1

Biochemical and Kinetic Characterization of the Eukaryotic 1 Phosphotransacetylase Class IIa Enzyme from Phytophthora ramorum 2

3 Tonya Taylor, Cheryl Ingram-Smith, and Kerry S. Smith# 4

5 Department of Genetics and Biochemistry, Clemson University, 6

Clemson, SC 29634 7 8

*Running Title: Phytophthora ramorum Class IIa Phosphotransacetylase 9 10

To whom correspondence should be addressed: 11 Kerry S. Smith 12

Department of Genetics and Biochemistry, Clemson University, 257B Life Sciences Facility, 13 190 Collings Street, Clemson, SC 29634-0318 14

E-mail: kssmith@clemson.edu 15 Phone: (864) 656-6935 16

17 18 19

EC Accepted Manuscript Posted Online 8 May 2015Eukaryotic Cell doi:10.1128/EC.00007-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

2

ABSTRACT 20 Phosphotransacetylase (Pta), a key enzyme in bacterial metabolism, catalyzes the 21

reversible transfer of an acetyl group from acetyl phosphate to CoA to produce acetyl-CoA and 22 Pi. Two classes of Pta have been identified based on the absence (PtaI) or presence (PtaII) of an 23 N-terminal regulatory domain. PtaI has been fairly well studied in bacteria and one genus of 24 archaea; however, only the Escherichia coli and Salmonella enterica PtaII enzymes have been 25 biochemically characterized, and both are allosterically regulated. Here we describe the first 26 biochemical and kinetic characterization of a eukaryotic Pta from the oomycete Phytophthora 27 ramorum. The two Ptas from P. ramorum, designated as PrPtaII1 and PrPtaII2, both belong to 28 class II. PrPtaII1 displayed positive cooperativity for both acetyl phosphate and CoA and is 29 allosterically regulated. We compared the effect of different metabolites on PrPtaII1 and the S. 30 enterica PtaII and found that although the N-terminal regulatory domains share only 19% 31 identity, both enzymes are inhibited by ATP, NADP, NADH, PEP, and pyruvate in the acetyl-32 CoA/Pi–forming direction but are differentially regulated by AMP. Phylogenetic analysis of 33 bacterial, archaeal, and eukaryotic sequences identified four subtypes of PtaII based on the 34 presence or absence of the P-loop and DRTGG subdomains within the N-terminal regulatory 35 domain. Although the E. coli, S. enterica, and P. ramorum enzymes all belong to the IIa 36 subclass, our kinetic analysis has indicated that enzymes within a subclass can still display 37 differences in their allosteric regulation. 38 39

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

3

INTRODUCTION 40 Acetate production has been studied for many years in bacteria, but has received less 41

attention in eukaryotic microbes even though acetate is produced as an important end product of 42 energy metabolism in yeasts (1-3) and protists (4-6). Four different pathways for production of 43 acetate from acetyl-CoA have been identified in eukaryotic microbes (7). ADP-forming acetyl-44 CoA synthetase (Eq. 1; EC 6.2.1.13) has been implicated in acetate production in 45 amitochondriate protists and some species of archaea. Acetate:succinate CoA-transferase (Eq. 2; 46 EC 2.8.3.8) is present in kinetoplastids, Trichomonas species, the trematode Fasciola hepatica, 47 the yeast Saccharomyces cerevisiae, the rumen fungus Neocallimastix sp. L2 (8-12). Acetyl-CoA 48 hydrolase (Eq. 3; EC 3.1.2.1) is involved in peroxisomal acetate formation in kinetoplastids (7). 49 Phosphotransacetylase (Pta; Eq. 4; EC 2.3.1.8) and acetate kinase (Ack; Eq. 5; EC 2.7.2.1) form 50 a pathway for the interconversion of acetate and acetyl-CoA that was previously thought to be 51 limited to bacteria and one genus of archaea but has now been shown to be present in eukaryotes 52 such as green algae and Phytophthora (13, 14). 53

[Eq. 1] acetyl-CoA + ADP + Pi ↔ acetate + ATP + CoA 54 [Eq. 2] acetyl-CoA + succinate ↔ acetate + succinyl-CoA 55 [Eq. 3] acetyl-CoA + H2O ↔ acetate + CoA 56 [Eq. 4] acetyl-CoA + Pi ↔ acetyl phosphate + CoA 57 [Eq. 5] acetyl phosphate +ADP ↔ acetate + ATP 58 The Pta-Ack pathway is best understood in its roles in both acetate production and 59

assimilation in Escherichia coli and other bacteria. This pathway is responsible for the 60 production of acetate during mixed acid fermentation under hypoxic conditions, and in a 61 metabolic overflow mechanism in which acetyl-CoA is diverted from the TCA cycle when there 62

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

4

is an imbalance between the rapid uptake of glucose and its conversion into products (15). Under 63 high acetate concentrations, this low affinity pathway can also be used for assimilation of acetate 64 by its conversion to acetyl-CoA (16). 65

In eukaryotes, the Pta-Ack pathway has only been investigated in the green algae 66 Chlamydomonas, in which two parallel Pta-Ack pathways have been identified (13). Proteomic 67 studies have suggested that the Pat1-Ack2 pathway is localized to mitochondria (note that 68 phosphotransacetylase is designated as Pat in Chlamydomonas), and the Pat2-Ack1 pathway is 69 localized to chloroplasts (13, 17). Acetate is found to be one of the major fermentative products 70 excreted by Chlamydomonas during growth in dark, anoxic conditions, and ACK1, ACK2, PAT1, 71 and PAT2 transcript levels are increased, in agreement with a role for the Pat-Ack pathway in 72 acetate production (18). The ack1 and pat2 mutants were the most vulnerable to anoxia and 73 strains could not be recovered after a 24 hour exposure to anoxia (19). Far less acetate was 74 produced in each of the mutants after imposition of anoxia, yet small amounts of acetate (<20%) 75 were still produced in the ack1-ack2 double mutant suggesting Pat-Ack is not the only pathway 76 for acetate production in Chlamydomonas (19). 77

Analysis of bacterial and archaeal Pta sequences revealed two classes (20). PtaI enzymes 78 consist of a single catalytic domain, whereas the PtaII enzymes have an additional N-terminal 79 regulatory domain (20, 21). The Pta from the archaeon Methanosarcina thermophila is the best 80 studied class I enzyme (22-25), and several structures have been solved (26, 27). A ternary 81 complex mechanism based on kinetic and structural studies has been proposed for this enzyme 82 (24). Two PtaII enzymes have been characterized, one from Salmonella enterica (SePtaII) and 83 one from E. coli (EcPtaII) (20, 21); however, a structure for a PtaII has not been reported. The N-84 terminal regulatory domain of EcPtaII and SePtaII contains two recognizable subdomains 85

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

5

designated as the P-loop and the DRTGG subdomains (21). Truncations of the N-terminal 86 domain of EcPtaII revealed that the P-loop subdomain is required for regulation of the enzyme by 87 NADH, ATP, PEP and pyruvate, and that the DRTGG subdomain is vital for the sigmoidal 88 response that is observed in allosteric enzymes (20, 21). 89

Here we report the first biochemical and kinetic investigation of a eukaryotic Pta, the 90 PtaII enzyme from Phytophthora ramorum, a pathogenic oomycete that causes Sudden Oak 91 Death (28). P. ramorum has a single ORF that encodes Ack and two ORFs that encode class II 92 Ptas (designated here as PrPtaII1 and PrPtaII2). Our characterization of PrPtaII1 demonstrates that 93 this enzyme strongly prefers the acetyl-CoA/Pi - forming direction, unlike the S. enterica and E. 94 coli enzymes. PrPtaII1 displays substrate cooperativity for acetyl phosphate and CoA, and is 95 allosterically regulated through inhibition by ATP, AMP, NADP, NADH, PEP, and pyruvate. 96 Our phylogenetic analysis of the Pta family, the first reported that includes eukaryotic sequences, 97 indicates there are four different subclasses of PtaII based on differences in the N-terminal 98 regulatory domain. A comparison of the bacterial and eukaryotic enzymes and the phylogenetic 99 diversity suggests that the N-terminal domain and its regulatory role have evolved throughout the 100 Bacteria and Eukarya domains. 101 102

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

6

MATERIALS AND METHODS 103 Materials 104 Chemicals were purchased from Sigma-Aldrich, VWR, Fisher Scientific, and Gold 105 Biotechnology. Oligonucleotide primers were purchased from Integrated DNA Technologies. A 106 codon-optimized gene encoding P. ramorum PrPtaII1 (JGI 78441; http://genome.jgi-107 psf.org/Phyra1_1/Phyra1_1.home.html) was synthesized by GenScript and supplied in the E. coli 108 expression vector pET21b, which provides for addition of a C-terminal His tag for use in nickel 109 affinity column purification. Plasmid pPTA69 (kindly provided by Dr. Jorge Escalante-110 Semerena, University of Georgia) encodes S. enterica PtaII with a His6 tag fused to the N-111 terminus of the protein (20). 112 113 Phylogenetic Analysis of Pta 114

BLASTP and TBLASTN (29, 30) were used to search the sequence databases at the 115 National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov), the Broad 116 Institute (http://www.broadinstitute.org/), and the U.S. Department of Energy Joint Genome 117 Institute (http://genome.jgi-psf.org/) for putative Pta amino acid sequences, using the M. 118 thermophila PtaI as the query sequence. Sequences were aligned using ClustalW with the Gonnet 119 protein weight matrix, a gap-opening penalty of 10.0, and a gap extension penalty of 0.2 (31). 120 Phylogenetic analysis of the aligned sequences was performed with the MEGA 5.1 program (32) 121 using the neighbor-joining algorithm with partial deletion estimates. Five hundred bootstrap 122 replicates were executed, and bootstrap values of 75% or greater are shown. The EMBOSS 123 Needle Pairwise Sequence Alignment program (http://www.ebi.ac.uk) was used to determine 124 sequence identity and similarity (33). The presence or absence of the P-loop and DRTGG 125

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

7

subdomains in each PtaII sequence was analyzed using the Pfam Protein Families Database 126 (http://pfam.xfam.org/search) with an e-value cutoff of E-10 (34). 127 128 Heterologous Production and Purification of Pta 129

Recombinant plasmids were introduced into E. coli RosettaTM 2 (DE3) pLysS, and cells 130 were grown in Luria-Bertani broth with 50 μg/mL ampicillin and 34 μg/mL chloramphenicol at 131 37°C shaking at 200 rpm until an OD600 of 0.6 – 0.8 was reached. Production of recombinant Pta 132 was induced by addition of isopropyl-β-D-thiogalactopyranoside to a final concentration of 1 133 mM. 134

Following overnight incubation at ambient temperature, cells were harvested by 135 centrifugation. Cells were resuspended in Buffer A (25 mM Tris, 150 mM NaCl, 25 mM 136 imidazole, 10% glycerol; pH 7.5), disrupted by three passages through a chilled French pressure 137 cell at 138 mPa, and centrifuged at 100,000 x g for 90 minutes at 4°C. The supernatant was 138 applied to a HisTrapTM HP Ni2+ affinity column (GE Healthcare, Inc.) equilibrated with Buffer 139 A. The protein was eluted using a linear gradient from 25 mM to 500 mM imidazole in 25 mM 140 Tris-HCl, 150 mM NaCl, and 10% glycerol (pH 7.5). Fractions with Pta activity were pooled and 141 dialyzed against buffer containing 25 mM Tris-HCl and 10% glycerol (pH 7.5). The recombinant 142 enzyme was determined to be electrophoretically pure by SDS-PAGE. The protein concentration 143 for purified PrPtaII1 was calculated from the absorbance at 280 nm using an extinction 144 coefficient of 36,330 M-1cm-1. 145 146 Activity Assays 147

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

8

PrPtaII1 activity in the acetyl-CoA forming direction was measured by monitoring the 148 increase in absorbance at 233 nm due to thioester bond formation (ε233 nm = 5.55 mM-1 cm-1) 149 (20, 21). The reaction mixture contained 50 mM Tris (pH 7.5), 20 mM KCl, 20 mM NH4Cl, 1 150 mM DTT, and the concentrations of acetyl phosphate and CoA were varied. Activity in the 151 acetyl phosphate forming direction was measured with two different assays. The thioester assay 152 monitors the decrease in absorbance at 233 nm due to the release of CoA (ε233 nm = 4.44 mM-1 153 cm-1) (22), and the Ellman’s thiol assay monitors the increase in absorbance at 412 nm due to the 154 formation of the thiophenolate anion with DTNB [5',5-dithiobis(2-nitrobenzoic acid); ε233 nm = 155 14,150 M-1 cm-1] (20, 21). The reaction mixtures for both assays contained 50 mM Tris (pH 7.5), 156 20 mM KCl, 20 mM NH4Cl, 1 mM DTT, 1 mM DTNB, and the concentrations of acetyl-CoA 157 and Pi were varied. Reaction mixtures for all assays were pre-incubated for 3 minutes at 37°C. 158 Reactions were initiated by the addition of enzyme and were performed in triplicate. 159

SePtaII activity in the acetyl-CoA forming direction was measured by monitoring the 160 increase in absorbance at 233 nm. The reaction mixture contained 50 mM Tris (pH 7.5), 40 mM 161 NH4Cl, 1 mM CoA, and 3 mM acetyl phosphate. Reaction mixtures containing acetyl phosphate 162 and enzyme were pre-incubated for 1 min at 37°C, and reactions were initiated by the addition of 163 CoA. All reactions were performed in triplicate. 164

Assays were performed in 96-well plates and the absorbance was monitored using the 165 Synergy HT Multi-mode Microplate Reader (BioTek Instruments, Inc.). Data are expressed as 166 mean ± S.D. 167 168 Kinetic Analysis 169

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

9

To determine apparent kinetic parameters for PrPtaII1 in the acetyl-CoA forming 170 direction, the concentration of one substrate was varied while the second substrate was held 171 constant at saturating concentration (determined to be 4 mM for CoA and 5 mM for acetyl 172 phosphate). KaleidaGraph (Synergy Software) was used to fit the data to the Michaelis-Menten 173 equation [Equation 6], where V0 is initial velocity, [S] is substrate concentration, V is maximum 174 velocity, and Km is the Michaelis constant. 175

[Eq. 6] = × [ ]/( + [ ]) 176 When acetyl phosphate was varied, the data displayed positive cooperativity when fit to the Hill 177 equation [Equation 7] (35, 36), where K0.5 is the substrate concentration at half maximal velocity 178 and h is the Hill constant. 179

[Eq. 7] = × [ ] /( . + [ ] ) 180 181 Determining IC50 Concentration 182 Metabolic intermediates, coenzymes, and nucleotide triphosphates were tested as 183 allosteric effectors of PrPtaII1and SePtaII. Substrate concentrations were held at saturating 184 conditions, and effector molecule concentrations were varied from 3 μM to 3 mM. Half maximal 185 inhibitory concentrations (IC50) were determined for all PrPtaII1 and SePtaII allosteric inhibitors 186 by measuring the decrease in activity as a function of increasing inhibitor concentration. IC50 187 values were determined using GraphPad Prism 5 (GraphPad Software, Inc.) by fitting the data 188 with a log [inhibitor] vs. response curve. 189 190 Site-directed Mutagenesis 191

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

10

The QuikChange® Lightning Site-Directed Mutagenesis kit (Stratagene, Inc.) was used 192 for mutagenesis according to the manufacturer’s instructions. Primers used in the alteration of 193 the Gly-300 codon are as follows: 5’PrPTAG300D, 194 CACCTGAAAAAATATAAAGACGACGCGATGATTATCACCAGTGGT; 3’PrPTAG300D, 195 ACCACTGGTGATAATCATCGCGTCGTCTTTATATTTTTTCAGGTG; 5’PrPTAG300A 196 CACCTGAAAAAATATAAAGACGCGGCGATGATTATCACCAGTGGT; 3’PrPTAG300A 197 ACCACTGGTGATAATCATCGCCGCGTCTTTATATTTTTTCAGGTG. Alterations were 198 confirmed by sequencing at the Clemson University Genomic Institute (CUGI). 199 200 Gel Filtration Chromatography 201 The native molecular mass of recombinant PrPtaII1 was examined by gel filtration 202 chromatography using an ÄKTA Fast Protein Liquid Chromatography (FPLC) system with a 203 Superose 12 column (GE Healthcare). The gel filtration column was calibrated with cytochrome 204 C (12.4 kDa), carbonic anhydrase (29 kDa), albumin (66 kDa), amylase (200 kDa), apoferritin 205 (443 kDa), and thyroglobulin (669 kDa) (Sigma Aldrich Co.). The column was equilibrated with 206 buffer containing 50 mM Tris and 150 mM KCl (pH 7.5) and developed at a rate of 0.5 mL/min.207

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

11

RESULTS 208 Discovery of the Different Subclasses of PtaII 209

The Pta enzyme family has previously been divided into two classes (20). PtaI enzymes 210 are approximately 350 amino acids long and consist of only a catalytic domain. PtaII enzymes are 211 approximately twice the size, with a C-terminal catalytic domain and an N-terminal regulatory 212 domain (20, 21). Although Pta was commonly considered to be a bacterial enzyme, sequences 213 have now been identified in the Eukarya (14). To determine how widespread the Pta enzyme 214 family is in this domain, searches of the sequence databases were performed using the 215 Methanosarcina thermophila PtaI sequence as the query. Pta sequences were identified in a 216 number of eukaryotes such as green algae, lycophytes, moss, and oomycetes, but were absent in 217 fungi, diatoms, higher plants, and metazoans. Every completed eukaryotic genome that has a Pta 218 sequence also has an ORF with identity to Ack, consistent with these enzymes acting as a 219 pathway as in bacteria. In a phylogeny of Pta sequences constructed based on the catalytic 220 domain, the PtaII sequences form a separate clade (Figure 1). All of the eukaryotic sequences 221 belong to the PtaII class except for those from Perkinsus marinus, Emiliana huxleri, and 222 Thecomonas trahens. The P. marinus PtaI is a single domain enzyme, whereas the E. huxleyi and 223 T. trahens Pta sequences (shown in red in Figure 1) are multi-domain enzymes, but are 224 considered to be a PtaI rather than PtaII because the Pta catalytic domain is fused to Ack rather 225 than an N-terminal regulatory domain as for the PtaII enzymes. The E. huxleyi enzyme has just 226 the Pta and Ack domains, whereas the T. trahens Pta has four domains: a domain of unknown 227 function, an Ack domain, a Pta domain, and a poly(R)-hydroxyalkanoic acid synthase domain. 228

The N-terminal regulatory domains of EcPtaII and SePtaII contain two recognizable 229 subdomains designated as the P-loop and the DRTGG subdomains (21). The P-loop NTPase 230

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

12

subdomain contains a conserved nucleotide triphosphate-binding motif similar to that found in 231 enzymes involved in translation, transcription, intracellular trafficking, membrane transport, and 232 DNA replication and repair (37). The DRTGG subdomain has an unknown function, but is 233 named after some of its most conserved residues. This domain is related to the cystathione-beta-234 synthase domain (CBS) that exists in both membrane-bound and cytosolic proteins, and is known 235 to function in eukaryotes, prokaryotes, and archaea (38). 236

Although the PtaII N-terminal domains are similar in size, analysis of their sequences has 237 revealed four subclasses based on the presence or absence of the P-loop and DRTGG 238 subdomains (Figure 2). The PtaIIa N-terminal domain includes both subdomains, whereas the 239 PtaIIb, PtaIIc, and PtaIId subclasses lack one or both subdomains. The majority of PtaII sequences 240 belong to the PtaIIa subclass, with PtaIIb, PtaIIc, and PtaIId sequences distributed infrequently 241 throughout the phylogeny. Surprisingly, the two C. reinhardtii PtaII enzymes belong to two 242 different subclasses, PtaIId and PtaIIc. 243 244 Purification and Molecular Properties of PrPtaII1 245 The genome of P. ramorum (http://genome.jgi-psf.org/Phyra1_1/Phyra1_1.home.html) 246 has two PtaIIa ORFs, designated as PtaII1 (Protein ID 78441) and PtaII2 (Protein ID 78440). An E. 247 coli codon-optimized gene encoding PrPtaII1 (GenScript Inc.) was cloned into pET21b (C-248 terminal His tag), and the recombinant enzyme was produced in E. coli and purified by nickel 249 affinity chromatography to electrophoretic homogeneity. In determining optimal reaction 250 conditions for PrPtaII1, we tested the requirement for KCl and NH4Cl, as other PtaII enzymes 251 have been shown to have increased activity in the presence of one or both salts (20, 21). 252 Maximum activity was observed in the presence of 20 mM NH4Cl and 20 mM KCl, and both 253

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

13

salts are required. Increasing the concentration of either or both salts does not further increase 254 enzyme activity. Optimal activity also requires the presence of 1 mM DTT final concentration. 255 PrPtaII1 has highest activity at 37°C; therefore, all experiments were conducted at 37°C. Due to 256 aggregation issues, the molecular mass of the enzyme could not be determined by gel filtration. 257 Brinsmade and Escalante-Semerena (20) encountered similar discrepancies with the S. enterica 258 Pta. 259 260 Kinetic Analysis of PrPtaII1 261 In determining kinetic parameters for PrPtaII1 in the acetyl-CoA/Pi – forming direction, 262 plots of substrate concentration versus velocity were sigmoidal. Apparent kinetic parameters 263 were determined by fitting the experimental data to the Hill equation (Eq. 7) in which a Hill 264 constant (h) greater than 1.0 represents positive cooperativity and a Hill constant less than 1.0 265 represents negative cooperativity (39, 40). PrPtaII1 exhibited positive cooperativity (h = 1.75 ± 266 0.18) with acetyl phosphate and slight positive cooperativity (h = 1.04 ± 0.05) with CoA (Table 267 1). The maximum activity observed in the acetyl phosphate/CoA-forming direction is 268 approximately three-fold lower than that in the acetyl-CoA/Pi-forming direction (8.9 ± 0.5 μmol 269 min-1 mg-1 versus 23.8 ± 0.7 μmol min-1 mg-1, respectively), but kinetics parameters could not be 270 determined in this direction due to an inability to reach saturation with inorganic phosphate. 271 272 Allosteric Regulation of the PtaIIa Enzyme Family 273 Although the catalytic domains of all Pta enzymes share strong identity (e.g., the catalytic 274 domains of PrPtaII1 and SePtaII share 52.0% identity), the N-terminal domains within a subclass 275 can differ substantially. The PrPtaII1 N-terminal domain shares only 19% identity with the N-276

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

14

terminal domains of the E. coli and S. enterica PtaIIa enzymes, raising the question of whether 277 this eukaryotic Pta is subject to similar allosteric regulation as the bacterial PtaII enzymes. We 278 tested nucleotides, coenzymes, and metabolic intermediates from both the glycolytic pathway 279 and citric acid cycle as effector molecules of PrPtaII1. NAD+, NADH, NADP, and NADPH were 280 potent inhibitors, with NADP having the strongest effect (Figure 3A). ATP, ADP, AMP, PEP, 281 and pyruvate were also found to inhibit activity (Figure 3B), but to a lesser extent than the 282 nicotinamide derivatives. Fructose-1,6-bisphosphate (1 mM), oxaloacetate (1 mM), α-283 ketoglutarate (1.5 mM), and citrate (1.5 mM) had no effect on PrPtaII1activity. 284 Although SePtaII and EcPtaII were shown to be allosterically regulated (20, 21), only 285 ATP, NADH, PEP and pyruvate were examined for EcPtaII, and only pyruvate and NADH were 286 tested in the acetyl phosphate-forming direction for SePtaII. IC50 values were not reported for 287 EcPtaII and the IC50 values for SePtaII were reported only in the acetyl phosphate/CoA – forming 288 direction. To allow direct comparison between the eukaryotic and bacterial enzymes, 289 recombinant SePtaII was produced and purified and the effects of ATP, AMP, NADP, NADH, 290 and PEP on SePtaII enzymatic activity were determined in the acetyl-CoA/Pi – forming direction 291 and IC50 values were determined (Table 2). Our results show that both SePtaII and PrPtaII1 are 292 regulated by the same allosteric effectors although the potency differed. 293

Because NADP was the most potent inhibitor for PrPtaII1, we evaluated its effect on 294 substrate affinity. The Km values for CoA were relatively unchanged by the presence of 295 increasing concentrations of NADP but the Vmax decreased (Figure 4A), suggesting mixed 296 inhibition by NADP towards CoA. The K0.5 values for acetyl phosphate increase and the 297 cooperativity decreases as the NADP concentration is increased (Figure 4B), indicating that 298 NADP has a direct effect on the affinity of PrPtaII1 for acetyl phosphate. 299

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

15

For PrPtaII1, activity steadily decreases as AMP concentration is increased, similar to the 300 behavior observed with other PrPtaII1 effectors. AMP has a much different effect on SePtaII, 301 resulting in activation of the enzyme when present at low concentrations and inhibition at higher 302 concentrations. SePtaII has 28% higher activity in the presence versus absence of 30 µM AMP 303 (Figure 5); however, as the concentration of AMP was increased to 100 µM, the activity 304 returned to the level observed in the absence of effector. Activity is inhibited further as the AMP 305 concentration is increased, with approximately 50% inhibition in the presence of 1 mM and 306 complete loss of activity at 3 mM AMP. Pyruvate also has an unusual biphasic effect on SePtaII 307 activity (Figure 5). In the presence of 50 µM pyruvate, activity was 133% that observed in the 308 absence of pyruvate. However, as pyruvate concentration was increased further to 100 µM, 309 activity began to decrease and inhibition was observed in the presence of 500 µM pyruvate. 310

311 Analysis of PrPta1G300D and PrPta1G300A 312 Brinsmade and Escalante-Semerena (20), using a S. enterica knockout mutant for acetyl-313 CoA synthetase (Acs), screened for Pta variants that supported growth of this mutant on 10 mM 314 acetate, conditions in which Acs would normally be responsible for acetate activation to acetyl-315 CoA. They isolated ten single amino acid variants, for which the mutations all mapped to the N-316 terminal regulatory domain of PtaII. Three of the variants (R252H, G273D, and M294I) displayed 317 altered responses to at least one of the allosteric effectors. Differences in substrate affinities 318 between the wild type and variant enzymes were minor. A G273D variant had approximately two-319 fold increased Vmax in the acetyl-CoA/Pi – forming direction and three-fold increased Vmax in the 320 acetyl phosphate/CoA – forming direction. This variant also showed approximately three-fold 321 stimulation by pyruvate versus 1.2-fold stimulation for the wild type enzyme, but remained 322

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

16

subject to strong inhibition by NADH (20). This Gly residue is conserved in both PrPtaII1 and 323 PrPtaII2, unlike the other two residues identified that altered the wild type SePtaII response to 324 allosteric regulators. 325 To investigate the role of the conserved Gly residue in allosteric regulation of PrPtaII1, 326 we targeted the corresponding residue Gly300 for alteration. The G300A variant was soluble but 327 was not active in either direction of the reaction. This result suggests that either this alteration 328 resulted in complete loss of activity or that the structural integrity of the protein was 329 compromised but not so severely that it was no longer soluble. Kinetic analysis of the PrPtaII1 330 G300D variant revealed a nearly 450-fold reduction in the catalytic rate in the acetyl-CoA forming 331 direction (Table 1) and activity was completely abolished in the acetyl phosphate forming 332 direction, indicating the importance of this residue in catalysis. A slight decrease in the K0.5 for 333 acetyl phosphate and a four-fold decrease in the K0.5 for CoA were observed for the G300D 334 variant versus the wild type enzyme. The kcat/K0.5 value for each substrate decreased 335 significantly, with a 420-fold decrease for acetyl phosphate and a 110-fold decrease observed for 336 CoA (Table 1). This alteration resulted in increased substrate cooperativity for both CoA and 337 acetyl phosphate. The Hill constant for CoA increased by half, and that for acetyl phosphate 338 increased 3.7-fold versus the wild type (Table 1). 339 We analyzed the effect of several allosteric inhibitors on the PrPtaII1 G300D variant and 340 found that the IC50 values for ATP, AMP, and NADH decreased approximately five-fold versus 341 the wild type, whereas only a 1.6-fold decrease was observed for NADP (Table 2). A nearly 14-342 fold decrease was observed in the IC50 for PEP (Table 2). Interestingly, nearly 50% inhibition 343 was observed with 50 µM pyruvate, but activity increased as the pyruvate concentration was 344 increased. At 1 mM pyruvate, enzyme activity had reached the uninhibited level and by 3 mM 345

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

17

pyruvate concentration activity was 124% that of the control (Figure 6). The EC50 for pyruvate 346 was determined to be 503 ± 24 µM. 347 348 349

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

18

DISCUSSION 350 Phylogenetic analysis of Pta sequences shows that PtaI and PtaII sequences form separate 351

clades (Figure 1). Notably, nearly all of the eukaryotic enzymes belong to the PtaII class, 352 whereas both PtaI and PtaII enzymes are well represented in the bacteria. In fact, E. coli and S. 353 enterica possess both PtaI and PtaII enzymes. Based on these distributions and what is currently 354 known about the roles of Pta in various bacteria and Chlamydomonas, it is difficult to determine 355 what dictates whether an organism is more likely to have at PtaI or a PtaII. 356

Our sequence analysis of the regulatory domain of PtaII enzymes has revealed four 357 subclasses based on the presence or absence of the P-loop and DRTGG subdomains. Our 358 phylogeny indicates that the eukaryotic enzymes group together within the PtaII clade, and that 359 the eukaryotic PtaIIa sequences are clustered together. Both of the P. ramorum PtaII sequences 360 belong to this subclass and fall within this cluster. 361

Like P. ramorum, Chlamydomonas reinhardtii and Volvox carteri also have two PtaII 362 enzymes. However, Pat2 from C. reinhardtii lacks the DRTGG subdomain and thus belongs to 363 the PtaIIc subclass, whereas Pat1 lacks identity to either subdomain within the N-terminus and is 364 classified as a PtaIId. The V. carteri PtaII sequences both belong to PtaIIc and are most closely 365 related to the P. ramorum enzymes. The PtaIIa subclass is the most prevalent, followed by PtaIId. 366 The infrequent number of PtaIIb and PtaIIc sequences and their distribution throughout the 367 phylogeny suggests these subclasses arose recently and sporadically through the loss of domains. 368

Yang et al. (41) have shown that the C. reinhardtii Pta enzymes have different 369 localization, with Pat1 localized to mitochondria and Pat2 localized to chloroplasts. That these 370 two enzymes belong to different subclasses most likely reflects different regulatory requirements 371 in each organelle. The presence of two Pta enzymes in P. ramorum may also indicate different 372

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

19

cellular localization. However, that they both belong to the IIa subclass suggests that both are 373 similarly regulated. 374

It is interesting to note that although Pta has been identified in the oomycete 375 Phytophthora and in the green alga Chlamydomonas, it has not been identified in other 376 stramenopiles such as the diatoms. A search of diatom sequences revealed an Ack sequence in 377 Phaeodactylum tricornutum; however, the only gene encoding an Ack partner enzyme present in 378 that genome is that of xylulose 5-phosphate/fructose 6-phosphate phosphoketolase (Xfp), the 379 partner enzyme for Ack in euascomycete and basidiomycete fungi. No ORFS for Ack or Pta 380 have been identified in any other diatom sequences available. 381

382 Eukaryotic PtaII versus Bacterial PtaII 383

Our characterization of PrPtaII1 allowed us to investigate the similarities and differences 384 between bacterial and eukaryotic PtaII enzymes and provides us with a better overall picture of 385 the regulation of this subclass. PrPtaII1, SePtaII, and EcPtaII all display positive cooperativity but 386 for different substrates. SePtaII and PrPtaII1 display positive cooperativity for acetyl phosphate 387 but little or no cooperativity for CoA, whereas EcPtaII displays positive cooperativity for CoA 388 but not for acetyl phosphate. 389

As EcPtaII and SePtaII are both allosterically regulated (20, 21), we examined whether 390 PrPtaII1 is also subject to allosteric regulation and if the same metabolites are effectors for all 391 three enzymes. ATP, NADH, PEP and pyruvate were previously shown to be inhibitors of 392 EcPtaII (21), and we have now shown that they are also inhibitors of SePtaII and PrPtaII1, 393 although the order of potency of these inhibitors differs. We have also found that AMP 394 influences both SePtaII and PrPtaII1 activity but in different ways. AMP inhibits PrPtaII1 but 395

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

20

activates SePtaII at lower concentration and then inhibits activity at higher concentrations. AMP 396 has a similar effect on glycogen phosphorylase (42). At low concentrations, AMP acts as a 397 strong activator by binding to a site close to the subunit interface and increasing release of 398 glucose 1-phosphate from glycogen (43, 44). At higher concentrations, AMP binds to the ATP 399 inhibitor site (45, 46) located at the entrance to the channel to the catalytic site (46), resulting in 400 inhibition. By analogy, this may suggest that AMP and ATP bind at separate effector sites on 401 SePtaII. 402

It is surprising that both Pta enzymes studied here display negative regulation by both 403 NAD(P) and NAD(P)H and ATP, ADP, and AMP. Typically, an enzyme would be expected to 404 respond differently to signals of high versus low cellular energy or the redox indicator pairs, 405 rather than to all of them. One possible explanation is that the regulatory domain signals a 406 response to one set of signals (e.g., ATP and NADH) and the C-terminal catalytic domain is 407 regulated by the opposite signals. However, no such regulation of Class I Pta enzymes that 408 consist of just the catalytic domain have been reported, so it is difficult to speculate further on 409 this at this time. 410

411 The Role of the P-loop and DRTGG Subdomains in Catalysis and Allosteric Regulation 412 Through analysis of EcPtaII truncations, Campos-Bermudez et al. (21) demonstrated that 413 the N-terminal domain is required for maximal catalytic activity and that the P-loop subdomain 414 is required for the regulation of the enzyme by metabolic effector molecules. Using a positive 415 selection method to identify Pta variants that allow S. enterica growth on low acetate 416 concentrations in an acs mutant, Brinsmade and Escalante-Semerena (20) identified three single 417 amino acid variants altered in the N-terminal domain for which regulation by allosteric effectors 418

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

21

differs. Of particular interest is the G273D SePtaII variant, which displayed much stronger 419 activation by pyruvate than the wild type enzyme but similar inhibition by NADH (20). This 420 glycine is located in the DRTGG subdomain and is conserved among all PtaIIa and PtaIIb 421 enzymes, including both enzymes from P. ramorum. 422

We altered Gly300, the equivalent residue in PrPtaII1, to Ala and Asp to investigate 423 whether this enzyme is regulated similarly to SePtaII. The G300A variant lacked activity in either 424 direction, and the G300D variant had greatly reduced activity in the acetyl-CoA/Pi – forming 425 direction and no activity in the acetyl phosphate/CoA forming direction. With the exception of 426 pyruvate, each allosteric effector had a similar effect on activity of the PrPtaII1 G300D variant as 427 for the wild type, although IC50 values were reduced. Remarkably, pyruvate enhanced activity of 428 the variant in the acetyl-CoA/Pi-forming direction. However, activity was still very low in the 429 opposite direction. In the corresponding SePtaII variant, this alteration greatly stimulated activity 430 in the acetyl phosphate/CoA forming direction. This result demonstrates that residue G300 in the 431 DRTGG subdomain of the N-terminal regulatory domain is important across both bacteria and 432 eukaryotes in how the enzyme reacts to the presence and absence of pyruvate. In addition, our 433 results suggest that residues within the regulatory domain may also play a catalytic role, since the 434 G300A variant lacks activity and the G300D variant has reduced activity in one direction and 435 activity in the other direction was abolished, both in the absence of any effector molecules. 436

437 A Possible Physiological Role for Pta in Phytophthora 438

439 440

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

22

Our knowledge of Pta and its physiological role has largely been limited to bacterial 441 enzymes. The Pta-Ack pathway has been shown to be essential for growth and invasion in 442 several pathogenic bacteria, including Vibrio cholera (47), uropathogenic E. coli (48), S. enterica 443 (49), and Listeria monocytogenes (50). A eukaryotic Pta has not previously been characterized, 444 and the only report on the physiological role of a non-bacterial Pta is from the green algae 445 Chlamydomonas (19). 446

An important aspect to adapting to changing environments is the ability to use a variety 447 of carbon sources, including acetate. In addition to having the Ack-Pta pathway utilized by 448 bacteria to activate acetate under high acetate concentrations, P. ramorum also has the ubiquitous 449 AMP-forming acetyl-CoA synthetase (Acs) that a number of eukaryotic microbes use for acetate 450 activation. That PrPtaII1 preferentially operates in the acetyl-CoA/Pi-forming direction suggests 451 the physiological role for the Ack-PtaII1 pathway is in utilization of acetate as a carbon source. 452 Perhaps, these pathways function in Phytophthora as in the bacteria E. coli in which the high-453 affinity Acs pathway functions in acetate activation at low acetate concentrations and the low-454 affinity Ack-Pta pathway functions at high acetate concentrations (51, 52). However, there are no 455 reports in the literature investigating the ability of Phytophthora to utilize acetate as a carbon 456 source, leaving this question unanswered. 457

The presence of a second Pta raises the possibility that the two enzymes are specialized, 458 with PrPtaII2 operating in the acetyl phosphate/CoA-forming direction. Alternatively, PrPtaII2 459 may catalyze both directions of the reaction and metabolic effectors may regulate these activities 460 as well as the activity of PrPtaII1. The two P. ramorum Pta sequences share 82.3% identity 461 overall, with 91% identity between the catalytic domains and 75.6% identity in the N-terminal 462 domains. Thus, specialization in terms of directionality may not be as likely and the presence of 463

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

23

two Pta enzymes may instead reflect localization to different compartments within the cell, as 464 seen in Chlamydomonas. 465

466 Concluding Remarks 467

The PtaII class is much more complex than previously thought, with four subclasses, and 468 PtaIIa enzymes are subject to allosteric regulation by a number of effectors (53, 54). Regulation of 469 enzymes from the other three subclasses and further study of the N-terminal domain is needed. 470 An understanding of the regulation exerted by this domain would be greatly facilitated by having 471 a structure of a PtaII enzyme. 472

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

24

ACKNOWLEDGMENTS 473 This work was supported by awards from the National Science Foundation (Award# 0920274) 474 and the South Carolina Experiment Station Project SC-1700340, and represents Technical 475 Contribution #6242 of the Clemson University Experiment Station. 476

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

25

REFERENCES 477 478

1. Bubb WA, Wright LC, Cagney M, Santangelo RT, Sorrell TC, Kuchel PW. 1999. 479 Heteronuclear NMR studies of metabolites produced by Cryptococcus neoformans in 480 culture media: identification of possible virulence factors. Magn Reson Med 42:442-453. 481

2. Himmelreich U, Allen C, Dowd S, Malikic R, Shehan BP, Mountford C, Sorrell TC. 482 2003. Identification of metabolites of importance in the pathogenesis of pulmonary 483 cryptococcoma using nuclear magnetic resonance spectroscopy. Microbes and Infection 484 5:1427-1438. 485

3. Oura E. 1977. Reaction products of yeast fermentations. Process Biochem 12:19-21. 486 4. Mazet M, Morand P, Biran M, Bouyssou G, Courtois P, Daulouede S, Millerioux Y, 487

Franconi JM, Vincendeau P, Moreau P, Bringaud F. 2013. Revisiting the central 488 metabolism of the bloodstream forms of Trypanosoma brucei: production of acetate in 489 the mitochondrion is essential for parasite viability. PLoS Negl Trop Dis 7:e2587. 490

5. Montalvo FE, Reeves RE, Warren LG. 1971. Aerobic and anaerobic metabolism in 491 Entamoeba histolytica. Exp Parasitol 30:249-256. 492

6. Reeves RE, Warren LG, Susskind B, Lo HS. 1977. An energy-conserving pyruvate-to-493 acetate pathway in Entamoeba histolytica. Pyruvate synthase and a new acetate 494 thiokinase. J Biol Chem 252:726-731. 495

7. Tielens AG, van Grinsven KW, Henze K, van Hellemond JJ, Martin W. 2010. 496 Acetate formation in the energy metabolism of parasitic helminths and protists. Int J 497 Parasitol 40:387-397. 498

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

26

8. Fleck CB, Brock M. 2009. Re-characterisation of Saccharomyces cerevisiae Ach1p: 499 fungal CoA-transferases are involved in acetic acid detoxification. Fungal Genet Biol 500 46:473-485. 501

9. Marvin-Sikkema FD, Pedro Gomes TM, Grivet JP, Gottschal JC, Prins RA. 1993. 502 Characterization of hydrogenosomes and their role in glucose metabolism of 503 Neocallimastix sp. L2. Arch Microbiol 160:388-396. 504

10. Saz HJ, deBruyn B, de Mata Z. 1996. Acyl-CoA transferase activities in homogenates 505 of Fasciola hepatica adults. J Parasitol 82:694-696. 506

11. Steinbuchel A, Muller M. 1986. Anaerobic pyruvate metabolism of Tritrichomonas 507 foetus and Trichomonas vaginalis hydrogenosomes. Mol Biochem Parasitol 20:57-65. 508

12. Van Hellemond JJ, Opperdoes FR, Tielens AG. 1998. Trypanosomatidae produce 509 acetate via a mitochondrial acetate:succinate CoA transferase. Proc Natl Acad Sci U S A 510 95:3036-3041. 511

13. Atteia A, van Lis R, Gelius-Dietrich G, Adrait A, Garin J, Joyard J, Rolland N, 512 Martin W. 2006. Pyruvate formate-lyase and a novel route of eukaryotic ATP synthesis 513 in Chlamydomonas mitochondria. J Biol Chem 281:9909-9918. 514

14. Ingram-Smith C, Martin SR, Smith KS. 2006. Acetate kinase: not just a bacterial 515 enzyme. Trends Microbiol 14:249-253. 516

15. Akesson M, Karlsson EN, Hagander P, Axelsson JP, Tocaj A. 1999. On-line detection 517 of acetate formation in Escherichia coli cultures using dissolved oxygen responses to 518 feed transients. Biotechnol Bioeng 64:590-598. 519

16. Wolfe AJ. 2005. The acetate switch. Microbiol Mol Biol Rev 69:12-50. 520

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

27

17. Terashima M, Specht M, Naumann B, Hippler M. 2010. Characterizing the anaerobic 521 response of Chlamydomonas reinhardtii by quantitative proteomics. Mol Cell Proteomics 522 9:1514-1532. 523

18. Mus F, Dubini A, Seibert M, Posewitz MC, Grossman AR. 2007. Anaerobic 524 acclimation in Chlamydomonas reinhardtii: anoxic gene expression, hydrogenase 525 induction, and metabolic pathways. J Biol Chem 282:25475-25486. 526

19. Yang W, Catalanotti C, D'Adamo S, Wittkopp TM, Ingram-Smith CJ, Mackinder 527 L, Miller TE, Heuberger AL, Peers G, Smith KS, Jonikas MC, Grossman AR, 528 Posewitz MC. 2014. Alternative acetate production pathways in Chlamydomonas 529 reinhardtii during dark anoxia and the dominant role of chloroplasts in fermentative 530 acetate production. Plant Cell doi:10.1105/tpc.114.129965. 531

20. Brinsmade SR, Escalante-Semerena JC. 2007. In vivo and in vitro analyses of single-532 amino acid variants of the Salmonella enterica phosphotransacetylase enzyme provide 533 insights into the function of its N-terminal domain. J Biol Chem 282:12629-12640. 534

21. Campos-Bermudez VA, Bologna FP, Andreo CS, Drincovich MF. 2010. Functional 535 dissection of Escherichia coli phosphotransacetylase structural domains and analysis of 536 key compounds involved in activity regulation. FEBS J 277:1957-1966. 537

22. Lawrence SH, Ferry JG. 2006. Steady-state kinetic analysis of phosphotransacetylase 538 from Methanosarcina thermophila. J Bacteriol 188:1155-1158. 539

23. Lundie LL, Jr., Ferry JG. 1989. Activation of acetate by Methanosarcina thermophila. 540 Purification and characterization of phosphotransacetylase. J Biol Chem 264:18392-541 18396. 542

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

28

24. Lawrence SH, Luther KB, Schindelin H, Ferry JG. 2006. Structural and functional 543 studies suggest a catalytic mechanism for the phosphotransacetylase from 544 Methanosarcina thermophila. J Bacteriol 188:1143-1154. 545

25. Iyer PP, Ferry JG. 2001. Role of arginines in coenzyme A binding and catalysis by the 546 phosphotransacetylase from Methanosarcina thermophila. J Bacteriol 183:4244-4250. 547

26. Iyer PP, Lawrence SH, Luther KB, Rajashankar KR, Yennawar HP, Ferry JG, 548 Schindelin H. 2004. Crystal structure of phosphotransacetylase from the methanogenic 549 archaeon Methanosarcina thermophila. Structure 12:559-567. 550

27. Iyer PP, Lawrence SH, Yennawar HP, Ferry JG. 2003. Expression, purification, 551 crystallization and preliminary X-ray analysis of phosphotransacetylase from 552 Methanosarcina thermophila. Acta Crystallogr D Biol Crystallogr 59:1517-1520. 553

28. Grunwald NJ, Garbelotto M, Goss EM, Heungens K, Prospero S. 2012. Emergence 554 of the sudden oak death pathogen Phytophthora ramorum. Trends Microbiol 20:131-138. 555

29. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment 556 search tool. J Mol Biol 215:403-410. 557

30. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 558 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search 559 programs. Nucleic Acids Res 25:3389-3402. 560

31. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DJ. 1997. The Clustal 561 X windows interface: flexible strategies for multiple sequence alignment aided by quality 562 analysis tools. Nucl Acids Res 25:4876-4882. 563

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

29

32. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: 564 molecular evolutionary genetics analysis using maximum likelihood, evolutionary 565 distance, and maximum parsimony methods. Mol Biol Evol 28:2731-2739. 566

33. Rice P, Longden I, Bleasby A. 2000. EMBOSS: the European Molecular Biology Open 567 Software Suite. Trends Genet 16:276-277. 568

34. Finn RD, Mistry J, Tate J, Coggill P, Heger A, Pollington JE, Gavin OL, 569 Gunasekaran P, Ceric G, Forslund K, Holm L, Sonnhammer EL, Eddy SR, 570 Bateman A. 2010. The Pfam protein families database. Nucleic Acids Res 38:D211-222. 571

35. Hill AV. 1910. The possible effects of the aggregation of the molecules of haemoglobin 572 on its dissociation curves. J Physiol 40:iv-vii. 573

36. Motulsky H. 2004. Fitting Models to Biological Data Using Linear and Nonlinear 574 Regression: A Practical Guide to Curve Fitting: A Practical Guide to Curve Fitting. 575 Oxford University Press. 576

37. Leipe DD, Koonin EV, Aravind L. 2003. Evolution and classification of P-loop kinases 577 and related proteins. J Mol Biol 333:781-815. 578

38. Baykov AA, Tuominen HK, Lahti R. 2011. The CBS domain: a protein module with an 579 emerging prominent role in regulation. ACS Chem Biol 6:1156-1163. 580

39. Traut T. 2008. Allosteric Regulatory Enzymes doi:10.1007/978-0-387-72891-9. 581 Springer US. 582

40. Copeland RA. 2000. Enzymes: A Practical Introduction to Structure, Mechanism, and 583 Data Analysis, 2nd edition ed. Wiley-VCH. 584

41. Yang W, Catalanotti C, D'Adamo S, Wittkopp TM, Ingram-Smith CJ, Mackinder 585 L, Miller TE, Heuberger AL, Peers G, Smith KS, Jonikas MC, Grossman AR, 586

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

30

Posewitz MC. 2014. Alternative acetate production pathways in Chlamydomonas 587 reinhardtii during dark anoxia and the dominant role of chloroplasts in fermentative 588 acetate production. Plant Cell 26:4499-4518. 589

42. Black WJ, Wang JH. 1968. Studies on the allosteric activation of glycogen 590 phosphorylase b by Nucleotides. I. Activation of phosphorylase b by inosine 591 monophosphate. J Biol Chem 243:5892-5898. 592

43. Johnson LN, Stura EA, Wilson KS, Sansom MS, Weber IT. 1979. Nucleotide binding 593 to glycogen phosphorylase b in the crystal. J Mol Biol 134:639-653. 594

44. Stura EA, Zanotti G, Babu YS, Sansom MS, Stuart DI, Wilson KS, Johnson LN, 595 Van de Werve G. 1983. Comparison of AMP and NADH binding to glycogen 596 phosphorylase b. J Mol Biol 170:529-565. 597

45. Kasvinsky PJ, Madsen NB, Sygusch J, Fletterick RJ. 1978. The regulation of 598 glycogen phosphorylase alpha by nucleotide derivatives. Kinetic and x-ray 599 crystallographic studies. J Biol Chem 253:3343-3351. 600

46. Klinov SV, Kurganov BI. 2001. Combined kinetic mechanism describing activation and 601 inhibition of muscle glycogen phosphorylase b by adenosine 5'-monophosphate. Biophys 602 Chem 92:89-102. 603

47. Chiang SL, Mekalanos JJ. 1998. Use of signature-tagged transposon mutagenesis to 604 identify Vibrio cholerae genes critical for colonization. Mol Microbiol 27:797-805. 605

48. Anfora AT, Halladin DK, Haugen BJ, Welch RA. 2008. Uropathogenic Escherichia 606 coli CFT073 is adapted to acetatogenic growth but does not require acetate during murine 607 urinary tract infection. Infect Immun 76:5760-5767. 608

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

31

49. Kim YR, Brinsmade SR, Yang Z, Escalante-Semerena J, Fierer J. 2006. Mutation of 609 phosphotransacetylase but not isocitrate lyase reduces the virulence of Salmonella 610 enterica serovar Typhimurium in mice. Infect Immun 74:2498-2502. 611

50. Gueriri I, Bay S, Dubrac S, Cyncynatus C, Msadek T. 2008. The Pta-AckA pathway 612 controlling acetyl phosphate levels and the phosphorylation state of the DegU orphan 613 response regulator both play a role in regulating Listeria monocytogenes motility and 614 chemotaxis. Mol Microbiol 70:1342-1357. 615

51. Kumari S, Tishel R, Eisenbach M, Wolfe AJ. 1995. Cloning, characterization, and 616 functional expression of acs, the gene which encodes acetyl coenzyme A synthetase in 617 Escherichia coli. J Bacteriol 177:2878-2886. 618

52. Brown TD, Jones-Mortimer MC, Kornberg HL. 1977. The enzymic interconversion 619 of acetate and acetyl-coenzyme A in Escherichia coli. J Gen Microbiol 102:327-336. 620

53. Kuhn ML, Zemaitaitis B, Hu LI, Sahu A, Sorensen D, Minasov G, Lima BP, Scholle 621 M, Mrksich M, Anderson WF, Gibson BW, Schilling B, Wolfe AJ. 2014. Structural, 622 kinetic and proteomic characterization of acetyl phosphate-dependent bacterial protein 623 acetylation. PLoS One 9:e94816. 624

54. Weinert BT, Iesmantavicius V, Wagner SA, Scholz C, Gummesson B, Beli P, 625 Nystrom T, Choudhary C. 2013. Acetyl phosphate is a critical determinant of lysine 626 acetylation in E. coli. Mol Cell 51:265-272. 627

628 629 630 631

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

32

FIGURE LEGENDS 632 Figure 1. Phylogeny of PtaI and PtaII family. The phylogenetic tree was constructed based on 633 the sequences of the Pta catalytic domains. PtaI sequences are shown in black, PtaIIa sequences 634 are shown in blue, PtaIIb sequences are shown in purple, PtaIIc sequences are shown in green, and 635 PtaIId sequences are shown in pink. Only bootstrap value of 75% or higher are shown. 636 637 Figure 2. Subdomain Structure of the PtaI and PtaII classes. PtaI enzymes have just a 638 catalytic domain; PtaII enzymes have a catalytic domain and an N-terminal domain. Four 639 subclasses of PtaII enzymes have been identified based on the presence or absence of the P-loop 640 and DRTGG subdomains, as shown. Domains are not drawn to scale. 641 642 Figure 3. Regulation of PrPtaII1 by Allosteric Effectors. PrPtaII1 activity in the acetyl-CoA 643 forming direction was monitored in the absence and presence of allosteric effector molecules. All 644 data was normalized to the control, which represents the enzymatic activity observed in the 645 absence of effector molecule. (a) Results are displayed as percent activity in the presence of 100 646 μM and 750 μM NAD+, NADH, NADP, and NADPH. (b) Results are displayed as percent 647 activity in the presence of 100 μM and 750 μM ATP, ADP, and AMP, and 100 µM and 1000 µM 648 PEP and pyruvate. 649

650 Figure 4. Effect of NADP on CoA and Acetyl Phosphate Utilization by PrPtaII1 (a) 651 Enzymatic activity was measured in the acetyl-CoA forming direction in the presence of 5 mM 652 acetyl phosphate with varying concentrations of NADP using the thioester-forming assay. () 0 653 μM NADP, () 67.1 μM NADP, () 134.2 μM NADP. (b) Enzymatic activity in the acetyl-654

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

33

CoA forming direction was measured in the presence of 4 mM CoA with varying concentrations 655 of NADP using the thioester-forming assay. () 0 μM NADP, () 67.1 μM NADP, () 134.2 656 μM NADP. 657 658 Figure 5. AMP and Pyruvate Activate and Inhibit SePtaII in the Acetyl-CoA Forming 659 Direction. SePtaII activity in the acetyl-CoA forming direction was determined in the presence of 660 increasing concentrations of AMP () and pyruvate (). All data was normalized to the control, 661 which represents the enzymatic activity observed in the absence of effector molecule. Errors bars 662 are indicated for each value. 663 664 Figure 6. Alteration of the Gly300 Residue in PrPtaII1 Changes the Effect of Pyruvate. 665 Enzyme activity was determined in the presence of increasing amounts of pyruvate in the acetyl-666 CoA forming direction for PrPta1 () and PrPta1G300D (). Error bars are indicated for each 667 value. 668 669

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

34

TABLE 1. Kinetic parameters for PrPtaII wild type and the G300D variant in the acetyl-670 CoA-forming direction 671

Enzyme K0.5 CoA (mM)

K0.5 AcP (mM)

kcat/K0.5 CoA (sec-1 mM-1)

kcat/K0.5 AcP (sec-1 mM-1)

Hill constant CoA (h)

Hill constant AcP (h)

Wild type 1.05 ± 0.31 1.85 ± 0.14 35.1 ± 6.0 18.04 ± 1.26 1.04 ± 0.05 1.75 ± 0.18

G300D 0.24 ± 0.05 1.75 ± 0.10 0.32 ± 0.06 0.043 ± 0.001 1.50 ± 0.05 6.50 ± 1.76 672

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

35

TABLE 2. IC50 values for PtaII enzymes in the Acetyl-CoA direction 673 Effector Molecule PrPta IC50

(µM) PrPtaG300D IC50

(µM) SePta IC50

(µM) ATP 736 ± 6 133 ± 8 364 ± 19 AMP 287 ± 4 53 ± 2 ND

NADP 135 ± 4 81 ± 3 97 ± 8 NADH 275 ± 21 52 ± 2 24 ± 6

PEP 1018 ± 128 74 ± 4 67 ± 3 ND: IC50 could not be determined due to the biphasic response. 674

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

Catalytic Domain PTAI

Ploop DRTGG Catalytic Domain

DRTGG Catalytic Domain

Ploop Catalytic Domain

PTAIIa

PTAIIb

PTAIIc

Catalytic Domain PTAIId

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

on January 28, 2020 by guesthttp://ec.asm

.org/D

ownloaded from