OF by and Biology, in U. S.A. Valyl-tRNA Synthetase Gene of … · 2017-08-30 · THE JOURNAL 0 1988 by The American Society for Biochemistry OF BIOLOGICAL CHEMISTRY and Molecular

THE JOURNAL 0 1988 by The American Society for Biochemistry

OF BIOLOGICAL CHEMISTRY and Molecular Biology, Inc

Vol .263, , No. 2, Issue of January 15, pp. 857-867,1988 Printed in U. S.A.

Valyl-tRNA Synthetase Gene of Escherichia coli K12 MOLECULAR GENETIC CHARACTERIZATION*

(Received for publication, June 8, 1987)

J. Denis Heck$ and G. Wesley Hatfield4 From the Department of Microbiology and Molecular Genetics, California College of Medicine, University of California, Irvine, Iruine, California 9271 7

We report the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene which encodes the enzyme valyl-tRNA synthetase (EC 6.1.1.9). The valS gene was subcloned from the Clarke-Carbon plasmid pLC26-22 by genetic complementation of the valS temperature-sensitive mutant strain, AB4 141. The protein-coding region of the valS structural gene was determined by in vitro DNA directed coupled transcription-translation assays. Assays of cellular extracts of cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase-specific activity 12-fold. The DNA sequences of the 5’- and 3“terminal regions of the valS structural gene are presented. The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both CY-~’P labeled and ~-~~P-end-labeled in vitro transcription assays. In vivo, valS transcription initiates from tandem overlapping promoters separated by seven nucleotides. In vitro, only the upstream promoter is active. The presence of several regions of hyphenated dyad symmetry overlapping the tandem promoter region are noted. The valS translational start codon (AUG) is located 93 base pairs downstream from the major transcription initiation site. The valS transcriptional unit encodes only the valyl-tRNA synthetase gene since the 3‘ terminus of the amino acid-coding region of this gene is followed closely (26 base pairs) by an efficient p-independent transcription termination site.

The aminoacyl-tRNA synthetases of Escherichia coli are a group of 20 enzymes, each responsible for the correct ligation of one of the 20 amino acids to a specific isoacceptor set of cognate tRNA molecules (1). In addition to this primary role in protein synthesis, it has often been suggested that these enzymes also play important regulatory roles in the cell. For example, various aminoacyl-tRNA synthetases have been reported to be involved, at least indirectly, in the regulation of certain amino acid biosynthetic pathways (2), in the regulation of the transport of certain amino acids into the cell (3), and in the regulation of the synthesis of the bacterial alarmone guanosine tetraphosphate (4).

Considering the common catalytic function of the amino-

* This work was supported in part by Grant GM24330 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

4 Recipient of a CUPP graduate fellowship in biotechnology. To whom correspondence should be addressed.

acyl-tRNA synthetases, a surprising degree of structural di- versity is observed in this group of enzymes. For example, mature aminoacyl-tRNA synthetases exist in monomeric, di- meric, and tetrameric forms, and the subunit molecular weights of these enzymes range from 54,000 to 110,000. Di- verse patterns of regulation are also observed. While on one level the synthesis of all of the aminoacyl-tRNA synthetases has been shown to be controlled by metabolic (growth rate coupled) regulation, several types of amino acid specific regulation have been documented (5-7). Amino acid-specific regulation of an aminoacyl-tRNA synthetase is effected when growing cells encounter a growth rate limiting intracellular concentration of a cognate amino acid. Comparison of the molecular mechanisms responsible for the amino acid-specific regulation of the several aminoacyl-tRNA synthetases that have been investigated reveals that each synthetase is regulated by a fundamentally different mechanism. For example: the alanyl-tRNA synthetase gene (alas) is autoregulated by the binding of alanyl-tRNA synthetase to an operator site in the alas promotor region (5); expression of threonyl-tRNA synthetase is autoregulated at the post-transcriptional level by the binding of this enzyme to the 5’-end of thrS mRNA inhibiting the translation of the thrS gene transcript (6); the phenylalanyl-tRNA synthetase gene is regulated by translational control of transcription termination at an attenuator site preceding the pheS gene which responds to intracellular aminoacylated tRNAPhe levels (7); and, it has been proposed that the glnS gene, encoding glutaminyl-tRNA synthetase, is regulated by a trans-acting positive activator, the product of the unlinkedglnR gene (8). Thus, no common mechanism can be evoked to explain amino acid specific regulation of the E. coli aminoacyl-tRNA synthetases.

In this study we report the subcloning and characterization of DNA sequence elements necessary for the expression of the structural gene encoding another E. coli aminoacyl-tRNA synthetase, the valS gene encoding valyl-tRNA synthetase (EC 6.1.1.9). As a first step in understanding the molecular details of Valyl-tRNA synthetase regulation, analyses of both the in vivo and in vitro transcription products of valS have defined the specific DNA sequences responsible for initiation and termination of transcription.

MATERIALS AND METHODS

General-Restriction endonucleases and other enzymes were purchased from Boehringer Mannheim or New England Biolabs, Inc. Radioactive compounds were obtained from the Amersham Corp.

Bacterial Strains and Growth Conditions-The bacterial strains used were: Valyl-tRNA synthetase conditional mutant strain, AB4141 (F-, metC56, kt-1, thi-1, valS7, ara-14, lacY1, galK2, xyl-7, rpsLA9, tfr-5, supE44). The ualS7 temperature-sensitive mutation has been described previously (9). JA221 (F-, thi-1, hsdM’, hsdR; lacy, leuB6, AtrpE5, recA1, X-) (lo), was utilized for all valyl-tRNA synthetase enzyme assays. Both JM105 (thi-1, rpsL, endA1, sbcBl5, hspR4, A(lac-

857

858 valS Gene Isolation and Molecular Characterization

proAB), [F', traD36, proAB, lacPZAM15]) and JM109 (recAI, endAI, gyrA96, thi-I, hsdRl7, supE44, reL11, X-,A(lac-proAB),[F', traD36, proAB, tacIqZAM15]) were used for M13 sequencing and for cloning into the pUC vectors (11). The galactokinase mutant strain, C600K- (F-, thi-1, thrl, leuB6, lacYI, galK2, tonA21, supE44, X-), was,used in all of the in vivo ualS transcription termination assays (12). Strains were grown in minimal medium M63 (13) supplemented with 0.5% glucose, 1 mM MgS04 and 5 pg/ml thiamine. Auxotrophies of individual strains were satisfied by the addition of 50 pg/ml of the appropriate amino acid. Ampicillin selection was performed at concentrations of either 50 pg/ml for growth in minimal media or 100 pg/ml for growth in LB medium (13).

Nucleotide Sequencing Analysis-DNA sequence analysis was performed either according to the chemical cleavage method of Maxam and Gilbert (14) or the dideoxy chain termination method of Sanger et al. (15). The identity of each nucleotide of the noncoding strand was verified by the independent determination of the complete DNA sequence of each strand, with some portions of each strand repeatedly analyzed from overlapping sequential deletions (Fig. 4). The method of Henikoff (16) was employed for the generation of M13 sequential deletion derivatives utilized for DNA sequence analysis.

DNA-"13 RF DNA or cesium chloride band-purified plasmid DNA was prepared by standard methods (17).

RNA-Preparation of total cellular RNA was accomplished as previously reported (18) utilizing the E. coli K12 strain JA221 harboring plasmid pDH-lAll (Table I). The isolation of the in uitro generated transcription product initiating from the Pvals promotor was accomplished utilizing a previously described gel-slice soak method (19).

DNA Directed in Vitro Transcription-Transltions-CsC12 band- purified plasmid DNA was used as template for the Prokaryotic DNA- Directed Translation Kit purchased from the Amersham Corp. The resulting [35S]methionine-labeled translation products, coded for by plasmid constructs containing subcloned portions of plasmid pLC26- 22 inserted into either pBR322 or pUC9, were analyzed by electrophoresis in a 10% sodium dodecyl sulfate-polyacrylamide gel (20).

Assay for Enzyme Actiuity-E. coli strain JA221, either transformed or not with plasmid pDH-lAll, was grown in 500 ml of LB medium (13) to near mid log ((OD65o) = 0.6-0.7). The cells were collected by centrifugation and resuspended in a 40-ml solution of 50 mM sodium cacodylate (pH 7.0), 10 mM 2-mercaptoethanol, 10 mM MgC12, and 10% glycerol. The washed cells were collected by centrifugation and resuspended in 10 ml of the same buffer prior to disrup- tion by sonication with a Tekmar sonicator (largetip/output 7) for 8 X 15 s, with 15 s cooling on ice between each burst. The sonicated cellular debris was removed by centrihgation at 27,000 X g for 15 min at 4 "C. The cell free extracts were frozen (-20 "C) until assayed for valyl-tRNA synthetase-specific enzyme activity.

The specific activity of valyl-tRNA synthetase in the cellular extracts was determined by measuring the esterification of L-['~C] valine to E. coli tRNA at 37 "C. The 0.25-ml reaction mixtures all contained 200 mM sodium cacodylate (pH 7.0), 10 mM MgCl,, 2 mM dithiothreitol, 4 mM ATP, 0.6 mM CTP, 70 p M L-valine, 3.2 p M L- [14C]valine (280 mCi/mmol), 500 pg of E. coli tRNA and variable amounts of cellular extract, diluted in a buffer composed of 50 mM sodium cacodylate (pH 7.0), 2.0 mM dithiothreitol, 10 mM MgC12, and 10% glycerol. The reaction mixtures were incubated for 5-10 min at 37 "C, stopped by the addition of 3 ml of ice-cold 10% trichloroacetic acid, and chilled on ice for 20 min. The trichloroacetic acid precipitated tRNA was collected on glass-fiber filters, washed 3 times with 6 ml of 10% trichloroacetic acid and dried. The amount of L-[14C] valine attached to the filter-bound tRNA was measured in a Beckman LS230 scintillation counter. All assays were performed under conditions in which the reaction rates were constant and proportional to protein concentration. Protein measurements were determined by the method of Bradford (21).

In Vitro Transcriptions-The uniformly labeled [a-32P]GTP in uitro transcription reactions were carried out as previously described (22) utilizing closed circular supercoiled plasmid DNA templates. The extent of supercoiling was determined by examination of an ethidium bromide stained 1.5% agarose gel containing CsClz band-purified plasmid DNA. It was determined that greater than 75% of the plasmid DNA existed as supercoiled (Form I) DNA.

The [y-3ZP]NTP end-labeled in uitro transcription reactions were performed as follows. All four [y-32P]NTPs utilized were prepared with the Promega Biotec Gammaprep" Synthesis System. For each of the four separate gamma end-labeled transcription reactions, 15 p1 (-300 pCi) of the appropriate Gammaprep" ~-~'P-labeled NTP syn-

thesis reaction mixture was frozen on dry ice and lyophilized in a 500-pl volume plastic tube. In each of the four transcription reaction tubes, 1 pg of plasmid DNA was mixed with a 9-pl solution containing: 100 mM KC1, 6.4 units of RNasin (Promega Biotec), 45 mM Tris- HOAc (pH 7.9), 4.5 mM MgOAc, 0.1 mM dithiothreitol, 0.1 mM EDTA, 200 pM each for the three unlabeled NTPs, and 20 p~ for the specific NTP being assayed as the initiating ribonucleotide. Following gentle vortexing these mixtures were preincubated for 3 min at 37 "C. The transcription reactions were initiated by the addition of a 1-el volume containing RNA polymerase (0.64 units/pl) in 50% glycerol followed by continued incubation at 37 "C for 15 min. The transcription reactions were terminated by phenol/chloroform extraction followed by the addition of 30 pg of E. coli tRNA. Each of the transcription samples were EtOH-precipitated, washed with 70% EtOH, desiccated, and resuspended in a 15-p1 solution of 8 M urea, 0.1% sodium dodecyl sulfate, 0.25% xylene cyanol, and 0.25% bromphenol blue. The transcription products were analyzed by electrophoresis in a 6% polyacrylamide-denaturing gel containing 8 M urea buffered with 50 mM Tris- borate (pH 8.3) and 1 mM EDTA.

SI Nuclease Mapping-Both the in uiuo and in uitro transcriptional initiation sites of the ualS gene were determined by the following modification of the Berk and Sharp (22) S1 nuclease mapping pro- cedure. Total in uiuo cellular RNA and the in uitro generated transcription product initiating from the ualS promoter were isolated as previously described. A 316-bp' Sau3AI/Sau3AI restriction endonuclease fragment was end-labeled with [y-32P]ATP using T4 polynu- cleotide kinase (14) and digested with HindIII. The larger of the two resulting DNA restriction endonuclease fragments (255 bp) was hybridized to either 100 pg of total cellular RNA or to the in uitro transcription product eluted from a polyacrylamide/urea gel. The hybridization reactions were carried out in a 20-4 solution of 80% formamide, 400 mM NaCl, 40 mM PIPES (pH 6.4), and 1 mM EDTA, heated at 80 "C for 5 min, followed by incubation at 49 "C for 3 h. The resulting hybridization mixtures were diluted with a 18O-pl solution of 60 mM NaOAc (pH 6.4), 100 mM NaCl, and 2 mM ZnC12. Following the addition of 1500 units of S1 nuclease (Boehringer Mannheim), the mixtures were incubated at room temperature for 30 min and at 4 "C for another 15 min. The resulting digestion products were recovered by EtOH precipitation, washed with 70% EtOH, and desiccated. These samples were resuspended in 100 el of 0.1 N NaOH and boiled for 20 min to hydrolyze the labeled RNA. Following this alkaline hydrolysis, the reactions were neutralized with the addition of 2 pl of 2 M Tris-HC1 (pH 8.0). The S1-protected DNA fragments were EtOH precipitated in the presence of 10 pglreaction of E. coli tRNA. After desiccation, the in vivo and in uitro samples were resuspended in a 15-pl solution of 80% (v/v) formamide, 10 mM NaOH, 1 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1% (w/v) bromphenonol blue. The samples, along with a DNA sequencing ladder (14) prepared with the same end-labeled HindIII/Sau3AI DNA fragment, were heated for 2 min at 90 "C prior to analysis by gel electrophoresis in a 6% polyacrylamide, 8 M urea denaturing gel.

In Viuo and in Vitro Primer Extensions-In uiuo primer extension analyses were performed using 150 pg of total cellular RNA isolated from E. coli strain JA221 carrying the multicopy plasmid pDH-1A11. The in uitro primer extension reactions were accomplished using the ualS transcript produced from in uitro transcriptions of plasmid pDH201 (Table I). In both cases the RNA was allowed to hybridize to the 5'-32P-end-labeled 86-nucleotide long coding strand of a T q I / Sau3AI restriction fragment in the same manner as previously out- lined in the S1 nuclease-mapping methods. The hybridized RNA/ DNA duplexes were collected by EtOH precipitation. The end-labeled DNA fragments were extended by reverse transcription in a 20-p1 reaction consisting of 2 mM each dATP, dTTP, dCTP, and dGTP, 50 mM Tris-HC1 (pH 8.3), 8 mM MgCl,, 30 mM KC1, 1 mM DTT, 800 units/ml RNasin and 1000 units/ml AMV reverse transcriptase (Pharmacia LKB Biotechnology Inc.) for 60 min at 42 "C. Following EtOH precipitation, washing with 70% EtOH and desiccation, the primer extension products were resuspended in 100 gl of 0.1 N NaOH and boiled for 20 min to hydrolyze the RNA. Following this alkaline hydrolysis, 2 pl of 2 M Tris-HC1 (pH 8.0) was added to each sample prior to EtOH precipitation in the presence of 10 pg of E. coli tRNA. After desiccation, the samples were resuspended in 40 pl of a solution of 80% (v/v) formamide, 10 mM NaOH, 1 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1% (w/v) bromphenol blue and analyzed by electrophoresis in a 6% polyacrylamide, 8 M urea denaturing gel.

The abbreviations used are: bp, base pair; kb, kilobase; PIPES, 1,4-piperazinediethanesulfonic acid.

valS Gene Isolation and Molecular Characterization 859

Galactokinuse Assays and Plasmid-specific Number Determina- tions-The procedures utilized for the galactokinase assay and plasmid-specific copy number determination were performed as previously described (22).

Plasmid Construction-See plasmid construction Table I.

RESULTS

Subcloning the valS Gene of E. coli from the Clarke-Carbon PlasmidpLC26-22”The valS gene encoding valyl-tRNA synthetase, located at 97 min on the genetic linkage map of E. coli K12 (23), is contained in the plasmid pLC26-22 of the Clarke-Carbon E. coli library of hybrid plasmids (24). The presence of the valS gene in plasmid pLC26-22 had been previously verified by genetic complementation of a valyl- tRNA synthetase temperature-sensitive strain and by the fact

that minicells containing the plasmid produce a protein that comigrates with purified valyl-tRNA synthetase on two-di- mensional polyacrylamide gels (25). Starting with this knowl- edge, the plasmid pLC26-22 was physically mapped via single and multiple restriction endonuclease enzyme analysis. In order to determine the location of the valS structural gene, appropriately sized and isolated DNA restriction endonuclease fragments of the parental 23.1-kb pLC26-22 plasmid were subcloned into either plasmid pUC9 or pBR322 (see plasmid construction Table I). Transformation of a valyl-tRNA synthetase temperature-sensitive strain, AB4141, with the resulting recombinant plasmids, followed by growth on minimal media at the restrictive temperature, 40 “C, allowed selection for those plasmids containing DNA sequences capable of complementing the chromosomal ualS temperature-sensitive

TABLE I List of plasmid constructions utilized in this study

Plasmid Descriution Reference

PDH-1

PDH-lA

pDH-lA11

pDH-14

pDH-23

pDH-57

pDH-104

pDH201

pDH311

pDH361

pDH2011

pDH2061

pKG2001

pLC26-22 Plasmid from the Clarke-Carbon library of hybrid plasmids

pDD3 Plasmid consists of a unique BamHI site flanked by diverging rrnB tl terminator sequences replacing pBR322 sequences extending from EcoRI to the SalI site (base pair numbers 4361-651)

Plasmid consists of 5.4-kb ClaIIBarnHI fragment of pLC26- 22 inserted into the unique ClaI and BamHI sites of pBR322

Plasmid consists of pDH-1 digested with EcoRI, Klenow end- filled to blunt, followed by digestion with SmaI and self ligation (deletes 3.2-kb ClaIISmaI fragment)

Plasmid consists of 2.7-kb SphIISphI fragment of pLC26-22 inserted into SphI site of pDH-lA

Plasmid consists of 5.4-kb PuuII/PuuII fragment of pLC26- 22 inserted into SmaI site of pUC9

Plasmid consists of 6.8-kb BamHIIClaI fragment of pLC26-

pBR322 22 inserted into the unique ClaI and BamHI sites of

Plasmid consists of 3.5-kb SmaIIPuuII fragment of pLC26- 22 inserted into SmaI site of pUC9

Plasmid consists of 3.9-kb SmaIIXhoI fragment of pLC26- 22 inserted into SmaI and SalI sites of pUC9

Plasmid consists of 316-bp SauJAIISau3AI fragment containing ualS promoters inserted into BamHI site of pDD3

Plasmid consists of 369-bp NruIIRsaI fragment containing ualS 3’-end inserted into the SmaI site of pKK223-3

Plasmid consists of 722-bp RsaIIRsaI fragment containing ualS 3’-end inserted into the SmaI site of pKK223-3

Plasmid consists of 369-bp NruIIRsaI fragment containing ualS 3’-end inserted into the SmaI site of pKG2001

Plasmid consists of 722-bp RsaIIRsaI fragment containing ualS 3’-end inserted into the SmaI site of pKG2001

Plasmid consists of 982-bp HindIIIIMluI fragment of pKO- 11 inserted into the unique HindIII and MluI sites of pKG1800 (this places HindIII, PstI, SalI, BamHI, SmaI, and EcoRI sites between Pgal promoter and galK

24

36, and D. W. Daniels, personal communication

36, and this work

This work

This work

37, and this work

36, and this work

37, and this work

37, and this work

This work

38, and this work

38, and this work

This work

This work

39, 12, and this work

12, and this work pKODH-3 Plasmid consists of 465-bp HindIII/HindIII fragment containing ualS promoters inserted into the unique HindIII site of pKO-1

860 valS Gene Isolation. and Molecular Characterization

mutation. As seen in Fig. 1, the recombinant plasmids pDH- 1, pDH-14, pDH-57, and pDH-104 all contain differing lengths of inserted DNA encompassing a common region of the E. coli chromosomal DNA present in plasmid pLC26-22. The recombinant plasmid pDH-23, which predominantly contains a region of E. coli chromosomal DNA immediately adjacent to the region common to the other complementing plasmids, was unable to complement AB4141 at 40 "C.

These recombinant plasmids were utilized as DNA templates in an in vitro DNA-directed transcription-translation system (26). The resulting ["Slmethionine-labeled translation products, encoded by each DNA template, were analyzed on a 10% sodium dodecyl sulfate-polyacrylamide gel (20). An autoradiogram of this gel (Fig. 2), shows that the recombinant and parental plasmids encode unique proteins of the following molecular weights (MI): 57,000 (pDH-I) , 75,000 (pDH-14,- 57), 88,000 (pDH-104), and 107,000 (pLC26-22). Analysis of this autoradiogram permitted the determination of both the direction of transcription (from left to right, as shown in Fig. 1) and the relative start of translation of the ualS structural gene, since the recombinant plasmids which contain increas- ingly longer lengths of E. coli chromosomal DNA produce correspondingly larger protein products. Extrapolations based on the relative molecular masses of the truncated ualS protein products encoded by these recombinant plasmids permitted the determination of the relative start of translation. The approximate number of nucleotides required to encode the observed truncated products was determined assuming an average molecular weight of llO/amino acid. The relative start of ualS translation for each of the plasmid constructs was determined by subtracting the approximate number of required nucleotides from the inserted fragment end point restriction site. Utilizing this method the relative translational starts of the individual truncated ualS gene products were found to be clustered within an 80-bp region centered 100 bp to the right of the Hind111 site located at position -50 (Fig. 3). The validity of this method was subsequently demonstrated following DNA sequence analysis of this region which revealed this proposed translational start for ualS to be within 50 nucleotides of the DNA sequence encoding the ualS amino terminus.

The molecular weight of valyl-tRNA synthetase (Mr

C.." - COL EI PLASMID+-V~~S : "+

I I pDH-1 -

1 Kb

pDH-23 I I

pDH-14 1- * El 1 mdlll 7 &I pDH-57 C I T pst~ t -1

pDH-104 1-1 1 Sphl t pvull

1 B a H l 1 S m . 1

pDH-1A 1-1 t W l

pDH-1 A1 1 1-1

FIG. 1. Partial restriction endonuclease map of Clarke-Car- bon hybrid plasmid pLC26-22. A partial physical map of the hybrid plasmid pLC26-22 (24), which is composed of a segment of E. coli genomic DNA (thin line) inserted into the naturally occurring ColEl plasmid (thicker line), is illustrated above. Symbols for individual restriction sites are defined in the key at the right. Bold bars immediately below the map represent the extent of specific DNA segments that were subcloned into either plasmid pBR322 (yielding plasmids pDH-1, pDH-23, pDH-1A and pDH-1A11) or plasmid pUC9 (yielding plasmids pDH-14, pSH-57 and pDH-104) as described in Table I. The location and direction of transcription of ualS is depicted by the bold arrow immediately above the physical map.

r I

r n n

)c v)

I 0 P

I

d 9 I

X 0 n

c) a r I

I 0 P

r r a r n

7 I

P

107-

75 - 57-

aa-

"""

FIG. 2. Autoradiograph of a 10% polyacrylamide Laemmli gel (20) exhibiting the [3"S]methionine-labeled polypeptides synthesized in a DNA directed in vitro transcription-translation system. The plasmids listed immediately above each lane, each containing different subcloned DNA fragments of plasmid pLC26-22, were used as DNA templates for the in vitro translation reactions. The determined molecular weights (X103) of the [35S] methionine-labeled translation products resulting from the truncated and full length ualS gene sequences present in each plasmid are indicated on the right. Plasmid pDH-1A11 (and pDH-1A3, identical isolate) contains a full length copy of the ualS gene of E. coli as the largest polypeptide present (M, 107,000) comigrates with the uolS encoded translational product of parental plasmid pLC26-22.

110,000) (27) suggested that the ualS structural gene should be approximately 3.0 kb in length. Based on this size prereq- uisite and the deduced location of the start of ualS translation, it was presumed that a full length copy of the ualS gene could be obtained by isolating the 2.7-kb SphIISphI DNA restriction endonuclease fragment of pLC26-22, followed by insertion of this DNA fragment into the SphI sites of pDH-1A to yield the plasmid pDHlA11 (Table I). Examination of an autoradiogram of a polyacrylamide gel containing the [35S] methionine-labeled translation products of a coupled transcription-translation reaction showed that pDH-1A11 encodes a high molecular weight protein product ( M , 107,00O).This protein comigrated with valyl-tRNA synthetase protein encoded by the parental plasmid, pLC26-22 (Fig. 2). Further evidence that pDH-1A11 contains a full length copy of the gene encoding valyl-tRNA synthetase was obtained by transforming E. coli strain JA221 with this plasmid. Based on assays of cellular extracts for valyl-tRNA synthetase specific activity, the presence of this multicopy plasmid within the cells increased the relative valyl-tRNA synthetase enzyme- specific activity by 12.1-fold over control cells not containing the plasmid (data not shown).

hcalizing the ualS 5'-Boundary and Putative Promoter Region-Based on the in uitro DNA-directed transcription- translation analysis described above, the 465-bp HindIIIl Hind111 DNA restriction endonuclease fragment (Fig. 4), as- sumed to contain the start of translation of the uaZS gene product, was inserted into the transcription fusion vector pKO-1 (12). This vector was utilized to determine if this restriction endonuclease fragment possessed promotor activ-

valS Gene Isolation and Molecular Characterization

-35 -35 -10 -10

+20 CGTCCTGAAACAACTGGCGCGCGAACGCTATAAAGCCTACCGCGTGGCTGGTTTCAACCT~AATACGG~AACCTG

+30 +40 +so +60 +70 +eo

+90 G A A A T ~ A A A A G A C A T A T A A C C C A C A A G A T A T C ...

MetGlu LysThrTyrAsnProGln Asp Ile ... + I +10

+loo + ( l o +120

FIG. 3. The 5"flanking nucleotide sequence of the nontranscribed DNA strand of the valS gene of E. coli K12. The -35 and -10 hexamers of the two overlapping valS promoters are indicated by the brackets and larger boldface numbers centered immediately above each hexamer. Based on the results of in vivo and in vitro S1 nuclease protection and in vivo primer extension analysis, the nucleotide sequence numbers have been arbitrarily set to coincide with the upstream transcription initiation site located at the T residue designated +1 (wavy arrow). Transcription initiating from the downstream promoter begins at the G (Sl) or A (primer extension) residue designated +8 or +9 (wavy arrow), respectively. The double underlined regions indicate two 7-bp direct repeats (the starts of which are separated by 14 bp); each repeat contains a potential ribosomal-binding site. The ualS gene translational start condon (ATG), beginning at position +93, is boxed. The predicted amino acid sequence of valyl-tRNA synthetase encoded by the ualS gene is listed immediately below the determined nucleotide sequence. The sequence of the first deduced 10 amino acids of valyl-tRNA synthetase has been confirmed? The extent of four regions of hyphenated dyad symmetry overlapping the valS promoters are indicated by diverging bold arrows.

-.../ ..... 4" - -

"+ "+ "" - --+ -+ - 4" -

"" 460 bp

FIG. 4. Partial restriction endonuclease map and nucleotide sequencing strategy of the 5'- and 3'-DNA sequence flanking and encoding the valS gene of E. coli K12. The extent of the arrows below the map represents the breadth of readable sequence de_termined by the dideoxy chain termination method of Sanger (15). The open arrow above the map designates the 5' start and 3' terminus of the ualS structural gene. Recombinant Ml3mplO and 11 or M13mp18 and 19 containing discrete restriction fragments or sequential derivatives obtained by the method of Henikoff (16) were used as the template. All the DNA fragment inserts utilized in the sequencing analysis were excised from the parental Clarke-Carbon Library plasmid pLC26-22 (24).

ity. Proper orientation of this inserted DNA fragment in the galK transcription fusion vector, yielding plasmid pKODH-3 (Table I), was confirmed by restriction endonuclease analysis. The galK strain, C600K-, was transformed with the recombinant plasmid pHODH-3 and plated onto galactose-Mac- Conkey agar plates (13). The resulting colonies appeared red, whereas the C600K- control cells transformed with the starting plasmid pKO-1 produced white colonies on the same indicator plates. These results demonstrated that the 465-bp HindIII/HindIII DNA restriction endonuclease fragment contains promotor activity. The DNA sequence of both strands of this restriction fragment insert (Fig. 4) was obtained by the Sanger dideoxy chain termination method (15). Analysis of this sequence showed an open translational reading frame of greater than 375 bp extending in the deduced direction of

861

FIG. 5. Partial restriction endonuclease map depicting the "P-end-labeled DNA probes used for S1 nuclease protection studies and primer extension analysis of valS transcription. The shaded bold arrow immediately above the partial physical map defines the 5' terminus of the valS structural gene. The wavy line below the physical map indicates the relative start of valS transcription as determined by both S1 protection studies and primer extension analysis. A 255-bp HindIII/Sau3AI restriction fragment labeled on the depicted 5'-end was hybridized in both in vivo and in vitro derived valS transcripts for all S1 nuclease protection studies. An 86-bp T q I / Sau3AI restriction fragment labeled on the depicted 5'-end was utilized in all primer extension analyses. The key to the left defines the symbols used for the individual restriction endonuclease sites.

ualS transcription (see accompanying paper); however, based on DNA sequence analysis, the putative promoter for the ualS gene was not intuitively obvious since several moderately near to consensus promoter sequences (base pair number -37 to -8, -26 to +2 and +85 to +110; Fig. 3) were observed (28).

Characterization of the in Vivo Transcription Products of the Valyl-tRNA Synthetase Gene

SI Nuclease Protection Studies-Since it was not obvious where the promoter for ualS transcription was located, S1 nuclease protection studies were performed to ascertain the 5' terminus of the in uiuo ualS transcript (23). A 255-bp HindIIIISau3AI DNA restriction endonuclease fragment, 5'- end-labeled at the Sau3AI site, was used to hybridize total cellular RNA isolated from E. coli strain JA221 harboring the multicopy plasmid pDH-lAll, which contains a full length copy of the ualS gene (Fig. 5). Following treatment with S1 nuclease, the S1-protected DNA fragments were separated in a denaturing polyacrylamide gel along with a Maxam and


e"". A A T"".

209- 201 - 196-

FIG. 6. Autoradiograph of a 6% polyacrylamide/urea gel used to determine both the in vivo and in vitro vaIS transcriptional initiation sites by S1 nuclease protection analysis. A double-stranded 255-bp HindIII/Sau3AI restriction fragment (Fig. 5 ) was end-labeled at the Sau3AI site. The labeled strand was allowed to hybridize to either total cellular RNA isolated from E. coli K12 strain JA221 transformed with plasmid pDH-1A11 or to an in vitro valS-derived transcript isolated from a gel used to analyze the in vitro transcription products of the plasmid pDH201 (Table I). After S1 nuclease treatment, the protected DNA was analyzed by electrophoresis in a 6% polyacrylamide/urea gel in parallel with the Maxam and Gilbert (14) sequence reactions of the same end-labeled HindIIIl Sau3AI restriction fragment. In vivo S1-protected DNA identifies two transcriptional starts with the two A residues of the upper cluster and the C residue of the lower cluster being the principal protected end points (corresponding to the two T residues, a t positions +1 and +2, and the G residue, a t position +8, of the nontranscribed DNA strand, respectively; Fig. 3). In vitro protected DNA identified only the upstream transcriptional start site with the two A residues being the principal protected end points (again corresponding to the two T residues located at positions +1 and +2; Fig. 3). No protected DNA fragments were observed when the labeled DNA fragment was incubated in the absence of RNA or in the presence of tRNA and digested with S1 nuclease (data not shown).

Gilbert DNA-sequencing ladder (14) of the same 5'-end- labeled DNA restriction fragment. The resulting autoradiogram is shown in Fig. 6.

The ualS encoding mRNA present within the isolated total in uiuo RNA allowed protection of two groupings of DNA fragments having clustered 5'-end points (nucleotide positions from base pairs -5 to +2 and from base pairs +7 to +11; Fig. 3). The two predominate starting nucleotides of the upstream-protected region are both T residues (nucleotide positions +1 and +2), while the predominate downstream protected starting nucleotides are A and G residues (nucleotide positions +7 and +8, respectively). Examination of the

M 1 2 M

FIG. 7. Autoradiograph of a 6% polyacrylamide/urea gel used to determine the in vivo vaIS transcriptional initiation site by primer extension analysis. A double-stranded 86-bp TaqI/ Sau3AI restriction fragment (Fig. 5) was end-labeled at the Sau3AI site. The labeled strand was allowed to hybridize to total cellular RNA isolated from E. coli K12 strain JA221 transformed with plasmid pDH-1A11. Following treatment with avian myeloblastosis virus reverse transcriptase, the extended labeled primers were analyzed by electrophoresis in a 6% polyacrylamide/urea gel. The sizes of the extension products, listed to the left of the gel, were determined by comparison to the marker lanes (M) which consisted of Sau3AI- digested pUC19 ( l l ) , Klenow end-filled with [a-"'P]GTP. Lanes 1 and 2 are the resulting extension products observed when using two separately isolated total cellular RNA extracts as described above. The 209, 201, and 196 nucleotide extension products correspond to transcriptional start sites at residues T (position +l), A (position +9), and T (position +14), respectively (Fig. 3).

DNA sequence upstream of these two i n uivo transcription start sites reveals that they are both preceded by appropriately spaced nucleotide sequences that correspond to the -35 and -10 hexamers of the E. coli consensus promoter (28).

Primer Extension Analysis-In order to independently cor- roborate the S1 nuclease protection studies that suggested two ualS transcriptional start sites in uiuo, primer extension studies utilizing in uiuo generated mRNA were also performed. An 86-bp TagI/Sau3AI DNA restriction endonuclease fragment (Fig. 5), 5'-end-labeled at the Sau3AI site, was used as the primer in these reactions. This 86-bp restriction fragment was hybridized to total cellular RNA isolated from E. coli strain JA221 containing the plasmid pDH-1A11 prior to extension with avian myeloblastosis virus reverse transcriptase. The primer extension reaction products were sized by electrophoresis in a 6% polyacrylamide, 8 M urea denaturing gel. The resulting autoradiogram of the gel shows three prominent


bands (Fig. 7). Correlation of the end points of these primer extension products with the DNA sequence of the promoter proximal region of the ualS gene identifies the T residue a t position +1, the G residue a t position +8, and a T residue a t position +14 as potential transcription initiation sites (Fig. 3). The transcription start sites corresponding to the T residue at position +1 and the G residue a t position +8 were previously identified by the S1 protection analyses. However, the site corresponding to the T residue a t position +14 was not revealed by the S1 protection studies and is not preceded by DNA sequences exhibiting homology to the E. coli consensus promotor sequence. Therefore, the T residue at position +14 is not interpreted to be a transcription start site.

Both S1 nuclease protection and primer extension studies suggest two transcription initiation sites for the ualS gene. Transcription a t these sites, separated by seven nucleotides, is initiated at the two overlapping promoter sequences shown in Fig. 3. Laser densitometry readings of the resultant auto- radiograms from primer extension experiments reveal that in uivo transcription initiation from the upstream site (position +1) is favored by a ratio of approximately 4:l over transcription initiation from the downstream site (position +8), assuming no differential mRNA turnover due to separate initiation sites. I t is of interest to note that the stronger upstream promoter possesses a rare pyrimidine (T) transcription initiation site (28).

Characterization of the in Vitro Transcription Products of the Valyl-tRNA Synthetase Gene

In Vitro Transcription from the ualS Promoter Region-In order to further characterize the transcription initiation sites of the valS gene in uitro transcription of a DNA fragment containing the ualS promoter region was performed. Initially, a set of in vitro run-off transcription experiments using several linearized DNA restriction fragments overlapping the valS promoter region were attempted. Although a wide range of KC1 and RNA polymerase concentrations were tested, no RNA transcripts were detected. Consequently, since it is known that the transcription of some promoters is enhanced with supercoiled DNA templates (29), a DNA fragment containing the ualS promoter region was inserted immediately upstream of the strong rrnB terminator sequence contained within the plasmid construct pDD3 (Table I). That is, the 316-bp Sau3AIISau3AI DNA restriction fragment containing the putative in uiuo ualS promoters was inserted into the unique BamHI site of plasmid pDD3 to generate plasmid pDH201 (Table I). This plasmid construct, pDH201, would allow transcription to initiate at the ualS promoters and terminate a t the rrnB terminator site on a closed, circular, supercoiled DNA template.

A greater than 75% negatively supercoiled pDH201 plasmid DNA preparation was used as the DNA template in an in vitro transcription reaction utilizing purified E. coli RNA polymerase. The transcription products from these reactions were analyzed by electrophoresis on a 6% polyacrylamide, 8 M urea gel. The autoradiogram of this gel (Fig. 8) shows three prominent transcription products: a 350-nucleotide transcript originating from the upstream promoter (approximate position +1) of the valS promoter region, a 207-nucleotide transcript of undetermined origin and, finally, a 108-nucleotide transcript initiating from the ori region of pBR322 (30). Thus, only one of the two putative valS promoters identified by in vivo experiments is functional in uitro, specifically the upstream promoter located a t position +1 (Fig. 3).

SI Nuclease Analysis of the in Vitro ualS Transcript-S1 nuclease protection studies were performed in order to more

- 350

- 207

FIG. 8. Autoradiograph of a 6% polyacrylamide/urea gel displaying the in vitro transcription products produced when using plasmids pDD3 and pDH201 as template DNAs. In order to determine the start of in vitro transcription, a 316-hp Sau3AIl Sau3AI restriction fragment (Fig. 5) containing the ualS promoter elements was cloned into the unique BamHI site of plasmid pDD3 (Table I) to yield plasmid pDH201. The plasmids listed immediately above each lane designate the supercoiled DNA plasmid template utilized in the in vitro transcription reactions. The transcription products were analyzed by electrophoresis in a 6% polyacrylamide/ urea gel. The determined nucleotide sizes of the prominent transcription products are listed to the right of the gel. The 350, 207, and 108 nucleotide long transcripts correspond to a ualS transcriptional start at the T residue (position +l; Fig. 3), a transcript of undetermined origin and a transcript originating from the ColEl origin of replication (ori) present on pDD3, respectively (Table I).

definitively determine the transcription start site of the in uitro generated ualS transcript. The same 255-bp 5'-end- labeled HindIIIISau3AI DNA restriction endonuclease fragment used for the S1 nuclease analysis of the in viuo produced RNA was utilized for the in vitro analysis. This DNA fragment, 5'-end-labeled at the Sau3AI site, was hybridized to the 350 nucleotide in vitro transcription product of pDH201 prior to treatment with S1 nuclease. The resulting autoradiogram (Fig. 6) of an electrophoresis gel used to analyze the SI-protected products reveals that both in uiuo and in vitro transcription initiation originating from the upstream promoter occurs at the same identical sites (nucleotides +1 and +2; Fig. 3). Thus, both in viuo and in vitro, ualS transcription initiates predominately at a pyrimidine (T) start site.

In Vitro -p"P-End-labeled Transcriptional Analysis of the valS Promoter Region-In view of the fact that a pyrimidine (T) transcription initiation site is a relatively rare event (<3% of promoters analyzed; 28), the starting nucleotide of the ualS transcript was further characterized by performing in vitro y-


32P-end-labeled transcriptional analysis of the ualS promoter region. Utilizing plasmid pDH201 as the DNA template, four separate in uitro transcription assays were carried out in the presence of RNA polymerase and one of the four -p3*P-labeled ribonucleotide triphosphates. In uitro transcription products produced under these conditions are radioactively labeled only if the starting ribonucleotide of an in uitro generated transcript is the same as the 7-”P-labeled ribonucleotide present in that specific reaction. The transcription products produced

1 2 3 4 5

* 350

4 207

- 108

FIG. 9. Autoradiograph of a 6% polyacrylamide/urea gel displaying the y-“*P-end-labeled in vitro transcription products produced utilizing supercoiled plasmid pDH201 as DNA template. In order to determine the starting nucleotide of the valS transcript, four individual in vitro transcription reactions were performed in the presence of either y-labeled GTP, ATP, UTP, or CTP or a-labeled GTP (lanes 1-5, respectively) using supercoiled plasmid pDH201 as DNA template. The transcription products of each reaction were analyzed by electrophoresis in a 6% polyacrylamide/urea gel. The nucleotide sizes of the prominent transcription products produced are listed on the right of the gel. The 350-nucleotide long valS transcript has the expected U start (corresponding to a T residue in the DNA sequence) with a minor A start. The 207-nucleotide long transcript starts with a G residue while the 108-nucleotide long transcript starts with a expected A residue (30).

from these four separate reactions were separated by electrophoresis in a 6% polyacrylamide, 8 M urea gel. As expected, the autoradiogram shows that the 350-nucleotide long ualS transcript begins with a uridine triphosphate (Fig. 9, lane 3 ) . However, a small percentage of these transcripts also originate with an adenosine triphosphate (lane 2). A 207-nucleotide long transcript of undetermined origin, begins with a guanosine triphosphate (lane 1 ), while the 5’ terminus of the 108- nucleotide long ori transcript (lane 2 ) starts with an expected adenosine triphosphate (30). These results additionally con- firm that only the upstream ualS promoter is capable of functioning in uitro and that this promoter initiates predominately at a pyrimidine (T residue in the DNA sequence) start site, which is located 8 or 9 base pairs downstream from the “invariant T” of the -10 hexamer (Fig. 3, position -8). The results further show that in uitro a small percentage of the transcripts originating from the upstream ualS promoter begin with an A residue (position +3), which is immediately adjacent to but further downstream of the T start(s) (positions +1 and +2).

DNA Sequence Determination and Analysis 5’-DNA Sequence Analysis-The DNA sequence of the 5’-

and 3’-flanking regions of the ualS structural gene (Fig. 4) was determined (14, 15). Examination of the nucleotide sequence of the region containing the overlapping ualS promoters (Fig. 3) shows that both the upstream and downstream -35 hexamer sequences differ from the E. coli consensus promoter -35 hexamer (TTGACA) sequence by one base, while the upstream and downstream -10 hexamer sequences vary from the consensus promoter -10 hexamer (TATAAT) sequence by two and four bases, respectively (28). The distance separating the two hexamers of each ualS promoter is also found to differ from the optimal 17-bp distance that separates the -35 and -10 hexamers of the consensus promoter. The upsteam ualS promoter hexamers are separated by 18 bp, while the downstream ualS promoter hexamers are 16 bp apart. The tandem ualS promoter elements overlap each other with the -35 hexamer of the downstream promoter falling between the -35 and -10 hexamers of the upstream promoter.

Additional examination of the DNA sequence around the ualS promoter region reveals the presence of a number of regions of hyphenated dyad symmetry (Fig. 3). The region immediately in front of the upstream promoter -35 hexamer contains a 10-bp inverted repeat separated by 5 bp (positions -62 to -53 and -47 to -38). A second region of dyad symmetry, a 7-bp inverted repeat separated by 6 bp, can be found centered over the -35 hexamer of the downstream promoter (positions -32 to -26 and -19 to -13). There exists a third region, a 5-bp inverted repeat separated by 5 bp, that overlaps the -10 hexamer of the upstream promoter (positions -20 to -16 and -10 to -6). Finally, there is a 6-bp inverted repeat separated by 5 bp that is centered over the downstream promoter -10 hexamer region (positions -9 to

TABLE I1 Percent relative readthrough from in vivo galK assays performed on cells containing plasmids bearing the valS

p-independent terminator inserted prior to the galK structural gene

Plasmid Galactokinase- Plasmid-specific Amount of Relative specific activity number readthrough readthrough

nmol Gal-I-PO,lminl fmol plasmid/mg nmol Gal-I-PO,/minl mgprotein protein fmol plnsmid

%

pKG2001 404 180 2.24 100 pDH2011 15.9 269 0.059 2.63 pDH2061 6.65 238 0.028 1.25

valS Gene Isolation and Molecular Characterization

A. CAUG

A-U G-C G-C

GoC - 2987

2977 - cceG 2947 2957 2%7

c *G GoC 2997

X&BJCAAAACUCAGUGAUGAAAACGAAGG-CUUUUUUAU..F

B. 111

2%7 2977 ml 2987 2997

XAACGAAGGGCCCGGAGCATG~CCGGCCTTSTTTAT..F

~~

rrLs TRANSCRIPT

p//A369 bp Nrql/blv//A " i -

1 W b P

FIG. 10. Partial restriction endonuclease map of 3'-end of the vals structural gene indicating the position and nucleotide sequences of the p-independent terminator of valS. The numbers above the nucleotide sequences indicate position with respect to the start of valS transcription. A region of dyad symmetry followed by a run of 6 uridine residues, centered on the recognition sequence of the SphI restriction site located 36 bp downstream from the valS translational stop codon (UAA, boxed in RNA transcript), is responsible for termination of valS transcription. As indicated in the valS mRNA secondary structure ( A ) and the valS DNA sequence by the solid and doshed line beneath the symmetry region ( B ) , the C residue at position 2977 is a foldout/mismatch within the stem-forming section of the terminator. The h t c h e d bars below the partial restriction endonuclease map represent the discrete DNA restriction fragments that were cloned into plasmids pKG2001 and pKK223-3 in order to perform both in vivo and in vitro studies of valS transcriptional termination, respectively (Table I). Based on in vitro transcription studies, valS transcriptional termination occurs within the last three U residues (arrows, position 2998-3000) of the run of 6 uridine residues located immediately following the stem-loop structure.

-4 and +3 to +8). It is currently not known whether any of these hyphenated palindromic sequences might play a role in the regulation of valS gene expression.

Examination of the DNA sequence immediately following the valS promoter region reveals that the first possible translational start condon (ATG) is located approximately 90 nucleotides downstream from the upstream start of vats transcription (Fig. 3). Further analysis reveals the existence of an extensive open reading frame continuing downstream from this ATG condon (see accompanying paper). The deduced amino acid sequence, starting with this first ATG codon, is listed immediately below the corresponding DNA sequence. The ordered amino-terminal sequence of valyl-tRNA synthetase has recently been determined by automated protein sequence analysis of the purified valyl-tRNA synthetase enzyme? The length of amino acid sequence obtained matches the first 10 deduced amino acids of the DNA sequence beginning with this ATG codon. It is interesting to note that immediately preceding the translational start site are two potential ribosome-binding sites contained in two directly repeated 7-bp sequences that are separated by 7 bp (Fig. 3).

W.-C. Chu and J. Horowitz, personal communication.

1

rrn B t l -

174

865

M 2 3

537

FIG. 11. Autoradiograph of a 6% polyacrylamide/urea gel depicting the transcription termination products obtained from in vitro transcription assays utilizing DNA plasmid templates containing 3'-end valS restriction fragments. The DNA plasmid template used for the in vitro transcription reactions consisted of plasmid pKK223-3, which has the strong tac promoter located upstream of the rrnE terminator, either unmodified (lune 3) or with discrete DNA restriction fragments, containing sequences overlapping the 3'-end of the valS structural gene, inserted (lunes 1 and 2). The DNA templates utilized in lanes 1 and 2 consisted of pKK223-3 inserted with either the 369-bp NruI/RsaI or the 722-bp RsaI/RsaI restriction fragments, respectively (Fig. 10 and Table I). Sizing of the discrete transcription products resulting from transcription termination due to the inserted valS DNA sequences (174 nucleotides, lane l and 537 nucleotides, lane 2) allowed for the determination of the region of transcription termination. Termination was localized to the last 3 U residues (positions 2998-3000, Fig. 10) within the run of 6 U residues immediately following the dyad symmetry structure. Transcripts terminating at the rrnB tl terminator are noted to the left. The molecular markers consisted of end-labeled Sau3AI- digested plasmid pUC19 (lune M).

I n Vivo and in Vitro Characterization of ualS Transcriptional Termination

I n Vivo Termination of ualS Transcription-To determine whether the valS promoters are responsible for the initiation of transcription of additional genes downstream of the valS structural gene, in vivo based valS transcription termination studies were performed utilizing the plasmid construct pKG2001 (Table I). Plasmid pKG2001, a derivative of transcription fusion vector pKG1800 (12), has additional restriction endonuclease sites present to facilitate the insertion of a DNA fragment of interest between the PgaI promoter and the galactokinase gene, galK, present on the plasmid. When compared to cells transformed with the starting plasmid pKG2001, proper insertion of a DNA restriction fragment containing a transcription termination sequence results in a


dramatic reduction in galK expression in cells transformed with the resultant plasmid. The 369-bp NruI/RsaI and the 722-bp RsaIIRsaI DNA restriction endonuclease fragments (Fig. lo), both overlapping the vaZS structural gene 3’-end (see accompanying paper), were inserted in the correct orientation between the P,., promoter and the galK gene of plasmid pKG2001 to produce recombinant plasmids pDH2011 and pDH2061, respectively (Table I). Assays of extracts of C600K- cells transformed with either plasmid pDH2011 or pDH2061, reveal that the level of galK expression is reduced by 97.4 and 98.7%, respectively, when compared to the level of galK expression obtained using extracts of C600K- cells containing the starting plasmid pKG2001 (Table 11). Thus, the 369-bp region common to these two fragments contains DNA sequences encoding an efficient transcription terminator.

I n Vitro Termination of valS Transcription-Recombinant plasmids containing the 3’-end of the valS gene and associated downstream sequences were used as DNA templates for a set of in vitro transcription assays designed to determine the sequence elements responsible for the reduced expression of the galK gene. The first plasmid construct, pDH311, was made by inserting the 369-bp NruIIRsaI DNA restriction endonuclease fragment in the proper orientation between the Pt., promoter and the rrnB TIT2 terminators of the commer- cially available plasmid pKK223-3 (Table I). A second plasmid construct, pDH361, was made by inserting the 722-bp RsaIIRsaI DNA restriction endonuclease fragment into pKK223-3 in the proper orientation (Table I). Both of these plasmid constructs were used as template DNA in a set of in uitro transcription assays designed to locate nucleotide sequences capable of terminating transcription originating from the P, promoter prior to the strong rrnB terminators. The resultant autoradiogram of a 6% polyacrylamide, 8 M urea gel used to analyze the lengths of the transcripts produced in these reactions indicates that both plasmid constructs produce discretely sized transcripts that terminate prior to the expected sized transcripts terminating at the rrnB terminators (Fig. 11). The two plasmids, pDH311 and pDH361, produce transcripts of 174 and 537 nucleotides in length, respectively, which correspond to a termination site located within a stretch of 6 T’s just 3’- to the SphI restriction endonuclease site present in the DNA sequence (Fig. 10). Analysis of this portion of the DNA sequence reveals a region of hyphenated dyad symmetry centered on the 6-bp recognition sequence of the SphI restriction endonuclease enzyme (positions 2982- 2987). This places the site of in vitro transcription termination for the valS gene immediately downstream of the hyphenated dyad symmetry structure within the stretch of 6 T’s. This potential stem-loop forming RNA structure is characteristic of a p-independent terminator (31). Subsequent analysis indicated that the center of this hyphenated dyad symmetry structure is located 36 bp downstream from the translational stop codon (TAA) for the valS structural gene (see accompanying paper). Thus, it appears that valS is the only structural gene encoded within the transcription unit and that valS is not transcribed as part of a multigene operon as is the case for several of the aminoacyl-tRNA synthetase genes (32, 33).

DISCUSSION

In this report, the molecular genetic elements necessary for the expression of the valyl-tRNA synthetase gene of E. coli K12 are identified and characterized. These elements include: two transcription initiation sites preceded by tandem overlapping promoters separated by seven base pairs; a translational initiation codon defining a deduced amino acid sequence for

the structural gene which matches the amino-terminal portion of the valyl-tRNA synthetase protein; and, a translation stop codon defining the 3’-end of the coding region of the structural gene preceding a p-independent transcription termination site. In addition, several regions of dyad symmetry in the DNA sequence of the promoter regions are identified that potentially could be important for regulating the expression of this gene.

Subcloning the valyl-tRNA synthetase gene from the starting plasmid pLC26-22 was accomplished by a combination of genetic complementation and in vitro transcription-translation experiments. I t is interesting to note that the plasmid pDH-1, which contains only the proximal fifth of the valS- coding region, is still able to complement the ualS temperature sensitive strain, AB4141, at the nonpermissive temperature. Since AB4141 is not a recA strain, the simple explanation is that the valSt6 mutation of AB4141(9) must occur within the proximal fifth of the valS gene. Presence within the cell of a multicopy plasmid containing the proximal sequence of the valS gene would allow for recombination and rescue of the conditional valS mutation carried on the chromosome. An alternative explanation is that the essential catalytic core of valyl-tRNA synthetase is encoded within this subcloned portion of vats. This explanation is less likely since it has been previously noted that the catalytic core responsible for the aminoacyl-tRNA activity of most synthetases is on the order of 300-400 amino acids in size (34), while the subcloned portion of ualS contained within plasmid pDH-1 encodes only the amino proximal 175 amino acids of the valyl-tRNA synthetase enzyme.

The conclusion that transcription of the valyl-tRNA synthetase gene originates from tandem overlapping promoters is somewhat ambiguous since in vitro transcription is detected only from the upstream promoter (Fig. 8). Since both initiation sites can be demonstrated in vivo by two independent methods, S1 nuclease protection and primer extension, it is unlikely that the apparent downstream initiation site is due to artifacts of either method of analysis; nevertheless a site specific rapid in uioo mRNA degradation event giving rise to the shorter transcript cannot be excluded. I t is of interest to note that in order to demonstrate any transcription in vitro, even at the upstream promoter site, a closed circular negatively supercoiled DNA template was required (29). A supercoiled DNA template might affect the activity of the upstream promoter by improving the spatial orientation of the -35 and -10 hexamer regions which are separated by 18 bp rather than the optimal distance of 17 bp (28). Such an effect of DNA conformation in this region might also inhibit the in vitro activity of the downstream promoter since the subopti- mal spatial orientation of the -35 and -10 hexamer regions of this promoter, separated by only 16 bp, would be exacer- bated. I t is also possible that an additional transcription factor(s) is required for in vitro activity of the downstream promoter.

As previously mentioned, several different forms of amino acid specific regulation of aminoacyl-tRNA synthetases have been documented. Specifically, phenylalanyl-tRNA synthetase is regulated by translational control of transcription termination at an attenuator site preceding the pheS structural gene (7). DNA sequence analysis of the region 5’- to the valS structural gene reveals that transcription attenuation is not a formal possibility for regulating ualS expression since the sequence shows no evidence for a leader RNA transcript capable of encoding a short leader test polypeptide and pos- sessing the required RNA secondary structures necessary to effect regulated transcription termination. A second type of


aminoacyl-tRNA synthetase regulation is exhibited by alanyl- tRNA synthetase. In this case it has been shown that the alas gene product, alanyl-tRNA synthetase, is capable of binding in an autoregulatory manner to a region of hyphenated dyad symmetry overlapping the -10 hexamer of the alas promoter, thus acting to repress the level of alas transcription (5). The existence of similar regions of hyphenated dyad symmetry overlapping the -10 hexamers of both ualS promoters might likewise function to cause repression of transcription of the valS gene (Fig. 3). By analogy with alanyl-tRNA synthetase, the regulatory molecule which interact in a repressive fashion with either of these two symmetry regions could possibly be the valS gene product, valyl-tRNA synthetase. However, we note that this is unlikely because valyl-tRNA synthetase is composed of a single polypeptide chain (a) , lacking the pre- requisite two-fold symmetry required for recognition of these symmetry regions (27). Conversely, these same regions of hyphenated dyad symmetry might possibly function as recognition sites for an as yet undefined gene product involved in the regulation of ualS expression. Such a hypothesis could be similar to the observed positive regulation of glutaminyl- tRNA synthetase, which appears to be mediated at the level of glnS gene transcription by the unlinked glnR gene product (8).

DNA sequence analysis also reveals the existence of two additional regions of hyphenated dyad symmetry that immediately precede or overlap the -35 hexamers of the valS promoters (Fig. 3). Binding of an effector molecule to either of these two sites could conceivably act to modulate the expression from either of the overlapping valS gene promoters. In general, this possible method of regulation is comparable to the mechanism utilized in the E. coligal operon, which is also controlled by two overlapping promoters, whose activities are modulated by the CAMP-CRP protein complex (35). Binding of the CAMP-CRP complex to the CRP site overlapping the upstream gal promoter -35 hexamer allows transcription only from the downstream promoter. Although not quite analogous, specific binding to the region of symmetry immediately preceding the -35 hexamer of the stronger valS upstream promoter could possibly preclude this DNA sequence from acting as a RNA polymerase recognition site, thus allowing only for the observed reduced valS expression that originates from the weaker downstream promoter. Con- versely, specific binding to this same region could act to possibly stimulate transcription initiation from the upstream valS promoter. Further experimentation is required in order to determine whether any of these observed regions of dyad symmetry function in some manner to regulate valS gene expression originating from either of the valS promoters.

In summary, the ualS structural gene encoding the valyl- tRNA synthetase of E. coli has been cloned, and those DNA sequences involved in the expression of the enzyme have been characterized. These results lay the foundation for future experiments designed to elucidate the mechanisms responsible in the regulation of valyl-tRNA synthetase gene expression.

Acknowledgments-We are grateful to Ronald C. Wek for helpful suggestions and discussions. Additionally, we thank David W. Daniels for the transcriptional analysis vector pDD3, Wen-Chy Chu and Jack Horowitz for determination of the amino terminus of valyl-tRNA synthetase, and Kurt Gish, Elaine Ito, and Jeanne Sameshima for excellent technical assistance.

1.

2.

3.

4.

5. 6.

7.

8.

9. 10. 11.

12.

13.

14.

15.

16. 17.

18.

19.

20. 21. 22. 23. 24. 25.

26.

27. 28.

29.

30. 31.

32.

33.

34.

35.

36.

37. 38.

39.

REFERENCES Schimmel, P. R., and So11, D. (1979) Annu. Reu. Biochem. 48 ,

Kolter, R., and Yanofsky, C. (1982) Annu. Reu. Biochem. 16,

Moore, P. A., Jayme, D. W., and Oxender, D. L. (1977) J. Biol. Chem. 252 , 7427-7430

Cashel, M., and Gallant, J. (1974) in Ribosomes (Nomura, M., Tissiers, A., and Lengyel, P., eds) pp. 733-745, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

601-648

113-143

Putney, S. D., and Schimmel, P. (1981) Nature 291,632-635 Butler, J. S., Springer, M., Dondon, J., and Grunberg-Manago,

M. (1986) J. Bacteriol. 165 , 198-203 Springer, M., Trudel, M., Graffe, M., Plumbridge, J., Fayat, G.,

Mayaux, J. F., Sacerdot, C., Blanquet, S., and Grunberg-Man- ago, M. (1983) J. Mol. Biol. 171, 263-279

Cheung, A. Y., Watson, L., and Soll, D. (1985) J. Bacteriol. 161 ,

Baer, M., Low, K. B., and So11, D. (1979) J. Bacteriol. 139, 165 Clarke, L., and Carbon, J. (1978) J. Mol. Biol. 120, 517-532 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene

McKenney, K., Shimatake, H., Court, D., Schmeissner, U., and Rosenberg, M. (1981) in Gene Amplification and Analysis (Chi- rikjian, J., and Papas, T., eds) Vol. 2, pp. 383-415, Elsevier Scientific Publishing Co., New York

Miller, J. H. (1972) in Experiments in Molecular Genetics, pp. 431-433, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 ,

Sanger, F., Nicklen, S., and Coulsen, A. (1977) Proc. Natl. Acad.

Henikoff, S. (1984) Gene (Amst.) 28 , 351-359 Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) in Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Wek, R. C., and Hatfield, G. W. (1986) J. Biol. Chem. 261,2441- 2450

Wek, R. C., and Hatfield, G. W. (1986) Nucleic Acids Res. 14 ,

Laemmli, U. K. (1970) Nature 227 , 680-685 Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 Berk, A. J., and Sharp, P. A. (1977) Cell 12, 721-732 Bachmann, B. J. (1983) Microbiol. Rev. 4 7 , 180-230 Clarke, L., and Carbon, J. (1976) Cell 9,91-99 Neidhardt, F. C., Vaughn, V., Phillips, T. A., and Bloch, P. L.

Pratt, J. M., boulnois, G. J., Darby, V., Orr, E., Wahle, E., and

Yaniv, M., and Gros, F. (1969) J. Mol. Biol. 44 , 1-15 Hawley, D. K., and McClure, W. R. (1983) Nucleic Acids Res. 11 ,

Kassavetis, G. A., Elliott, T., Rabussay, D. P., and Geiduschek,

Morita, M., and Oka, A. (1979) Eur. J. Biochem. 97,435-443 Christie, G . E., Farnham, P. J., and Platt, T. (1981) Proc. Natl.

Acad. Sci. U. S. A. 78,4180-4184 Miller, K. W., and Wu, H. C. (1987) J. Biol. Chem. 262 , 389-

393 Mayaux, J.-F., Fayat, G., Fromant, M., Springer, M., Grunberg-

Manago, M., and Blanquet, S. (1983) Proc. Natl. Acad. Sci. U.

Jasin, M., Regan, L., and Schimmel, P. (1984) Cell 36 , 1089- 1095

Musso, R. E., Di Lauro, R., Adhya, S., and de Crombrugghe, B. (1977) Cell 12,847-854

Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, M. C., Heyneker, H. L., and Boyer, H. W. (1977) Gene (Amst.) 2,95- 113

212-218

(Amst.) 3 3 , 103-119

499-560

Sci. U. S. A. 74 , 5463-5467

2763-2777

(1983) Microbiol. Reu. 4 7 , 231-284

Holland, I. B. (1981) Nucleic Acids Res. 9,4459-4474

2237-2255

E. P. (1983) Cell 33 , 887-897

S. A. 80, 6152-6156

Viera, J., and Messing, J. (1982) Gene (Amst.) 19, 259-268 Brosius, J., and Holy, A. (1984) Proc. Natl. Acad. Sci. U. S. A.

Rosenberg, M., Chepelinsky, A. B., and McKenney, K. (1983) 8 1,6929-6933

Science 222,734-739

Documents

OF by and Biology, in U. S.A. Valyl-tRNA Synthetase Gene of … · 2017-08-30 · THE JOURNAL 0 1988 by The American Society for Biochemistry OF BIOLOGICAL CHEMISTRY and Molecular