21
OEB 192 – 10.09.1 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)

OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

  • View
    213

  • Download
    0

Embed Size (px)

Citation preview

Page 1: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

OEB 192 – 10.09.13

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)

Page 2: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree of Life: primary divisions

Page 3: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Microbial systematics

• Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea

multi-C C1(& all use methanol)

Page 4: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

16S rRNA as phylogenetic marker• Why a good molecule?

70S 30S 50S

Page 5: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree of Life: three “domains”• Based on 16S rRNA (Woese, 1987):

Page 6: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree of Life: three “domains”• Based on 16S rRNA (Pace, 1997):

Page 7: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Bacteria & Archaeal: all genomes as of 12 Feb., 2010

(Lee, Robinson & Marx, in prep)

Page 8: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree basics: meaning

Page 9: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree basics: rotation

Page 10: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree basics: shape

Page 11: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Tree basics: character change

Page 12: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Key phylogenetic terms

Page 13: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Key phylogenetic terms

Page 14: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Phenetics vs. cladistics

Page 15: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Lysozyme amino acid changes in unrelated ruminants

Phenetics vs. cladistics

Page 16: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Maximum Parsimony• Parsimony – shortest tree (fewest homoplasies)

Page 17: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Neutral theory• Developed by Motoo Kimura, 1968

Page 18: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Good Dataset

[A1, A2, A3, A4] [A1, B2, A3, A4]

Bad Dataset

A B

species 1 species 2 species 3 species 4

A1B1

A2B2 A4

B4A3

B3

1. Collect Sequence DataOrtholog vs. paralog?

Page 19: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

2. Sequence Alignment

CGGATAAACCGGATAGACCGCTGATAAACCGGATAC

taxa1taxa2taxa3taxa4

Alignment

Page 20: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Wednesday (9/15): Molecular evolution & phylogenetic inference:

case of HIV

& comment…

Page 21: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical

Upcoming talks in (microbial) evolution…

Wednesday, 9/15

11:00 AM Main Lecture HallBioLabs Building

OEB Weekly Seminar Series

Gunter WagnerYale University

Transcription factor protein evolution and the origin of evolutionary novelties

Host: Abzhanov Lab