Nucleotide sequence of the mitochondrial cytochrome oxidase subunit II gene in the yeast Hansenula saturnus

Current Genetics (1985) 9:351 360 Current Genetics © Springer-Verlag 1985

Nucleotide sequence of the mitochondrial cytochrome oxidase subunit II gene in the yeast Hansenula saturnus

Janet E. Lawson and Donald W. Deters

Department of Microbiology, University of Texas at Austin, Austin, Texas 78712 1095, USA

Summary. The gene for subunit II of cytochrome oxidase in the yeast Hansenula saturnus was previously shown to be located on a 1.7 kb HindIII-BamHI fragment of mitochondrial DNA (Lawson and Deters, accompanying paper). In this paper, we report the nucleotide sequence of a large part of this fragment, covering the coding region of the subunit II gene, designated coxlI, and its 5' and 3' flanking regions. The coding region ofthecoxII gene consists of a continuous open reading frame, 744 nucleotides long, containing 6 in frame TGA codons. Examination of the sequence and alignment with known homologous gene sequences of other organisms indicates that TGA codes for tryptophan in H. saturnus mitochondria as it does in several other mitochondria. Despite considerable homology to subunit II of Saccharomyces cerevisiae, there are 9 codons used in coxII that are not used in the corresponding S. cerevisiae gene. CTT, which is believed to code for threonine in S. cerevisiae mitochondria, appears 3 times in coxII and probably codes for leucine. While the CGN family is rarely, if ever, used in S. cerevisiae mitochondria, CGT appears 4 times in coxII and probably codes for arginine. The deduced amino acid sequence, excluding the first ten amino acids at the N-terminus, is 81% homologous to the amino acid sequence of the S. cerevisiae subunit II protein. The first ten amino acids at the N-terminus are not homologous to the N-terminus of the S. cerevisiae protein but are highly homologous to the first ten amino acids of the deduced amino acid sequence ofsubunit II of Neurospora crassa. Minor variations of a transcription initiation signal and an end of message or processing signal reported in S. cerevisiae are found in the regions flanking the H. saturnus coxII gene. The subunit II gene contains numerous symmetrical elements, i.e. palindromes, inverted repeats, and direct repeats. Some of these have conserved

Offprint requests to: D. W. Deters

counterparts in the S. cerevisiae subunit II gene, suggest- ing that they may be functionally or structurally important.

Key words: Mitochondrial gene - Hansenula saturnus mitochondria - Yeast mitochondria - Cytochrome oxidase

Introduction

The mitochondrial genome of many eukaryotic cells encodes several important mitochondrial polypeptides, including the apoprotein of cytochrome b, one or more subunits of the ATP synthetase, and the 3 largest subunits (I, II, and III) of cytochrome oxidase. The nucleotide sequence of the subunit II gene of cytochrome oxidase has now been determined in the yeast Saccharomyces cerevisiae and a few other eukaryotes (Fox 1979b; Comzzi and Tzagoloff 1979; Macino and Morelli 1983; Fox and Leaver 1981; Hiesel and Brennicke 1983; Bibb et al. 1981; Anderson et al. 1982, 1981). The amino acid sequence of the beef heart subunit has also been directly determined (Steffens and Buse 1979). Comparison of the nucleotide and amino acid sequences demonstrates that mammalian mitochondria do not adhere to the "universal" genetic code, but instead use TGA to code for tryptophan. In frame TGA codons also occur in several fungal coding sequences (Fox 1979b; Coruzzi and Tzagoloff 1979; Macino and Morelli 1983) but not in the plant sequences (Fox and Leaver 1981; Hiesel and Brennicke 1983). In S. cerevisiae, CTA and probably the entire CTN family, which codes for leucine in the universal code, specifies threonine (Bonitz et al. 1980; Li and Tzagoloff 1979), and ATA probably codes for methionine instead of isoleucine (Hudspeth et al.

352 J.E. Lawson and D. W. Deters: Cytochrome oxidase subunit II sequence

1982). In mammalian mitochondria ATA also specifies methionine, and AGG and AGA are termination condons instead of arginine codons (BarreU et al. 1980). Zea mays mitochondria adhere more closely to the standard code except that CGG probably codes for t ryptophan not arginine (Fox and Leaver 1981; Kroon 1983). Of those genes for cytochrome oxidase subunit II sequenced to date, only those o f certain plants contain an intron (Fox and Leaver 1981;Kao et al. 1984; Bonen et al. 1984).

Analysis of regions flanking the coding port ions of several mitochondrial genes has revealed a number o f other unique features ofmitochondr ia l genetic systems. A conserved nonanucleotide sequence appears to serve as a transcription initiation site (Osinga et al. 1984b), and a conserved dodecamer sequence may serve as a message terminator signal or a site where transcripts are processed to mature mRNAs (Osinga et al. 1984a; Michel 1984).

In the accompanying paper, we report the identifica- t ion and isolation o f the cytochrome oxidase subunit II gene, coxlI, of the petite negative yeast H. saturnus. In this paper, we present and discuss the nucleotide sequence of the subunit II gene. The sequence contains six in frame TGA codons, indicating that H. saturnus mitochondria also do not adhere to the universal genetic code. As in S. cerevisiae, the gene is AT rich, and although the derived amino acid sequence is homologous to that of S. cerevisiae, the genetic code and codon usage differ appreciably from those ofS. cerevisiae. The gene contains numerous direct and inverted repeats, some of which are

conserved in the S. cerevisiae gene.

with 250 t~l of 20% polyethylene glycol 6000 (PEG) in 2.5 M NaC1. To precipitate the phage, the samples were placed on ice for at least 30 rain and then centrifuged for 15 min at 12,000 rpm in an Eppendorf Microfuge. The PEG was drained from the tubes and the phage resuspended in 100 ~1 10 mM Tris-Cl (pH 7.5), 0.1 mM EDTA. Protein was removed by extraction with phenol, and the phage DNA was concentrated by precipitation with ammonium acetate and ethanol. DNA from a 3 ml culture was resuspended in 10 gl 10 mM Tris-cl (pH 7.5), 0.1 mM EDTA. A 2 #1 aliquot of each template was mixed with an equal volume of tracking dye solution containing 2.7 ml glycerol, 0.3 m110X TBE, 1 ml 1% SDS, 1 ml 0.5 M EDTA, 1 mg bromophenol blue and analyzed on a 1% agarose gel.

DNA sequencing. DNA sequencing reactions were carried out (Sanger et al. 1977), using the Bethesda Research Laboratories (BRL) M13 Sequencing Kit. Alpha labeled [35S]-dATP (Amer- sham) was used as a radioactive label, necessitating the following adjustments in the reaction conditions in addition to those recommended by BRL. The dideoxy ATP concentration was reduced to from 1/2 to 1/20 of the recommended amount, depending on the length of the fragment to be sequenced, and the sequencing reaction time was increased to 25 rain at 30 °C. Sequenced DNA was analyzed by electrophoresis on buffer gradient gels (Biggin et al. 1983). Gels were routinely run at 1,750 V, 30-35 W for 2.5 to 7.5 h. Gels were dried and exposed to Kodak SB-5 X-ray film for at least 12 h.

Sequence analysis. The sequence was analyzed by visual inspec- tion and by the use of computer programs developed by J. Pustell and purchased from International Biotechnologies, Inc.

Results

Subcloning and sequencing

Materials and methods

Cloning of yeast mitochondrial DNA into M13. Host E. coli strain • r F ' JM105 (Apro-lac, tht, strA, hsdRo~ endA, sbcB, traD36,

proA+B +, lacl q, lacZ AM15) (Felton 1983) was grown in 1.6% bacto~tryptone, 1% yeast extract, 0.5% NaC1. Cloning of mitochondrial DNA fragments into M13 derivatives mp18 and mpl9 was carried out as recommended (M13 Cloning and Sequencing Handbook, Amersham), but with the following modifications. 1.1 ~g of insert DNA (4 pmoles) and 0.8 pmoles/ml M13 DNA were used. Ligations were done at 15 °C for 5-10 h. The ligation buffer used was 50 mM Tris-C1 (pH 7.8), 10 mM MgC12, 20 mM dithiothreitol, 1 mM ATP. Colorless plaques were purified by stabbing the plaque and streaking the phage across an overlay plate containing 5-bromo-4-ehloro-3-indoyl-beta-D-galactoside (X-gaD, isopropylthio-beta-galactoside (IPTG), and fresh JM105 cells in the top layer. Replicative forms were isolated by the boiling method of plasmid isolation (Holmes and Quigley 1981) and screened for inserts by digestion with appropriate restriction enzymes.

Isolation of template DNA for sequencing. JM105 cells that were to be infected by the M13 derivatives were prepared by a 1 : 100 dilution of an overnight culture or by using an aliquot of a 3 h fresh culture inoculated from an overnight culture. Six to eight hours after the addition of phage to the ceils, bacterial ceils were removed by centrifugation and 1.5 mlof supernatant were mixed

Using the map of restriction sites previously obtained, small restriction fragments of the 1.7 kb H. saturnus DNA fragment were produced by digestion with EcoRI, EcoRI and HpalI, and TaqI and isolated from agarose gels (Lawson and Deters 1985)• The fragments were cloned into the phage M13 derivatives m p l 8 and m p l 9 at the appropriate restriction sites and sequenced. The sequencing strategy, approximate lengths of the segments sequenced, and the direction of sequencing are shown in Fig. 1. Each base was sequenced at least two times and an average of 4.5 times, and all cloning sites were crossed.

Features o f sequence

Homology to the oxiI gene of S. cerevisiae

A continuous stretch of 1,200 nucleotides was sequenced. This sequence, containing one long open reading frame o f 744 nucleotides, is printed in Fig. 2. The.other 5 possible reading frames do not appear to code for proteins, except as discussed below. The reading frame does not appear to be interrupted by introns. Given the absence

J. E. Lawson and D. W. Deters: Cytochrome oxidase subunit II sequence 353

H • • O i • I I I ' I I I "~

i

Fig. 1. Sequencing strategy of the cloned 1.7 kb HindllI-BamHI fragment of H. saturnus mitochondrial DNA containing the coxlI gene. The arrows represent the origin of sequencing, the direction of sequencing, and the approximate lengths of segments sequenced. The heavy black line indicates the position of the coding region of the gene, coxlI. Symbols used: H HindlII; B BamHI; solid triangles HpalI, solid squares Taql; solid circles EcoRl

of introns and given the codon assignments described later in this paper, the reading frame is predicted to code for a protein 247 amino acids long having a molecular weight of 27,944. The H. saturnus gene, called coxlI , is AT rich (71.2% AT). Extensive homology to the S. cerevisiae oxiI gene was expected since hybridization to the S. cerevisiae probe was demonstrated at a stringent 65 °C (Lawson and Deters accompanying paper). In fact, except for the first 30 nucleotides (42 for S. cerevisiae) of the coding region, coxlI is 80% homologous to the S. cerevisiae subunit II gene. The amino acid homology be-

-260 -250 -240 -230 -220 -210

AA GCT TAT ATA GTT TAA TGG TTA AAA CTA TTG TCT CAT ATG CAA TCA ATG TTC GGG TTC

-200 -190 -180 -170 -160 -150

AAA TCC CAC TAT AAG TAT ATA TAT TTA AAA CTG ATT GAT CTA TAT TAT TAA TAT TAG GAA

-140 -130- -120 -110 -i00 -90

TAT TAT TTG ACA TTA GTT TGA TTT CTT CCT GGC GGA GCC TTT TGC GTT GCC GGC ACG GTA

-80 -70 -60 -50 -40 -30

ATT AAA ATT GAA CTT ATG TTA ATT AAC CTA TAT TAA TAA TTA TAT AGA TAT TAT ATA TCT

-20 -I0 1 i0 20 30

AAA AAA TAA AAA AAA AAA TAA AAA GAA ATG TTA TTA TTA ATT AAT AAT TTA ATT TTA AAT H. saturnus Met Lou Leu Leu lie Asn Asn Leu lie Leu Asn S. cerevisiae Met Leu Asp Leu Leu Arg Leu Gin Leu Thr Thr Phe lie Met Ash

40 50 60 70 80 90

GAT GTT CCG ACA CCT TGA GGT TTA TAC TTC CAA GAT TCG TCA ACT CCA AAC CAA GAA GGT Asp Val Pro Thr Pro Trp Gly Leu Tyr Phe Gin Asp Ser Ser Thr Pro Asn Gin Glu Gly Asp Val Pro Thr Pro Tyr Ala Cys Tyr Phe Gin Asp Set Ala Thr Pro Ash Gin Glu Cly

I00 II0 120 130 140 150

ATT ATC GAA TTA CAT GAT AAT ATT ATG TrC TAC 1~rA GTA TTA ATC TTA TGT ¢TT GTA TCA lie lie Glu Leu His Asp Asn lie Met Phe Tyr Leu Val Leu lie Leu Cys Leu Val Set lle Leu Glu Leu His Asp Asn lie Met Phe Tyr Leu Leu Val lie Leu Gly Leu Val Set

160 170 180 190 200 210

TGA TTA TTA TTC AGT ATT GTT AAA GAT TCA AGT AAA AAT CCA TTA CCA CAT AAA TAT TTA Trp Leu Leu Phe Ser lie Val Lys Asp Set Ser Lys Asn Pro Leu Pro His Lys Tyr Leu Trp Met Leu Tyr Thr lie Val lie Thr Tyr Ser Lys Asn Pro lie Ala Tyr Lys Tyr lie

220 230 240 250 260 270

GTA CAT GGA CAA ACA ATT GAA ATT ATT TGA ACT ATT TTA CCT GCT GTA GTA TTA TTA ATT

Val His Gly Gin Thr lie Glu lie lie Trp Thr lie Leu Pro Ala Val Val Leu Leu lie Lys His Gly Gin Thr lie Clu Val lie Trp Thr lie Phe Pro Ala Val lie Leu Leu lie

280 290 300 310 320 330

ATT GCT TTC CCA TCA TTT ATC TTA TTA TAT TTA TGT GAT GAA GTT ATT TCT CCT GCA ATG lie Ala Phe Pro Ser Phe lie Leu Leu Tyr Leu Cys Asp Glu Val lie Ser Pro Ala Met lle Ala Phe Pro Ser Phe lie Leu Leu Tyr Leu Cys Asp Glu Val lie Ser Pro Ala lle

340 350 360 370 380 390

ACT ATT AAA GCT ATT GGA TTA CAA TGA TAC TGA CGT TAT GAA TAC TCA GAT TTC ATT AAT Thr lie Lys Ala lle Gly Leu Gin Trp Tyr Trp Arg Tyr GIu Tyr Ser Asp Phe lie Asn Thr lie Lys Ala lie Gly Tyr Gln Trp Tyr Trp Lys Tyr Glu Tyr Ser Asp Phe lie Asn

400 410 420 430 440 450

GAT TCA GGT GAA ACA ATT GAA TTC GAA TCA TAT GTT ATT CCT GAA GAT TTA TTA GAA GAT Asp Set Gly Glu Thr lie Glu Phe Glu Ser Tyr Val lie Pro Glu ASp Leu Leu Glu Asp Asp Set Gly Glu Thr Val Glu Phe Glu Ser Tyr Val lie Pro Asp Glu Leu Leu Glu Glu

Fig. 2. DNA sequence of the H. saturnus gene for cytochrome oxidase subunit II. The predicted amino acid sequence is written directly below the nucleotide sequence. For comparison, the amino acid sequence of the S. cerevisiae subunit II gene (Fox 1979b; Coruz- zi and Tzagoloff 1979) is included below the tl. saturnus amino acid sequence. The two amino acid sequences are aligned for maximum amino acid homology. For S. cerevisiae, ATA eodons are translated here as isoleucine as originally reported (see text) rather than as methionine


460 470

GGT CAA TTA CGT TTA TTA Gly Gin Leu Arg Leu Leu Gly Gin Leu Arg Leu Leu

520 530

CGT TTT ATT GTA TCA GCT Arg Phe lie Val Ser Ala Arg Phe Val Val Thr Ala

580 590

AAA GTT GTA GCT AGT CCT Lys Val Val Ala Ser Pro Lys Val Asp Ala Thr Pro

640 650

GTA TAT TAT GGG ATG TGC Val Tyr Tyr Gly Met Cys Val Phe Tyr Gly Ala Cys

700 710

ATT GAA GTA GTA TCA CTT lie Glu Val Val Ser Leu lle Glu Ala Val Ser Leu

760 770

ATT TTT ATG TAT ATT ATA

820 830

TAT TAA TTA TTT TAT ATA

880 890

CTA CTC TAA TTA AGA AAT

940 950

ATA ATA ATT ATT TAA AAT

Fig. 2. (Continued)

48O 490 500 510

GAT ACA GAT ACA TCT GTT GTA TGT CCT GTT AAT ACT CAT ATT Asp Thr Asp Thr Ser Val Val Cys Pro Val Ash Thr His lie Asp Thr Asp lhr Ser lie Val Val Pro Val Asp Thr His lle

540 550 560 570

GCT GAT GTT ATT CAT GAT TTT GCA ATT CCT TCA TTA GGA ATT Ala Asp Val Ile His Asp Phe Ala Ile Pro Ser Leu Gly Ile Ala Asp Val Ile His Asp Phe Ala Ile Pro Ser Leu Gly Ile

600 610 620 630

GGA CGT TTA AAC CAA GTA TCT GCA TTA ATT CAA AGA GAA GGG Gly Arg Leu Ash Gln Val Ser Ala Leu lie Gin Arg Glu Gly Gly Arg Leu Asn Gln Val Ser Ala Leu lie Gin Arg Glu Gly

660 670 680 690

TCG GAA CTT TGT GGC GTA GCA CAT TCC GCA ATG CCA ATA AAA Ser Glu Leu Cys Gly Val Ala His Ser Ala Met Pro Ile Lys Ser Glu Leu Cys Gly Thr Gly His Ala Asn Met Pro Ile Lys

720 730 740 750

AAA GAA TTC TTA ACA TGA TTA AAT GAA CAA TAA TAT ATA CAT Lys GIu Phe Leu Thr Trp Leu Asn Glu Gln --- Pro Lys Phe Leu Glu Trp Leu Asn Glu Gin ---

780 790 800 810

CTA AAT TAT CCA TAT TCC ATT ATA AAA TAA TAT TTT ATA TAT

840 850 860 870

AAT AAA AAA AAA ATG AAT ATT AAT AAT TTT AAA TAA ATA TAA

900 910 920 930

AGT ATT TTC ACC TTT TCA ATT ATG AAT AGG TGA TTT ATA TAA

ATG TTA GAT TTA TTA AGA TTA CAA TTA ACA ACA TTC ATT ATG AAT --- GAT GTA CCA S. cerevisiae Met Leu Asp Leu Leu Arg Leu Gin Leu Thr Thr Phe lle Met Asn --- Asp Val Pro

H. saturnus

N, crassa

ATG TTA TTA TTA ATT AAT AAT TTA ATT TTA AAT --- GAT GTT CCG Met Leu Leu Leu lie Asn Asn Leu lie Leu Asn --- Asp Val Pro

ATG GGA TTA TTA TTT AAT AAT TTA ATT ATG AAT TTT GAT GCT CCA Met Gly Leu Leu Phe Asn Ash Leu lie Met Asn Phe Asp Ala Pro

Fig. 3. Nucleotide and derived amino acid sequences of the N-termini of the H. saturnus, S. cerevisiae (Fox 1979b; Coruzzi and Tzagoloff 1979), and N. crassa (Macino and Morelli 1983) genes for subunit II of cytochrome oxidase. The second methionine found in the N. crassa and S. cerevisiae sequences is not present in the H. saturnus sequence. The dash lines indicate the absence of an amino acid in the H. saturnus and S. cerevisiae proteins compared to the N. crassa protein

tween the two subunits, excluding the first 10 amino acids of H. saturnus (14 for S. cerevisiae), is 81%. At the N-terminus, the homology of the derived amino acid sequence to the S. cerevisiae sequence is low (Fig. 3). Interestingly, as shown in Fig. 3, this portion of the H. saturnus sequence is highly homologous to the corresponding N-terminal sequence of the filamentous fungus Neurospora crassa (Macino and Morelli 1983).

The probable ATG initiation codon of the H. saturnus sequence lies four codons downstream from the position of the first ATG in the S. cerevisiae sequence, when the two sequences are properly aligned for maximum amino acid homology. Since the two coding sequences are identical in length beyond this point, the H. saturnus

protein is four amino acids shorter than the corresponding S. cerevisiae protein. Based on analysis of the nucleo-


TTT Phe 3 TCT Ser 3 TAT Tyr 6 TGT Cys 4

TTC Phe 7 TCC Ser I TAC Tyr 4 TGC Cys I

TTA Leu 31 TCA Ser I0 TAA --- I TGA Trp 6

TTG Leu 0 TCG Ser 2 TAG --- 0 TGG Trp 0

CTT Leu 3 CCT Pro 7 CAT His 6 CGT Arg 4

CTC Leu 0 CCC Pro 0 CAC His 0 CGC Arg 0

CTA Leu 0 CCA Pro 5 CAA Gin 8 CGA Arg 0

CTG Leu 0 CCG Pro 1 CAG Gin 0 CGG Arg 0

ATT lie 24 ACT Thr 4 AAT Asn 8 AGT Ser 3

ATC lie 3 ACC Thr 0 AAC Asn 2 AGC Ser 0

ATA lie I ACA Thr 6 AAA,Lys 7 AGA Arg 1

ATG Met 5 ACG Thr 0 AAG Lys 0 AGG Arg 0

GTT Val 8 GCT Ala 6 GAT Asp 13 GGT Gly 4

GTC Val 0 GCC Ala 0 GAC Asp 0 GGC Gly 1

GTA gal 13 GCA Ala 5 GAA Glu 15 GGA Gly 4

GTG Val 0 GCG Ala 0 GAG Glu 0 GGG Gly 2

coxlI, CTT is used three times. OxiI has a codon for leucine in all three of these positions (1 TTG, 2 TTA), so CTT probably codes for leucine in H. saturnus mitochondria. In contrast the entire CTN family, which probably codes for threonine in S. cerevisiae mitochondria (Li and Tzagoloff 1979; Bonitz et al. 1980; Kroon 1983), is not used at all in the S. cerevisiae gene. Similar- ly, in coxlI, CGT is used four times. Three of the corresponding four positions in the S. cerevisiae gene are AGA, codons for arginine, so in H. saturnus mitochondria, CGT probably codes for arginine. In contrast, none of the CGN family is used in the S. cerevisiae subunit II gene, and, in fact, this family is only rarely, if ever, used in S. cerevisiae mitochondrial genes. In S. cerevisiae and mammalian mitochondria, ATA codes for methionine instead of isoleucine (Hudspeth et al. 1982; Anderson et al. 1981; Kroon 1983). Because ATA is used only once in the H. saturnus coxII gene (position 688, Fig. 2), the amino acid specified by ATA in H. saturnus mitochondria remains uncertain. However, isoleucines are found at positions corresponding to position 688 in both the bovine (Steffens and Buse 1979) and S. cerevisiae subunit II.

Fig. 4. Apparent codon usage in the coxlI gene of H. saturnus. The codon TGA has been designated tryptophan

tide sequence it was not clear which of two ATG codons in the S. cerevisiae seqeunce is the initiation codon (Fox 1979b; Coruzzi and Tzagoloff 1979). Only one ATG is found in the H. saturnus gene; there is no ATG in the position corresponding to the second of the S. cerevisiae ATG codons.

Codon usage

The codon usage table for coxlI is pictured in Fig. 4. Six in frame TGA codons occur in the coxII gene; five of these six are conserved in the same position in S. cerevisiae. Thus, as in S. cerevisiae mitochondria (Fox 1979b; Coruzzi and Tzagoloff 1979), TGA undoubtedly codes for tryptophan in/-/, saturnus mitochondria.

Despite the high homology of the H. saturnus sequence to the S. cerevisiae gene at both the nucleotide and amino acid levels, the codon usage is not the same in the two organisms. For example, TAC, a tyrosine codon, is used four times in the H. saturnus sequence, but this codon is not used at all in the oxiI gene (subunit II gene in S. cerevisiae); instead oxiI uses TAT, the other codon for tyrosine, at each of these four positions. In

Possible end of message signal

Fifty-three bases downstream from the termination codon of coxII (position 797 to 807 in Fig. 2) is the sequence AATAATATTTT. This sequence differs by only one base from the sequence AATAATATTCTT previously proposed to be an end of message signal in S. cerevisiae mitochondria (Michel 1984; Osinga et al. 1984a). Slight variations of the sequence are found within 200 bases of 14 known or suspected protein coding genes in S. cerevisiae. The sequence may serve as a transcription termination signal or as an RNA processing point. In S. cerevisiae, the common transcript for subunit I of cytochrome oxidase and ATPase subunits 6 and 8 is cleaved at this sequence. The 3' ends of mRNAs for S. cerevisiae cytochrome oxidase subunits 1 and 2, ATPase subunit 9, cytochrome b, and the unidentified reading frame of the intron of the large rRNA gene map very close to the end of this dodecamer sequence (Osinga et al. 1984a).

Possible transcription initiation site

191 to 199 bases upstream of the coxII initiation codon is the sequence CTATAAGTA (Fig. 2). This sequence is only slightly different from the consensus sequence ATATAAGTA, which has been proposed to be a transcription start site in S. cerevisiae (Osinga et al. 1984a, b) and Kluyveromyces lactis mitochondria (Osinga et al. 1982).


Table 1. Palindromes of 8 or more bases in length found in the 1-1. mturnus coxlI gene, and palindromes found at identical or similar positions in the S. cerevisiae oxiI gene

Palindromes in H. saturnus coxlI Possible corresponding palindromes in S. cerevisiae oxiI

Position a Length Sequence Position a Length Sequence

6 16/16 ATTATTAATTAATAAT 12 10/11 AATTAA TAATT

110 10/10 ATAATATTAT 150 8/8 ATCATGAT 204 10/10 TAAATATTTA 386 10/10 TCATTAATGA

477 14/19 AG ATCATCTGTTGTATGT 525 12/13 ATCAGCTCGTGAT 596 8/8 GTTTAAAC 713 10/10 AAGAATTCTT

110 10/10 ATAATATTAT b

372 10/10 366 20/22

TGAATATTCA AAAATA TGAATATTCA GATTTT c

527 8/9 CAGCTGCTG b

a Position in nucleotide sequence if the H. saturnus amino sequence begins at 1, and the S. cerevisiae amino acid sequence begins at -12 (corresponding to position -414 (Fox 1979b) or position 1 (Coruzzi and Tzagoloff 1979)

b These palindromes contain the same nucleotide sequence and are found in the same position as the corresponding palindrome in H. saturnus

c This palindrome crosses the point at which the intron occurs in the Zea rnays gene for cytochrome oxidase subunit II (Fox and Leaver 1981)

Sequences flanking the probable initiation codon of cox l I

An unusual sequence o f 28 bases immediately precedes the cox l I gene in H. saturnus. Twenty-five out of the 28 bases are A, the last A of the stretch being the A in the probable ATG initiation codon (Fig. 2). Near the center o f the 28 bases is an uninterrupted run of eleven As. The corresponding region of the S. cerevisiae genome is AT rich, as are other intergenic regions, but it contains a total of only 11 As, no more than 4 in a row. This unusual A stretch may be ribosome binding site or a regulatory site. A similar poly A region is found 89 bases downstream from the end of the TAA stop codon of coxl l . Here, 13 of 14 bases are A, the last A again being the A of an ATG. Ten of the As are in an uninterrupted stretch. Although the reading frame following the ATG is closed by TAA codons, the sequence has a higher GC content than the nearby spacer regions flanking coxlI . In addition, just after the ATG in the A stretch downstream of coxl I (at position 8 5 0 - 8 6 0 in Fig. 2), there are 11 bases which are identical to an 11 base sequence that occurs just after the probable initiation codon (at position 13 to 23 of coxlI) . The A stretch and the 11 base perfect repeat suggest the possibility that this sequence is functional. It is possible that a small peptide is encoded by the sequence or that the sequence codes for the beginning of a transcript that is spliced. There are, however, other possibilities. Possible reading frames of unknown significance occur downstream of subunits II and III in S. cerevisiae mitochondria (Michel 1984).

Elements o f symmetry

Analysis o f the nucleotide sequence in the coding region of coxl I reveals that the gene contains a large number of perfect, or nearly perfect, palindromes, inverted repeats, and direct repeats. The S. cerevisiae oxtI sequence was scanned to see if any of these symmetrical elements are also present in corresponding positions in S. cerevisiae.

Features conserved in both organisms may be structurally or functionally important. Many of the inverted and direct repeats and palindromes found in coxlI are, in fact, conserved in oxiI.

An element o f symmetry is likely to be conserved in the coding region of a gene for one (or both) of two reasons. If it occurs in a region of the gene in which the nucleotide sequence itself is highly conserved, the amino acid sequences in these regions may be important, and thus the element of symmetry may be conserved in order to conserve the amino acid sequence. If, however, an inverted or direct repeat or palindrome occurs at a position where the nucleotide sequence is not particularly well conserved, or at a position slightly offset relative to that in a homologous gene in another organism, the symmetrical element may be conserved for other reasons (e.g. in the case of palindromes or inverted repeats, the possibility of folding into a secondary structure).

Palindromes. There are ten palindromes of eight of more bases in eoxlI , the longest being a 19 base palindrome. Seven of the ten are perfect palindromes, including one


Table 2. Examples of conserved inverted and direct repeats found in coxlI whose counterparts in oxfl do not contain the same nucleotide sequence and/or are displaced relative to the corresponding repeat in coxlI. Components of the inverted and direct repeats are underlined. Hs - H. saturnus, Sc - S. cerevisiae, Nc - N. crassa. The S. eerevisiae and H. saturnus sequences are aligned as in Table 1

ed another 6 bases on either end, resulting in a 20 out of 22 base palindrome which overlaps the position of the palindrome in coxII. It appears this palindrome may have been conserved for its structure, not base content, since the nucleotide sequences of the palindromes in the 2 organisms are not conserved.

1. Inverted repeats

a) 20 25 30 I I

Hs ATTTAATTTTAAATG ) <

Sc CATTCATTATGAATG ) <

Nc ATAATTTAATTATGAATT ) <

b) 560 570 580 I I I

Hs AATTCCTTCATTAGGAATTAAAGTTG

Sc TATCCCAAGTTTAGGTATTAAAGTTG ) <

2. Direct repeats

a) 30 35 I I

Hs TTAAATGAT

Sc ATGAATGAT )

725 730 735

ACATGATTAAATGA

GAATGATTAATGA )

b) 295 305 760

Hs TTATTATATTTATGT ... TTTTATGT ) )

Sc TTATTATATTTATGT ... TTATTATT ) )

of 16 bases. Three of the palindromes found in coxII

are conserved in oxiI (Table 1). Two of the conserved sequences in S. cerevisiae have exactly the same nucleotide sequence and code for the same amino acid sequence as coxII. In these two cases, it is therefore difficult to know whether the palindrome is conserved due to its structure, or conserved due to the amino acid sequence that is encoded. The third conserved palindrome occurs just after the point corresponding to where the intron is found in the subunit II gene in corn (Fox and Leaver 1981). This 10 base perfect palindrome in H. saturnus

begins at nucleotide 386 and ends at 395. In S. cerevisiae a perfect ten base palindrome begins at position 372 and ends at 381 in oxiI (numbering system based on aligning the first base of the coding region of oxiI with base -12 of coxII). Thus the coxII palindrome appears to be displaced relative to the oxiI palindrome. If one mismatch is allowed, the palindrome in S. cerevisiae can be extend-

Inverted repeats. Over 50% ofcoxII is made up of perfect inverted repeats of 7 or more bases. Several of these repeats are found in corresponding positions in the S. cerevisiae oxiI gene. Some of these conserved inverted repeats have the identical base sequence in equivalent positions in the two organisms, but there are cases in which the base sequence is not conserved. For example, at the beginning of the translated portion of the gene, the nucleic acid and amino acid homologies between coxlI and oxiI are low. However, both genes have an inverted repeat at identical positions (provided that proper alignment of the A of the probable initiation codon of the S. cerevisiae gene is made with position - 1 2 of the H. saturnus gene). In coxII, the halves of the 6 base inverted repeat are separated by 2 Ts, and in oxiI, the halves of a 7 base inverted repeat are separated by 1 T. A similar repeat is also found beginning three bases upstream of the corresponding position in the N. crassa subunit II gene. Here a 6 base inverted repeat is separated by one T (Table 2, 1.a). The fact that this structure is conserved in 3 organisms in a region where the S. cerevisiae sequence is not homologous to either the H. saturnus or N. crassa sequences suggests that this inverted repeat structure may be important.

An inverted repeat of 7 bases separated by five bases begins at position 555 in coxII (Table 2, 1 .b). A similar inverted repeat of 8 bases (with 1 mismatch) separated by 5 bases in observed in oxiI, but it is displaced 5 bases (it begins at position 560) relative to the inverted repeat in coxII. The second halves of both inverted repeats occur in a highly conserved region (15 out of 16 bases conserved), but different portions of this highly conserved region form the right half of the inverted repeats. This suggests that evolutionary constraints have operated to conserve this inverted sequence.

Direct repeats. There are approximately 45 pairs of perfect direct repeats of seven or more bases in coxII. The oxiI sequence was scanned to see if any of these repeats are conserved in both yeasts. The S. cerevisiae sequence contains over 50 pairs of direct repeats of 7 or more bases. Several of these correspond in location to direct repeats in the H. saturnus gene, a few because they contain identical base sequences. However, many of the direct repeats in S. cerevisiae are found in positions close to but not identical to the coxIl position and do not contain the same sequence. For example, an eight base sequence at position 28 in coxlI is repeated at position

358 J. E. Lawson and D. W. Deters: Cytochrome oxidase subunit II sequence

730. In oxiI, an 8 base sequence at position 30 (displaced 2 bases relative to the repeat in coxII) is repeated at position 724 (displaced six bases relative to coxII).

(Table 2, 2.a) The sequences of the 2 genes in these regions are similar, but a one base difference in the left half of the element appears to have been matched by base changes downstream in the right half of the element so as to preserve a direct repeat in the same general region on the gene.

A similar situation occurs at position 303 in H. saturnus and 295 in S. cerevisiae (Table 2, 2.b). The base sequence from 295 to 309 is identical in the two yeasts implying that the amino acid sequence at this point is important. But the fact that seven bases in this general area of the gene (not the same 7 bases in both organisms) are repeated downstream at a point which is just outside the coding region of the gene (11 bases after the TAA stop codon) is probably not accidental. The two sequences are not particularly homologous beyond the end of the coding region of the subunit II gene.

Discussion

The completion of the sequence of the H. saturnus coxlI

gene provides an opportunity to examine amino acid sequences of subunit II of cytochrome oxidase from two different yeasts. If the eleventh amino acid of the predicted amino acid sequence of the H. saturnus subunit II is aligned with the fifteenth amino acid of the S. cerevisiae protein, then the amino acid sequences to the C-termini are 81% homologous with no insertions or deletions. However, up to amino acid 11 (or 15 in S. cerevisiae), the sequences are not homologous. Curiously, the first ten amino acids of the H. saturnus protein are highly homologous to the first ten amino acids of cytochrome oxidase subunit II from iV. crassa (Macino and Morelli 1983), although the overall homology beyond that point between the N. crassa and H. saturnus sequences is only about 63% significantly less than the homology between the H. saturnus and S. cerevisiae sequences (81%). It seems remarkable that the H. saturnus

subunit II coding region is homologous to the S. cerevisiae

subunit II coding region throughout most of the sequence, except at the N-terminus, where it is highly homologous to the corresponding N. crassa sequence. This disparity at the N-terminus is unlikely to have a direct effect on the mature protein since in both N. crassa (Van den Boogart et al. 1982) and S. cerevisiae (Mannahaupt et al. 1983), subunit II is probably made as a precursor from which the N-terminus is post-translationally removed. However, this leader segment may be important in dictat- ing how the protein is directed to the membrane, processed, or assembled into a functional complex. Thus it seems possible that in certain aspects of membrane

assembly or precursor processing, H. saturnus may have more in common with N. crassa than with S. cerevisiae.

Several studies have shown that subunit II is a catalyti- cally important subunit of cytochrome oxidase. Anti- bodies to subunit II inhibit the activity of cytochrome oxidase (Poyton and Schatz 1975), and there are numerous mitochondrial mutants in the subunit II gene of S. cerevisiae that are deficient in cytochrome oxidase (Slonimski and Tzagoloff 1976; Fox 1979a; Cabral et al. 1978). Subunit II has been shown tomake up at least part of the binding site for cytochrome c, since cytochrome c, the natural donor of electrons to cytochrome oxidase in the electron transport chain, has been covalent- ly crosslinked to subunit II in vitro (Freedman and Chan 1984; Millet et al. 1983; Bisson et al. 1982). Several of the amino acids in subunit II are probably required for binding of the positively charged cytochrome c or are otherwise involved in enzyme function. Ten out of 13 aspartate and 13 out of 15 glutamate residues found in H. saturnus are conserved in S. cerevisiae. Disregarding the two initiation codons, three out of four methionine codons (ATG) found in the H. saturnus sequence are conserved in corresponding positions in S. cerevisiae.

Similarly, three out of five cysteines and five out of six histidines found in H. saturnus are conserved in S. cerevisiae.

There is a great deal of crystallographic and other structural information available now on cytochrome c from many organisms (Dickerson and Timkovich 1975). However, relatively little is known about the next com- ponent in the electron transport chain, cytochrome oxidase. While comparison of the primary structure of homologous protiens from related organisms generally provides important information about essential and nonessential amino acids, determining the primary structure of a protein can also sometimes suggest new approaches to ob- taining additional important structural information. For example, a potentially useful feature of the H. saturnus

subunit II is that it is predicted to contain two cysteines that do not correspond to cysteines in S. cerevisiae. One of these is found in a hydrophobic region (corresponding to nucleotide position 142 in Fig. 2) while the other (corresponding to position 493) is in a somewhat less hydrophobic region. Since cysteines are attractive targets for chemical modification, it may be possible to chemi- cally modify these cysteines in H. saturnus to probe one or more regions of the enzyme which are otherwise inaccessible in other versions of the enzyme.

Two remarkable characterisitcs of mitochondrial gene expression in various systems that have been studied is that the mitochondrial genetic code differs from the universal code, and mitochondria often show extreme bias in eodon usage. CoxII contains six in frame TGA codons, five of which correspond to TGA codons in equivalent positions in oxiI. It is therefore apparent that


TGA codes for tryptophan in H. saturnus mitochondria as it does in several other mitochondrial systems (Kroon 1983). However, the H. saturnus gene uses nine codons that are not used in oxiI. For example, TAC is used to code for four out of ten tyrosines in coxII, but the codon is not used at all in oxiI. In coxII, CTT is used to code for leucine (three times) and CGT for arginine (four times), but neither the CTN nor CGN families are used at all in oxiI. In fact, the CGN family is rarely if ever used in S. cerevisfae mitochondria although there is a tRNA Arg gene to decode CGN (Bonitz et al. 1980; Dujon 1981). In S. cerevisiae and mammalian mitochondria, ATA codes for methionine (Kroon 1983). It is not obvious whether ATA codes for methionine or isoleucine in H. saturnus mitochondria since the codon is used only once in coxlI.

H. saturnus mitochondrial DNA flanking coxII contains minor variations o f the reported transcription initiation signal (Osinga 1984b) and the end of message signal (Michel 1984; Osinga et al. 1984a) found in S. cerevisiae. However, we cannot yet say that these suequences are functional in 14. saturnus. The nucleotide sequence exhib- its some other unusual features. For example, before both the coxII gene and the possible reading frame downstream from coxII, the H. saturnus genome has an ex- tremely A-rich sequence, which could be a ribosome binding site, a signal for translation initiation, or could serve some other control function. The gene also is laden with elements of symmetry, including palindromes, inverted repeats, and direct repeats, such that less than 20% of the nucleotides within the coding region are not part of one or more of these symmetrical elements. One of the major unanswered questions concerning mitochondria is how the expression of individual mitochondrially encoded and translated polypeptides is regulated. For example, how are the 3 subunits of cytochrome oxidase made in equimolar amounts from separate transcripts? And how is this synthesis coordinated with cytoplasmic synthesis and import of nucleafly encoded proteins that are required by the mitochondria, especially those proteins that are nuclearly encoded subunits of the cytochrome oxidase or other inner membrane complexes? Answers to these questions are likely to be complex and involve a network of regulatory interactions that work together to control mitochondrial expression. Some of the symmetrical elements found in the subunit II gene are likely participants in this regulatory network. Being able to compare H. saturnus to S. cerevisiae mitochondrial genes may help to reveal which of the many elements of symmetry are important for regulation or other func- tions. However, it should be kept in mind that while S. cerevisiae and H. saturnus are both faced with many common regulatory problems, each organism may also experience unique problems. For example, H. saturnus is a petite negative yeast (Wickerham 1970), and some of

the symmetrical elements may be linked to this pheno-

menon.

Acknoweldgement. This work was supported in part by Grant F-925 from the Robert A. Welch Foundation.

References

Anderson S, deBruij n MHL, Coulson AR, Eperson IC, Sanger F, Young IG (1982) J Mol Biol 156:683-717

Anderson S, Bankier AT, Barrell BG, de Bruijn MHL, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, schreier PH, Smith AJH, Staden R, Young IG (1981) Nature 290:457-465

Barrell BG, Andeson S, Bankier AT, de Bruijn MHC, Chen E, Coulson AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJH, Staden R, Young IG (1980) Proe Nat1Acad Sci USA 77:3164 3166

Bibb M J, Van Etten RA, Wright CT, Walberg MW, Clayton DA (1981) Cell 26:167-180

Biggin MD, Gibsons TJ, Hong GF (1983) Proc Natl Acad Sci USA 80:3963-3965

Bisson R, Steffens GCM, Capaldi RA, Buse G (1982) FEBS Lett 144:359-363

Bonen L, Boer PH, Gray MW (1984) EMBO J 3:2531-2536 Bonitz SG, Beflani R, Coruzzi G, Li M, Maeino G, Nobrega FG,

Nobrega MP, Thalenfeld BE, Tzagoloff A (1980) Proc Natl Acad Sci USA 77:3167-3170

Cabral F, Solioz M, Rudin Y, Schatz G, Claviler L, Slonimski PP (1978) J Biol Chem 253:297-304

Coruzzi G, Tzagoloff A (1979) J Biol Chem 254:9324-9330 Dickerson RE, Timkovich R (1975) In: Boyer PC (ed) The en-

zymes, vol XI. Academic Press, pp 397-547 Dujon B (1981) In: Strathern JN, Jones EW, Broach JR (eds)

The molecular biology of the yeast saccharomyces. Life cycle and inheritance, Cold Spring Harbor Laboratory, pp 505-635

Felton J (1983) Biotechniques 1:42 43 Fox TD (1979a) J Mol Biol 130:63-82 Fox TD (1979b) Proc Natl Acad Sci USA 76:6534-6538 Fox TD, Leaver CJ (1981) Cell 26:315-323 Freedman JA, Chan SHP (1984) J Bioenerg Biomembr 16:75-

100 Hiesel R, Brennicke A (1983) EMBO J 2:2173-2178 Holmes D, Quigley M (1981) Anal Biochem 114:193-197 Hudspeth MES, Ainley WM, Shumard DS, Butow RA, Grossman

LI (1982) Cell 30:617-626 Kao T, Moon E, Wu R (1984) Nucleic Acids Res 12:7305-7314 Kroon AM (1983) In: Kroon AM (ed) Genes: Structure and ex-

pression. John Wiley and Sons Ltd, pp 347-356 Lawson JE, Deters DW (1985) Curr Genet 9:345 350 Li M, Tzagoloff A (1979) Cell 18:47-53 Macino G, Morelli G (1983) J Biol Chem 258:12230-13235 Mannahaupt G, Michaelis G, Pratje E (1983) In: Schweyen RJ,

Wolf K, Kaudewitz F (eds) Mitochondria 1983. Nucleo-mito- condrial interactions. Walter de Gruyter, pp 449-454

Michel F (1984) Curr Genet 8:307-317 Millet F, de Jong C, Paulson L, Capaldi RA (1983) Biochemistry

22:546-552 Osinga KA, De Haan M, Christianson T, Tabak HF (1982) Nucleic

Acids Res 10:7993-8006

360 J.E. Lawson and D. W. Deters; Cytochrome oxidase subunit II sequence

Osinga KA, De Vries E, Van der Horst G, Tabak HF (1984a) Nucleic Acids Res 12:1889-1900

Osinga KA, De Vries E, Van der Horst G, Tabak HF (1984b) EMBO J 3:829-834

Poyton RO, Schatz G (1975) J Biol Chem 250:762-766 Sanger F, Nicklen S, Coulson RA (1977) Proc Natl Acad Sci

USA 74:5463-5467 Slonimski P, Tzagoloff A (1976) Eur J Biochem 61:27-41 Steffens GJ, Buse G (1979) Hoppe-Seyler's Z Physiol Chem

360:613-619

Van den Boogaart P, van Dijk S, Agsteribbe E (1982) FEBS Lett 147:97-100

Wickerham LJ (1970) In: Lodder J (ed) The Yeasts. A Taxono- mic Study. North Holland Publishing Co, pp 227-245,299- 302

Communicated by L. A. Grivell

Received January 11, 1985

Documents

Nucleotide sequence of the mitochondrial cytochrome oxidase subunit II gene in the yeast Hansenula saturnus