PURIFICATION OF TEE &GALACTOSXDASES

Strains containing W999F- and W999GB-gaiactosidase were obbined

h m Dr. C. Cupples (Concordia University, Montreai). The E.c& JM 108 cells

containing G794A-13-galactosidase were grown and the substituted B-

gdactosidases were purified. The actïvity of the substituted enzymes in the

fiactions was followed thmughout the purification using 2 mM PNPG in TES

assay bufXer. All of the substituted O-galactosidases eluted h m the DEAE-

agarose column at about 0.18 M NaCl (Figure 5.1). The fractions containing

the highest activities were pooled and the pooled samples were used in the finsll

pdca t ion step.

k7.1 G794Al&GaIactosidn-

The pooled sample from the DEAE column was brought to 50%

ammonium suifàte and the pellet was redissolved and then didyzed in Tris

column buffer. It was passed through the DEAE column a second time. The

fractions that eluted fkom this second pass through the DEAE colilmn were

very pure as judged fiom SDS-PAGE (Figure 5.2). Therefore, this sample did

not require passage through the FPLC columns. This enzyme was stable for

2-3 months under normal storage conditions.

5.79 WWSF-B-GaIactosidase and W999GIEGalactosidase

F'PLC through a Superose 12 column in series with a Supemse 6 column

F i g u r e 5.3) was used for the final purification step for this enzyme. W999F-B-

Galactosidase eluted in a similar volume from these columns as did wild type i%

galachsidase, indicating that the enzyme was a tetramer. The samples h m

the FPLC containhg high B-galactosidase activity were analyzed by SDS-

PAGE. The SDS-PAGE anslyses of W999F- and W999GB-galactosidase are

shown in Figures 5.4 and 5.5 respectively. Both enzymes were stable for 2-3

months under normal storage conditions.

5.8 gINETIC ANALYSES

5.8.1 pH Probiles

The effects of pH (Corn 6 to 10) on the kcat, Km and the k&Km values

Figure 5.2. SDS-PAGE analysis of the purification of G794A-B-galactosidase. Lane 1: molecular weight standards: Phosphorylase b (94 000 kDa); Aibumin (67 000 kDa); Ovalbnmin (43 000 kDa); Carbonic Anhydrase (30 000); Trypsin Inhibitor (20 100kDa) and a-Iactalbumin (14 400 ma). Lane 2: cell fkee extract. Lane 3: proteins remahhg &r the second ammonium sulphate cut (45% saturation) . Laue 4: proteins remaining aRer the first passage through the DEAE column - B-galactosidase is the protein present in the highest amount; the remaining bands are contamïnating pmteins. Lanes 5-7: only S galachsidase remains af&r the second passage through the DEA, column.

10 20 s-O

Fraction Number

Figure 5.3. Representative elution profile of a B-galactosidase (W999F-& galactosidase) through the Superose 12 and Superose 6 FPLC gel filtration columns W e d in series. The enzyme was loaded after pre-equilibrating the column with TES buffer. The wlumn was washed with TES b d e r at a fiow rate of 0.2 mL/min. The protein concentration (open squares) was determined using an extinction coefficient of 2.09 cm%ng. ActiviQ (open circles) was determined as described in section 4-7.1. The size of each ftaction colIected was about 2 mL.

Figure 5.4. SDS-PAGE analysis of the purification of W999F-i3-galactosidase. Laue 1: molecular weight standards: Phosphorylase b (94 000 kDa); Albumin (67 000 ma); Ovalbumin (43 000 ma); Carbonic Anhydrase (30 000); Trypsin Inhibitor (20 100kDa) and a-lactalbumin (14 400 ma). Lane 2: proteins remahhg aRer passage through the DEAE column - 6-galadosidase is the protein present in the highest amount; the remaining bands are contaminsrting proteins. Lane 3 and 4: only B-galactosidase remainw a f k passage through the FPLC coIllmns. Lane 5: empty lane. Lane 6: proteins remaining after the second ammonium sulphate cut (45% saturation) . Lane 7: c d fkee extract. Lane 8: molecular weight standards (same as lane 1).

Figure 5.5. SDS-PAGE analysis of the purification of W999G-B- galactosidase. Lane 1: molecular weight standards: Phosphorylase b (94 000 kDa); Albumin (67 000 kDa); 0valbiim;n (43 000 kDa); Carboaic Anhydrase (30 000); Trypsin Inhibitor (20 100kDa) and a-lactalbumin (14 400 kDa). Lane 2-8: only B-galactosidase remains after passage through the FPLC columns.

of G794A-l3-galactosidase and W999F-13-galactosidase were determined with

both ONPG and PNPG (Figures 5.6 ta 5.19).

5.8.1.1 G794.A-B-Galactosidase

5.8.1.l.1 ONPG

G794A-B-Galactosidase and wild type had somewhat sirnilar pH profiles

for Km (Figure 5.6). The Km values for the substituted enzyme are, however,

lower than for the wild type enzyme for pH 7.5-10 but about the same between

pH 6.0 and 7.5. The pH required for the half maximal normalized k t value for

G794A-B-galactosidase was shifted about 2.0 pH units lower than for the wild

type enzyme (Figure 5.7). The pH profiles for the normalized kt iKm values

are simila. for G794A-13-galactosidase and the wild type enzyme (Figure 5.8).

Both e-es have half 1 values at about pH 8.5.

5.8.1.1.2 PNPG

The Km values for G794A-l3-galactosidase were higher than those for

wild type between pH 6.0-7.5 but similar between pH 7.5 and 10 (Figure 5.9).

The pH required for the half maximal normalized kcat for G794A-B-

galactosidase was again shifted lower thiin for the wild type enzyme (Figure

5.10). The p H profiles for the normalized kcat& values were again quite

similar (Figure 5.11).

5.8.1.1.3 Ratios of Km and Normalized Lt Values With ONPG and PNPG as Functions of the p H

The & ONPG / & PNPG ratio and the kt ONPG / kcat PNPG ratio

Figare 5.6. pH profiles of the Km values for wild tSpe enzyme and G794A-B- galactosidase with ONPG. The values were determined in pH Assay BuEer (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgSOq, pH adjusted at 25°C). The open squares represent the kinetic constant values for the wild type enzyme and the filled &des represent the kinetic constant values for G794A- 8-galactosidase.

Figure 5.7. pH profiles of the normalized kCat values for G794A-13- galactosidase and wild type enzyme with ONPG. The values were determined in pH Assay B d e r (30 mM TES, 50 mM histidine, 145 mM NaCl, 1m.M MgSOq, pH adjusted at 25°C). The open squares represent the normalized kt values for the wild type enzyme and the Med circles represent the normalized bat values for G794A-13-galactosidase. The bat values were normalized as pementages of the maximum activity observed (pH 6.0 to 10.0) to account for the large differences in the activities of the enzymes, The observed kt for d d type at pH 7.0 was 600 s-1 and 100 s-f for G794A-J3-galactosidase.

Normalized Lt / g, (% of maximuni value)

Figure 5.8 pH pronles of the normalized ka,,, values for wild type enzyme and G794A-B-galactosidase with ONPG. The values were determined in pH Assay BufEer (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgS04, pH adjusted at 25°C). The open squares represent the normalized &fim values for the wild type enzyme and the fïüed circles represent the normalized b& values for the G794A-î3-galactosidase. The k&Km values were normalized as percentages of the maximum activity observed (pH 6.0 to 10.0) to account for the large clifferences in the values between the enzymes. The &fim for wild type was 5310 s-1 mM-1 and 820 s-l mM-1 for G794A-B-galactosidase at pH R n

0.6

Ob-

O A -

0.3-

O f 3

0.1 -

Figare 5.9. pH profiles of the & values for the wild S.pe enzyme and G794A- 8-galactosidase with PNPG, The values were determined in pH Assay B d e r (30 mM TES, 50 m M histidine, 145 mM NaCl, lmM MgSOq, pH adjusted at 25°C). The open squares represent the Km values for the wild type enzyme and the med circles represent the Km values for G794A-Sgalactosidase.

Noimalized kat (96 of maximum value)

Figare 5.10. pH profiles of the normalized kcst values for the wild type enzyme and G794A-B-galactosidase with PNPG. The values were determined in pH Assay Buffer (30 mM TES, 50 mM histidine, 145 mM NaCl, 1mM MgSOq, pH adjusted at 25°C). The open squares represent the normalized kat values for the wild type enzyme and the faed M e s represent the normalized Ircat values for G794A-B-galactosidase. The bat values were normalized as percentages of the maximum activiw observed (pH 6.0 to 10.0) to account for the clifferences in the activities of the enzymes. The observed kt for wild type at pH 7.0 was 90 s-1 and for G794A-8-galactosidase 74 s-1.

NQmlaked kt / p (96 of mnrimum values)

Figure 5.11. pH profiles of the normalized ka& values for G794A-B- galactasidase with PNPG. The values were determinecl in pH Assay Buffer (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgSOq, pH adjusted at 25°C). The open squares represent the normalized values for the wild type enzyme and the GUed &cles represent the normalized kcafim values for (2794.-&galactosidase. The &fim values were normalized as percentages of the maximum activity observed (pH 6.0 to 10.0) to account for the large clifferences in the values between the enzymes. The &t/Km for wild type was 2250 s-1 mM-1 and for G794A-l3-galactosidase was 362 s-1 mM-1 at pH 7.0.

remained quite constant for G794A-I3-galactosidase (Figure 5.12).

5.8.1.2 W999F-&Galactosidase

5.8.1.2.1 ONPG

The shapes of the I(m vs. pH profiles for W999F-l3-galactosidase and the

wild type enzyme were quite similar (Figure 5.13) when ONPG was the

substrate. However, W999F-i3-galactosidase has higher Km values than the

wild type enzyme. The pH profiles for the nonnalized kt values have similar

shapes for both enzymes (Figure 5.14). The pH required for the half 1

kt value for W999F-B-galactosidase was shiRed a little lower (about 0.5 pH

units) than for the wild type enzyme, The pH profiles for the normalized

L t / R m values for the two enzymes are similar (Figure 5.15). Both enzymes

have half 1 values for &t/R, at about pH 8.5.

5.8-1.2.2 PNPG

W999F-13-Galactosidase had higher Km values than the wild type

enzyme at aU of the pH values (Figure 5.16) when PNPG was the substrate

but the pH profiles had essentially the same shapes. The pH required for the

half maximal normalized kcat value for W999F-13-galactosidase was shiRed

about 0.75 pH unit lower than for the wild type enzyme (Figure 5.17). The pH

promes for the normalized L J R m values were again quite gmilar for the wild

type and W999F-Qgalactosidases (Figure 5.18). The wild type B-galachsidase

may have a slightly lower half maximal value.

Figure 5.12. The pH profle of the ratio of Km values with ONPG (Rm ONPG) and the Içm values with PNPG & PNPG) for G794A-13-galactasidase and pH profiles of the ratio of kt values with ONPG k t ONPG) and the kt values with PNPG (kCat PNPG) for G794A-B-galactosidase. The values were detennined in pH Assay BuEer (30 mM TES, 50 mM histidine, 145 rnM NaCl, Imhi MgS04, pH adjusted at 25°C). Filled squares represent the Km ONPG Km PNPG at various pH values for G794A-f3-galactosidase. Filled circles represent the kcat ONPG / bat PNPG at various p H values for G794A-8- galactosidase.

Figure 5.13. pH profiles of the Km values for the wild type enzyme and W999F-B-galactosidase with ONPG. The values were deterrnined in pH Assay Buffer (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgSOq, pH adjusted at 25°C). The open squares represent the Km values for the wild type enzyme and the filled circles represent the Km values for W999F-13- galactosidase.

Figure 5.14. pH profiles of the normalized bat values for the wild type enzyme and W999F-f3-galactosidase with ONPG. The values were determined in pH Assay B s e r (30 mM TES, 50 mM histidine, 145 mM NaCl, 1mM MgSOq, pH adjusted at 25°C). The open squares represent the normalized kcat values for the wild type enzyme and the filied cirCles represent the normalized kt values for W999F-13-galactosidase. The bat values were normdized as percentages of the maximum activi* obsemed (pH 6.0 to 10.0) to account for the large differences in the activities of the enzymes. The observed kcat for wild tgpe at pH 7.0 was 6û0 s-1 and 54 s-1 for W999F-B-galactosidase-

Figure 5.15. Tbe pH profiles of the normalized values for the wild type enzyme and W999F-13-galamsidase. The values were determined in pH Assay Bufïer (30 mM TES, 50 mM histidine, 145 mM NaCl, lmM MgSO4, pH adjusted at 25°C). The open squares represent the normalized k tKm values for the wild type enzyme and the med d e s represent the normalized & values for the W999F43-galactosidase. The values were norrnalized as percentages of the maximum activity observed (pH 6.0 to 10.0) to account for the k g e clifferences in the values between the enzymes. The &JEC, for wild Qpe was 5310 s-1 mM-1 and 218 s-1 mM-1 for G794A-13-galactosidase at pH 7.0.

Figure 5.16. pH profiles of the Km values for the wild S p e enzyme and W999F-B-galactosidase with PNPG. The d u e s were determined in pH Assay BuEer (30 mM TES, 50 mM histidine, 145 mM NaCl, I n N MgSOq, pH adjusted at 25°C). The open squares represent the Km values for the wild type enzyme and the filled circles represent the Km values for W999F-13- galactosidase.

Normalized Lt (% of inatimnm value)

Figure 5.17. pH profiles of the normalized kcat values for the wild type enzyme and W999F-8-galactosidase with PNPG. The values were determined in pH Assay B&er (30 mM TES, 50 mM histidine, 145 mM NaCl, 1mM MgSOq, pH adjusted at 25°C). The open squares represent the normalized kcat values for the wild type enzyme and the filled circles represent the normalized k t values for W999F-6-galactosidase. The kcat values were normalized as percentages of the maximum activiw observed (pH 6.0 to 10.0) to account for the diEerences in the activities of the enzymes. The observed kcat for wild type at pH 7.0 was 90 s-l and 67 s-1 for W999F-13-galactosidase.

Figure 5.18. pH profiles of the normalized values for W999F-l3- galachsidase with PNPG. The values were determineci in pH Assay BufCer (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgSOq, pH adjusted at 25°C). The open squares represent the normalized k&Km values for the wild S.pe enzyme and the med in circles represent the normalized kca& values for W999F-i3-galactosidase. The k&Cm values were normalized as percentages of the maximum activity obsemed (pH 6.0 to 10.0) to account for the large differences in the d u e s between the enzymes. The b t / K m for wild type was 2250 s-1 mM-1 and 184 s-1 mM-1 for W999F-Rgalactosidase at pH 7.0.

5.8.1.2.3 pH Profiles of the Cornparison of Km and kt Values Witb

ONPG and PNPG

The H, ONPG / & PNPG ratio for W999F-l3-galactosidase over the pH

range was quite constant except for s d increases at the pH extremes

(Figure 5.19). The kt ONPG / kcat PNPG ratio remained relatively constant

for W999F-B-gaiactosidase (Figure 5.19).

5.8.2 kat and Km Values (pH 7.0)

5.8.2.1 G794A-B-Galactosidase

The bat and Km values for G794A-B-galactosidase were detennined

both ONPG and PNPG as the substrates (Table 5.1). When determiaing

the k t values, only very pure fractions of B-galactosidase were used. If the

fi-actions had not been pure, the Lt values would have been underestimateci

The b& values for G794A-13-gdactosidase with ONPG and PNPG were 6.0 and

1.2 fold lower (respectively) than the kcat values for the wrld type enzyme wi th

these same substrates. The Km values were s M a r for both ONPG and

PNPG. The kt& values for G794A-8-galactosidase with ONPG and PNPG

were 10 fold and 6.7 fold lower (respectively) than the kcaJRm values for the

wild type enzyme with these substrates.

5.823 W999Fi3-GaIactosidase and W999G-&Galactosidase

The kcat and Km values for W999F- and W999G-13-gdactosidase were

also determined using both ONPG and PNPG as the substrates (Table 5.1).

Again, when determining the kt values, only very pure fractions of the l.3-

ONPGIPNPG mtio of and

Figure 5.19. The pH profle of the ratio of Km values with ONPG (Hm ONPG) and the Rm values with PNPG (& PNPG) for W999F-B-galactosidase and the pH profile of the ratio of bat values with ONPG (kcat ONPG) and the bat values with PNPG kt PNPG) fur W999F-B-galactosidase. The values were determined in p H Assay Bder (30 mM TES, 50 mM histidine, 145 mM NaCl, ImM MgSO4, pH adjusted at 25°C). Frlled squares represent Km ONPG / & PNPG at various pH values for G794A-B-galactosidase. Filled circles represent kCat ONPG / bat PNPG at v h o u s pH values for W999F-B- galacbsidase.

Table 5.1. The & , Lt and kcat& values for the wild type egalactosidase and the substituted f3-galactosidases using ONPG and PNPG as the substrates a t pH 7.0.

galactosidases were used. The LJrc, values for W999F-f3-galactosidase with

ONPG and PNPG were 24 fold and 14 fold lower (respectively) than the

values for the wild type enzyme with these substrates. The kt/& values for

W999Gbgalactosidase with ONPG and PNPG were 32 fold and 22 fold lower

(respectively) than the bat&, values for the wild type enzyme with these

substrates.

!i'ype of&

galactosidase

enzyme

wiid type

G794A

W999F

W999G

5.8.3 Alcohol Acceptors

5.8.3.1 G794A-B-Galactosidase

The effects of the acceptor on the Vma (kcat values) were similar with

both ONPG and PNPG (Table 5.2). Methanol appeared to activate the

substituted enzyme the most. 1,3-Propanediol, and 1,4-butanediol caused

decreases of the enzyme activity to almost half of the normal values with both

ONPG and PNPG as the substrates.

kt value

for ONPG

(sl)

600

100

54

48

bt value

for PNPG

(s'l)

90

74

67

52

&value

for ONPG

(mm

0.12

0.20

0.26

0.3 1

&value

for PNPG

(mM3

0.040

O .22

0.43

0.52

for ONPG

( m ~ - 1 s - 1 )

5000

500

210

155

for P

(mM.

22

34

1 t

1 C

The catalytic activity of W999F-B-galactosidase was found to bc

increased significantly by each of the alcohol acceptors used (Table 5.2). Thc

acceptors inmeased the activity to sfightly d i f f e ~ g extents depending on thc

substrate used. Again the effects of the acceptors were similar for ONPG 01

PNPG.

Table 5.2. The effect of various alcohols on the Lt values of the substitutec fbgalactosidases. The apparent bt vdues (app &t) are the kt values ir the presence of an acceptor. The bat value is the kcat value for thc --- substituted enzyme in the absence of an acceptor.

G794A

G794A

G794.A

G794A

G794A

W999F

W999F

W999F

W999F

W999F

n-propanol

1,s-propanediol

1,3-propanediol

methanof

1,4butanediol

n-propanol

1,2-propanediol

1.3-propanedi01

methanol

1,4butanediol

1.4 1.7

1-2

0.37

2.0

0.39

5.9

6.3

4.9

2.2

9.3

1.1

0.57

2.1

0.57

3.8

4.8

7.2

2.5

6.1

5.8.4 Acceptor Studies

Figure 1.4 shows the reaction scheme of Rgalactosidase in the presence

of an acceptor. The following equation [II cm be derived h m the mechanism

ShominF'igure L4:

(apparentkcat - kcat) apparentkcat =

[Al k, + k,

Plots of apparent kt values as a function of (apparent bt - bt) / [acceptorj

were constructed. The Y-interceptai of the lines of these cuves represent the

maxixnum rates of activity at infinite acceptor concentrations and are equal to

k W (32 + k4). The slope is equal to Ck2 + k3IRi'' l (ka + b).

5.û.4.1 Acœptoi Studies with Alcohols

Acceptor studies were carried out using a series of different

concentrations of the alcohol acceptor with ONPG and PNPG as the

substrates. Methano1 was used for G794A-0-galactosidase and 1,4-butanedioi

was used for W999F-B-galactosidase because these alcohols were the best

activators of these enzymes (Table 5.2).

5.8.4.1.1 G794A-B-Galactosidase

The activity of G794A-B-galactosidaçe was increased the most when

methanol was used as the acceptor with PNPG or ONPG as the substrate.

The plots of the acceptor study with methanol and ONPG or PNPG as the

substrate are shown in Figure 5.20. The intercepts and slopes of these graphs

are summarized in Table 5.3. The bat values for G794A-0-galactosidase

apparent &*

Figure 5.20. a. The acceptor study for the G794A-i3-galactosidase using methanol as the acceptor and ONPG as the substrate. b. The acceptor study for the G794A-B-galactosidase using methanol as the acceptor and PNPG as the substrate. The apparent is the catalytic rate constant (bat) in the presence of methsnol and kt is the catalytic rate constant in the absence of methanol. The intercepts of these graphs represent the apparent kt values at infinite methanol concentrations and are equal to k2k4/ (k2 + k4).

700

600-

500 - 400-

apparent kat ( d l 300-

200-

7

100-

O I I

without methanol are 100 s-1 for ONPG and 74 s-1 for PNPG.

5.8.4.1.2 W999F-&Galachsidase

The plots of the acceptor study with 1,4butanediol and ONPG or PNPG

as the substrate are shown in Figure 5.21. The intercepts and slopes of these

graphs are summarized in Table 5.3. The intercepts showed that large rate

increases were found (the kcat values for ONPG and PNPG without 1,4-

butanedi01 are 54 s-1 and 67s-1, respedively). Both the slopes and intercepts

were similar for ONPG and PNPG.

Table 5.3. The slope and intercept values for the plots on Fïgure 5.20 and 5.21.

Substi tuted Alcohol Substrate Intercep t S l o ~ e

I G794A 1 methanol 1 PNPG 1 120 1 130 I G794A

1 W999F 1 1,4-butanedi011 PNPG 1 470 1 430 1

methanol

W999F

5.8.5 INHIBITOR SrUDIES

Competitive inhibition constants (Ki values) for the interaction of the

inhibitors with the fi-ee enzyme were obtained usjng the following eqpation [SI:

ONPG

1,4-butanediol

670

ONPG

2830

520 490

apparent bt (a1)

I I I

0.25 0 5 0.75

(apparent kat - kt) 1 [1,4Butanediol] (s-l BlM-1)

Figure 5.21: a The acceptor study for the W999F-B-galactosidase using 1,4 butanediol as the acceptor and ONPG as the substmk. b. The acceptor study for the W999F-&gaIactosidase using 1,dbutanediol as the acceptor and PNPG as the substrate. The apparent bat is the catalytic rate constant (k& in the presence of 1,4-butanediol and kcat is the catalytic rate constant in the absence of l,4butanediol. The vertical intercepts of these graphs represent the apparent bat values at infinite 1,4-butanediol concentrations and are e q d to k2k4/ (k2 + hl-

This equation is based on the mechanisms shown in Figures 1.3 and 1.4 and

mathematidy accounts for the rate changes that occur if an inhibitor also

acts as an acceptor (Deschavanne et al., 1978). The Vm and the Km values

are those for enzymes in the absence of an inhibitdacceptor (m) and were

found using Eadie-Hofstee plots. In the presence of inhibitors/acceptors, the

Vm and the Km values change and these values are called apparentVm and

apparen-.

5.8.5.1 G794.A-&Galactosidase

The Ki values obtained for a series of inhibitors are shown in Table 5.4.

G794A-B-Galactosidase was not inhibited as well by IPTG and PETG as was

the wild type enzyme while lactose inhibited the G794.A-B-galactosidase

somewhat better than wild type i3-galactasidase. D-Galactose and Larabinose

inhibited G794A-&galactosidase and wild type B-galactosidase to similar

extents. D-Xylose and D-mannose inhibited G794.A-B-galactosidase a little

better than they inhibited the wild type enzyme. An important finding is that

D-glucose and D-lyxose inhibited the G794.A-I3-galactosidase several fold better

than they inhibited the wild type enzyme. G794A-f3-Galactosidase was also

more stmngly inhibited by the transition state analog inhibitors Lribose (14

fold better), D-galactonolactone (3.5 fold better) and D-galactal (3 fold better)

compared to the wild type enzyme. The transition state analog inhibitor 2-

amino-galactose also inhibited the mutant a little better than the wild type

enzyme.

5.8.52 W999F-B-Galactosidase and W999GB-Galactosidase

The values for the various inhiiitors wi th W999F- and W999G-13-

Table 5.4. The inhibitor constants (Ki) for various substrate analog and transition state analog inhibitors using merent B-galactosidases.

Name of Inhibitor

lPTG

PETG

lactose

D-galactose

Larabinose

D-glucose

galactosidase are also shown in Table 5.4. The Ki values for the substrate

I D-mannose

Lribose

analog inhibitors, IPTG and PETG, were much higher than those of the

D-lyxose 80 31 200 145

wild type

W m M )

0.11

0.0009

1.5

7.20

78

230

unsubstituted enzyme (330 and 3300 fold, respectively). Lactose also inhibited

520

0.28

the substituted enzymes much more poorly than it did the wild type enzyme

G794.A

Ki(mM)

0.59

0.0036

O .99

8.5

77

43

360

0.020

W999F

Ici b M )

7.8

0.30

160

79

300

3990

W999G

( m m

60

2.8

177

101

507

1860

750

2.1

1150

1.1

(about 100 fold). D-Gaiactose also inhibited the substitukd enzymes poorlq;

compared to the d d type enzyme (10 - 15 fold). The transition state inhibitoz

Lribose inhibited the substituted enzymes more poorly (about 8 fold) than the

wild type enzyme while D-galactd, 2-amino-D-galactose and D-

galactonolactone had more or less s d a r efTects on both enzymes as on the

wild type enzyme. The Ki values of D-glucose were significantly higher than

the values for the wild type enzyme wMe the values for D-lyxose and L

arabinose were also somewhat higher. D-Xyiose and D-mannose only inhibited

the substituted enzymes a littIe more poorly than the wild type enzyme.

5.8.5.3 D-Glucose, D-Xybse and LArabiaose Studies

The above data showed that Gly-794 and -999 seemed important for

binding at the glucose subsite. Therefore, detailed kinetic studies with D-

glucose, D-xylose and Larabinose were carried out.

5.8.5.3.1 Plots of apparent Km / apparent k t As A Function of the

InhiiitodAcœptor Concentration

Plots of apparent Km/apparent kcat as a fiindion of the concentration of

inhibitor/acceptor were comtructed. The dopes of tbese plots are estimsites of

(Kd k&l(l/Ki). The intercepta are estiriïntes of Km / kt values. The value of

Ki (inhibition constant) can, therefore, be determined using this plot and is

more a m t e than simply using equation [2] at one inhibitor concentration to

obtain the value.

5.8.5.3.1.1 G794A-&Galactosidase

The Ki values for D-glucose, Larabinose and D-glose (with PNPG as

the substrate) that are in Table 5.4 were d e t e d e d h m the plots on figures

5.22 and 5.23.

5.8.53.1.2 W999F-&Gala~h~idase

Plots of apparent &/apparent kCat as a.function of D-glucose

concentration were constructed using PNPG as the substrate (Figure 5.24).

Similar plots were constructed using L-arabinose and D-xylose as the

acceptors and PNPG as the substrate (Figure 5.25). The Kj values for glucose,

arabinose and xylose (with PNPG as the substrate) were those reported in

Table 5.4.

5.8.6 Acceptor Studies with Sugars

5.8.6.1 G794.A-&.GaIactosidase

5.8.ô.l.l D-Glucose Study The plots of the acceptor study using equation [1] with D-glucose and

(apparentkcat - kat) apparentkcat =

[AI

ONPG or PNPG as the substrate are shown in Figure 5.26. The intercepts and

dopes of ttiese graphs are ized in Table 5.5. The presence of innriite D-

glucose decreased the rate of the reaction w i t h ONPG and PNPG compared to

G794A-f3-galadosidase without D-glucose with these substrates. Note that

the slopes (related to &) are very low.

apparent & / apparent kt (mM 8 )

Figure 5-22. Plots of apparent Km / apparent bat as a firnction of the D- glucose concentration for G794A-B-galactosidase. a. Plot of apparent Km / apparent kt as a fuoction of the D-glucose concentration usling ONPG as the substrate. b. Plots of apparent Km / apparent bat as a h c t i o n of the D- glucose concentration for G794A-13-gdactosidase using PNPG as the substrate.

Figure 5.23. Plots of apparent Km / apparent bat as a function of the acceptorf~nhibitor concentration for G794A-B-gahctosidase using PNPG as the substrate. a. Plot of apparent H, / apparent bat as a function of the G arabinose concentration. b. Plot of apparent Km /apparent kt as a function of the D-xylose concentration.

Figare 6.24. PIots of apparent Km / apparent bat as a fundion of the D- glucose concentration for W999F-B-galactosidase. a. Plot of apparent R, / apparent Lt as a h c t i o n of the D-glucose concentration using ONPG as the substrate. b. Plot of apparent Km /apparent kCat as a h c t i o n of the D- glucose concentration concentration using PNPG as the subshte.

apparent / apparent kt (mM s)

Figure 5.25. Plots of apparent Km / apparent bat as a function of the acceptorhhibitor concentration for W999F-Bgalactosidase using PNPG as the substrate. a. Plot of apparent Km / apparent Lt as a function of the G arabinose concentration. b. Plot of apparent Km /apparent kt as a hct ion of the D-xylose concentration.

75 - 60 -

apparent (s-1) 45-

30 - 16 -

O I 1 1

Figure 5.26. a. The acceptor study for G794.A-13-galactosidase using D- glucose as the acceptor and ONPG as the substrate. b. The acceptor study for the G794.A-P-galadosidase using D-glucose as the acceptor and PNPG as the substrate. The apparent kat is the catalytic rate constant (bat) in the presence of D-glucose and bat is the catalytic rate constant in the absence of glumse. The vertical intercepts of these graphs at zen, on the horizontal sale represent the & at infinite D-glucose concentrations.

Table 5.5. The intercept values and slopes for the plots of apparent Lt vs- (apparenbt - bkcat) / [Sugar Accepter] for G794A-&galactosidase.

G794A 1 D-xylose PNPG 1 54 1 1

Substituted

&Galactosidase

G794A

G794A

5.û.6.12 D-Xylose Study

The activity decreased when D-xylose was used as the acceptor with

PNPG as the substrate. The plot of the acceptor study with D-xylose and

PNPG as the substrate is shown in Figure 5.27. This is a poor graph as it only

has 3 points. However, it is actually based on 4 points and the information

obtained from it is important. The intercept and dope of this graph are shown

in Table 5.5. The presence of infinite D-xylose decreased the rate of the

reaction compared to the bt of G794A-i3-galactosidase in the absence of D-

xylose.

5.8.6.2 W999F-i3-Galactosidase

5.8.6.2.1 D-Glucose Study

The plots of the acceptor study with D-glucose as the acceptor and

ONPG or PNPG as the substrates are shown in Figure 5.28. The intercepts

and slopes of these graphs are siimmarized in Table 5.6. The presence of D-

glucose increased the rate of the reaction with ONPG and PNPG . The k a t

values for W999F-&galactosidase in the absence of D-glucose are 54 s-l and

SW

D-Glucose

D-Glucose

Substrate

ONPG

PNPG

Intercept

(s+

22

15

S o ~ e

(mM)

5.2

1.7

Figure 5.27. The acceptor study for the G794A-B-galactosidase using D- xylose as the acceptor and PNPG as the substrate. The apparent kcat is the catalytic rate constant (kCat) in the presence of D-xylose and kcat is the catalytic rate constant in the absence of D-xylose. The vertical intercept of this graph at zero on the horizontal scale represent the bt at infinib D-xylose concentration.

Fi- 5.28. a The acceptor study for the W999F-Bgalactosidase using D- glucose as the acceptor and ONPG as the substrate. b. The aaxptur study for the W999F-&galactosidase using D-glucose as the acceptor and PNPG as the substrate. The apparent kt is the catalytic rate constant (kcat) in the presence of D-glucose and k t is the catalytic rate constant in the absence of D-glucose. The vertical intercepts of these graphs at zero on the horizontal scale represent the kcat at infinite D-glucose concentrations and the dopes represent the dissociation constant (Ki") of D-glucose nom the galactosyl fonn of the enzyme.

67 s-1 with ONPG and PNPG respectively.

Table 5.6. The intercept and dope values for the plots of apparent kcat vs. ( apparenh t - bt) / [Sugar Accepter] for W999F-B-galactosidase.

5.8.6.22 D-Xylose

The plots of the acceptor study with D-xylose and PNPG as the

substrate is shown in Figure 5.29. The data for this plot was poor but the

information obtained from it is important. The intercept and dope of this

graph are summarized in Table 5.6. The presence of D-xylose increased the

rate of the reaction compared ta W999F-B-galactosidase in the absence of D-

xylose.

Substituted

8-Galachsidase

W999F

W999F

W999F

5.9 GAS LIQULD CHROMATOGRAPHY STUDIES

63.1 Sugar Stadards

Various concentrations of D-glucose, D-galactose and lactose were used

as sugar standards for the gas liquid chromatography assays. The peaks on

the chromatogram that represented B-D-glucose, a-D-glucose, i3-D-galactose,

a-D-galactose, a furanose form of D-galactose, Ij-lactose, a-lactose and the

interna1 standards (2 mM i-inositol and 7 mM i3-D-phenyl-glucoside) were

s~gar

D-Glucose

D-Glucose

D-Xylose

Substrate

ONPG

PNPG

PNPG

Intercept

(s-l)

570

420

280

~ O P

(mM)

950

350

1110

600

SOO-

400-

apparent kt (s'l) 300-

200-

100-

O I I

Figure 5.29. The acceptor study for the W999F-6-galactosidase using D- xylose as the acceptor and PNPG as the substrate. The apparent bat is the catalytic rate constant (kCat) in the presence of D-rrylose and kt is the catalytic rate constant in the absence of D-xylose. The vertical intercept of this graph at zero on the horizontal scale represent the kcat at infinite D-xylose concentrations,

identified (Figure 5.30). The e s t interna1 standard peak corresponds to i.

inositoL The peak areas for &glucose, a-glucose, &galactose, a-galactose anc

a furanose form of D-galactose were aII added together and also divided by t h e

ârea for the i-inositol peak. This was done for each concentration of t h c

standard sugars and a standard plot for the glucose plus galactose wai

constructed using these peak ratios Figure 5.31). The peak areas for B-

lactose and a-lactase were added together and also divided by the area for the i.

inositol. This was done for each concentration of the standard sugars and a

standard plot for lactose was constmcted using these ratios (Figure 5.32). Il

was assumed that this standard line also holds for allolactose. (Note that i-

inositol was used as the interna1 standard for both the monosaccharides and

the disaccharides since the peak areas for the 13-D-phenyl-glucoside gavc

anomalous results.)

5.922 Wild Type i3-Galactosidase

The J3-galactosidase assay with 50 mM lactose as the substrate was

stopped at various time intervals. The samples were analyzed by gas liquid

chromatography. The production of glucose and allolactose was measured al

each time. The peak areas for &glucose, a-glucose, B-galactose, a-galactose,

and the furanose form of galactose were all added together and divided by the

area for the i-inositol peak. This was done for each time interval. Using these

peak ratios and the standard cvve in Figure 5.31, the concentration oi

galactose and glucose at each time intemal was determined. Figure 5.33

shows the amount of glucose and galactose produced per pg of the wild type

enzgme. To determine the amount of dolactose produced, the peak areas for

t t t Pigare 5.30. A mical gas chromatography elution profile of B-galachsidase reacting with lactose. The concentration of lactose was 50 rnM A sample was h z e n in liquid nitmgen a f k reaction for 20 min and lpopkdized overaight. The sample was silylated. Sample was injected into the gas chromatograph (1 pL) and the elution profile was proàuœà. Peaks are represented by S, G+G, IS, L, and A which indîcate solvent, g.luc~se+gaiactase, interna1 standard, lactose and allolactose respectively. Additional peaks are a d a c t s of the silylation reaction.

Peak Ratio

O 2 4 6 8

Concentration of Sugars (mM)

Figure 5.31. The standard m e for the peak ratios as a function of the combined concentrations of D-glucose and D-galactose. The peak ratios were detennined by adding up all the areas of the glucose and galactose peaks and dividing them by the area under the i-inositol peak (the interna1 standard).

Peak Ratio

Concentration of Sugars (mM)

Figure 6.32. The standard m e for the peak ratios as a function of thi l a d s e concentrations. The peak ratios were determined by adding up thi areas of the B-lactose and a-lactose peaks and dividing them by the area foi the i-inositol peak (the intemal standard).

Figure 5.33. The amount of glucose and galactose produced by wild type 13- galactosidase and the amount of allolactose produced by this same enzyme per pg of enzyme at given time intervals using 50 mM lactose as the substrate. Filled squares represent the amount of glucose and galactose produced per pg of enzyme and filled Qrcles represent the amount of dolactose produced per pg of enzyme.

&allolactose and a-dolactose were aded together and divided by the area for

the i-inositol standard for each time interval. Using these ratios and the

standard m e in Figure 5.32 the concentration of dolactose present at each

time interval was determined. The plot of the concentration of allolactose

present produced at each time intemal for the wild type f3-gdactosidase is

shom in Figure 5.33.

5.9.3 G794A-&GalactoBidase

The G794A-&galactosidase assay with 50 mM lactose as the substrate

was stopped at various time intemals. The samples were analyzed by gas

liquid chromatography. Unfortunately too much enzyme was added and too

much product was produced. As a result, the results could not be properly

analyzed since the integration was incorrect. Qualitatively it could be seen

that the amount of allolactose produced was much smsller than the amount of

galactose and glucose (especially when compareci to the values for wild type

e n m e ) .

5.9.4 W999F-B-Galactosidase

The W999F-&galactosidase assay with 50 mM lactose as the substrate

was stopped at various time intemals. The samples were analyzed by gas

liquid chrornatography. Unfortuaately too much enzyme was added and a

large amount of product was produced. As a consequence of this the results

could not be properly analyzed since the integration was incorrect.

Qualitatively it could be seen that the amount of dolactose produced was

much smaller than the amount of galactose and glucose (especially when the

amounts were compared to these aame values for wild type enzyme).

6. Discussion

6.1 G794A-&GALACTOSIDASE

G794.A-13-Galactosidase precipitated at the same ammonium sulfatx

concentration and eluted h m the DEAE colflmn in simhr volumes compared

to the wild type enzyme. This indicates that the gross physical propertieê

associateci with purification were not seriously afEected by the substitutions.

The pH profles for normalized &fim were very similar for G794A-13-

galactosidase and the wild enzyme with ONPG. Since ktKm is equal tc

k f i it is independent of ka and it lacks the influence of ka. The similaritg

between the two curves indicates that kz and R, are not chiirigina in a different

way than d d type l3-galachsidase is. The kt value for B-galactosidase in the

absence of acceptors and inhibitors is e q d ta k&/(k2+k3). The & value for

i3-galactosidase is equal to Ic6k3/(k2+k3)]. Both of these equatioxls are derived

fkom Figure 1.3. Any differences between the pH vs. Km and pH vs. bat profiles for wild type and G794A-f3-galactosidase with ONPG are, therefore, due

to changes in the ka value. The Km value of G794A-B-galactosidase with

PNPG (Figure 5.9) decreased with increasing pH (starting at pH 6.0) reaching

a minimum at pH 8.0. The decrease of the Km value between pH 6.0 and 8.0

had a halfmliJrimR1 value between pH 7.0 and 7.5. This was not seen for wild

type &galadosidase as the & value for wild type f3-galactosidase with PNPG

(Figure 5.9) remained more or less constant between pH 6.0 and 8.0. At pH

values larger than 8.0, the & values increased in the same manner for both

enzymes. Although it is not as obvious, a similar decrease was seen for the Km

values of G794A-13-galactosidase with ONPG (Figure 5.6). The pH profile of

the normalized bat values for G794A-13-galactosidase and the wild type

enzyme shows that G794A-bgalactosidase has half maximal norrnalized Lt values for both ONPG and PNPG that are about 2 pH units lower than witb

the wild type enzyme and the half maximal values are at about pH 7.0 ta 7.5.

These & and bt data therefore, indicate that the pKa for is about 7.0 to

7.5 for G794.A-13-galactosidase and has decreased about 2 pH units îrom the

value for wild type (Huber et al. 1983). The lowering of the pKa may be due to

a change in the environment around an active site residue (Figure 1.5). It rnay

be due ta a pKa change for Tyr-503, which is important for catdysis, or it may

be due to a change in the environment of a retidue on the loop (e-g. Glu-797)

(see Figure 1.5). (It could a c t d y be due to some other residue.) The ratio of

Km (ONPG) / Km CPNPG) and the ratio of bat (ONPG) / kcst (PNPG) also

remained constant. This indicates that the k2, k3, and R, values all have the

same pH, values for ONPG as for PNPG wi th G794A-B-galactosidase.

Determination of the rate determining steps and of the actual values of

rate constants is important for analysis of the effects of eubstituted residues

in enzymes. The bat value for the action of 0-galactosidase in the absence of

an acceptor is kzk~/(kz+h) (Tenu et al., 1971). This value is derived from the

mechanism in Figure 1.3. Two different synthetic B-D-galacbsyl substrates

(ONPG and PNPG) can have different k2 values but must have the same

cornmon ka value. For wild type B-galactosidase, kz and k3 are both partially

rate determining for ONPG (values are 1500 s-1 and 1000 s-l for k2 and ka,

respectively), while k2 is rate limiting for P W G ( the k2 value is 90 s-1). As a

result, the kt value differs when the substrate is changed values are 600

s-1 and 90 s-1 for ONPG and PNPG, respectively). If ka were rate limiting with

both PNPG and ONPG for G794A-&galactosidase, the bat values would be the

same. The kat values for G794A-B-galactosidase with ONPG and PNPG (100

s-1 and 74 s-1, respectively) are lower than the kmt values for the wild type

enzyme with these substrates. This indicates that either the k2 value, the k3

value, or both are decreased for the substituted enzyme. The kcat values for

wild type B-galactosidase with ONPG and PNPG are very different (1500s-1

and 90s-1 respectively). Although the bt values for G794A-8-galactosidase

with ONPG and PNPG were not the same, they are roughly similar connpared

to the wild type enzyme, This suggests that ka is probably smaller than k2 for

these substrates.

The reaction scheme of 13-galactosidase with compounds which are both

cornpetitive inhibitors and acceptors is shown in Figure 1.4. Many alcohols and

sugar compounds accept galactose from the galactosyl form of the enzyme

CEmGA) to form B-galactoside adducts with the acceptors (Deschavanne et al,,

1978; Huber et al., 1984). It was found (Table 5.2) that 1.0 M n-propanol and

1.0 M methanol increased the activity of G794A B-galactosidase with both

ONPG and PNPG (Table 5.2). The fact that these alcohols increased the

reaction rate regardless of the substrate indicates that k3 is at least partially

rate deteminkg for G794A-13-galactosidase with both ONPG and PNPG.

The activation by increasing concentrations of methanol as an acceptor

showed that the activity with ONPG increased to almost 7 fold while the rate

increase with PNPG was less than 2 fold (Figure 5.20a and b). These results

are summarized in Table 5.3 and are similar to results with B-galactosidases

with other substitutions for Gly-794 (Martinez-Bilbao et al., 1991). The

intercepts of the plots (Figure 5.20a and b) are equal to (k2k4/(k2+k&. Since

methanol enhanced the rates of the reactions with the substituted enzyme, the

values of ka and kq (methanol) of the substituted B-galactosidase must be

greater than the ka value (Figure 1.4). The ka value for the wild type enzyme

is 1500 s-1 with ONPG and 90 s-1 with PNPG as the substrate. The values of

the intercepts wi th methanol lïsted in Table 5.3 indicate that the k~ values for

G794A-f3-galactosidase are greater than or equal to 670 s-1 with ONPG and

roughly equal to 120 s-1 with PNPG as the substrate. In the case of PNPG,

the value of 120 s-f must nearly represent k2 since k4 has a value of 670 s-1 o r

greater (as indicated by the fact that the intercept with ONPG was 670 s-1 and

that 1Lq is a cornmon step). That is, is much larger than k2 and thus

k2k4/&2+k4) becomes k2. The value of ka for both substrates (cornmon) must

be about 100 s-1 since k2 is at least 6.7 fold higher than this value in the case

of ONPG and yet the kt &2I&(k2+k3)} is 100 s-1. The ka value of the wild

type i3-galactosidase is 1000 s-1. Thus, the substitution of Gly-794 by Ala in i3-

galactosidase defkitely increased the kz value with PNPG as the substrate

but not necessarily with ONPG. The ka value was decreased about 10 fold.

Therefore, the fac'trs that increase the k2 values for G794A-8-galactosidase

with some substrates (e.g. PNPG) have the opposite effects on the values.

It is possible that locking the loop between residues 793 and 804 (Figure 1.5) in

the closed position resuIts in altered binding of the transition state. There could

be a difference in the positioning of the transition state and, if precise

positioning is highly important for hydrolysis (k3), one could expect that the k3

value would be decreased CMartinez-Bilbao et al., 1991).

The dope of the plots with methanol are equal to Kiw(k2+k31/(k2+k4).

The values of these slopes are also summarized in Table 5.3. Since k2 and k4

(methanol) are quite a lot larger than ka in the case of ONPG, the dissociation

constant for methanol h m the galactosyl form of the e-e (Ki"), which

should be the same for both substrates, is larger than the dopes of the plots

for both ONPG and PNPG. In the case of PNPG, it is obviously very much

larger because both kz and k3 are quite smnll relative to k4. Thus, since the

slope was 2û30 mhd the Q" is greafer than 2830 mM. This value is, of course,

the same for each substrate. Such a large Ki1' value indicates that the

galactosyl form of the enzyme binds methano1 poorly. This is, of course,

expected since methanol is Rmall and has few functional groups available for

binding. The binding is, however, poorer than it is with wiid m. The value of

I(i" for methanol for the d d type enqme is 2210 mM (Huber et al., 1984) and

the value for G794A-i3-galactosidase is > 2830 mM.

The great disparity between ONPG and PNPG in the slope values (Table

5.3) and the fact that estimates of k2 for PNPG (=120 s-1) and estimates of the

common kg value (= 100 6-1) are available, allows one to obtain an

approximation of the kz value of ONPG. The value of is > 2830 mM. The

slope for the PNPG plot with methanol is 130 mM (Table 5.3). Thus,

Ki1'(k2+k3)/(k2+k4) = (>2830H120+100Y(120 + kq) = 130. Solving for shows

that its value is > 4670 s-1. The intercept of the plot for OM?G with methanol

is 670 s-1 (Table 5.3) and is equal to k2k4/(kz+k4). Since k4 is > 4670 s-1 it can

be stated that k g for ONPG is approximately equd to 670 s-1. Thus,

substitution of an N a for Gly-794 has decreased the kz for ONPG (fiom 1500

s-1 to about 670 si). The effect is different h m that with PNPG. In the case

of PNPG, k2 was increased ( h m 90 s-1 ta 120 s-1). The values of the

constants obtained by the above reasoning are summarized in Table 6.1. The

rate of cleavage of the glycosidic bond appears to depend on the orientation of

the aglycone. G794A-l3-Galactosidase has a lower k2 value than the wild type

enzyme w i t h ONPG but a higher k2 value than the wild type enzyme with

PNPG. The rate of galactosylation was probably enhanced for G794A-B-

galactosidase with PNPG because the aglycone is in a more optimal

orientation for galactasyiation to occur while the opposite seems to be true fa

ONPG.

The Km value for the action of B-gahctosidase in the absence of a:

accephr is KJlq/(k2+k31] (Figure 1.3). Since the approximate values of k2 an'

ka are known and since the Km values were determined, approaimRte values c

& can be obtained. Calculations show that H, for ONPG is about 1.5 mM

Table 6.1. The (rate constant for the reaction of the acceptor with th galactosyl form of the enzyme) and Ki" values ( dissociation constant for th acceptor fiom the galactosy1 form of the enzyme) for methanol and th1 caldated dissociation constants (Hç) for the substrates (ONPG and PNPG for G794A-B-gdactosidase and the literature values for the & values for wilc Qpe are also shown.

while it is about 0.5 mM for PNPG. Thus, the substitution has significantlj

increased the & values for ONPG and PNPG (the wild type & for ONPG is 0.1

mM and 0.04 mM for PNPG). The capacity of the enzyme to bind thesc

Enzyme

(Substratel

G794A

(ONPG) . G794A

CPNPG)

wild type

(ONPG)

wild type

(PNPG)

k2 (s-l)

= 670

= 120

1 500

90

k3 (s-1)

= 100

= 100

1000

1000

kq (s-1)

(methanoIl

> 4 670

> 4 670

10 500

10 500

Hi" (mM) (methanol)

> 2 380

> 2 830

2 210

2 210

synthetic substrates has been decreased as a result of the substitution. The

calculated H, values are also summarized in Table 6.1. Positionhg of the 793-

804 Ioop over the active site thetefore causes the substrate dissociation

constant 6) for hydrophobic synthetic substrates to increase.

The ratio of Lt/Km is equal to k f i for each fi-galadsidase regardless

of which step (k2 or k3) is rate limithg. The ratios are estimates of the

catalytic efficiencies of enzymes. RJote that the k f i values obtained h m

the ka& ratios (Table 5.1) are in quite good agreement with the k 2 4

values that ca. be calculated h m the values on Table 6.1). Any differences in

the k&Xm values fimm the values of wild type 8-galactosidase with ONPG or

PNPG as the substrates are due to changes in the values of k2 and/or &. The

large decreases of ka& values for ONPG and PNPG in each case are due

maidy to the increases in the R, values for the substituted enzymes since the

k2 for ONPG only decreased about 2 fold and the kz for PNPG actually

increased That is, the binding of these substrates has decreased considerably

and the decreases in binding have caused the catalytic efficiencies of this

substituted enzyme to decrease.

The bat/K, values are also second order rate constants for the

formation of the first transition state (Fersht et al., 1984) and are thus

measures of transition state stabilization (Fersht et al., 1974). Table 5.1

summarizes the bat/K, values obtained for G794A-13-galactosidase with

ONPG and PNPG. With both substrates the kCat/R, values decreased

compared to the wild type enzyme despite the fact that kg for PNPG was

larger. Figure 6.1 is an illustration of the energetics that may be occuring.

The substrates for the substituted enzyme bind more poorly and thus the

energy well for E *GAL-OR is more shalIow. When PNPG was the substrate,

Figure 6.1. Hypothetical reaction CU-ordinate for wild type and G794A-l3- galactosidase with ONPG (tbick Lue) and PNPG (thin line). The extents to which the two transition stata and the intermediate have ben destabilized are arbitrary but are consistent with the results. It is also arbitrarily shown that the stability of the covalent intermediate is the same for both enzymes but these stabilities are unknown

the k2 value of G794A-13-galactosidase increased compared to the wild type

enzyme. This is because there is a decrease in the difference in the energy

barrier for galactosylation (fiom EmGAL-OR to the first transition state - E*TS #1) for the substituted enzyme (hm * to t). The overall energy ta d o w

the transition state to form h m E + GAL-OR (comparable to ks/fC[,) is not,

however, decreased (hm to t). With ONPG, the rate of galactosylation (ka)

decreased for G794A-B-galactosidase compared to the wild type enzyme. This

resulted in a larger energy barrier for k2 (galactosylation) (hm EaGALOR to

EeTS #1) of G794A-galactosidase compared to the d d type enzyme in th

case of ONPG. The rate of degalactosylation (k3) was much lower for G794A

B-galactosidase compared to the wrld type enzyme and its decrease is one o

the main reasons that the overall bat has decreased. In the case of thc

common kg step, the transition state (EmTS #2) is much less stable (mon

energy is needed to reach it) than is the case for the transition state for ka witl

the wild Qpe enzyme,

It was suggested that substitution of Gly-794 by an Ala should causr

the loop made up of residues 793 to 804 (Figure 1.5) to be held in the closec

position (personal communication with Doug Juers and Brian Matthews)

Inhibition studies to be discussed below, suggested that there is better bhdiq

of the transition state and poorer bnding of the substrate. For this to ocm

the extra energy needed for binding the substrate should be regained whex

binding the transition state and this should result in lowering the energy of th

transition state for G794A-B-galactosidase compared to the wild type enzyme

With PNPG this appears to be partially true as the energy needed (* to t) tc attain the transition state (starting with the E9GA.L-OR cornplex) is lowerea

compared to the wild type enzyme. However, siace the binding of th€

substrate has become very poor as a result of the substitution, the transitioc

state is less stable despite this. With ONPG, the energy for k2 (starting with

E*GAL-OR) is ac tudy raised compared to the wild type enzyme. These

kdings indicate that some energy is regained when the transition state i e

bound for PNPG but substrate binding is very poor and the reaction is thu

very slow. For ONPG there is no evidence of any energy regain when the

transition state is bound since the k2 value is decreased. In addition, kz/R, is

even smaller since H, is so large. G794A-eGalacbsidase binds ONPG and

144

PNPG poorly and this over rides any positive dects for galactosylation in the

case of PNPG. The differences on the efEects of the substitution of Ala for Gly-

794 on the k2 values for PNPG and ONPG m u t be dependent on how the loop

affects the al ig~lent of the nitrophen01 aglycones (Figure 6.2) and then on how

this affects the stability of the transition sbtes (which presumably s t i l l have

partial bonds to the galactosyl part of the transition state) or there would not

be any different effects on the k2 values.

Figure 6.2. The alignment of nitropHeno1 groups in the aglycone subsite. A represents a possible transition state orientation with ONPG while B represents a possible transition state orientation with PNPG.

Cornpetitive inhibition constants (Ki values) pmvided more information

about G794A-i3-galactosidase. These were obtained using equation [SI. The Ki

values obtained are summarized in Table 5.4. Low Ki values indicate that the

enzyme binds the inhibitor tightly while high ones indicate that inhibitor

binding is poor. In some cases, only one inhibitor concentration was used but

for cases where more accurate values were wanted CD-glucose, Larabinose

and D-xylose), the effects of several concentrations of the inhibitor /accepter

were studied. Plots of apparent K,/apparent kCat as a fùnction of the

concentration of the inhibitor/acceptor were constructed and Ki was obtained

fimm the slope. The substrate analog inhibitors with hydrophobic aglycones

(IPTG and PETG) inhibited G794A-13-galactosidase less well than they

inhibited the wild type enzyme (Table 5.4). These inhibitor &ects are expected

since the R, values of ONPG and PNPG (with hydrophobic aglycones) were

also higher for G794A-I3-galactosidase than for the wild type enzyme. These

£indings indicate that the abiiity of the glucose subsite of the tiee enzyme to

bind hydrophobic moieties has b e n decreased because of the substitution of

Gly-794 by Ala. On the other hand, lactose, the natural substrate, inhibited

G794A-&galactosidase a little better than the wild type enzyme. D-Galactose

inhibited G794A-13-galactosidase about the same as the wild type enzyme. L-

Arabinose resembles galactose (except that it does not have a hydroxymethyl

group) and this inhibitor also inhibited the G794A-B-galactosidase to about the

same extent as the wild type enzyme. D-Glucose, on the other hand, inhibited

the substituted enzyme much better than it inhibited the wild Qpe enzyme. D-

Lyxose, D-mannose and D-xylose also inhibited the substituted enzyme better

than they inhibited the wild type enzyme but to varyhg degrees. These sugars

al1 resemble D-glucose. The glucose subsite of wild type 8-galactosidase is

hydrophobic (Huber et al., 1984). The aglycones of ONPG and PNPG are

hydrophobic and as a result they bind well to the wild type enzyme.

Substitution of Gly-794 with Ala probably causes the Ioop fkom 793 to 804 ta

be held close to the active site. The data indicate that this causes the aglywne

binding site to become less hydrophobic and much more specifïc for glucosc

binding. For the wild type en- this only happens after the Ml-4) glycosidil

hkage between galactose and the glucose is broken. A chmged conformatioi

is thought to muse the glucose to bind tightly (Deschavannne et al., 1978)

G794A-B-Galactosidase appears to be able to bypass these steps and thr

glucose appears ta bind tightly in the fiee enzyme form. This then suggest!

that the conformational change in the wild type enzyme includes thr

movement of the loop and this enables the glucose to bind well and thr

hydrophobic aglycones or acceptors (e.g. methanol) to bind poorly. With tht

substituted enzyme, the loop is artificially held dose to the active site and thii

has a similar effect as the change that occurs when the glycosidic bond ir

broken with the wild type enzyme. It is known that the nitrophen01 products O:

ONPG and PNPG of wild type B-galactosidase leave very rapidly once the

glycosidic bond is cleaved. The reason for this may be the conformatior

changes that occur when the loop between 793 and 804 folds towards th6

active site. The poor binding of hydrophobic groups that results may caust

rapid dease of the nitrophenols.

The planar transition state analog inhibitors (L-ribose, D-

galactonolactone and D-galactal) CLee, 1969; Lehmann and Schroter, 1972,

Wentworth and WoLfenden, 1974; Huber and Brockbank, 1987) inhibited the

substituted enzyme quite a lot better than the d d type enzyme. On the othei

hand, 2-Rmino-D-galactose (a positively charged transition state a n a l o g

inhibitor) inhibited the G794A-egalactosidase about the same as the wild type

enzyme. This shows that the effect of substitution for GIy-794 on the binding

of the transition state analogs is due to their planar structure not their charge.

One expects that better binding of transition state analogs should reflect

better binding of the real transition states. The transition state, however,

seems to be destabilized in the case of ONPG and for i~ (which should have a

sïmiiar transition state). I t is possible that the better bindhg of the transition

state as shown by the transition state analog inhibition is only a partial

representation of the r d transition s b t e binding since transition skite analog

inhibitors are o d y estimntes of what the transition state must look Iike. In the

case of PNPG there was transition state stabilization but not for ONPG or k3.

Acceptor studies were done using D-glucose as the acceptor and both

ONPG and PNPG as the substrates to determine how the substitution affecteci

the Kr and the kq values for D-glucose. Plots of apparent bat vs. (apparent

~t-k, ,t)~GlucoseI were constiucted and the dopes and intercepts of these

graphs were found and are summarized in Table 5.5. The equation for the

reaction of G794A-13-galactosidase in the presence of an acceptor is shown

below (equation Cl]). The intercepts of the graphs are equal to (k2k4)/(k2+k4)

(apparentkcat - k a t ) k, + k, apparentkcat =

[Al {, + k4}--{k:r4}

and were found to be 22 s-1 for ONPG and 15 s-1 for PNPG. Since they are

much d e r than the estimates of the k2 values for ONPG and PNPG (670 s-

1 and 120 s-1, respectively) they are estimates of k.4 for D-glucose. Thus, k4 is

very much decreased compared to wild type enzyme (b for the wild type

enzyme with D-glucose is 380 cl, Huber et al., 1984). The dopes of these plots

are equal to (kZ-tk3)Kjlv/(k2+k4). men ONPG was used as the substrate, the

slope was 5.2 mM while when PNPG was the substrate, the slope was 1.7 mM.

When the &" values were calculated, Ki" was found ta be about 1.5 mM using

ONPG and about 1.1 mM using PNPG (Table 6.2). The Ki" value should be

wmmon for both substrates (ONPG and PNPG) with D-glucose- Both of these

values are low compared ta wild Spe (Ri1' for wild type is about 17 mM). Thus,

not only is the glucose subsite of the fiee form of the enzyme better able to

bind glucose (as indicated by the Ki" values), the glucose subsite of the

galactosyl form of the enzyme can also bind glucose better (as bdicated by the

Ki" values). The Ki'' value for D-xylose was d e t e h e d from a similai. study

and was found to be 1 mM. This is also much lower than the Ki" for the wild

type enzyme (140 mM, Huber et al., 1984). This suggests that D-xylose

(which resembles D-glucose) binds to the substituted enzyme much better

than to the wild type enzyme. The positioning of the loop close to the active

site was shown t o help binding of D-glucose to the fiee enzyme. The

conformation change that normally occurs upon breakage of the glycosidic

bond must move the loop even closer (Figure 6.3) and exaggerate the normally

good glucose binding (I(i") that occus aRer glycolytic cleavage.

Table 6.2. The k4 (rate constant for the reaction of the acceptor with the gdadsyl form of the enzyme) and the Ki" (the dissociation constant for the sugar h m the galactosyl form of the enzyme) for G794A-6-galactosidase with D-glucose and D-rtylose as the acceptors as estimated by studies with ONPG and PNPG.

G794 (ONPG)

1 G794A (PNPG) 1 D-wlose 1 60 1 = 1.0

G794 (PNPG)

D-gluco se

D-glucose

22 1.1-1.5

15 1.1-1.5

bonds to glucose

GALACTOSE Ala-794 SUBSITE (~ocks loop in place) SUBSITE

Figure 6.3. Diagram of the loop held dose to the active site in the G794A-& galactosidase. Glucose binds weU to the glucose subsite but hydrophobie nitrophenol groups (oNP and pNP) are readily released because the hydmphobicity is decreased. When substrates bind, the loop moves even doser (shown by arrow) to the glucose subsite.

Gas chromatographie andysis revealed that G794A-i3-galactusidase

produced much more glucose and galactose than allolactose when lactose is the

substrate. Huber et al. (1976) showed that the ratio of

aUolactosd(glucose+galactose) is equai to the ratio of k4 : rate of release of

glucose. For G794.A-J3-galactosidase both the k4 and the release of glucose

(shown by the low Ki" values) are slow reactions but kq must be signifiicantiy

slower than the rate of release of glucose in order to make the allolactose :

(glucose+gala&se) ratio small. The reduced rate of transgalactosylation

(allolactose production) may be due to the strong affinity of the D-glucose to

the glucose subsite. D-Glucose may bind to G794A-B-galactosdase tightly and

also in a position that is not ideal for hydrolysis. The rate of degalactosylation

(k3) is also low for G794A-&galactosidase and this may also be due to the poor

positioning of water for reaction

The findirtgs of this study for G794A-B-galachsidase can be surnmarized

as foilows. In wild m e i3-galactosidase when no subssate is present, the loop

that extends h m residues 793 to 804 (Figure 1.5) is thought to be held away

h m the active site (open conformation). When a substrate binds to the active

site, or at hast when the glycosidic bond is broken the loop is thought to swing

toward the active site (closed conformation). Studies done by Juers and

Matthews suggest that a substitution of Ala for GIy-794 should result in the

closed conformation. The studies th& 1 have done and presented in this thesis

indicate that the substitution of Gly-794 by an Ala may indeed result in an

enzyme with the loop held in the closed conformatiun (Figure 6.3). This closed

conformation probably resembles the conformation change that aormally

occurs for the wild type enzyme after the glycosidic bond of the galactoside

substrak is cleaved (Figure 6.3). My studies have also s h m that when the

loop was in the closed conformation, the hydrophobic binding at the glucose

subite was greatly decreased This may be why the normal enzyme is able to

bind hydrophobic substrates well in the free form but release them very rapidly

when the glycosidic bond is broken (Figure 6.3). The ability of the substituted

enzyme (in the fkee form) to bind glucose was increased by a large amount

compared to the wild type enzyme (in the free form). The galactosyl form of the

substituted enzyme, however, binds glucose even more tightly than the fkee

form of the substituted enzyme. This strong binding of glucose may be due to

the loop moving even doser to the active site after glycolytic bond cleavage

(Figure 6.3). The strong binding of glucose to the galactosyl form of the

substituted enzyme may, howwer, result in poor positioning of the glucose and

thus a low value and a low allolactose production rate results. It is also

probable that the substituted enzyme positions water poorly so that it also

camot react well and thus also cause a low k3 value. The substituted enzyme

seems to bind the transition state for PNPG better than does the wild type

enzyme. This resulted in larger k2 values for PNPG. The abiliw of the enzyme

ta stabilize the transition state may depend upon the orientation of the

aglycone at the glucose subsite.

6.2 W999F-S-GALACTOSIDASE and W999G&GALACTOSII)ASE

Mutant E.coli with B-galactosidases containing site directed

substitutions at position 999 were provided as a gift fiom Dr. C. Cupples

(Concordia University, Montreal). W999F- and W999G-13-Galactosidase

precipitated at the same ammonium d a t e concentrations and eluted h m

the DEAE and FPLC columns in similar volumes compared to the wild type

enzyme. This indicates that the gross physical properties associated with

purification were not seriously affected by the substitutions.

The pH proEles of the normaiized k&Km d u e s were very similar for

W999F-B-galactosidase and the wild type enzyme with ONPG. Since LJEC,

is equal to k&, it is independent of and lacks the influence of k3. The

similarity between the two cuves indicab that k2 and K, are not &anging in a

different way h m how wild type B-gaiadsidase changes over that pH range.

The pH vs. Km (ONPG) and pH vs. bat (ONPG) m e s for W999F-13-

galactsidase were only a little different h m those for the wild type enzyme.

Any clifferences between the pH vs. & and pH vs. kt profiles for wild Qpe

and W999F-I3-galactosidase with ONPG are due to changes in the k3 value.

Only the pH vs. kcat curves for W999F-13-galactosidase were significantly

different for those h m the wild type enzyme and these differences were not of

the same magnitude as those found for G794A-B-galactosidase. This indicates

that there may be diEerences in pRa values that control k3 for this enzyme

aIso but they are not as different as they were for G794A-i3-galactosidase.

The kt values for W999F- Rgaiactosidase with ONPG and PNPG were

54 s-1 and 67 s-1, respectively. The kat values for W999G-0-galactosidase

with ONPG and PNPG were 48 s-1 and 52 s-1, respectively. Both substitubd

enzymes had lower kCat values than the wild type enzyme with these

substrates ( M O s-1 for ONPG and 90 s-1 for PNPG). This indicates that either

the k2 and/or the ka values of the substituted enzymes decreased, The bat values for the W999F-0-galactosidase with ONPG and PNPG are somewhat

similar, but not the same, suggesting that ka is at least partially rate limiting

for this substituted enzyme. For W999G-B-galactosidase the values are

essentially the same. It is probable that ka is rate limiting for this enzyme.

The effects of various alcohols on the activity of W999F-0-galactosidase

were investigated (Table 5.2). AU of the alcohol acceptors studied dramatically

increased the activity with both ONPG and PNPG as the substrates (Table

5.2). Such large inmeases in the rates of catalysis would be expected only if k3

was essentially rate determining (in the absence of acceptor) and if k4 is much

greater than kg (Figure 1.4). Thus, it seems that k3 is probably the rate

determining step for W999F-B-galactosidase (in the absence of acceptor). The

fact that these alcohols increased the reaction rate regardless of the substrate

again indicates that k3 is much smaller than k2 for W999F-13-galactosidase

with ONPG and PNPG. Flots of apparent bat vs. (apparent bat - Lt) / [1,4-

butanediol] (Figure 5.21a and b) were coastructed. The slopes and intercepts

of the apparent kt vs. (apparent keat - &t> / [1,4-butanediol] that were found

with both ONPG and PNPG are shown on Table 5.3. The intercepts are equal

to (k2k&k2+k4)}. Since 1,4-butanediol enhanced the rate of the reaction, the

values of k2 and lq must be quite a lot greater than the ka value (Figure 1.5).

However, since the intercepta and dopes of these plots are very 'Fimilar, the k2

Table 6.3. The kinetic constants for galactosylation and degalactosylation (k2 and k3 respectively) for W999F-&galactosidase and for the wild type enzyme. The (rate constant for the reaction of the acceptor with the galactosyl form of the enzyme) and IQ" values ( dissociation constant for the acceptor h m the galactosyl form of the enzyme) for 1,4-butanediol are also shown. The dissociation constants (Rs) for the substrates (ONPG and PNPG) for W999F- Bgalactasidase and for wild type.

and the kq values m o t be accurately determined. The values of the

intercepts with 1,4butanediol listed in Table 5.3 indicate that the k2 values for

W999F-B-galactosidase in the presence of 1,4-butanediol is greater than or

equal to 520 s-1 with ONPG and greater than or equal to 470 s-1 with PNPG as

the substrate. These values are lower limit estimates of the k2 values since

both k2 and k4 are greater than or equal to these values. The k2 value for the

wild type enzyme is 1500 s-1 with ONPG and 90 s-1 with PNPG as the

Enzyme

, (Substratel

W999F

(ONPG)

W999F

(PNPG)

d d type

(ONPG)

wild type

(PNPG)

k2 (s-1)

> 520

> 470

1500

90

ka (s-1)

= 60

= 60

1 O00

1 000

k4 (s-l)

(1,4butanedioI)

> 520

> 520

8 400

8 400

K" (mM) ( 1,4-butanediol)

> 850

> 850

410

410

& (m

> 2.

> 3.

0.3

O .O<

substrate. Thus, the value of k2 has inmeased simrificantly for the substituted

eazgme with PNPG. The data do not indicate whether or not kg for ONPG is

increased or decreased. The value of Ir3 must be about 60 s-1 since the k2

values for both ONPG and PNPG are so much higher than the k t values and

60 s-1 is about the average of 54 s-1 and 67 s-1 for ONPG and PNPG

respectively. The for the wild type enzyme is 1000 s-1. The factors which

increased the k2 value with PNPG (and rnaybe for ONPG) for W999F-R

galactosidase seem to have the opposite effects on the k3 values for this

enzyme. The calculated constants are strmmarized in Table 6.3 dong with

literature values for wild type B-galactosidase.

The slopes of these plots (Table 5.3) are equai to Ki1'(k2+k3)/(k2+k4).

The Ki" for the 1,4butanediol which should be the same for both substrates,

can be calculated h m the slopes of the plots for both ONPG and PNPG. Since

k3 is much smder than k2 and kq, one can cdculate a lower limit estimate of

Ki" (Table 6.3). The lower limit estimate is 850 mM, the larger of the two

values obtained. The Ki" value (1,4butanediol) for the wild type enzyme is 410

mM (Huber et al., 1984). Therefore, Ki" is higher for W999F-I3-galactosidase

wmpared to the wild type enzyme (Table 6.3). Since 1,4-butanediol is neither

higfily polar nor highly hydrophobie, the lower limit of its Ki" value for W999F-

13-galactosidase yields little information about the hydrophobicity of the bindùlg

site.

The Km value for the action of wild type l3-galactosidase in the absence

of an acceptor is &&/(k2+k3)]. Degalactosylation (k3), is rate determining. If

that is the case, Km for these enzymes becomes &lk&d he. ka < k2). Since

the approximate d u e of k3 is known and a lower limit estimate for the k2

values are known and since the & values were determinecl, approrn'mate lower

limits of H, can be obtained. The calculations show that the R, for ONPG is >

2.5 mM and the & for PNPG is >3.3 mM. The R, values for wild type with

ONPG and PNPG are 0.3 mM and 0.04 mM, respectively. Thus, the

substitution has greatly decreased the capacity of the enzyme ta bind these

synthetic substrates. The R, values are summarized in Table 6.3. This

suggests that the substrate binds to the substituted enzyme much more

poorly than to the wild type enzyme. The substitution of Trp-999 wi th Phe

causes decreases of the hydrophobicity of the glucose subsite and as a result

the substituted enzyme m o t bind ONPG and PNPG nearly as well as does

wild type. The Km values for W999G-13-galactosidase were also very large

indicating th& bindinp of hydrophobic synthetic substmtes is much decreased

in that enzyme also.

A ratio of bt/R, gives kz/& for all the enzymes regardless of which

step (k2 or k3) is rate Iimiting. The koJRm ratio indicates the catalytic

efficiency of the enzyme. The catalytic efficiencies of W999F-13-galachsidase

was found to be 24 fold lower with ONPG and 14 fold lower with PNPG as the

substrate compared to the wild type enzyme with these substrates (Table 5.1).

Any differences in the kCat/K, values from those values for wild type 8-

galactosidase with ONPG or PNPG as the substrates are due to changes in

either k2 or K, for the substituted enzyme. The 1,4-butanediol studies

discussed above suggested that k2 is greatly increased for W999F-B-

galactosidase with PNPG. The fact that the kat/K, values decrease for

PNPG is due to the drnmatic increase in the R, value for the substituted

enzyme with PNPG. Therefore, even though the catalysis rate is increased in

the substituted enzyme, the large increase in the R, causes the transition

state to be less stable than it is for wild type enzyme.

Cornpetitive inhibition collstants (Ki values) for the interaction of the

inhibitors with 6.ee W999F- and W999G-6-galachsidase were obtained using

equation [2]. These values are summârized in Table 5.4. In some cases only

one inhibitor concentration was used but for cases where very accurate values

were wanted (D-glucose, Lambinase, and D-xylose), several concentrations of

the inhibitor Iacceptor were studied. Plots of apparent Wappa ren t Lt as a

fiuiction of the concentration of the inhibitor/acceptor were construcfed and

the Ki values were calculated from these plots. The substrate analog

inhibitors with hydmphobic aglymnes W ï G and PETG) inbibited W999F- and

W999GB-galactosidase enzyme much less weU thnn they inhibited the wild

type enzyme (Table 5.4). The effect was pater when Gly was substituted

than when Phe was substituted. IPTG inhibited W999F- and W999G-8-

galactosidase 71 and 545 fold worse, respectively, than the wild type enzyme.

PETG inhibited W999F- and W999G-13-galactosidase 333 fold and 3111 fold

worse, respectively, than the wild type enzyme. This is in strong agreement

with the data of the R, values of ONPG and PNPG for W999F-0-galactosidase.

The binding of those was also much decreased. These fïndings indicate that the

ability of the glucose subsite of the fhe enzyme to bind hydmphobic moieties is

greatly decreased as a result of the substitutions made. Lactose, the natural

substrate, also inhibited W999F- and W999G-0-galactosidase more poorly

(over 100 fold) than wild type B-galadosidase but in this case the difference

betmeen W999F- and W999G-8-galachsidase was not as large. D-Galactose

only inhibited W999F- and W999G-l)-galactosidases about 10 fold more poorly

than the wild type enzyme. LArabinose resernbles galactose (except that it

does not have a hydroxymethyl group) and this inhibitor also inhibited the

W999F- and W999G-B-galactosidase over 3 fold worse than it inhibited the wild

157

type enzyme. Since Trp-999 is part of the aglycone site (Figure 1.4) it wodd

not be expected ta afF& binding to the galactose site. The findings h m the &

studies with galactose, which M d only bind ta the galactose subsite, indicate

that substitution for Trp-999 Sects more than the giucose subsite. The rnost

important finding relaüng to these enzymes with substitutions for Trp-999 is,

however, that D-glucose inhibited the substituted enzymes much worse than

the wild type enzyme. D-Lyxose, D-mannose and D-xylose also inhibited the

substituted enzymes more poorly than the wild type enzyme. These sugars all

resemble D-glucose. The effects of substitutions for Trp-999 on their inhibitory

effects were not, however, as dramatic as the effect on glucose binding. When

-999 is substituted with Phe or Gly, the hydrophobic stackïng interactions

that Trp makes seem to be absent, resulting in less hydrophobic binding and

less binding of D-glucose. -999 must be an important residue for binding

glucose as well as for binding hydrophobic moieties.

The planar transition state d o g inhibitor Lribose inhibited W999F-

and W999Gi3-galactosidase worse than the wild type enzyme. On the other

hand, D-galactonolactone and D-galactal inhibited W999F-B-gaiactosidase and

W999G-B-galactosidase about the same as the wild type enzyme. L-Ribose, D-

galactonolactone and D-galactal are planar transition state analog inhibitors

(Lee, 1969; Lehmann and Schroter, 1972, Wentworth and Wolfenden, 1974;

Huber and Brockbank, 1987). 2-Amino-D-galactose (positively charged

transition state d o g inhibitor) inhibited the W999F-B-galactosidase about

the same as the wild type enzyme but W999GB-galactosidase was inhibited

more poorly. The= is, therefore, some evidence of loss of the ability to bind the

transition state but it is not strong. Therefore, one would think that there

would not be any &ect on k2. It is interesting that kz is increased by such a

large amount by this substitution, with PNPG as the substrate.

An acceptor study was done using glucose as the acceptor and both

ONPG and PNPG as the substrates to determine how the substitution a f f i

Ki" (for D-glucose) and k4. Plots of apparent bat vs. (apparent bat- ~3/CGlucose] were constructeci and the dopes and intercepts of these p p h s

were found and are sumrnarized in Table 5.6. The intercepts of the graphs are

equal to (k2g4)/(k2+k) and were found to be 570 s-1 for ONPG and 420 s-1 for

PNPG. Tbis indicates that k2 and are greater than 570 s-1 for ONPG and

greater than 420 s-1 for PNPG. The Ki" value can be found by substituthg

these values into the following equation K;"(k2+k3)/(k2+k4) =

K~(570+60)/(570+570)= >960 mM. The Ki" value for D- glucose calculated

from this is greater than 1740 mM. The Ki" (D-glucose) for the wild type

enzyme is 17 mM (Huber et al., 1984). Thus, the substituted enzyme also

binds glucose much more poorly than the wild type enzyme when both

e-es are in the galactosyl form. The k4 value for the wild type enzyme is

380 s-1 (Huber et al., 1984). The highest intercept shows that for G7M-i3-

galactosidase is > 570 s-1. This indicates that the rate of reaction of the

glucose reaction with the galactosyl form of the enzyme is faster for the

substituted enzyme than the wild type enzyme. Tbis study indiates that even

tbough glucose binds more poorly to the galactosyl form of the substituted

enzyme cumpared to the wild type enzyme, the rate of transgalactosylation

04) is much fàster for the substituted enzyme than for the wild m e enzyme.

The calculated values are s u m . z e d in Table 6.4.

Gas chromatographie analysis showed that W999F-B-galactosidase

produced much more glucose and galactose than allolactose wi th lactose as the

substrate. Even though the rate for transgalactosylis (k4) is high for W999F

&galactosidase, low amounts of dolactose are produced by this substitutec

enzyme because the dissociation constant for glucose h m the galactosyl fom

Table 6.4. The k4 (rate constant for the reaction of the acceptor with the galactosyl form of the enzyme) and the I(i" (the dissociation constant for the sugar h m the galactosyl form of the enzyme) for W999F-B-galactosidase witk D-glucose and D-xylose as the acceptors.

of the enzyme (Ki') is very high (> 1750 mM). Thus, the E-GaloGlu complex ii

so unstable that even though k4 is high, only small amounts of dolactose an

found.

An acceptor study using D-xylose as the acceptor and PNPG as thc

substrate was also ca.?.rried out. The intercept was found t o be 280 s-1. This

compares to a value of 320 s-1 for wild type Buber et ai., 1984). The dope oi

this graph is equal to Ki"(k2+k3)/&2+k4). Since kq is greater than ka, Ki'' id

bigger than the slope. The slope of the plot was found to be 1100 mM

Calculatim shows Ki'' is greater than 1600 mM. The &" d u e for D-xylose foi

the wild type enzyme is 140 mM (Huber et al., 1984). This indicates that D-

xylose (related to glucose) binds poorly ta the substituted enzyme compared tc

the wild type enzyme.

In surnmary, Trp999 is Iocated in the glucose subsite (Figure 1.5) and is

believed to be important in substrate binding (personal communication with

Doug J u e r s and Brian Matthews) because of its ability to stack with the

hydrophobic side of glucose. Substitution of the large hydrophobic Trp with a

smaller and less hydrophobic Phe results in a large decrease in the

hydmphobicity of the glucose subsite. An even greater effect on hydmphobic

binding occurs upon substitution with Gly. The substitutions also cause a

decrease in the ability of the substituted enzyme to form hydrophobic stacking

interactions with sugars resulting in decreased binding of glucose. The

hydrophobic interactions at the glucose site in general seem to be absent.

Substitution of Trp999 for a Phe or a Gly may also alter the positiming of

transition state and if p d e positioning is bighly important for hydrolysis one

could expect that the l~ value would be decreased (Martinez-Bilbao et al.,

1991). The substituted enzyme appears ta stabilize some transition states

better than does the wild type m e . This may be the reason that the k2 for

PNPG is large. The loss of the stabilizing ability of Trp-999 for D-glucose

actuauy increases the rate of allolactase production but since D-glucose is

bound so poorly, the proportion of allolactose to galactose and glucose is sti l l

low.

6.3 AGLYCONE SlTE OF &GALACïOSIDASE

The hdings from both studies suggest that in the fkee form of the

enzyme the hydmphobicity of the glucose subsite is very important for binding

glucose and substrates wi th hydrophobic aglycone rnoieties. It is also,

important for binding glucose to the galactosyl forni of the enzyme. The

binding of D-glucose is fhcilitated by Trp999 and by changes that occur when

the loop between 793 and 804 is in the closed position. The aglycone site is

much less hydrophobic in the galactosyl form of the enzyme but the specificiQ

for glucose is higher in this form. The decrease in the hydrophobicity of the

agiycone site in the galactosyl form of the enzyme probably causes

hydrophobic aglycone products (oNP and pNP) to leave readily but keeps

glucose bound to this site longer so that allolactose can be produced. T h e

positioning of glucose in this site by Trp-999 and the closed loop appears to be

highly important. If it is not in the correct position to react, very little

alloladoçe wiil be produced even though glucose is bound well. The fact that

the k2 for PNPG was higher than k2 for ONPG for both G794A-hgalactosidase

suggests that the orientation of the aglycone binding ta the aglycone site is

important for transition state stabilization.

Ahmed, J. (1996) Nucleophile effects on B-galactosidases. University of Cal-, Master of Science thesis.

Bader, D. E., Ring, M., and Huber, R. E. (1988) Site directed mutagenic replacement of Glu-461 with Gln in &galactosidase (Escherichiu coli): evidence that Glu-461 is important for activity. Biochen. Biophys. Res. Commun. 153,301-306.

Barrett, H., Butler, R., and Wilson 1. B. (1969) Evidence for a phosphoryl- enzyme intermediate in alkaline phosphatase catalyzed reactions. Biochemistry 8 1042.

Bio 10 1, Inc. (1988) Technical Bulletin: The geneciean kit instruction manual.

Biochemistry 541 Iaboratory manual (1995). University of Calgary, Department of Biological Sciences.

Blake, C. C. F., Roenig, D. F., Mair, G. A, North A T. C., Phillips, D. C., and Sarma, V. S. (1965) Structure of hen egg white lysozyme. A three- dimensional Fourier synthesis at 2 A resolution. Nattlre 206,757-761.

Boel, E., Brady, L., Bnozowski, A. hiZ, Derewenda, Z,, Dodson, G. G., Jensen, V. J., Peterson, S. B., Swifb, H., Thim, L., and Woldike, H- F. (1990) Calcium binding in a-amylases: An x-ray difhction study at 2.1-A resolution of two enzymes h m Aspergillus. Blochemistry 29,6244 6249.

Burchardt, G., and Bah1 H. (1991) Cioning and Analysis of the 8-galactusidase- encoding gene h m C M u m themulfimgenes EMT. Gene 106,13- 19.

Buvinger, W. E., and Riley, M. (19853 Nucleotide sequence of KZebsiella ptleumluae lac genes. J. Bacferiol. 163,850-857.

Case, G. C., Sinnott, M. L., and Tenu, J. P. (1973) The d e of magnesiun ions in &galactasidasecatalyzed hydrolysis: studies on charge and shape of the B-galactopyranosyl binding site. Biochem J. 133,99-104.

Compagno C., Tura A, R d B. M., and Martegani E. (1993) Bioconversion of lactosdwhey t~ fructose diphosphate with recombinant Sacchmmyœs cemuisiae cells. Biotech B k n g 42,398400.

Costa, G. L., McGowau, B., Angert, M., McMullan, D., Bauer, J. C., and Weiner, M. P. (1995) ExSitefn PCR-based mutagenesis kit for site directed mutagenesis of double stranded DNA St-s in Mokc. B a . 8,ô-8.

Coughlan, M. P., and Hazelwood, G. (1993) Beta-1,4D-vlan degrading enzyme systems: Biochemistry, mole& biology and applications. Biotechml. Appl 17,259-289.

Cupples, C. G., and Miller, J. H. (1988) Effects of amho acid substitutions at the active site in Esclmichia coli Bgalactosidase. Genetics 129,637- 644.

Cupples, C. G., Miller, J. H., and Huber, R E. (1990) Determination of the d e s of Glu-461 in 13- galactosidase (Escherichia d i ) using site spedic mutagenesis. J. Bid. Chem. 265,5512-5518.

Dalbadie-McFarland, G., Cohen, L, W., Riggs, A D., Morin, D., Itakura, K., and Richards, J. H. (1982) Oligonucleotide-directed mutagenesis as a general and powerfûl method for .studies of pmtein function h. Nd. Amd, Sci. USA 79 6409.

David, S., Stevens, H., van Riel, M., Simons, G., and de Vos, W.M. (1992) Lemnostoc lordis l3-galactosidase is encoded by two overlapping genes- J. Ba~teriol. 174,4475-4481.

Deschavanne, P. J., Viratelle, O. M., and Yon, J. M. (1978) Conformational adaptabiZiQ of the active site of 6-galactosidase. J. Biol. Chem. 253, 883-837.

Edwards, R, A, Cupples, C. G., and Huber, R. E. (1990) Site specific mutants of bgalactosidase show that Tyr-503 is unimportant in Mg2+ binding but that Glu-461 is very important and may be a ligand to Mg2+. Biochem. Biophys. Res. Commun. 171,33-37.

Epand, R M., and Wilson L B. (1963) Evidence for the formation of hippuryl chyrnotrypsin during the hydrolysis of hippuric acid esters. J. of Bwl. Chem. 238 1718-1723.

Fanning, S., Leahy, M., and Sheehan, D. (1994) Nucleotide and deduced amino acid sequences of Rhizobium rneliloti 102F34 lac Z gene: cornparison with prokaryotic B-galactosidase and human f3-glumnidase. Gene 142, 91-96.

Fersht, AR. (1974) Catalysis, binding and enzyme-substrate complementariQ. Proc. R. Soc. Lod. B. 187,397-407.

Fersht, A. R, Shi, J. P., Wilkinson, A J., Slow, D. M., C e , P., Waye, M. M. Y., and Winter, G. P. (1984) Analysis of enzyme b c t u r e and activity by protein engineering. man& Chernie CE@& ed.) 23,467-473.

Fowler, A. V., and Zabin, 1. (1978) Amino acid sequence of B-gdactosidase: XI. peptide ordering procedures and the amplete sequence. J. Biol. C h m 253, 5521-5525.

Gebler, J. C., Aebersold, R., and Withers S. G, (1992) Gh-537, not Glu -461 is the nudeophile in the active site of (lac Z) f3-gaiactosidase h m Escherichia coli. J. Biol. C k m . 267, 11126-11130.

Gekas, V., and Lopez-Leiva M. (1985) Hydrolysis of Lactose : A Literature Review. Pmess Biochemistry 2,2-12.

Hancock, K. R., Rockman, E., Young, C. A, Pearce, L., Maddox, 1. S., and Scott, D. B. (1991) Expression and nudeotide sequence of the CIUstr+diun acetobuiylicun &galactosidase gene cloned in E.coZi. Eur. J. Biochem. 138, 527-531.

Hex~echen, M., and Legler, G. (1984) Identification of an essential carboxylate group at the ative site of lac Z i3-galactosidase f i ~ m E s c h r i c k coli . Eur. J. Biochern. 138,527-531.

Henrissat B. (1991) A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem J. 280,309-316.

Henrissat, B., and Bairoch, A. (1993) New families in the classification of glycosyl hydmlases based on amino acid sequence similanties. Bkhem. J. 293, 781-788.

Huber, R. E., and Brockbank, R. L. (1987) Strong inhibitory effect of furanoses and sugar lactones on l3-galactosidase ofEsch,erichia d i . Biochem. 26, 1526-1531.

Huber, R. E., and Chivers, P. T. (1993) i3-Galactosidases of E.coli with substitutions for Glu461 c a n be activated by nudeophiles and can form i3-D-galactosyl adducts. Carhhydr. fis. 250,9- 18.

Huber, R E., and Gaunt, M. T. (1982) The inhibition of fi-galactosidase CEscherichia coli) by sim;no sugars and dcohols, Can. J. Biochem. 60, 608-612.

Huber, R. E., and Gaunt, M. T. (1983) Importance of hydroxyk at position 3,4, and 6 for binding to the "galactose * site of B-&&sidase (Eschrichia c d ) . h h . Biochem. Biophys. 220,263-271.

Huber, R E., Gaunt, M. T., and Hurhmt, K. L. (1984) Binding and reactivity at the YgIucose" site of gaIactosy1-B-galactosidase (Eschericfi coi?). h A Bhhem. Biophys. 234,151-160.

Huber, R. E., Gaunt, M. T., Sept, R L., and Babiak, M. J. (1983) Merences in the effect of pH on the hydrolytic and transgalactosylic reactions B- galactosidase (Eschrichia di). Cart. J. Biochem. Cell Bi&. 61,198- 206.

Huber, R. E., and Hurburt, K L. (1986) Reversion reactions of B- galactosidase ( E - c d ) . Ar&. Biochn. Biophys. 246,4 11-418.

Huber, R. E., Kun, G., and Walledels, K (1976) A ~uantitation of the factors which affect the hydrolase and transgalactosylase activities of l3- galactosidase (Escherichia d i ) on lactose. Biochemistry 15,1994 2001.

Huber, R E., Parfett, C., Woulfe-Flanagan, H., and Thompson, D. J. (1979) Interaction of divalent cations with 13-galactosidase (Eschrichia coli). Biochm. 18,4090-4095.

Huber, R. E., Wallenfels, K, and Kun, G. (1975) The action of B-galactosidase (EschenCIUa colil on dolactose. Can. J. B k h m . 53,1035-1038.

Jacob, F., and Monod J. (1961) Genetic regdatory mechanisms in the synthesis of proteins. M o k Biol. 3.3 18-356.

Jacobsen, R. ET., Zhang? X J., Dubose, R. F., and Matthews, B. W. (1994) Three dimensional structure of &galadusidase from E.coli.. Nature 369,76 1- 766.

Jobe, A, and Bourgeois, S. (1972) lac Repressor-operator interaction VI. The natural inducer of the lac operon J. Mol. Biol. 69,397-408.

Rosaric, N., and Asher, Y. J. (1985) The utirization of cheese whey and its components. Adv. in Biochern. Eng. 19,25-60.

Ralnins, A, Otto, K, Ruther, U., and Muller-Hill, B. (1983) Sequence of the Zac Z gene of E.coli. EMBO J. 2,593-597.

-tige, J. (1969) Mutations conferring qgantitative and qualitative increases in &galactosidase acüvity in Escherichia coli. Mokc. Gen. Gemtics 105,7483.

Langndge, J. (1968) Genetic evidence for the disposition of the substrate binding site of 13-gaiactosidase. Genetics 60,1260-1267.

Langridge, J., and Campbell, J. K (196û) Classification and intragenic position of mutations in the B-galactosidase gene of Escherichia coli. Molec. Gen.

Gemtics 103,339-347.

Lee, Y. C. (1969) Inhibition of B-galactosidase by D-galactal. Biochem. Biophys. Res. Commun. 35,161-167.

Lehmann, J., and Schroter E. (1972) Reactions of en01 sugar derivatives. Action of i3-D-glucosidase and B-D-galactosidase on D-glucal and D- galactal. Carbohydmte Res. 23(3), 359-68.

Martinez-Bilbao, M., Gaunt, M. T., and Huber, R E. (1995) E46i.H--13- galactosidase (Escirerichia c d ) : Altered divalent metal specifici and slow but reversible metal inactivation. Biochernistry. 34, 13437-13442.

Martinez-Bilbao, M., Holdsworth, R. E., Edwards, L. A, and Huber, R. E. (1991) A highly reactive &galadasidase (Escherichia d i ) resulting fiom a substitution of an aspartic acid for Gly-794. J. Biol. Chem. 266,4979- 4986.

Mârtinez-Bilbao, M., and Huber, R. E. (1994) Substitutions for Gly-794 show that binding interactions are important deterxninants of the mtalytic action of &galadasidase (Eschrichia d i ) . Biochem Ce21 BtoL 72,313- 319.

Martinez-Bilbao, M., and Huber, R. E. (1 996) The activation of Ggaiactosidase (E.coli) by Mg2+ at lower pH values. Biochem. Ce22 Biol. 74,295-298.

McCarter, J. D., Adam, M. J., and Withers, S. G. (1992) Binding energy and catalysis. Biochem. J. 286,721-727.

Naider, F., Bohak, Z., and Yariv, J- (1972) Reversible alkylation of a methionyl residue near the active site of B-galactosidase. Biochernistry 11,3202- 3208.

Neufeld, E. F. (1991) Lysosomal Storage Diseases. Ann. Rev. Biochem. 60, 257-280.

Pharmacia (1986a) Technical Bulletin: PhastSystem separation technique f3e no. 110, SDS-PAGE.

Pharmacia (1986b) Technical Bulletin: PhastSystem development technique file no. 200, Fast womassie staining.

Poch, O., L'Hote, H., Dallery, V., Debeaux, F., Fleer, R, and Sodoyer, R (1992) Sequence of the Rluyuemmyœs ZacÉis B-galactosidase: cornparison with prokaryotic enzymes and secondary structure analysis. Gem ll8,55- 63.

Roth, N. J., Wong, IL Y. N., and Huber, R. E. (1995) Probing the roles of conserved histidine residues in 13-galactosidase @.colil using site directed mutagenesis and transition state analog inhibition. Tech. Pmtein C h . VI, 365-371.

Rouvinen, J., -ors, T., Teeri, T., Knowles, J. K. C., and Jones, T. A. (1990) Three-dimensional structure of cellobiohydrolase II fiom TriChodenna reesei. Science 249,380-386.

Sambmk, J., Fritsch, E. F., and Maniatis, T. (1989) in Molecular Cloning a laboratory manual, 2nd ed., Cold Spring Harbor Labomtory, Cold Spring Harbor, N.Y.

Schmidt, B. F., Adams, R M., Requadt, C., Power, S., and Mahzer, S- E- (1989) Expression and nucleotide seqyence of the tactobacillzrs bulgaricus G-galactosidase gene cloned in E-coli. J. B a c t e ~ l . 171,625- 635.

Schroder, C. J., Robert, C ., Lenzen, G., McKay, L, L., and Mercenier, A. (1991) Analysis of the lac Z sequenœs h m two Stmptococcus themphilus strâins: cornparisons with the Escherichia coli and LactobaciZZus bulgaris &galadasidase sequences. J. Gen Mimbiol. 137,369-380.

Selwood, T., and Sianott, M, L. (1990) The solvent-isotope-effect study of proton transfer during catalysis by EscheTichia coli (lac Z) là- galactosidase. Bioctrem J. 268,317-323.

Shifr-in, S., and Hunn, G. (1969) Effect of alcohols on the enzymatic activiQ and subunit association of i3-galactosidase. Arch, Bimhern. B wphys., 130 530.

Sigal, L S., Harwood, B. G., and Arentzen, R. (1982) Thiol-B-lactamase: replacement of the active site serine of RI'EM &lactamase by a cysteine residue. Prix. Nutl. Acad. Sci. USA 79 7157-60.

Sinnott, M. L-, and Viratelle, 0. M, (1973) The &ect of methanol and dioxane on the rates of the &galactosidase catalyzed hydrolyses of some B-D- galactopyranosides: rate-Iimiting degalactosylation; the pH-dependence of galactosylation and degalactosylation. B i o c k m J . 133,81-87.

Sinnott, M. L., and Smith, P. J. (1978) AfIinity labeling with a deaminstively generated carbonium ion: kinetics and stoichiometry of the alkylation of methionine-500 of the of the lac Z &galactosidase of Escherichia c d by &D-galactopgranosyhethyl-pnitrophenylt. Biochern. J. 175, 525-538.

Sinnott, M. L. (1990) Catdytic mechanisms of enzymatic glycosyl trader. Chem. Rev. 90, 1171-1202.

Sinnott, M.. L., Viratelle, O. M., and Withers, S. G. (1975) pH-and Magnesiun Ion-Dependence of the hydrolyses of &D-galactapyranosyl pyridinium salts catalyzed by Escherichia coli B-galactosidase. Bimhern. Soc. fians. 3 100&1009.

Stokes, H. W., Betts, P. W., and Hall, B. G. (1985) Sequeme of the eb@ gene of EscherichiCr d i : cornparisan with the Zac Z gene. J. MoZec Euol. 2,469- 477.

Stokes, T. M., and Wdson, 1. B. (1972) A common intermediate in the hydrolysis of B-galactosides by B-galactosidase from E-coli. Biochemistry 11, 1061-1064.

Strynadka, N. C. J., and James, M. N. G. (1991) Lysozyme revisited: Crystallographic evidence for disbrtion of an N-ace~lmvamlc acid residue bound in site D. J. Mol. Biol. 220,401424

Strom, R., Gandini-Attardi, D., and Forsen, S. (1971) The activation of B- galactosidase by divalent and monovalent cations. Transient and steady statx studies. Eur. J. Bimhern. 23, 118-124.

Tenu, J. P., Viratelle, O. M., Garnier, J., and Yon, J. (1971) pH dependence of the activity of B-galactosidase h m Escherichia d i . Eur. J. Bùxhem. 20, 363-370.

Tenu, J. P., Viratelle, O. M., and Yon, J. (1972) Rinetic study of the activation process of B-galactosidase fimm E.coli by Mg2+. Eur. J. Biochem. 26, 112-118.

Viratelle, O. M., and Yon, J. M. (1973) Nucleophilic competition in some 13- galactosidase catalyzed reactions. Eur. J. Biochern. 33,110-116.

Wallenfels, K, Lehmann, J., and Malhotra, O. P. ( 1960) Untersuchungen uber milchzuckerspaltende enzyme VII. Die spez5tat der &galaktosidase von E.coli ML 309. Biochern. 2. 333,209-255.

Wallenfels, K., Zarnitz, M. L., Laule, k, Bender, A, and Keser, M. (1959) Untersuchungen uber milchzuckerspaltende enqme reinigung, kristallisation und eigenschaRen der B-galaktosidase von Escherichia mli ML 309. Biochem. 2. 331,459-485.

Wallenfels, K., and Weil, R- (1972) in The Enzymes, 3rd Ed., Vol. VII (Boyer, PB., ed), Academic Press, New York. pp. 617-663.

Wentworth, O. F., and Wolfenden, R. (1974) Slow binding of D-galactal a ureversible" inhibitor of bacterial &galactosidase. Biochemistry 13, 47 15-4'720.

Withers, S. G., and Street, 1. P. (1988) Identification of a covalent a-D- glucopyranosyl enzyme intermediate formed on a B-glucoside. J h Chem. Soc. 110,8551-8553

Winter, G., Fersht, A. R., Wilb3nson, k J., Zoller, A, and Smith, M. (1982) Redesigning enzyme structure by site directed mutagenesis: tymsyl tRNA synthetase and ATP binding. Nafun (London) 299 756-58.

Yariv, J., Wilson, K. J., Hildesheim, J., and Blumberg, S., (1971) Labellinp of the active site of i3-galactosidase by N-bromoacetyl -D- gaiactopyranosylsmie, FEBS LETTs 15,24.

Yde, M., and De Bruyne, C. K. (1978) Binding of substituted phenyl l-thio-&D- galactopyranosides ta J3-D-gahctosidase h m E.mli. Carbhydmte Research 60,155-165.

Yuan, J., Martinez-Bilbao, M., and Huber, R. E. (1994) Substitutions for Gly- 537 of B-galactosidase (Escherichia culi) causes a large loss of catalytic ability. Biochem, J. 299,527-53 1,

ZoUer, M. J., and Smith, M. (1982) Oligonucleotide-directed mutagenesis using M13-derived vectors: an e5cient and general procedure for the production of point mutations in any £ragments of DNA. Nucleic Acids Res. 10, 6487-6500.

APPLIED 4 I M G E . lnc - = 1653 East Main Street - -. , Rochester. NY 14609 USA -- == Phone: 71 61482-0300 -- -- - - Fax: 7161288-5989

O 1993. Applied Image. Inc.. Al1 Rights Resewed