Nucleotide binding domain and leucine-rich repeat pyrin domain- … · NLRPlrp12 binds to HCKck 2 20 yeast two-hybrid screen with a human leukocyte cDNA library as prey. Hematopoiesis

1

Nucleotide binding domain and leucine-rich repeat pyrin domain-

containing protein 12: characterization of its binding to

hematopoietic cell kinase

Yue Zhang* and Curtis T. Okamoto 1

2

Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of 3

Southern California, USA 90089-9121 4

5

*Correspondence: 6

Yue Zhang 7

[email protected] 8

9

Running title: NlrpNLRP12 binds to HckHCK 10

11

Key words: yeast two-hybrid, innate immunity, protein‐protein interaction, NlrpNLRP12, 12

HckHCK, acute myeloid leukemia13

14

15

Abstract 16

Protein-protein interactions are key to defining the function of nucleotide binding domain (NBD) 17

and leucine-rich repeat (LRR), pyrin domain (PYD)-containing family of proteins 12 18

(NlrpNLRP12). cDNA encoding the human PYD + NBD of NlrpNLRP12 was used as bait in a 19

mailto:[email protected]

NLRPlrp12 binds to HCKck

2

yeast two-hybrid screen with a human leukocyte cDNA library as prey. Hematopoiesis cell 20

kinase (HckHCK), a member of the Sc-SRCrc family of non-receptor tyrosine kinases, was 21

among the top hits. The C-terminal 40 amino acids of HckHCK specifically bound to 22

NlrpNLRP12’s PYD + NBD, but not to that of NlrpNLRP3 and NlrpNLRP8. Amino acids F503, 23

I506, Q507, L510, and D511 of HckHCK are critical for the binding of HckHCK’s C-terminal 24

40 amino acids to NlrpNLRP12’s PYD + NBD. Additionally, the C-terminal 30 amino acids of 25

HckHCK are sufficient to bind to NlrpNLRP12’s PYD + NBD, but not to its PYD alone nor to 26

its NBD alone. In cell lines that express HckHCK endogenously, it was co-immunoprecipitated 27

with stably expressed exogenous NlrpNLRP12. Also, NlrpNLRP12 co-immunoprecipitated and 28

co-localized with HckHCK when both were overexpressed in 293T cells. In addition, in this 29

overexpression system, steady-state NlrpNLRP12 protein expression levels significantly 30

decreased when HckHCK was co-expressed. Bioinformatic analysis showed that HckHCK 31

mRNA co-occurred with NlrpNLRP12 mRNA, but not with other NlrpNLRP proteinsmRNAs, in 32

blood and marrow samples from acute myeloid leukemia (AML) patients. The mRNA of 33

NlrpNLRP12 is also co-expressed with HckHCK in AML patient samples, and the levels of 34

mRNA expression of each are correlated. Together these data suggest that NlrpNLRP12, 35

through its binding to HckHCK, may have an effect on the progression of AML. 36

37

Introduction 38

Pattern recognition receptors (PRR) are the first major line of cellular defense against damage-39

associated molecular patterns (DAMP) and pathogen-associated molecular patterns (PAMP) (1). 40

Among PRR, one class of proteins is the nucleotide-binding domain (NBD) and leucine-rich 41

repeat (LRR) receptor family (NLR). NBD and LRR PYD protein 12 (NlrpNLRP12) is one 42


3

protein that belongs to the PYD subfamily of the NLR class and is a multi-functional protein (2). 43

NlrpNLRP12’s functions likely all depend on defined protein-protein interactions. For example, 44

in anti-inflammatory functions of NlrpNLRP12, NlrpNLRP12 interacts with tumor necrosis 45

factor receptor associated factor 3 (TRAF3) and nuclear factor kappa-light-chain-enhancer of 46

activated B cells (NF-κB)-inducing kinase (NIK) in the non-canonical NF-κB pathway, when 47

toll-like receptors (TLR) are stimulated with Pam3Cys4 triacylated lipopeptides followed by 48

addition of cluster of differentiation 40 (CD40) (3). Dr. Kanneganti’s group also showed that 49

NLRP12 expression downregulated the Nlrpcanonical NF-kB pathway during the Salmonella 50

infection (4,5). NLRP12’s inhibition of the non-canonical NF-κB pathway, thereby effecting an 51

anti-inflammatory function, has been reported in many publications (7-11). For example, in 52

colitis-driven colon cancer, NlrpNlrp12 knock-out (KO) mice experience a higher frequency of 53

death, weigh less, have a shorter colon length, and have more severe disease progression than 54

wild type (WT) mice, all of which may occur through NlrpNLRP12’s inhibition of the non-55

canonical NF-κB pathway (3,4). In addition, NlrpNlrpLRP12 KO mice have been reported to 56

exhibit higher innate immunity when it is infected by the virus because NlrpNLRP12 inhibits the 57

non-canonical NF-κB pathway; thus, in a KO mice, a more significant increase of NF- κB 58

activity is observed compared to WT mice when it is infected by the virus (6). And in the case 59

of NlrpNLRP12 protecting the diversity of intestinal microbiota (7), thereby preventing obesity 60

(8), it has also been reported that NlrpNlrpLRP12 KO mice display significantly decreased 61

intestinal microbial diversity due to increased innate immunity, resulting from the lack of 62

inhibition of the non-canonical NF-κB pathway. 63

64


4

In addition, NlrpNLRP12 also interacts with interleukin (IL)-1 receptor-associated kinase 1 65

(IRAK1) in the canonical NF-κB pathway when TLRs are stimulated, also to inhibit the 66

inflammatory response (9). In contrast, for human studies of NlrpNLRP12-associated 67

autoinflammatory disorders, no protein-protein interactions have been reported (10,11). 68

Functionally, however, NlrpNlrpLRP12 KO mice had a higher immunological response in the 69

autoimmune model of contact hypersensitivity (12); thus, these mice are more prone to develop 70

contact hypersensitivity. This results most likely from NlrpNlrpLRP12 KO mice having 71

defective migration of their dendritic cells (DC). In addition, Luken et al. demonstrated that 72

NLRP12 regulatesimpacts the eExperimental aautoimmune eencephalomyelitis (EAE) model via 73

regulating T- cell responses (13). But, in these mouse studies(Lukens et al., 2015)y, no protein-74

protein interactions had been reported either (12). And NlrpNLRP12 is protective against 75

Yersinia pestis infection through NlrpNLRP12’s activation of the inflammasome which results in 76

secretion of IL-18 and IL-1β. But again, no protein-protein interactions of NlrpNLRP12 within 77

inflammasomes had been characterized (14). Also, there is also a study showing that NLRP12 78

also regulates the c-Jun N-terminal kinase (JNK) pathway in hepatocytes (15);. bBut, again, no 79

protein-protein interactions related to howwithin the NLRP12 activates- JNK pathway hads not 80

been showeddemonstrated. Thus, there is a further need to find and to characterize previously 81

unreported NlrpNLRP12-binding proteins. Knowing NlrpNLRP12’s protein binding partners 82

may help to gain mechanistic insight into pathways previously characterized as being regulated 83

by NlrpNLRP12. Moreover, identifying and validating potentially novel binding partners of 84

NlrpNLRP12 may suggest novel functions for NlrpNLRP12. 85

86


5

In humans, NlrpNLRP12 is mainly expressed in macrophages, DCs, and neutrophils. In mice, 87

NlrpNLRP12 is primarily expressed in DCs and neutrophils (6,12,16). The NlrpNLRP12 protein 88

has three domains, from N- to C-terminus: PYD, NBD, and LRR domains (2,17,18). It is 89

generally accepted that the LRR domain, like NlrpNLRP1’s LRR domain and NlrpNLRP3’s 90

LRR domain, is responsible for sensing ligands or other types of activators of NlrpNLRPs in 91

modulating their role in an immunologic response (19-22). However, interestingly, it has been 92

reported that without the LRR domain, NlrpNLRP3 still can be activated by triggers of the 93

canonical NF-κB pathway (23). The NBD domain is responsible for self-oligomerization when 94

NlrpNLRP is activated, and the PYD domain is responsible for regulating downstream signaling 95

pathways (and thus, it is called the “interaction domain”) (16,23). Here we used a truncated 96

form of NlrpNLRP12 (PYD + NBD) to identify possible protein-protein interactions that may 97

regulate signaling pathways in which NlrpNLRP12 is involved. In addition, to our knowledge, 98

there are currently no protein-protein interaction studies that have been performed for this 99

truncated form of NlrpNLRP12 and may thus represent a new general approach to screening for 100

protein-protein interactions involved in signaling complexes with NlrpNLRPs. 101

102

A yeast two-hybrid screen was performed to identify potential binding partners of 103

NlrpNLRP12’s PYD + NBD. HckHCK, a member of the Sc-SRCrc family of non-receptor 104

tyrosine kinases, was one of the top positive clones (“hits”) among all of the proteins that 105

appeared to interact with NlrpNLRP12. Further experiments were done to confirm the novel 106

binding of NlrpNLRP12 to HckHCK and to characterize key structural features of the binding 107

interaction. In addition, co-expression of HckHCK with NlrpNLRP12 resulted in a significant 108

decrease of steady-state NlrpNLRP12 protein expression levels. In consideration tFinally, 109


6

together with a bioinformatics analysis included here, a potential interaction between 110

NlrpNLRP12 and HckHCK may be involved in modulating the role of HckHCK in the 111

pathogenesis of AML (24-26). 112

113

Results 114

NlrpNLRP12 interacts with HckHCK in the yeast two-hybrid assay 115

A human leukocyte cDNA library was used as prey in the screening of binding partners for 116

NlrpNLRP12 using the yeast two-hybrid assay. The basic principle of the yeast two-hybrid 117

assay is that if the cDNA library contains clones that express proteins, or parts thereof, that 118

interact with the co-expressed bait, the NlrpNLRP12 PYD + NBD (Figure 1A) in this case, then 119

the co-transformed yeast clones will grow. The cDNA clones from the library that supported 120

growth would then be isolated and characterize, to identify what proteins interact with 121

NlrpNLRP12’s PYD + NBD. The leukocyte library was used because NlrpNLRP12 is mainly 122

expressed in leukocytes in humans (2,16,27,28), and thus putative binding partners for 123

NlrpNLRP12 are also likely to be expressed there. 124

125

The screening resulted in 119 positive clones from the leukocyte cDNA library (“hits”) 126

expressed from 48 distinct genes (Supplementary materialsSupporting information, Table S1) 127

that were subsequently identified as encoding for proteins (or portions thereof) that potentially 128

interact with NlrpNLRP12’s PYD + NBD. The clones with the most hits are listed in Table 1. 129

Among the 119 hits, which included repeated hits of the same genes, 9 were individual clones 130

that encoded fragments of a member of the Sc-SRCrc family of non-receptor tyrosine kinases, 131

HckHCK, which was among the highest number of hits for a single gene (Figure 1B and Table 1). 132


7

Moreover, of the 9 positive HckHCK clones, 5 were encoded distinct HckHCK fragments 133

(Figure 1C). Full-length HckHCK p61 was also obtained as a hit in another independent yeast 134

two-hybrid screen (data not shown). HckHCK has two isoforms, p59 and P61, in Homo sapiens. 135

P61 and p59 share the same transcript, but p61 uses an uncommon start codon CTG, and p59 136

uses the common one, ATG (29), to give rise to two distinct transcripts. Endogenously 137

expressed in phagocytes, HckHCK p59 is mainly localized to the plasma membrane, while 138

HckHCK p61 is primarily localized to lysosomes, and both of them are also found in the Golgi 139

apparatus (30). It has been suggested that overexpression of p59 promotes the formation of 140

membrane protrusions such as pseudopodia and overexpression of p61 induces podosome 141

rosettes and triggers actin polymerization around lysosomes (30,31). However, there are no 142

differences between p61 and p59 in the region of HckHCK that appears to bind to 143

NlrpNLRP12’s PYD + NBD (see below), the C-terminal part of HckHCK. Thus, detecting a 144

full-length clone of only p61 as a hit, opposed to p59, appeared to be coincidental. 145

146

In directed screens using the yeast two-hybrid assay, NlrpNLRP12’s PYD + NBD domain 147

binding to HckHCK C-terminal 40 amino acids appears to be selective for NlrpNLRP12, 148

and HckHCK binding to NlrpNLRP12 appears to be selective for HckHCK 149

Initially, the HckHCK C-terminal 40 amino acids (“HckHCK C1 fragment”) was the shortest 150

HckHCK fragment from a positive clone that interacted with the bait, NlrpNLRP12’s PYD + 151

NBD (Figure 2A). NlrpNLRP 3 and NlrpNLRP8 were chosen based on the phylogenetic trees of 152

the PYD + NBD domains of members of the NlrpNLRP family: phylogenetically, NlrpNLRP3’s 153

PYD + NBD is the most closely related NlrpNLRP PYD + NBD to that of NlrpNLRP12, while 154

NlrpNLRP8’s PYD + NBD is among the furthest related PYD + NBD to that of NlrpNLRP12 155


8

(Figure 2B). In Figure 2C, yeast clones grew on the 4 drop out (DO) plates (synthetic dropout 156

(SD) plus amino acids supplements minus tryptophan, leucine, histidine, and adenine (-Trp-Leu-157

His-Ade)) and 4DO + 3-Amino-1,2,4-triazole (3-AT) high stringency plates when the yeast 158

were co-transformed with NlrpNLRP12’s PYD + NBD and HckHCK C1 fragment; and thus, this 159

result is indicative of an interaction between the two constructs. However, yeast clones were not 160

observed on 4DO and 4DO + 3-AT plates when NlrpNLRP3’s PYD + NBD and HckHCK C1 161

fragment were co-transformed, nor when NlrpNLRP8’s PYD + NBD and HckHCK C1 fragment 162

were co-transformed. These results suggest that the HckHCK C1 fragment binds to 163

NlrpNLRP12’s PYD + NBD, but not to those from either NlrpNLRP3 or NlrpNLRP8, results 164

consistent with a selective interaction between NlrpNLRP12’s PYD + NBD and the HckHCK C1 165

fragment. 166

167

Similarly, yeast clones again grew on the high stringency 4DO and 4DO + 3-AT plates when the 168

HckHCK C1 fragment was co-transformed with NlrpNLRP12’s PYD + NBD. However, clones 169

did not grow on the 4DO and 4DO + 3-AT plates when the C1 fragment of other members of the 170

Sc-SRCrc family of non-receptor tyrosine kinases were co-transformed with NlrpNLRP12’s PYD 171

+ NBD (Figure 2D). This experiment suggests that the interaction of HckHCK C1 fragment 172

with NlrpNLRP12 is selective for HckHCK; the C1 fragment of other members of the Sc-SRCrc 173

family of non-receptor tyrosine kinases did not bind to NlrpNLRP12’s PYD + NBD (Figure 2D). 174

175

In directed screens using the yeast two-hybrid assay, amino acids F503, I506, Q507, L510, 176

and D511 of HckHCK are critical for the binding between NlrpNLRP12’s PYD + NBD and 177

HckHCK C-terminal 40 amino acids 178


9

The HckHCK C1 fragment were divided into four helical regions according to its atomic 179

structure (32) (protein data bank (PDB) accession number: 1AD5): R1, R2, R3, and R4 180

(designated by us) (Figure 3A). As shown in the sequence alignments in Figure 3B, the primary 181

amino acid sequences of R2, R3, and R4 are very well conserved among members of the Sc-182

SRCrc family of non-receptor tyrosine kinases, while R1 is not. To characterize further the 183

important structural features of HckHCK’s binding to NlrpNLRP12’s PYD + NBD, all of the 184

amino acids comprising each of the R2, R3, and R4 domains were mutated to alanine, but only 185

mutated one section at a time was mutated, and these were denoted as the HckHCK M2 fragment, 186

HckHCK M3 fragment, and HckHCK M4 fragment, respectively. The amino acids comprising 187

the R1 region were mutated to those amino acids in the R1 region of the Sc-SRCrc family non-188

receptor tyrosine kinase LYNyn, which has the closest phylogenetic relationship to HckHCK 189

(Figure 3C). All of the mutated constructs are illustrated in Figure 3D. Yeast still grew on the 190

high stringency 4DO + 3AT plates when NlrpNLRP12’s PYD + NBD was co-transformed with 191

the HckHCK M1 fragment, HckHCK M2 fragment, and HckHCK M4 fragment. But, yeast could 192

not grow when NlrpNLRP12’s PYD + NBD was co-transformed with HckHCK M3 fragment 193

(Figure 3E). These experiments suggested that the R1, R2, and R4 regions are dispensable for 194

binding, while R3 may be important for binding. Further analysis was conducted to identify 195

individual critical amino acids of HckHCK’s R3 region binding to NlrpNLRP12’s PYD + NBD 196

using alanine scanning mutagenesis. However, the intervening sequences between R1, R2, R3, 197

and R4 were not examined for binding. 198

199

To identify the key amino acid residues involved in binding of R3 to NlrpNLRP12’s PYD + 200

NBD, each amino acid in R3 was individually mutated to alanine in an alanine scanning 201


10

mutagenesis analysis, on the background of the HckHCK C1 fragment. As shown by the yeast 202

two-hybrid assay, the mutations of F503A, I506A, Q507A, L510A, and D511A abolished the 203

growth of yeast clones on the high stringency 4DO when these yeast strains were co-transformed 204

with NlrpNLRP12’s PYD + NBD (Figure 3F). These experiments suggest that these four amino 205

acids are critical for binding. On the other hand, yeast clones still grew on the high stringency 206

4DO plates when the HckHCK C1 fragments with the E504A, Y505A, S508A, or V509A 207

mutations were co-transformed with NlrpNLRP12’s PYD + NBD (Figure 3F). These 208

experiments suggest that E504A, Y505, S508, and V509 are dispensable for binding of HckHCK 209

C1 fragment to NlrpNLRP12’s PYD + NBD. Whether E504 and I506 are critical for binding is 210

unfortunately not clear as the yeast did not grow on the control plates (SD/-Trp-Leu). Overall, 211

however, these results suggest that the amino acids F503, I506, Q507, L510, and D511 in 212

HckHCK are critical for the binding of HckHCK C1 fragment to NlrpNLRP12’s PYD + NBD. 213

214

On the other hand, YES also hasve these fiveour amino acid residues, are all conserved in all 215

members of the Src family of non-receptor tyrosine kinases (Figure 3A), suggesting that, while 216

they are important for binding, they cannot account for the specificity or selectivity of binding 217

between NlrpNLRP12 and HckHCK. In addition, these four critical residues, as shown in Figure 218

3C, appear to be in the same plane along a helix, which may then form an interface that is 219

important for binding to NlrpNLRP12. However, it is unclear whether the structure of the 220

isolated HckHCK C-terminus used in the screens here will retain theits structural features that it 221

possesses within the context of in full-length HckHCK, due to the potential loss of 222

intermolecular interactions for the C-terminal region. Moreover, for example, In addition, the 223

amino acids R500, P501, T502, D512, T515, Q520, and Y521, are 100% conserved among all 224


11

other members of the Sc-SRCrc family of non-receptor tyrosine kinases and are therefore 225

unlikely to play a role in specificity and selectivity of binding of NlrpNLRP12 with HckHCK. 226

But, it is possible that two or more amino acids in the intervening sections between the R1-R4 227

regions, which were not analyzed by mutagenesis, may then actually account for the specificity 228

and selectivity of binding of HckHCK to NlrpNLRP12. One example is that the combination of 229

R496, P497, and Q522 is unique to HckHCK compared to other members of the cS-SRCrc 230

family of non-receptor tyrosine kinases. 231

232

In directed screens using the yeast two-hybrid assay, the shortest fragment of HckHCK 233

that binds to NlrpNLRP12’s PYD + NBD is its C-terminal 30 amino acids 234

The shortest form of HckHCK that bound to NlrpNLRP12’s PYD + NBD was determined by 235

observing whether the yeast clones grew on high stringency 4DO or 4DO +3AT plates when 236

NlrpNLRP12’s PYD + NBD was co-transformed with HckHCK fragments C1 to C7 and N1 to 237

N5 (Figure 4) (data of NlrpNLRP12’s PYD + NBD co-transformed with HckHCK fragment C7 238

did not shown). HckHCK’s C1 to C7 fragments were gradually truncated from the N-terminus 239

of the HckHCK C-terminal 40 amino acid fragment (Figure 4A and 4B). HckHCK N1 to N5 240

fragments were gradually truncated from the C-terminus of the HckHCK C-terminal 40 amino 241

acid fragment (Figure 4BC and 4D). Yeast strains grew on high stringency 4DO or 4DO +3AT 242

plates when either the HckHCK C1, C2, or C3 fragment was co-transformed with NlrpNLRP12’s 243

PYD + NBD. Thus, of all of the constructs screened, the shortest fragment of HckHCK that can 244

apparently bind to NlrpNLRP12’s PYD + NBD is the C-terminal 30 amino acids, as indicated by 245

the HckHCK C3 fragment (Figure 4B and 4D). In addition, the last C-terminal 5 amino acids of 246

the HCK C-terminus also appear to be important for binding, as clones co-transformed with 247


12

NlrpNLRP12’s PYD + NBD with N1, with a deletion of the C-terminal 5 amino acids of 248

HckHCK, did not grow on the high stringency 4DO and 4DO + 3AT plates (Figure 4BD). The 249

structures of both inactive HckHCK (PDB accession number: 1AD5) and active c-SSRCrc (PDB 250

accession number: 1Y57), the prototypical member of this family of nonreceptor tyrosine kinases 251

related to HckHCK, show that the last C-terminal 4 amino acids of c-SSRCrc are surface-252

exposed, indicating that these four amino acids that are critical for binding are available to 253

interact with NlrpNLRP12 (33,34). 254

255

NlrpNLRP12 co-immunoprecipitates with HckHCK from mammalian cells, and 256

NlrpNLRP12 is co-localized with HckHCK in mammalian cells 257

NlrpNLRP12 and HckHCK could be co-immunoprecipitated when they were both 258

heterologously co-expressed in 293T cells (Figure 5A). Also, semi-endogenous conditions were 259

used for co-immunoprecipitations from cells in which HckHCK is endogenously expressed, and 260

NlrpNLRP12 was heterologously stably expressed in epitope-tagged form, such as in 261

macrophage-like RAW 264.7 cells (Figure 5B), monocyte-like THP-1 cells (Figure 5C), and 262

lymphocyte -like U937 cells (Figure 5D). Semi-endogenous conditions have been used in 263

previous reports where NlrpNLRP12 was shown to interact with TRAF3 (3), NIK (35), and 264

IRAK-1(9). In all cases, NlrpNLRP12 co-immunoprecipitated with the p59 and p61 isoforms of 265

HckHCK, but from these experiments, it is not clear that whether NlrpNLRP12 interacts with 266

p59, p61, or both isoforms of HckHCK. In U937 cells and THP-1 cells, since heterologous 267

NlrpNLRP12 expression level was low, adding phorbol 12-myristate 13-acetate (PMA) (1 µM 268

for 24 hr) increased NlrpNLRP12 expression level by stimulating the PMA-sensitive 269

cytomegalovirus promoter of NlrpNLRP12’s expression plasmid (Figure 5C and 5D). Taken 270


13

together, these data suggest that NlrpNLRP12 and HckHCK (either p59, p61, or both isoforms) 271

can interact with each other in a mammalian cell system, a result that in part validates the 272

findings from the yeast two-hybrid assay. 273

274

After heterologous co-expression of NlrpNLRP12 with either the p61 or the p59 isoform of 275

HckHCK in 293T cells, immunofluorescent staining of NlrpNLRP12 and HckHCK showed that 276

NlrpNLRP12 can be co-localized with either p61 or p59 isoforms of HckHCK in most of the 277

293T cells (Figure 5E and Supplementary materials, Supporting Information Figure S1). The co-278

localization of NlrpNLRP12 and HckHCK is consistent with an intracellular interaction between 279

the two proteins. In addition, the lack of selectivity of NlrpNLRP12 co-localizing with either 280

p61 or p59 isoform of HckHCK is consistent with the results from the screening assay, where the 281

putative binding region of HckHCK to NlrpNLRP12 is identical in both the p61 and p59 282

isoforms. 283

284

The steady-state level of NlrpNLRP12 protein may is significantly decreased when 285

HckHCK protein is co-expressed in an increasing amount 286

Figure 6 shows that in 293T cells, the co-expression of increasing amount of HckHCK may led 287

to a significant decrease in steady-state protein expression levels of NlrpNLRP12. Although, 288

alternatively, the apparent decrease in expression level of NlrpNLRP12 might be due actually to 289

a decrease in the epitope-tag itself or a decrease in the expression of the epitope-tagged protein 290

only. Interestingly, HckHCK protein levels did not show a linearlyn increasing level of 291

expression upon transfection with increasing amounts of plasmid DNA, possibly due to 292

HckHCK’s maximum expression levels in these cells being achieved with the lowest amounts of 293


14

plasmid DNA, which may be resolved if the transfections are performed with lower amounts of 294

plasmid DNA. This lack of linearity in protein expression It could also be due to saturation of the 295

signal for HCK on the the fact that blot at relatively low levels of HCK expression is saturated 296

or a combination of HCK’s maximum expression levels has been reached as well as saturation 297

of the and blot, as mentioned above. is saturated. Alternatively, reduction of NLRP12 expression 298

could be due to plasmid competition; that is, since the expression of both genes from either 299

plasmid are driven from the same promoter, an increase in the amount of one plasmid may 300

competitively decrease expression of the gene from the other plasmid due to their competition 301

for transcription factors.. 302

303

In blood and marrow samples from patients with AML, NlrpNLRP12 and HckHCK co-304

occur and are co-expressed 305

The odds ratio test (a statistical test that defines the likelihood of association of two events) 306

determines whether two proteins either co-occur or are mutually exclusive in their expression. 307

The Fisher exact test is a statistical test that uses P-values to determine if two events, such as co-308

occurrence or mutual exclusivity, are quantitatively significantly associated. Applying these 309

tests to The Cancer Genome Atlas (TCGA) provisional data sets for AML patients (36-38), 310

NlrpNLRP12 and NlrpNLRP1 are the only two NlrpNLRP family members that show a 311

statistically significant co-occurrence with HckHCK (Table 2). However, NlrpNLRP1’s co-312

occurrence has a P value of 0.048, while NlrpNLRP12’s co-occurrence has a P value of <0.001. 313

Therefore, NlrpNLRP12 is most likely the only NlrpNLRP family protein mRNAs that shows co-314

occurrence with HckHCK in samples from patients with AML. 315

316


15

Moreover, in this analysis, NlrpNLRP12 is significantly co-expressed with HckHCK (Pearson 317

coefficient = 0.80 and Spearman coefficient = 0.73, Pearson and Spearman coefficients show the 318

possibility of a linear relationship of two factors, Figure 7). This analysis is also consistent with 319

NlrpNLRP12 and HckHCK co-occurring in the same patients with AML. However, 320

NlrpNLRP12 was not the only NlrpNLRP protein mRNA that shows significant co-expression 321

with HckHCK. NlrpNLRP1 and NlrpNLRP3 also showed significant co-expression with 322

HckHCK. This can be explained by the fact that co-expression is less stringent than co-323

occurrence. In summary, NlrpNLRP12 is the only NlrpNLRP protein that shows co-occurrence 324

with HckHCK, and it also shows co-expression with HckHCK, although it is not the only 325

member of the NlrpNLRP family to do so. Other data sets, including Hausera data, Metzeler 1 326

data, Metzeler2 data, and Raponi data, were not available to evaluate the co-expression of 327

NlrpNLRP12 versus HckHCK, as these other data sets did not have information incorporate data 328

regarding NlrpNLRP12 expression. 329

330

Other potential binding partners of NlrpNLRP12 from the yeast two-hybrid screen 331

Other potentially interesting and unique genes that whose products may interact with 332

NlrpNLRP12’s PYD + NBD were identified in the yeast two-hybrid screen (Table 1 and 333

Supplementary materials, Supporting information Table S1). Table 1 only shows those hits with 334

frequency larger than 2, and these hits were analyzed through an Ingenuity Pathway Analysis 335

(IPA) diagram (Figure 8). In the IPA diagram, protein-protein interactions found by our yeast 336

two-hybrid screen are connected by solid lines and interactions between protein binding partners 337

collated by IPA are connected by dashed lines. In addition, those molecules that are associated 338

with AML are colored purple. Interestingly, NlrpNLRP12 is also associated with AML from the 339


16

database Catalogue of somatic mutations in cancer (COSMIC). Although the mutation occurs in 340

the NBD of NlrpNLRP12, only 2 samples of these mutations are observed within 175 samples 341

and may be worthy of follow-up study. 342

343

The interaction of one of the putative binding partners to NlrpNLRP12 identified in our screen, 344

TRAF3 interacting protein 3 (TRAF3IP3), was validated in a co-immunoprecipitation 345

experiment where the FLAG-tagged form of TRAF3IP3 and V5-tagged form of NlrpNLRP12 346

were overexpressed in 293T cells. TRAF3IP3 was coimmunoprecipitated by adding mouse 347

monoclonal anti-TRAF3IP3 antibody, and a band that showed the same molecular weight size of 348

NlrpNLRP12 was detected by rabbit monoclonal anti-V5 antibody (Figure 8). However, further 349

validation of these other putative interactors detected by the yeast two-hybrid needs to be done. 350

351

Discussion 352

In this paper, the yeast two-hybrid assay was used to screen for NlrpNLRP12 binding partners. 353

This approach identified 48 genes as positive hits encoding proteins that could possibly bind to 354

NlrpNLRP12. Among the hits, the cS-SRCrc non-receptor tyrosine kinase family member 355

HckHCK was selected to focus upon as a potentially interesting target, particularly given its 356

association with hematopoiesis and AML. Further direct screens found that NlrpNLRP12 357

specifically binds to HckHCK, but not to NlrpNLRP8 or NlrpNLRP3. Conversely, HckHCK, 358

but not other members of the SRCc-SRCrc non-receptor tyrosine kinase family, specifically 359

binds to NlrpNLRP12. HckHCK’s C-terminal 30 amino acids are sufficient for binding to 360

NlrpNLRP12. And, amino acids F503, I506, Q507, L510, and D511 of HckHCK are critical for 361

binding to NlrpNLRP12. Co-immunoprecipitation experiments from mammalian cells 362


17

confirmed that NlrpNLRP12 and HckHCK interact. Co-expression of NlrpNLRP12 and 363

HckHCK results in a significantly lower steady-state expression level of NlrpNLRP12; thus, the 364

interaction may affect NlrpNLRP12 protein stability. Finally, a bioinformatics analysis shows 365

that NlrpNLRP12 and HckHCK essentially exclusively co-occur, and mRNA levels for both are 366

correlated in blood samples from AML patients. Together, these data suggested that 367

NlrpNLRP12 and HckHCK protein and mRNA co-expression may have an effect on the AML. 368

369

The binding data from yeast two-hybrid (Figure 3 and Figure 4) showed that the R2 and R3 370

regions are both important for binding, but we suspect that R3 region is the major region that is 371

critical for binding, while R2 region may be an “auxiliary” region that is also critical for binding, 372

because when we delete the R2 region but maintain the R3 region, the R3 region itself cannot 373

maintain stable binding of HckHCK’s C-terminal 40 amino acids to NlrpNLRP12’s PYD + NBD. 374

Thus, binding of NlrpNLRP12’s PYD + NBD to this fragment of HckHCK may occur initially 375

through binding to R3, followed by stabilization of the interaction by secondarily binding to R2. 376

This model is also consistent with the finding that when we mutated the R3 region, the binding 377

of HckHCK’s C-terminal 40 amino acid fragment to the NlrpNLRP12’s PYD + NBD was lost 378

despite the R2 region being present. The above evidences are consistent with the model that R2 379

and R3 regions together are both necessary for binding, but the stabilization of binding to the R3 380

region may requires the presence of R2. 381

382

The yeast two-hybrid screen with NlrpNLRP12 also identified products from 47 other genes as 383

potential interactors. According to the Search Tool for Recurring Instances of Neighbouring 384

Genes (STRING) protein network and previous publications, NlrpNLRP12 interactors include 385


18

IRAK1 (39), NIK (35), TRAF3(3), heat shock protein 90 (HSP90) (40), Fas associated factor 1 386

(FAF1) (41), and apoptosis-associated speck-like protein containing a caspase activation and 387

recruitment domain (ASC) proteins. IRAK1, NIK, TRAF3, and Heat shock protein (HSP) 90 388

were only found in experiments involving semi-endogenous protein co-immunoprecipitations 389

with NlrpNLRP12. FAF1 was found to be an interacting protein in NMR experiments by 390

showing a difference in the chemical shift perturbation of FAF1’s ubiquitin-associated domains 391

(UBA) domain alone and NlrpNLRP12’s PYD domain bound to FAF1’s UBA domain. And 392

FAF1 was also found to interact with NlrpNLRP12 in a yeast two-hybrid study where the PYD 393

domain of different NlrpNLRP proteins were screened (42). However, in our study, IRAK1 (43), 394

NIK (44), TRAF3 (45), HSP90 (46), FAF1 (47), and ASC (48) proteins were not found in our 395

results of interacting proteins, although they are all expressed in leukocytes. Therefore, given 396

these differences, the results from this yeast two-hybrid screen may provide a unique database 397

for future investigations on the proteins that interact with NlrpNLRP12, and the functional 398

outcomes of these interactions. 399

400

How HckHCK co-expression affects NlrpNLRP12 expression can be further investigated to 401

determine the functional outcomes of the NlrpNLRP12-HckHCK interaction relative to protein 402

stability or degradation. For example, MG-132 and chloroquine, which are a proteasomal 403

inhibitor and an inhibitor of lysosomal degradation, respectively, can be added to cells in these 404

experiments to determine whether the decreasing protein expression level of NlrpNLRP12 in the 405

presence of HckHCK is due to proteasomal degradation or lysosomal degradation. In addition, 406

an NlrpNLRP12 stable cell line, with a typically lower level of NlrpNLRP12 expression, 407

compared to transiently transfected cells, can be used to test formally whether NlrpNLRP12 408


19

protein expression levels are increasingly decreased when the HckHCK’s is expression of HCK 409

is increased. Moreover, the rate of NlrpNLRP12 degradation, in the absence or presence of 410

HckHCK, can be studied and compared in pulse-chase assays (35). 411

412

Given the interaction that was characterized between Nlrp12NLRP12 and HckHCK, we sought 413

to identify diseases in which their interaction may be relevant. AML is a type of blood and bone 414

marrow cancer that is characterized by an unusually high level of circulating immature white 415

blood cells (49). HckHCK is found to be highly expressed in hematopoietic stem cells of AML 416

patients (24). The overexpression of HckHCK is linked with the development of AML (24,50). 417

Therefore, HckHCK may be potentially used as a blood biomarker to identify those patients with 418

potential to develop of AML disease. In addition, activation of HckHCK and its signaling 419

pathways often causes the development of AML (25,51). HckHCK has been reported to be 420

involved in the feline McDonough sarcoma (fms)-like tyrosine kinase 3 (FLT3)-HCKHCK- 421

cyclin D-dependent kinase (CDK6) pathway. The mutation in FLT3-internal tandem 422

duplications (FLT3-ITD) causes the activation of HckHCK, and subsequently results in 423

overexpression of CDK6 in MV4-11 cells, a human AML cell line with the FLT3-ITD mutation. 424

CDK6 siRNA resulted in MV4-11 cells with the FLT3-ITD mutation having a lower 425

proliferation rate compared to MV4-11 control cells (25). Also, it has been reported that in AML 426

patients, HckHCK, LynLYN, and Fgr FGR phosphorylation levels are high (51). In summary, 427

the above evidence suggests that either high expression and/or high activation of HckHCK could 428

occur in AML patients as well. 429

430


20

Our bioinformatics analysis revealed that Nlrp12NLRP12 is likely the only member of the 431

NlrpNLRP family that shows significant co-occurrence with HckHCK at the level of mRNA 432

expression. However, our cellular functional study revealed that NlrpNLRP12 protein 433

expression levels decreased when it is co-expressed with HckHCK. This discrepancy might be 434

due NlrpNLRP12 mRNA expression level not correlating with protein expression level (52-54). 435

Nevertheless, these data are still consistent with the possibility that NlrpNLRP12 may have an 436

effect on AML through its binding to HckHCK. NlrpNLRP12 and HckHCK co-expression and 437

co-occurrence may then also be relevant to the prognosis of AML. However, further analyses 438

need to be performed to evaluate the ability of NlrpNLRP12 and HckHCK to serve as 439

biomarkers in the prognosis of AML. 440

441

NlrpNLRP12 and HckHCK co-expression and co-occurrence may indicate that NlrpNLRP12 and 442

HckHCK mRNA or protein expression can impact the same pathway or both be regulated by the 443

same molecule. For example, in the case two molecules exhibiting co-occurrence, they may 444

interact in the same signaling pathway, for example, Ki-ras2 Kirsten rat sarcoma viral oncogene 445

homolog (KRAS) and glycogen synthase kinase 3 beta (GSK3β) showed co-occurrence in the 446

AML provisional data, and they are in the same signaling pathway (55). However, further 447

analyses need to be performed to evaluate the ability of NlrpNLRP12 and HckHCK to serve as 448

biomarkers in the prognosis of AML. 449

450

Although many HckHCK inhibitors have been developed, they often lack specificity, with 451

HckHCK inhibitors also inhibiting other members of the Sc-SRCrc non-receptor tyrosine kinase 452

family (24,56-5960). If the potential for the development of AML can be decreased when 453


21

NlrpNLRP12 does not bind to HckHCK, then an inhibitor to the interaction between 454

NlrpNLRP12 and HckHCK can be designed. On the other hand, if the potential for AML is 455

increased when NlrpNLRP12 and HckHCK does not bind, then a drug that facilitates 456

NlrpNLRP12 and HckHCK interaction could be developed. By this approach, the non-457

specificity problem with NlrpNLRP inhibitors may still exist but perhaps to a smaller extent, as 458

NlrpNLRP proteins are less conserved overall compared to the members of the Sc-SRCrc non-459

receptor tyrosine kinase family. For example, the amino acid identity between NlrpNLRP12’s 460

PYD + NBD versus another NlrpNLRP PYD + NBD most closely related to NlrpNLRP12, 461

NlrpNLRP3’s PYD + NBD, is 54%. But, the protein identity between the HckHCK C1 fragment 462

versus the one with the closest relationship, the LYNyn C1 fragment, is 78%. 463

464

In conclusion, this paper reports the preliminary findings of NlrpNLRP12 interacting with 465

HckHCK, and NlrpNLRP12 co-occurs with HckHCK in AML patients. The binding data 466

presented here will expand the database regarding the interactors of NlrpNLRP12, and additional 467

bioinformatic and functional in vitro and in vivo analyses may shed light on the functional 468

consequence of the interaction of NlrpNLRP12 with HckHCK. 469

470

Material and Methods 471

Reagents and cells 472

U937, THP-1, RAW 264.7, and 293T cells were all purchased from American Type Culture 473

Collection (ATCC) (Manassas, VA). pCDNA-NlrpNLRP12 plasmid and pCDNA-NlrpNLRP3 474

plasmid were gifts from Dr. Jenny P. Y. Ting (University of North Carolina-Chapel Hill). 475

pCDNA-NlrpNLRP8 plasmid was purchased from Genescript (Piscataway, NJ). All other 476


22

chemicals were reagent grade. The mouse monoclonal anti-FLAG antibody and the rabbit 477

monoclonal anti-FLAG antibody were purchased from Sigma-Aldrich (St. Louis, MO). The 478

mouse monoclonal anti-HckHCK antibody, the mouse monoclonal anti-TRAF3IP3 antibody, and 479

the mouse IgGκ binding protein-horseradish peroxidase (HRP) for detecting the anti-HckHCK 480

antibody were purchased from Santa Cruz Biotechnology (Dallas, TX). The rabbit monoclonal 481

anti-V5 antibody and polyclonal rabbit HRP-conjugated anti-mouse IgG secondary 482

antibodies were purchased from Cell Signaling (Beverly, MA). The goat anti-rabbit IgG HRP-483

linked secondary antibody was purchased from Cell Signaling. The Clean-Blot™ IP Detection 484

Reagent was purchased from Thermo Fisher Scientific (Grant Island, NY). Goat anti-mouse IgG 485

(H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 488 and goat anti-rabbit 486

IgG (H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555 were purchased 487

from Thermo Fisher Scientific (Grant Island, NY). The 4',6-diamidino-2-phenylindole, 488

dihydrochloride (DAPI) was purchased from Thermo Fisher Scientific. 489

490

Cloning 491

NlrpNLRP12’s PYD + NBD (corresponding to a.a. 1-531) was amplified by polymerase chain 492

reaction (PCR) (primers see Table 3), from a pCDNA-NlrpNLRP12 plasmid, was digested with 493

enzymes NdeI and SalI, and subcloned into the pGBKT7 vector (Takara). The sequence 494

encoding the PYD + NBD of NlrpNLRP3 (corresponding to a.a. 1-536) was amplified by PCR 495

(see table 3 for primers), digested with enzymes NdeI and BamHI, and subcloned in the 496

pGBKT7 vector. The sequence encoding the PYD + NBD of NlrpNLRP8 (corresponding to a.a. 497

1- 527) was amplified by PCR (see Table 3 for primers), digested with enzymes EcoRI and 498

BamHI, and subcloned into the pGBKT7 vector. The entire sequences corresponding to of the 499


23

C-terminal 42 amino acids of FGRgr, Sc-SRCrc, YESes, and FYNyn, and 40 amino acids of 500

BLKlk, LCKck, LYNyn, and HckHCK (The C terminal 40 (or 42) amino acids is called “C1”), 501

and HckHCK constructs C2, C3, C4, C5, C6, C7, N1, N2, N3, N4, N5, M1, M2, M3, M4, and 502

HckHCK C1 mutations for alanine scanning with F503A, E504A, Y505A, I506A, Q507A, 503

S508A, V509A, L510A, and D511A, were all synthesized from IDT DNA (Coralville, IA) and 504

cloned into the pACT2 vector (Takara). NlrpNLRP12 was amplified by PCR (see Table 3 for 505

primers), digested with AflII and XbaI, and subcloned into pEFIRES-P-3FLAG (601) and 506

pEFIRES -P-V5 (601). 3FLAG and V5 are homemade, i.e., added later into pEFIRES-P. The 507

peptide sequence of the 3FLAG epitope is DYKDDDDKDYKDDDDKDYKDDDDK. The 508

peptide sequence of the V5 epitope is GKPIPNPLLGLDST. The multiple cloning sites of 509

pEFIRES-P were modified according to our needs. Sequences encoding HckHCK p61 and p59 510

isoforms were amplified by PCR (see Table 3 for primers), digested with AflII and XbaI, and 511

subcloned into pEFIRES -3FLAG vector. Final plasmids were sequenced to confirm the 512

constructs. 513

514

Yeast two-hybrid assay 515

Yeast transformed with the plasmid PGBKT7- NlrpNLRP12’s PYD + NBD 516

Yeast strain AH109 (Takara, Mountain View, CA) was stored frozen at -80°C. Upon use, it was 517

streaked onto an agar plate supplemented with yeast extract, peptone, dextrose, and adenine 518

hemisulfate (YPDA) (Takara), which was then placed in a 30°C incubator overnight. The 519

growing colonies were picked and placed into 10 ml of YPDA media, incubated overnight with 520

shaking at 30°C. Then they were transformed with NlrpNLRP12’s PYD + NBD plasmid, 521

following recommendations in the Takara manual (MatchmakerTM Gal4 Two-hybrid System 3 522


24

and Libraries User Manual). A 4ml of 1 M of 3-AT was added into 800 mL of the YPDA 523

medium that were used for making the plates due to a leakage problem. 3-AT is a competitive 524

inhibitor for the product of the HIS3 reporter gene. Yeast cells were lysed using a trichloroacetic 525

acid (TCA) method, and western blots were performed to check NlrpNLRP12’s PYD + NBD 526

protein expression (data not shown). 527

528

Library scale transformation of cDNA library into yeast that have been transformed with the 529

PGBKT7- NlrpNLRP12 PYD + NBD plasmid 530

A human leukocyte MatchmakerTM cDNA library was purchased from Takara. The library was 531

titered according to the MatchmakerTM Gal4 Two-hybrid System 3 and Libraries User Manual. 532

The colony-forming units (CFU) for the library were calculated to be about 3.1 x 109 CFU/ml. 533

Four large scale transformations (equal to one library scale) were done at the same time 534

following the MatchmakerTM Gal4 Two-hybrid System 3 and Libraries User’s Manual. To 535

calculate the efficiency of yeast two-hybrid (i.e., the number of colons obtained per µg of library 536

plasmid DNA) and to check the expressions of “bait” and “prey” plasmids, small amounts of the 537

solution, diluted 10X, 100X, 1000X, and 10,000X were plated in SD/-Trp-Leu 2DO (drop out) 538

plates. The yeast two-hybrid efficiency obtained was 3 x 106 CFU per µg of library plasmid 539

DNA. In addition, if the yeast grew on the SD/-Trp-Leu-His-Ade + 3-AT plates, the “bait” and 540

“prey” plasmids were considered to be interacting with each other. 541

542

Small scale transformation 543

The yeast two-hybrid co-transformation on a small scale for all of the direct screenings was 544

performed following the small-scale transformation protocol in the MatchmakerTM Gal4 Two-545


25

hybrid System 3 & Libraries User’s Manual. The direct screens were to test whether 546

NlrpNLRP12 PYD + NBD and HckHCK specifically interact; identification of HckHCK F503, 547

Q507, L510, and D511 being critical for binding with NlrpNLRP12 PYD + NBD; and the 548

characterization of the HckHCK C-terminal 30 amino acid fragment binding to NlrpNLRP12 549

PYD + NBD. 550

551

Cell transfection 552

293T cells, THP-1 cells, U937 cells, and RAW 264.7 cells were seeded at a density of 5 x 105 553

per well in a 6-well plate. Transfection followed the Lipofectamine® 3000 reagent (Thermo 554

Fisher Scientific) protocol with the following modifications. Briefly, 3.75 µl of Lipofectamine® 555

3000 was added into 125 µl of Opti-MEM® medium (Thermo Fisher Scientific). 2.5 µg of 556

plasmid DNA (prepared by isolation through cesium chloride (CsCl) density gradient 557

purification (612) and 5 µl of P3000TM reagent were added into another aliquot of 125 µl of 558

Opti-MEM® medium. Then these two tubes were mixed together, and the mixed tube was 559

incubated at room temperature for 15 min. 250 µl of this mixture was added to the cells. The 560

cells were incubated at 37 °C with 5% CO2 for two days until analysis. 561

562

NlrpNLRP12 stable cell lines 563

THP-1 cells, U937 cells, and RAW 264.7 cells were transfected with pEFIRES-P-NlrpNLRP12-564

3FLAG plasmid, and 2.5 μg/ml puromycin (InvitrogenTM by Thermo Fisher Scientifc) was added. 565

After two weeks, the cells were considered to be stably expressing NlrpNLRP12 after screening 566

for expression. The stable cells were “pooled” clones, and they are maintained by adding 2.5 567

μg/ml puromycin. 568


26

569

Cell lysis and immunoprecipitation 570

After trypsinization, cells were lysed in 500 μl of lysis buffer (1% NP-40, 4mM Tris-HCl, pH 8.0, 571

150 mM NaCl). Cells were then treated with freeze-thaw cycles, i.e., frozen in the -80C freezer 572

for 5 min and thawed at 37C in a water bath for 3 min, for a total of five times. Cells were then 573

centrifuged at 12,000 x g for 10 min at 4C. After centrifugation, the supernatant was saved at -574

20C until further use. 575

576

For immunoprecipitations, cell lysates were pre-cleared by adding 40 μl of protein A/G agarose 577

beads (Thermo Fisher Scientific) from a 50% slurry, and the sample was rotated for 1 hr at 4C. 578

The sample was spun at 1000 x g for 1min. Then, 30 μl of pre-cleared cell lysate were removed 579

and run on immunoblotting as a control. The remaining cell lysate was incubated with 1 μg anti-580

HckHCK mouse monoclonal primary antibody overnight. On the second day, 30 μl of protein 581

A/G agarose, from a 50% slurry and previously washed with lysis buffer three times, were added 582

to the tube, and the tube was incubated for 3 hrs at 4C. The beads were then washed with lysis 583

buffer, but with the NaCl concentration increased to 500 mM. The tube was briefly centrifuged 584

at 1000 x g for 1min., and the supernatant was removed. This step was performed for a total of 5 585

times. The proteins were eluted from the beads by addition of SDS-PAGE sample buffer. 586

587

Immunoblotting 588

Protein concentrations were determined by the PierceTM BCA protein assay (Thermo Fisher 589

Scientific). About 20µg of cell lysate samples and immunoprecipitated samples were loaded 590

onto the 8% acrylamide gel. After overnight transfer of the proteins from an SDS-gel to a 0.45 591


27

μm pore size polyvinylidene difluoride (PVDF) membrane, the membrane was blocked in for 1 592

hr at room temperature 5% non-fat dry milk dissolved in (Tris-buffered saline with Tween 20, 593

pH=8.0) (TBST) (Sigma-Aldrich). Mouse monoclonal anti-FLAG antibody (diluted 1:1000) and 594

mouse monoclonal anti-HckHCK antibody (diluted 1:1000) were added and the membrane 595

incubated overnight. For detection of bands in the cell lysate, rabbit anti-mouse IgG HRP-linked 596

secondary antibody (diluted 1:2000) (for anti-FLAG antibody) and mouse IgGκ binding protein-597

HRP secondary antibody (for anti-HckHCK antibody) (diluted 1:1000) were added, and the 598

membrane was incubated for 1 hr at room temperature. For immunoprecipitations, Clean-Blot™ 599

IP detection reagent (HRP) secondary antibody (1:300) (Thermo Fisher Scientific) was used. 600

The detection signal was visualized by using enhanced chemiluminescence (ECL) reagent 601

(Thomas Scientific, Swedesboro, NJ). Immoblots were analyzed by chemiluminescence on a 602

Bio-Rad ChemiDocTM Touch Gel imaging system (Bio-Rad, Hercules, CA). 603

604

Immunofluorescence 605

The A protocol for immunofluorescence was followed 606

(https://www.cellsignal.com/contents/resources-protocols/immunofluorescence-general-607

protocol/if), with the following modifications. cCoverslips were autoclaved and coated with 0.1 608

mg/ml of poly-D-lysine hydrobromide (mol wt 70,000-150,000) (Sigma-Aldrich). Cells were 609

plated onto the coverslips. The cells were fixed in 4% paraformaldehyde (Alfa Aesar, Ward Hill, 610

MA) in phosphate buffered saline (PBS) for 15 mins. And fFixation was stopped by adding 50 611

mM NH4Cl in PBS for 15 min at room temperature. After raising with PBS, the fFixed cells 612

were permeabilized by adding 0.5% Triton®-X-100 in PBS for 10 min. The cells were then 613

washed with PBS three times and blocked with 0.1% of BSA in PBS at room temperature for 1 614


28

hr. The rabbit monoclonal anti-FLAG antibody (diluted 1:100) and mouse monoclonal anti-615

HckHCK antibody (diluted 1:100) were added to each cover slip and incubated overnight. Goat 616

anti-mouse IgG (H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 488 617

(diluted 1:100) and goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody, conjugated to 618

Alexa Fluor 555 (1: 100) were added. After incubation with secondary antibodies for 1 hr, the 619

cells were washed five times with PBS. During the first step, DAPI (InvitrogenTM by Thermo 620

Fisher Scientific) was also added at 1:1000 in PBS for 2 min. Finally, the coverslips were 621

mounted in ProLong™ Gold Antifade mounting medium (Life Technologies Corporation by 622

Thermo Fisher Scientific, Eugene, OR). The stained slides were viewed on a ZEISS LSM 880 623

(Pleasanton, CA) with Airyscan. The images were viewed and processed using Fiji software 624

(623). 625

626

IPA diagram 627

Yeast two-hybrid data were analyzed by IPA software (QIAGEN Inc., 628

https://www.qiagenbioinformatics.com/products/ingenuity- pathway-analysis). 629

630

Statistical analysis 631

The Spearman coefficient and Pearson coefficient used for co-expression was generated by 632

cBioPortal website (37,38,634). Clinical samples from the Oncomine website 633

(https://www.oncomine.org) were downloaded and checked for NlrpNLRP12 and Hck mRNA 634

expression levels and HckHCK levels. The Fisher exact test and the odds ratio test used for co-635

occurrence were generated by the cBioPortal website. Analysis of variance (ANOVA) was 636

performed to check whether a significant difference of the treatment exists among all the groups. 637

https://www.oncomine.org/


29

A p-value < 0.05 was considered statistically significant. If P < 0.05, then the Tukey test was 638

used to determine whether a pair-wise difference exists. Quantification of the western blot bands 639

was performed by FIJI software (623) and made into graphs by Prism 6.0 (GraphPad Software, 640

Inc., San Diego, CA).641

642

Acknowledgement 643

Thank you to Dr. Houda Alachkar for providing valuable suggestions to this paper. We also 644

thank Ms. Meng Li and Dr. Yibu Chen at the University of Southern California’s Norris Medical 645

Library for their suggestions for bioinformatic analysis. Appreciation is given to Mr. Noam 646

Morningstar-Kywi and Dr. Ian Haworth for their helps on structural analysis. 647

648

Abbreviations 649

3-AT: , 3-Amino-1,2,4-triazole; AML: , acute myeloid leukemia; ANOVA: , analysis of variance; 650

ASC: , apoptosis-associated speck-like protein containing a caspase activation and 651

recruitment domain; ATCC: , American Type Culture Collection; C1:, self-named truncations of 652

C-terminal 40 (or 41) amino acids fragment of Srcc-SRC family non-receptor tyrosine kinases; 653

C2-C7 and N1-N5:, self-named truncations HckHCK C1 fragment; CD40:, cluster of 654

differentiation 40; CDK6:, cyclin D-dependent kinase; CFU;, colony-forming units; COSMIC, 655

catalogueCOSMIC: catalogue of somatic mutations in cancer; CsCl:, cesium chloride; DAMP: , 656

damage-associated molecular patterns; DAPI:, 4',6-diamidino-2-phenylindole, dihydrochloride; 657

DC: , dendritic cells; DO:, drop out (2DO: SD/-Trp-Leu; 4DO: SD/-Trp-Leu-His-Ade); ECL:, 658

enhanced chemiluminescence; FAf1: Fas associated factor 1; FLT3-ITD: FLT3-internal tandem 659

duplications; FLT3: , feline McDonough sarcoma (fms)-like tyrosine kinase 3; GSK3b:, 660


30

glycogen synthase kinase 3 beta; HCK C1 fragment:, HckHCK C-terminal 40 amino acids; 661

HCK: , hHematopoiesis cell kinase; HRP: , horseradish peroxidase; HSP90:, heat shock protein 662

90; IL: interleukin; IPA:, ingenuity pathway analysis; IRAK1:, IL-1 receptor-associated kinase 1; 663

KO:, knock out; KRAS; Ki-ras2 Kirsten rat sarcoma viral oncogene homolog; LRR: leucine rich 664

repeat domain; M1:, the amino acids in the R1 region were mutated to the amino acids identical 665

to the R1 region in Lyn; M2: , the amino acids in the R2 region were all mutated to Alanine; 666

M3: , the amino acids in the R3 region were all mutated to Alanine; M4: , the amino acids in the 667

R4 region were all mutated to Alanine; NBD:, nucleotide binding domain; NF-κB:, nuclear 668

factor kappa-light-chain-enhancer of activated B cells; NIK:, NF-κB-inducing kinase; NLR: , 669

nucleotide binding domain and leucine-rich repeat; NLRP: , NLR pyrin domain-containing 670

protein; PAMP:, pathogen-associated molecular patterns; PBS: phosphate buffered saline; PCR:, 671

polymerase chain reaction; PDB: , protein data bank; PMA: , phorbol 12-myristate 13-acetate; 672

PRR: , pattern recognition receptors; PVDF: , polyvinylidene difluoride; PYD:, pyrin domain; 673

R1, R2, R3, and R4:, self-named four regions in the HckHCK C terminal 40 amino acids 674

fragment; SD:, synthetic dropout; SD/-Trp-Leu:, SD base plus amino acids supplements minus 675

tryptophan and leucine; SD/-Trp-Leu-His-Ade:, SD base plus amino acids supplements minus 676

tryptophan, leucine, and histidine, and adenine; STRING: search tool for recurring instances of 677

neighboring genes; TBST: tris-buffered saline with Tween 20, pH=8.0; TCA:, trichloroacetic 678

acid; TCGA:, the cancer genome atlas; TLR:, toll-like receptor; TRAF3: , tumor necrosis factor 679

receptor associated factor 3; TRAF3IP3:, TRAF3 interacting protein 3; UBA:, ubiquitin-680

associated domains; WT: wild type; YPDA:, yeast extract, peptone, dextrose, and adenine 681

hemisulfate. 682

683


31

Conflict ofCompeting Interest 684

The authors have declared that no competing conflict exists. of interest regarding publication of 685

this article. 686

687

Author Contributions Statement 688

YZ design the experiment and wrote and revised the manuscript. CO helped to design the 689

experiments and to revise the manuscript. 690

691

References 692

1. Takeuchi, O., and Akira, S. (2010) Pattern recognition receptors and inflammation. Cell. 693

2010; 140:, 805-820. 694

2. Tuncer, S., Fiorillo, M. T., and Sorrentino, R. (2014) The multifaceted nature of NLRP12. 695

J Leukoc Biol. 2014; 96:, 991-1000. 696

3. Allen, I. C., Wilson, J. E., Schneider, M., Lich, J. D., Roberts, R. A., Arthur, J. C., 697

Woodford , R. M., Davis, B. K., Uronis, J. M,., Herfarth, H. H., Jobin, C., Rogers, A. B., 698

and Ting , J. P. (2012) NLRP12 suppresses colon inflammation and tumorigenesis 699

through the negative regulation of noncanonical NF-kappaB signaling. Immunity. 2012; 700

36:, 742-754. 701

4. Zaki, M. H., Vogel, P., Malireddi, R. K., Body-Malapel, M., Anand, P. K., Bertin, J., 702

Green, D. R., Lamkanfi, M., and Kanneganti, T. D. (2011) The NOD-like receptor 703

NLRP12 attenuates colon inflammation and tumorigenesis. Cancer Cell. 2011; 20:, 649-704

660. 705

5. Zaki, M. H., Man, S. M., Vogel, P., Lamkanfi, M., and Kanneganti, T. D. (2014) 706

Salmonella exploits NLRP12-dependent innate immune signaling to suppress host 707

defenses during infection. Proc Natl Acad Sci U S A. 2014; 111:, 385-390. 708

6. Chen, S. T., Chen, L., Lin, D. S., Chen, S. Y., Tsao, Y. P., Guo, H., Li, F. J., Tseng, W. 709

T., Tam, J. W., Chao, C. W., Brickey , W. J,., Dzhagalov, I., Song, M. J., Kang, H. R., 710

Jung, J. U., and Ting, J. P. (2019) NLRP12 rRegulates aAnti-viral RIG-I aActivation via 711

iInteraction with TRIM25. Cell Host Microbe. 2019; 25:, 602-616.e607. 712

7. Chen, L., Wilson, J. E., Koenigsknecht, M. J., Chou, W. C., Montgomery, S. A., Truax, 713

A. D., Brickey, W. J., Packey, C. D., Maharshak, N,., Matsushima, G. K., Plevy, S. E., 714

Young, V. B., Sartor, R. B., and Ting, J. P. (2017) NLRP12 attenuates colon 715

inflammation by maintaining colonic microbial diversity and promoting protective 716

commensal bacterial growth. Nat Immunol. 2017; 18:, 541-551. 717

8. Truax, A. D., Chen, L., Tam, J. W., Cheng, N., Guo, H., Koblansky, A. A., Chou, W. C., 718

Wilson, J. E., Brickey, W. J., Petrucelli, A., Liu, R., Cooper, D. E., Koenigsknecht, M. J,., 719

Young, V. B., Netea, M. G., Stienstra, R., Sartor, R. B., Montgomery, S. A., Coleman, R. 720


32

A., and Ting, J. P. (2018) The Inhibitory Innate Immune Sensor NLRP12 mMaintains a 721

tThreshold against oObesity by rRegulating gGut mMicrobiota hHomeostasis. Cell Host 722

Microbe. 2018; 24:, 364-378.e366. 723

9. Ye, Z., Lich, J. D., Moore, C. B., Duncan, J. A., Williams, K. L., and Ting, J. P. (2008) 724

ATP binding by monarch-1/NLRP12 is critical for its inhibitory function. Mol Cell Biol. 725

2008; 28:, 1841-1850. 726

10. Jeru, I., Le Borgne, G., Cochet, E., Hayrapetyan, H., Duquesnoy, P., Grateau , G., Morali, 727

A., Sarkisian, T., and Amselem, S. (2011) Identification and functional consequences of a 728

recurrent NLRP12 missense mutation in periodic fever syndromes. Arthritis Rheum. 729

2011; 63: , 1459-1464. 730

11. Jeru, I., Duquesnoy, P., Fernandes-Alnemri, T., Cochet, E., Yu, J. W., Lackmy-Port-Lis, 731

M., Grimprel, E., Landman-Parker, J., Hentgen, V., Marlin, S., McElreavey, K., Sarkisian, 732

T., Grateau, G., Alnemri, E. ES., and Amselem, S. (2008) Mutations in NALP12 cause 733

hereditary periodic fever syndromes. Proc Natl Acad Sci U S A. 2008; 105: , 1614-1619. 734

12. Arthur, J. C., Lich, J. D., Ye, Z., Allen, I. C., Gris, D., Wilson, J. E., Schneider, M., 735

Roney, K. E., O'Connor, B. P., Moore, C. B., Morrison, A., Sutterwala, F. S., Bertin, J., 736

Koller, B. H., Liu, Z., and Ting, J. P. (2010) Cutting edge: NLRP12 controls dendritic 737

and myeloid cell migration to affect contact hypersensitivity. J Immunol. 2010; 185:, 738

4515-4519. 739

13. Lukens, J. R., Gurung, P., Shaw, P. J., Barr, M. J., Zaki, M. H., Brown, S. A., Vogel, P., 740

Chi, H., and Kanneganti, T. D. (2015) The NLRP12 sSensor nNegatively rRegulates 741

aAutoinflammatory dDisease by mModulating iInterleukin-4 pProduction in T cCells. 742

Immunity. 2015; 42:, 654-664. 743

14. Vladimer, G. I., Weng, D., Paquette, S. W. M., Vanaja, S. K., Rathinam, V. A., Aune, M. 744

H., Conlon, J. E., Burbage, J. J., Proulx, M. K., and Liu, Q. (2012) The NLRP12 745

inflammasome recognizes Yersinia pestis. Immunity. 2012; 37:, 96-107. 746

15. Udden, S. N., Kwak, Y. T., Godfrey, V., Khan, M. A. W., Khan, S., Loof, N., Peng, L., 747

Zhu, H., and Zaki, H.. (2019) NLRP12 suppresses hepatocellular carcinoma via 748

downregulation of cJun N-terminal kinase activation in the hepatocyte. Elife. 2019; 8: 749

e40396. 750

16. Hornick, E. E., Banoth, B., Miller, A. M., Zacharias, Z. R., Jain, N., Wilson, M. E., 751

Gibson-Corley, K. N., Legge, K. L., Bishop, G. A., Sutterwala, F. S., and Cassel, S. L. 752

(2018) NLRP12Nlrp12 mMediates aAdverse nNeutrophil rRecruitment during iInfluenza 753

vVirus iInfection. J Immunol. 2018; 200:, 1188-1197. 754

17. Damiano, J. S., Oliveira, V., Welsh, K., and Reed, J. C. (2004) Heterotypic interactions 755

among NACHT domains: implications for regulation of innate immune responses. The 756

Biochemical journal. 2004; 381:, 213-219. 757

18. Janowski, A. M., Kolb, R., Zhang, W., and Sutterwala, F.F S. (2013) Beneficial and 758

dDetrimental rRoles of NLRs in cCarcinogenesis. Frontiers in immunology. 2013; 4:, 759

370-370. 760

19. Faustin, B., Lartigue, L., Bruey, J. M., Luciano, F., Sergienko, E., Bailly-Maitre, B., 761

Volkmann , N., Hanein, D., Rouiller, I., and Reed, J. C. (2007) Reconstituted NALP1 762

inflammasome reveals two-step mechanism of caspase-1 activation. Mol Cell. 200; 25:, 763

713-724. 764


33

20. Martinon, F., Agostini, L., Meylan, E., and Tschopp, J. (2004) Identification of bacterial 765

muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr Biol. 2004; 766

14:, 1929-1934. 767

21. Kanneganti, T. D., Lamkanfi, M., and Nunez, G. (2007) Intracellular NOD-like receptors 768

in host defense and disease. Immunity. 2007; 27:, 549-559. 769

22. Sharif, H., Wang, L., Wang, W. L., Magupalli, V. G., Andreeva, L., Qiao, Q., Hauenstein, 770

A. V., Wu, Z., Núñez, G., Mao, Y., and Wu, H. (2019) Structural mechanism for NEK7-771

licensed activation of NLRP3 inflammasome. Nature. 2019; 570:, 338-343. 772

23. Hafner-Bratkovič, I., Sušjan, P., Lainšček, D., Tapia-Abellán, A., Cerović, K., Kadunc, 773

L., Angosto-Bazarra, D., Pelegrin, P., and Jerala, R. (2018) NLRP3 lacking the leucine-774

rich repeat domain can be fully activated via the canonical inflammasome pathway. 775

Nature Communications. 2018; 9:, 5182. 776

24. Roversi, F. M., Pericole, F. V., Machado-Neto, J. A., da Silva Santos Duarte, A., 777

Longhini, A. L., Corrocher, F. A., Palodetto, B., Ferro, K. P., Rosa, R. G., Baratti, M. O., 778

Verjovski-Almeida, S., Traina, F., Molinari, A., Botta, M., and Saad, S. T. (2017) 779

Hematopoietic cell kinase (HCK) is a potential therapeutic target for dysplastic and 780

leukemic cells due to integration of erythropoietin/PI3K pathway and regulation of 781

erythropoiesis: HCK in erythropoietin/PI3K pathway. Biochim Biophys Acta Mol Basis 782

Dis. 2017; 1863:, 450-461. 783

25. Lopez, S., Voisset, E., Tisserand, J. C., Mosca, C., Prebet, T., Santamaria, D., Dubreuil, 784

P., and De Sepulveda, P. (2016) An essential pathway links FLT3-ITD, HCK and CDK6 785

in acute myeloid leukemia. Oncotarget. 2016; 7:, 51163-51173. 786

26. Roversi, F. M., Pericole, F. V., Duarte, A. d. S. S., Ferro, K. P., Corrocher, F. A., 787

Palodetto, B., Longhini , A. L., Botta, M., and Saad, S. T. O. (2015) Knockdown of HCK 788

rReduces cCell dDeath and eErythroid dDifferentiation in hHuman CD34+ 789

hHematopoietic pProgenitor cCells. Blood. 2015; 126:, 2860. 790

27. Normand, S., Waldschmitt, N., Neerincx, A., Martinez-Torres, R. J., Chauvin, C., 791

Couturier-Maillard, A., Boulard, O., Cobret, L., Awad, F., Huot, L., Ribeiro-Ribeiro, A., 792

Lautz, K., Ruez, R., Delacre, M., Bondu, C., Guilliams, M., Scott, C., Segal, A., 793

Amselem, S., Hot, D., Karabina, S., Bohn, E., Ryffel, B., Poulin, L. F., Kufer, T. A., and 794

Chamaillard, M. (2018) Proteasomal degradation of NOD2 by NLRP12 in monocytes 795

promotes bacterial tolerance and colonization by enteropathogens. Nature 796

Communications. 2018; 9:, 5338. 797

28. Linz, B. M., Neely, C. J., Kartchner , L. B., Mendoza, A. E., Khoury, A. L., Truax, A., 798

Sempowski, G., Eitas, T., Brickey, J., Ting , J. P., Cairns, B. A., and Maile, R. (2017) 799

Innate iImmune cCell rRecovery iIs pPositively rRegulated by NLRP12 during 800

eEmergency hHematopoiesis. J Immunol. 2017; 198:, 2426-2433. 801

29. Robbins, S. M., Quintrell, N. A., and Bishop, J. M. (1995) Myristoylation and differential 802

palmitoylation of the HCK protein-tyrosine kinases govern their attachment to 803

membranes and association with caveolae. Mol Cell Biol. 1995; 15:, 3507-3515. 804

30. Carreno, S., Gouze, M. E., Schaak, S., Emorine, L. J., and Maridonneau-Parini, I. (2000) 805

Lack of palmitoylation redirects p59HCKHck from the plasma membrane to 806

p61HCKHck-positive lysosomes. J Biol Chem. 2000; 275:, 36223-36229. 807

31. Guiet, R., Poincloux, R., Castandet, J., Marois, L., Labrousse, A., Le Cabec, V., and 808

Maridonneau-Parini, I. (2008) Hematopoietic cell kinase (HCKHck) isoforms and 809


34

phagocyte duties - from signaling and actin reorganization to migration and phagocytosis. 810

Eur J Cell Biol. 2008; 87:, 527-542. 811

32. Sicheri, F., Moarefi, I., and Kuriyan, J. (1997) Crystal structure of the c-SRCSrc family 812

tyrosine kinase HCKHck. Nature. 1997; 385:, 602-609. 813

33. Ma , B., Elkayam, T., Wolfson, H., and Nussinov, R. (2003) Protein–protein interactions: 814

Structurally conserved residues distinguish between binding sites and exposed protein 815

surfaces. Proceedings of the National Academy of Sciences Proc Natl Acad Sci U S A. 816

2003; 100:, 5772. 817

34. Knappe, M., Bodevin, S., Selinka, H. C., Spillmann, D., Streeck, R. E., Chen, X. S,., 818

Lindahl, U., and Sapp, M. (2007) Surface-exposed amino acid residues of HPV16 L1 819

protein mediating interaction with cell surface heparan sulfate. J Biol Chem. 2007; 282:, 820

27913-27922. 821

35. Lich, J. D., Williams, K. L., Moore, C. B., Arthur, J. C., Davis, B. K., Taxman, D. J., and 822

Ting, J. P. (2007) Monarch-1 suppresses non-canonical NF-kappaB activation and p52-823

dependent chemokine expression in monocytes. J Immunol. 2007; 178:, 1256-1260. 824

36. Cerami, E., Gao, J,., Dogrusoz, U., Gross, B. E., Sumer, S. O., Aksoy, B. A., Jacobsen, 825

A., Byrne, C. J., Heuer, M. L., Larsson, E., Antipin, Y., Reva, B., Goldberg, A. P., 826

Sander, C., and Schultz, N. (2012) The cBio Cancer Genomics Portal: An oOpen 827

pPlatform for eExploring mMultidimensional cCancer gGenomics dData. Cancer 828

Discovery. 2012; 2:, 401. 829

37. Gao, J., Aksoy, B. A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S. O., Sun, Y., 830

Jacobsen, A., Sinha, R., Larsson, E., Cerami, E., Sander, C., and Schultz, N. (2013) 831

Integrative analysis of complex cancer genomics and clinical profiles using the 832

cBioPortal. Sci Signal. 2013; 6:, pl1. 833

38. Cancer Genome Atlas Research Network. (2013) Genomic and eEpigenomic lLandscapes 834

of aAdult dDe nNovo aAcute mMyeloid lLeukemia. NEJMNew England Journal of 835

Medicine. 2013, 368:, 2059-2074. 836

39. Williams, K. L., Lich, J. D., Duncan, J. A., Reed, W., Rallabhandi, P., Moore, C., Kurtz, 837

S., Coffield , V. M., Accavitti-Loper, M. A., Su, L., Vogel, S. N., Braunstein, M., and 838

Ting, J. P. (2005) The CATERPILLER protein monarch-1 is an antagonist of toll-like 839

receptor-, tumor necrosis factor alpha-, and Mycobacterium tuberculosis-induced pro-840

inflammatory signals. J Biol Chem. 2005; 280: , 39914-39924. 841

40. Arthur, J. C., Lich, J. D., Aziz, R. K., Kotb, M., and Ting, J. P. (2007) Heat shock protein 842

90 associates with monarch-1 and regulates its ability to promote degradation of NF-843

kappaB-inducing kinase. J Immunol. 2007; 179:, 6291-6296. 844

41. Pinheiro, A. S., Eibl, C., Ekman-Vural, Z., Schwarzenbacher, R., and Peti, W. (2011) The 845

NLRP12 pyrin domain: structure, dynamics, and functional insights. Journal of molecular 846

biology. 2011; 413:, 790-803. 847

42. Kinoshita, T., Kondoh, C., Hasegawa, M., Imamura, R., and Suda, T. (2006) Fas-848

associated factor 1 is a negative regulator of PYRIN-containing Apaf-1-like protein 1. Int 849

Immunol. 2006; 18:, 1701-1706. 850

43. Shi , C., Miley , J., Nottingham, A., Morooka, T., Prosdocimo, D. A., and Simon, D. I. 851

(2019) Leukocyte integrin signaling regulates FOXP1 gene expression via FOXP1-IT1 852

long non-coding RNA-mediated IRAK1 pathway. Biochim Biophys Acta Gene Regul 853

Mech. 2019; 1862:, 493-508. 854

https://www.ncbi.nlm.nih.gov/pubmed/?term=Cancer%20Genome%20Atlas%20Research%20Network%5BCorporate%20Author%5D


35

44. Fu, G., Xu , Q., Qiu, Y., Jin, X., Xu, T., Dong, S., Wang, J., Ke, Y., Hu, H., Cao, X., 855

Wang, D., Cantor , H., Gao, X., and Lu, L. (2017) Suppression of Th17 cell 856

differentiation by misshapen/NIK-related kinase MINK1. J Exp Med. 2017; 214:, 1453-857

1469. 858

45. Wang, Q., Liu, F., Zhang, M., Zhou, P., Xu, C., Li, Y., Bian, L., Liu, Y., Yao, Y., Wang, 859

F., Fang, Y., and Li, D. (2018) NLRP12 pPromotes mMouse nNeutrophil 860

dDifferentiation through rRegulation of nNon-canonical NF-kappaB and MAPK(ERK1/2) 861

sSignaling. Int J Biol Sci. 2018; 14:, 147-155. 862

46. Kinnaird, J. H., Singh, M., Gillan, V., Weir, W., Calder, E. D., Hostettler, I., Tatu, U., 863

Devaney, E,., and Shiels, B. R. (2017) Characterization of HSP90 isoforms in 864

transformed bovine leukocytes infected with Theileria annulata. Cell Microbiol. 2017; 19: 865

e12669. 866

47. Ryu, S. W., Lee, S. J., Park, M. Y., Jun, J. I., Jung, Y. K., and Kim, E. (2003) Fas-867

associated factor 1, FAF1, is a member of Fas death-inducing signaling complex. J Biol 868

Chem. 2003; 278:, 24003-24010. 869

48. Martin, B. N., Wang, C., Zhang, C. J., Kang, Z., Gulen, M. F., Zepp, J. A., Zhao, J., Bian, 870

G., Do, J. S., Min, B., Pavicic, P. G., Jr., El-Sanadi, C., Fox, P. L., Akitsu, A., Iwakura , 871

Y., Sarkar, A., Wewers, M. D., Kaiser, W. J., Mocarski, E. S., Rothenberg, M. E., Hise, 872

A. G., Dubyak, G. R., Ransohoff, R. M., and Li, X. (2016) T cell-intrinsic ASC critically 873

promotes T(H)17-mediated experimental autoimmune encephalomyelitis. Nat Immunol. 874

2016; 17:, 583-592. 875

49. Prada-Arismendy, J., Arroyave, J. C., and Rothlisberger, S. (2017) Molecular biomarkers 876

in acute myeloid leukemia. Blood Rev. 2017; 31:, 63-76. 877

50. Poh, A. R., O'Donoghue, R. J., and Ernst, M. (2015) Hematopoietic cell kinase (HCK) as 878

a therapeutic target in immune and cancer cells. Oncotarget. 2015; 6:, 15752-15771. 879

51. Dos Santos, C., Demur, C., Bardet, V., Prade-Houdellier, N., Payrastre, B., and Récher, C. 880

(2008) A critical role for LYNLyn in acute myeloid leukemia. Blood. 2008; 111:, 2269. 881

52. Greenbaum, D., Colangelo, C,., Williams, K., and Gerstein, M. (2003) Comparing 882

protein abundance and mRNA expression levels on a genomic scale. Genome Biol. 2003; 883

4:, 117. 884

53. Vogel, C., and Marcotte, E. M. (2012) Insights into the regulation of protein abundance 885

from proteomic and transcriptomic analyses. Nat Rev Genet. 2012; 13:, 227-232. 886

54. Liu, Y., Beyer , A., and Aebersold, R. (2016) On the dDependency of cCellular pProtein 887

lLevels on mRNA aAbundance. Cell. 2016; 165:, 535-550. 888

55. Prochnicki, T., and Latz, E. (2017) Inflammasomes on the cCrossroads of iInnate 889

iImmune rRecognition and mMetabolic cControl. Cell Metab. 2017; 26:, 71-93. 890

56. Saito, Y., Yuki, H., Kuratani, M., Hashizume, Y., Takagi, S., Honma , T., Tanaka, A., 891

Shirouzu , M., Mikuni, J., Handa, N., Ogahara, I., Sone, A., Najima, Y., Tomabechi, Y., 892

Wakiyama, M., Uchida, N., Tomizawa-Murasawa, M., Kaneko, A., Tanaka, S,., Suzuki, 893

N., Kajita , H., Aoki , Y., Ohara, O., Shultz, L. D., Fukami, T., Goto, T., Taniguchi, S., 894

Yokoyama, S., and Ishikawa, F. (2013) A pyrrolo-pyrimidine derivative targets human 895

primary AML stem cells in vivo. Sci Transl Med. 2013; 5:, 181ra152. 896

57. Patel, R. K., Weir, M., Hellwig, S., Dorman, H., and Smithgall, T. E. (2017) Abstract 897

2363: Targeting Src-family kinases to combat acquired inhibitor resistance in FLT3-898

ITD+ AML. Cancer Research 77, 2363-2363. 899


36

5758. Pene-Dumitrescu, T., Peterson, L. F., Donato, N. J., and Smithgall, T. E. (2008) An 900

inhibitor-resistant mutant of HCKHck protects CML cells against the antiproliferative 901

and apoptotic effects of the broad-spectrum c-SRCSrc family kinase inhibitor A-419259. 902

Oncogene. 2008; 27:, 7055-7069. 903

5859. Naganna , N., Opoku-Temeng, C., Choi, E. Y., Larocque, E., Chang, E. T., Carter-904

Cooper, B. A., Wang, M., Torregrosa-Allen, S. E., Elzey, B. D., Lapidus, R. G., and 905

Sintim, H. O. (2019) Amino alkynylisoquinoline and alkynylnaphthyridine compounds 906

potently inhibit acute myeloid leukemia proliferation in mice. EBioMedicine. 2019; 40:, 907

231-239. 908

5960. Hu , Y., Liu , Y., Pelletier, S., Buchdunger, E., Warmuth, M., Fabbro, D., Hallek, M., 909

Van Etten, R. A., and Li, S. (2004) Requirement of c-SRCSrc kinases LYNLyn, 910

HCKHck and FGRFgr for BCR-ABL1-induced B-lymphoblastic leukemia but not 911

chronic myeloid leukemia. Nat Genet. 2004; 36:, 453-461. 912

601. Hobbs, S., Jitrapakdee, S., and Wallace, J. C. (1998) Development of a bBicistronic 913

vVector dDriven by the hHuman pPolypeptide cChain eElongation fFactor 1α pPromoter 914

for cCreation of sStable mMammalian cCell lLines tThat eExpress vVery hHigh lLevels 915

of rRecombinant pProteins. Biochem Biophys Res Commun. Biochemical and 916

Biophysical Research Communications1998; 252:, 368-372. 917

612. Brakke, M. K. (1951) Density Gradient Centrifugation: A New Separation Technique1. 918

Journal of the American Chemical SocietyJACS. 1951; 73:, 1847-1848. 919

623. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., 920

Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., 921

Hartenstein, V., Eliceiri, K., Tomancak, P., and Cardona, A. (2012) Fiji: an open-source 922

platform for biological-image analysis. Nat Methods. 2012; 9:, 676-682. 923

634. Cerami, E., Gao, J., Dogrusoz, U., Gross, B. E., Sumer, S. O., Aksoy, B. A., Jacobsen, A., 924

Byrne, C. J,., Heuer, M. L., Larsson, E., Antipin, Y., Reva, B., Goldberg, A. P., Sander, 925

C., and Schultz, N. (2012) The cBio cancer genomics portal: an open platform for 926

exploring multidimensional cancer genomics data. Cancer Discov. 2012; 2: , 401-404. 927

928

Table 1: yeast two hybrid results (hit frequency >= 3) 929

Name Frequency

Deleted in azoospermia (DAZ) associated protein 2 (DAZAP2) 10

Filamin A, alpha (FLNA) 9

Hematopoietic cell kinase (HCK) proto-oncogene, Srcc-SRC family tyrosine kinase

(HCK) 9

Chaperone DnaJ (a.k.a., heat shock protein 40 kD(Hsp40)) homolog, subfamily B,

member 1 (DNAJB1) 9


37

Metallothionein 2A (MT2A) 7

Cluster of differentiation 14 molecule (CD14) 6

DEAD (Asp-Glu-Ala-Asp) box helicase 5 (DDX5) 6

Talin 1 (TLN1) 5

Calcium modulating ligand (CAMLG) 4

Squamous cell carcinoma antigen recognized by T cells (SART1) 4

Ras-related nuclear protein (RAN) binding protein 9 (RANBP9) 3

Tumor necrosis factor (TNF) receptor associated factor 3 (TRAF3) interacting protein 3

(TRAF3IP3) 3

Thyroid hormone receptor interactor 4 (TRIP4) 3

930

Table 2: Co-occurrence of mRNA expression level of HckHCK and all of the NlrpNLRP 931

family proteins (from the provisional data, assessed on July 11 2019) 932

HckHCK +

NlrpNLRP family

genesproteins

Co-occurrence (C) or

mutual exclusivity (M)

P-value

NlrpNLRP1 C 0.048

NlrpNLRP2 M 0.546

NlrpNLRP3 C 0.415

NlrpNLRP4 M 0.936

NlrpNLRP5 M 0.877

NlrpNLRP6 M 0.670


38

NlrpNLRP7 M 0.475

NlrpNLRP8 M 0.877

NlrpNLRP9 M 0.491

NlrpNLRP10 M 0.626

NlrpNLRP11 M 0.233

NlrpNLRP12 C <0.001

NlrpNLRP13 C 1.000

NlrpNLRP14 M 0.509

933

934

935

Table 3: Primers used in cloning (The underline shows the restriction enzymes) 936

Name Primers

NlrpNLRP12 5’ primer

(cloned into PGBKT7)

GATCTACATATGCTACGAACCGCAGGCAG



GATGTAGTCGACTCACCCCTCGTCCAGGATATAGTACATAGCT


(cloned into pGBKT7)

GATCTACATATGAAGATGGCAAGCACCCGCTGCA



GATGTAGGATCCTCACAGCAGGTAGTACATGGCGGCAAAGA

NlrpNLRP8 5’ primer GATCTAGAATTCATGAGTGACGTGAATCCACCCTCTG


39

(cloned into pGBKT7)



GATGTAGGATCCTCAGAGTCTTTGTGGGAAACAGAGAACA

NlrpNLRP12 5’ (cloned

into pEFIRES-P-3FLAG

and pIRES-V5)

GTCCAGCTTAAGATGCTACGAACCGCAGGCAG

NlrpNLRP12 3’ (cloned

into PIRES-3FLAG and

pEFIRES-P-V5)

CTGAATTCTAGAGCAGCCAATGTCCAAATAAGG

HckHCK p61 5’ (cloned

into pEFIRES-P-3FLAG)

GATCTACTTAAGGCCACCATGGGGGGGCGCTCAAGCTGCGAGG

HckHCK p59 5’ (cloned


GATCTACTCGAGGCCACCATGGGGTGCATGAAGTCCAAGTTCC

HckHCK p61/p59 3’

(cloned into pEFIRES-P-

3FLAG)

GTCGATTCTAGATGGCTGCTGTTGGTACTGGCTCTCT

937

Figure legends: 938

Figure 1: (A) Schematic drawing of the domain structure of full-length NlrpNLRP12 (top) and 939

the domains used as the construct for the yeast two-hybrid screen (bottom). PYD: Pyrin domain; 940

NBD: Nucleotide binding domain; and LRR: Leucine rich repeat domain. (B) The domain structures 941

of the two alternatively spliced isoforms of HckHCK, HckHCK p59 and HckHCK p61. (C) 942

Identification of the clones of HckHCK interacting with NlrpNLRP12 (“hits”) obtained from the 943


40

yeast two-hybrid screen. Among the nine of the clones positive for HCKHck, one clone encoded 944

for the smallest interacting fragment of HCKck, the C-terminal 40 amino acids of HCKck. The 945

numbers in parentheses indicate the total number of hits obtained in the screen. 946

947

Figure 2: Specificity of binding of NlrpNLRP12 with HCKck. (A) Schematic drawing of 948

HCKck (p61 isoform, top) and, for comparison, the region of HCKck (“HCKck C1 fragment,” 949

lower) used for testing the specificity of binding of HCKck to other members of the NlrpNLRP 950

family of proteins. The numbers represent the amino acid residues of the protein or protein 951

fragment (B) Phylogenetic tree showing the relationships among the PYD + NBD region of all of 952

the members of the human NlrpNLRP family of proteins. The phylogenetic tree was produced 953

through Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/). For each NlrpNLRP family 954

member, the PYD + NBD of the longest isoform was selected for generating the phylogenetic 955

tree. NlrpNLRP3 is phylogenetically the closest NlrpNLRP to NlrpNLRP12, while NlrpNLRP8 956

is phylogenetically among the most distant from NlrpNLRP12. NlrpNLRP3 and NlrpNLRP8 957

arewere highlighted in red color. (C) When NlrpNLRP12’s PYD + NBD and HCKck C1 958

fragment were co-transformed into yeast, they grew on the highest stringency plates (4DO + 959

3AT), consistent with an interaction between the two constructs. On the other hand, neither 960

NlrpNLRP3’s PYD + NBD co-transformed with the C1 fragment nor NlrpNLRP8’s PYD + NBD 961

co-transformed the C1 fragment grew on the highest stringency plates. These results are 962

consistent with a specific interaction between NlrpNLRP12 and the HCKck C1 fragment, but not 963

with the other NlrpNLRPs. (D) Yeast clones grew on the high stringency plates 4DO + 3AT 964

when HCKck’s C1 fragment and NlrpNLRP12’s PYD + NBD were co-transformed, but they did 965

not grow on the high stringency 4DO + 3AT plates when the C1 fragments of other members of 966

https://www.ebi.ac.uk/Tools/msa/clustalo/


41

the Sc-SRCrc family of non-receptor tyrosine kinases were co-transformed with NlrpNLRP12’s 967

PYD + NBD. These results are again consistent with a specific interaction between 968

NlrpNLRP12 and HCKck. 969

970

Figure 3: (A) Structure of the HCKck C1 fragment generated by Chimera from the University 971

of California, San Francisco (version 1.13.1), extracted from its structure within the entire 972

HCKck protein. HCKck C1 fragment was thus divided into four helical domains: R1, R2, R3, 973

and R4. The side chains of amino acids F503, I506, Q507, L510, and D511 are shown. However, 974

it is not clear whether the C1 fragment retains the structural features shown here when it 975

expressed on its own. (B) Primary amino acid sequence alignments showing of the C1 fragments 976

of all members of the Sc-SRCrc non-receptor tyrosine kinase family (40 amino acids for HCKck, 977

BLKlk, LCKck, and LYNyn; 42 amino acids for FGRgr, Sc-SRCrc, YESes, and FYNyn). The 978

black lines indicate the R1, R2, R3, or R4 regions. The arrows denote the four critical amino 979

acids for binding of HCKck C1 fragment to NlrpNLRP12’s PYD + NBD. (C) Phylogenetic tree 980

showing the relationship among all of the C1 fragments of the members of the Sc-SRCrc family 981

of non-receptor tyrosine kinases. The phylogenetic tree was produced through Clustal Omega 982

(https://www.ebi.ac.uk/Tools/msa/ clustalo/). HCKck iswas highlighted in red color. (D) Four 983

sets of distinct mutations were made within the HCKck C1 fragment. M1: the amino acids in the 984

R1 region were mutated to the amino acids identical to the R1 region in LYNyn (highlighted in 985

red color); M2: the amino acids in the R2 region were all mutated to alanine (Ala); M3: the 986

amino acids in the R3 region were all mutated to Ala; and M4: the amino acids in the R4 region 987

were all mutated to Ala. (E) Yeast did not grow on high stringency 4DO + 3AT plates when 988

HCKck C1 fragment with the M3 mutations was co-transformed with NlrpNLRP12’s PYD + 989


42

NBD. But yeast can grow on the high stringency 4DO + 3AT plates when the HCKck C1 990

fragment contained either the M1, M2, or M4 mutations, suggesting that the R3 region within the 991

C1 fragment was necessary for binding to NlrpNLRP12 NBD + PYD. (E) Yeast did not grow on 992

high stringency 4DO plates when NlrpNLRP12’s PYD + NBD was co-transformed with HCKck 993

C1 fragment with single Ala substitutions at either F503, I506, Q507, L510, or D511. But yeast 994

grew on high stringency 4DO plates when NlrpNLRP12’s PYD + NBD was co-transformed with 995

HCKck’s C1 fragment in which the following amino acids in the R3 region were individually 996

mutated to Ala: E504, Y505, S508, or V509. Yeast did not grow on either 2DO nor 4DO plates 997

when NlrpNLRP12’s PYD + NBD was co-transformed with Hck C1 fragment in which either 998

E504 or I506 was individually mutated to Ala, making the results with these particular mutants 999

inconclusive. 1000

1001

Figure 4: (A) Top: sSchematic drawing of HCKck truncations comprising the C1 to C7 1002

fragments. Bottom: . (B) yYeast grew on the high stringency 4DO plates and 4DO +3AT plates 1003

when HCKck’s C-terminal 40 amino acid fragment (C1), HCKck’s C-terminal 35 amino acid 1004

fragment (C2), and HCKck’s C-terminal 30 amino acid fragment (C3), individually, were co-1005

transformed with NlrpNLRP12’s PYD + NBD. But yeast did not grow on the high stringency 1006

4DO plates nor 4DO+ 3AT plates when C4 to C7 fragments were co-transformed to with 1007

NlrpNLRP12’s PYD + NBD. The lack of yeast growth upon co-transformation of the C7 1008

fragment and NlrpNLRP12 are not shown. (BC) Top: sSchematic drawing of Hck truncations 1009

comprising the N1 to N5 fragments. Bottom:(D) yYeast grew on the high stringency 4DO plates 1010

and 4DO +3AT plates when HCKck’s C-terminal 40 amino acid fragment (C1) was co-1011

transformed with NlrpNLRP12’s PYD + NBD (control). But yeast did not grow on the high 1012


43

stringency 4DO plates nor 4DO+ 3AT plates when N1 and N5 fragments were co-transformed 1013

to with NlrpNLRP12’s PYD + NBD, suggesting that the very C-terminal 5 amino acids are also 1014

necessary for binding of NlrpNLRP12. The colored boxes represent different fragments that 1015

were deleted each time. 1016

1017

Figure 5: NlrpNLRP12 co-immunoprecipitates with HCKck and co-localizes with HCKck by 1018

immunofluorescence. (A) NlrpNLRP12 co-immunoprecipitated with HCKck when both proteins 1019

were transiently exogenously co-expressed in 293T cells, with NlrpNLRP12 having to be 1020

expressed as epitope-tagged forms. Cells were lysed using a non-denaturing cell lysis buffer (see 1021

Material and Methods). Co-immunoprecipitations were done using a mouse monoclonal anti-1022

HCKck antibody followed by protein A/G agarose. The immunoprecipitated proteins were 1023

analyzed by immunoblotting. The same method was used for experiments shown in (B), (C), 1024

and (D). (B) NlrpNLRP12 co-immunoprecipitated with endogenous HCKck in macrophage-like 1025

RAW 264.7 cells, when NlrpNLRP12 is exogenously and stably expressed. Arrows show the 1026

two isoforms of HCKck p59 and p61 that were immunoprecipitated by the anti-HCKck antibody, 1027

although it is not clear whether NlrpNLRP12 co-immunopreciptitated with one form or the other, 1028

or both. (C) Exogenously and stably expressed NlrpNLRP12 co-immunoprecipitated with 1029

endogenously expressed HCKck in monocyte-like THP-1 cells. In these cells, phorbol 12-1030

myristate 13-acetate (PMA) (1µM) was added to enhance the expression of NlrpNLRP12 under 1031

the PMA-sensitive cytomegalovirus promoter of the NlrpNLRP12 plasmid. (D) Left panel 1032

shows that NlrpNLRP12 was exogenously and stably expressed in lymphoblast-like U937 cells. 1033

Right panel shows that NlrpNLRP12 co-immunoprecipitated with endogenously expressed 1034

HCKck in U937 cells after PMA was added to 1µM, as was done for THP-1 cells, to enhance 1035


44

expression of NlrpNLRP12. (E) Immunofluorescent images showing the colocalization of a 1036

cohort of NlrpNLRP12 with either HCKck p59 or p61. HCKck was immunolabeled with a 1037

mouse monoclonal anti-HCKck antibody, followed by a secondary goat anti-mouse IgG (H+L) 1038

cross-adsorbed, conjugated to Alexa Fluor 488. For NlrpNLRP12, the primary antibody was a 1039

rabbit monoclonal anti-FLAG antibody, and the secondary antibody was a goat anti-rabbit IgG 1040

(H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555. Nuclei were 1041

counterstained by DAPI. 1042

1043

Figure 6: The co-expression of HCKck protein significantly decreased the steady-state protein 1044

expression levels of NlrpNLRP12 (A) Epitope-tagged NlrpNLRP12-V5 and HCKck p61 were 1045

co-transfected into 293T cells. Cell lysates were immunoblotted with rabbit monoclonal anti-V5 1046

antibody for NlrpNLRP12 and mouse monoclonal anti-HCKck antibody. Comparing lane 2 1047

(basal level of NlrpNLRP12 expression) with lanes 5, 6, and 7, co-expression of HCK ck protein 1048

leads to a significant decrease of protein expression levels of NlrpNLRP12 over three times they 1049

are they co-expressed. Increasing protein expression of HCKck, relative to the plasmid DNA 1050

added (ramp: lanes 5, 6, and 7; 2.5-20 μg of DNA) was not observed possibly because the 1051

amount of plasmid for HCKHck transfection were already too high, resulting in the maximum 1052

expression of HCKck’s at all plasmid DNA amounts. The figure is a representative of one of 1053

threethe results from three experiments. (B) Quantification of the NlrpNLRP12 protein bands 1054

(mean + standard error) to show that NlrpNLRP12 protein expression levels decreased in the 1055

presence of co-expressed HCKck, relative to equal amounts of cell lysate being assayed. The 1056

NlrpNLRP12 protein expression levels are indicated as arbitrary units. (C) Quantification of the 1057

HCKck protein bands (mean + standard error) confirming that HCKck protein expression levels 1058


45

did not change although the amount of plasmid DNA for HCK Hck increased. Figure (B) and 1059

(C) were generated by Prism 6.0 (GraphPad Software, Inc., San Diego, CA). Twenty μg of cell 1060

lysate proteins were loaded for each lane. ANOVA and Tukey tests were used to compare the 1061

NlrpNLRP12 and HCKck protein bands. 1062

1063

Figure 7: NlrpNLRP12 is co-expressed with Hck in acute myeloid leukemia (AML) patient 1064

samples. Both NlrpNLRP12 expression and Hck expression data are shown as log2 values. The 1065

data are RNA seq data obtained from cBioportal (provisional) database assessed on July 11, 1066

2019. The graph was taken from the cBioportal website. Spearman coefficient, indicating the 1067

association of NlrpNLRP12 and Hck mRNA expression level (if NlrpNLRP12 and Hck mRNA 1068

expression levels are non-parametric) = 0.80. Pearson coefficient, indicating the degree of the 1069

linear relationship between the NlrpNLRP12 mRNA expression level and Hck mRNA expression 1070

level (if NlrpNLRP12 and Hck mRNA expression levels are parametric) = 0.73. The p-values for 1071

Spearman coefficient and Pearson coefficient are both < 0.001. 1072

1073

Figure 8: (A) Ingenuity Pathway Analysis (IPA) displaying the 13 distinctive hits from the total 1074

results of the yeast two-hybrid screen for proteins that interacted with NlrpNLRP12. The figure 1075

only shows the NlrpNLRP12-interacting proteins with hits that have a frequency larger than 2. 1076

The solid lines indicate interacting proteins found through our yeast two-hybrid screen. The 1077

dashed lines are the NlrpNLRP12-interacting proteins previously reported in published data. 1078

The purple-colored molecules are those associated with AML. (B) To validate an interaction 1079

shown in the IPA diagram, tumor necrosis factor receptor-associated factor 3 interacting protein 1080

3 (TRAF3IP3)-3FLAG and NlrpNLRP12-V5 were co-immunoprecipitated from co-transfected 1081


46

293T cells. A non-denaturing cell lysate buffer (see Material and Methods) was used to lyse the 1082

cell, and co-immunoprecipitations were performed with a mouse monoclonal anti-TRAF3IP3 1083

antibody followed by protein A/G agarose. The immunoprecipitates were analyzed for 1084

NlrpNLRP12 by immunoblotting with rabbit monoclonal anti-V5 antibody. The results from the 1085

co-immunoprecipitation are consistent with a confirmation of an interaction between TRAF3IP3 1086

and NlrpNLRP12. 1087

1088

1089

1090

1091

1092


47

1093

1094


48

1095

Figure 1 1096

1097

1098

1099

1100

1101

1102

1103

1104

1105


49

1106


50

1107

Figure 2 1108

1109

1110

1111


51

1112

1113

Figure 3 1114


52

1115

Figure 3 1116


53

1117

1118

1119


54

1120

Figure 4 1121

1122


55

1123


56

1124

Figure 5 1125

1126


57

1127


58

1128

Figure 6 1129


59

1130


60

1131

Figure 7 1132

1133

1134

1135

1136

1137

1138

1139

1140


61

1141


62

1142

Figure 8 1143

1144

1





2



5

*Correspondence: 6

Yue Zhang 7

[email protected] 8

9

Running title: NLRP12 binds to HCK 10

11

Key words: yeast two-hybrid, innate immunity, protein‐protein interaction, NLRP12, HCK, 12

acute myeloid leukemia13

14

15

Abstract 16


and leucine-rich repeat (LRR), pyrin domain (PYD)-containing family of proteins 12 (NLRP12). 18

cDNA encoding the human PYD + NBD of NLRP12 was used as bait in a yeast two-hybrid 19


NLRP12 binds to HCK

2

screen with a human leukocyte cDNA library as prey. Hematopoiesis cell kinase (HCK), a 20

member of the c-SRC family of non-receptor tyrosine kinases, was among the top hits. The C-21

terminal 40 amino acids of HCK specifically bound to NLRP12’s PYD + NBD, but not to that of 22

NLRP3 and NLRP8. Amino acids F503, I506, Q507, L510, and D511 of HCK are critical for the 23

binding of HCK’s C-terminal 40 amino acids to NLRP12’s PYD + NBD. Additionally, the C-24

terminal 30 amino acids of HCK are sufficient to bind to NLRP12’s PYD + NBD, but not to its 25

PYD alone nor to its NBD alone. In cell lines that express HCK endogenously, it was co-26

immunoprecipitated with stably expressed exogenous NLRP12. Also, NLRP12 co-27

immunoprecipitated and co-localized with HCK when both were overexpressed in 293T cells. In 28

addition, in this overexpression system, steady-state NLRP12 protein expression levels 29

significantly decreased when HCK was co-expressed. Bioinformatic analysis showed that HCK 30

mRNA co-occurred with NLRP12 mRNA, but not with other NLRP mRNAs, in blood and 31

marrow samples from acute myeloid leukemia (AML) patients. The mRNA of NLRP12 is also 32

co-expressed with HCK in AML patient samples, and the levels of mRNA expression of each are 33

correlated. Together these data suggest that NLRP12, through its binding to HCK, may have an 34

effect on the progression of AML. 35

36

Introduction 37


associated molecular patterns (DAMP) and pathogen-associated molecular patterns (PAMP) (1). 39

Among PRR, one class of proteins is the nucleotide-binding domain (NBD) and leucine-rich 40

repeat (LRR) receptor family (NLR). NBD and LRR PYD protein 12 (NLRP12) is one protein 41

that belongs to the PYD subfamily of the NLR class and is a multi-functional protein (2). 42

NLRP12 binds to HCK

3

NLRP12’s functions likely all depend on defined protein-protein interactions. For example, in 43

anti-inflammatory functions of NLRP12, NLRP12 interacts with tumor necrosis factor receptor 44

associated factor 3 (TRAF3) and nuclear factor kappa-light-chain-enhancer of activated B cells 45

(NF-κB)-inducing kinase (NIK) in the non-canonical NF-κB pathway, when toll-like receptors 46

(TLR) are stimulated with Pam3Cys4 triacylated lipopeptides followed by addition of cluster of 47

differentiation 40 (CD40) (3). Kanneganti’s group also showed that NLRP12 expression 48

downregulated the canonical NF-kB pathway during Salmonella infection (4,5). NLRP12’s 49

inhibition of the non-canonical NF-κB pathway, thereby effecting an anti-inflammatory function, 50

has been reported in many publications (7-11). For example, in colitis-driven colon cancer, 51

Nlrp12 knock-out (KO) mice experience a higher frequency of death, weigh less, have a shorter 52

colon length, and have more severe disease progression than wild type (WT) mice, all of which 53

may occur through NLRP12’s inhibition of the non-canonical NF-κB pathway (3,4). In addition, 54

Nlrp12 KO mice have been reported to exhibit higher innate immunity when it is infected by the 55

virus because NLRP12 inhibits the non-canonical NF-κB pathway; thus, in a KO mice, a more 56

significant increase of NF- κB activity is observed compared to WT mice when it is infected by 57

the virus (6). And in the case of NLRP12 protecting the diversity of intestinal microbiota (7), 58

thereby preventing obesity (8), it has also been reported that Nlrp12 KO mice display 59

significantly decreased intestinal microbial diversity due to increased innate immunity, resulting 60

from the lack of inhibition of the non-canonical NF-κB pathway. 61

62

In addition, NLRP12 also interacts with interleukin (IL)-1 receptor-associated kinase 1 (IRAK1) 63

in the canonical NF-κB pathway when TLRs are stimulated, also to inhibit the inflammatory 64

response (9). In contrast, for human studies of NLRP12-associated autoinflammatory disorders, 65

NLRP12 binds to HCK

4

no protein-protein interactions have been reported (10,11). Functionally, however, Nlrp12 KO 66

mice had a higher immunological response in the autoimmune model of contact hypersensitivity 67

(12); thus, these mice are more prone to develop contact hypersensitivity. This results most likely 68

from Nlrp12 KO mice having defective migration of their dendritic cells (DC). In addition, 69

Luken et al. demonstrated that NLRP12 impacts the experimental autoimmune 70

encephalomyelitis (EAE) model via regulating T-cell responses (13). But, in these mouse studies, 71

no protein-protein interactions had been reported either (12). And NLRP12 is protective against 72

Yersinia pestis infection through NLRP12’s activation of the inflammasome which results in 73

secretion of IL-18 and IL-1β. But, no protein-protein interactions of NLRP12 within 74

inflammasomes had been characterized (14). Also, NLRP12 also regulates the c-Jun N-terminal 75

kinase (JNK) pathway in hepatocytes (15); but, again, no protein-protein interactions within the 76

NLRP12-JNK pathway had been demonstrated. Thus, there is a further need to find and to 77

characterize previously unreported NLRP12-binding proteins. Knowing NLRP12’s protein 78

binding partners may help to gain mechanistic insight into pathways previously characterized as 79

being regulated by NLRP12. Moreover, identifying and validating potentially novel binding 80

partners of NLRP12 may suggest novel functions for NLRP12. 81

82

In humans, NLRP12 is mainly expressed in macrophages, DCs, and neutrophils. In mice, 83

NLRP12 is primarily expressed in DCs and neutrophils (6,12,16). The NLRP12 protein has 84

three domains, from N- to C-terminus: PYD, NBD, and LRR domains (2,17,18). It is generally 85

accepted that the LRR domain, like NLRP1’s LRR domain and NLRP3’s LRR domain, is 86

responsible for sensing ligands or other types of activators of NLRPs in modulating their role in 87

an immunologic response (19-22). However, interestingly, it has been reported that without the 88

NLRP12 binds to HCK

5

LRR domain, NLRP3 still can be activated by triggers of the canonical NF-κB pathway (23). 89

The NBD domain is responsible for self-oligomerization when NLRP is activated, and the PYD 90

domain is responsible for regulating downstream signaling pathways (and thus, it is called the 91

“interaction domain”) (16,23). Here we used a truncated form of NLRP12 (PYD + NBD) to 92

identify possible protein-protein interactions that may regulate signaling pathways in which 93

NLRP12 is involved. In addition, to our knowledge, there are currently no protein-protein 94

interaction studies that have been performed for this truncated form of NLRP12 and may thus 95

represent a new general approach to screening for protein-protein interactions involved in 96

signaling complexes with NLRPs. 97

98

A yeast two-hybrid screen was performed to identify potential binding partners of NLRP12’s 99

PYD + NBD. HCK, a member of the c-SRC family of non-receptor tyrosine kinases, was one of 100

the top positive clones (“hits”) among all of the proteins that appeared to interact with NLRP12. 101

Further experiments were done to confirm the novel binding of NLRP12 to HCK and to 102

characterize key structural features of the binding interaction. In addition, co-expression of HCK 103

with NLRP12 resulted in a significant decrease of steady-state NLRP12 protein expression levels. 104

Finally, together with a bioinformatics analysis included here, a potential interaction between 105

NLRP12 and HCK may be involved in modulating the role of HCK in the pathogenesis of AML 106

(24-26). 107

108

Results 109

NLRP12 interacts with HCK in the yeast two-hybrid assay 110

NLRP12 binds to HCK

6


NLRP12 using the yeast two-hybrid assay. The basic principle of the yeast two-hybrid assay is 112

that if the cDNA library contains clones that express proteins, or parts thereof, that interact with 113

the co-expressed bait, the NLRP12 PYD + NBD (Figure 1A) in this case, then the co-114

transformed yeast clones will grow. The cDNA clones from the library that supported growth 115

would then be isolated and characterize, to identify what proteins interact with NLRP12’s PYD + 116

NBD. The leukocyte library was used because NLRP12 is mainly expressed in leukocytes in 117

humans (2,16,27,28), and thus putative binding partners for NLRP12 are also likely to be 118

expressed there. The screening resulted in 119 positive clones from the leukocyte cDNA library 119

(“hits”) expressed from 48 distinct genes (Supplementary materials, Table S1) that were 120

subsequently identified as encoding for proteins (or portions thereof) that potentially interact 121

with NLRP12’s PYD + NBD. The clones with the most hits are listed in Table 1. Among the 122

119 hits, which included repeated hits of the same genes, 9 were individual clones that encoded 123

fragments of a member of the c-SRC family of non-receptor tyrosine kinases, HCK, which was 124

among the highest number of hits for a single gene (Figure 1B and Table 1). Moreover, of the 9 125

positive HCK clones, 5 encoded distinct HCK fragments (Figure 1C). Full-length HCK p61 was 126

also obtained as a hit in another independent yeast two-hybrid screen (data not shown). HCK 127

has two isoforms, p59 and P61, in Homo sapiens. P61 and p59 share the same transcript, but p61 128

uses an uncommon start codon CTG, and p59 uses the common one, ATG (29), to give rise to 129

two distinct transcripts. Endogenously expressed in phagocytes, HCK p59 is mainly localized to 130

the plasma membrane, while HCK p61 is primarily localized to lysosomes, and both of them are 131

also found in the Golgi apparatus (30). It has been suggested that overexpression of p59 132

promotes the formation of membrane protrusions such as pseudopodia and overexpression of p61 133

NLRP12 binds to HCK

7

induces podosome rosettes and triggers actin polymerization around lysosomes (30,31). 134

However, there are no differences between p61 and p59 in the region of HCK that appears to 135

bind to NLRP12’s PYD + NBD (see below), the C-terminal part of HCK. Thus, detecting a full-136

length clone of only p61 as a hit, opposed to p59, appeared to be coincidental. 137

138

In directed screens using the yeast two-hybrid assay, NLRP12’s PYD + NBD domain 139

binding to HCK C-terminal 40 amino acids appears to be selective for NLRP12, and HCK 140

binding to NLRP12 appears to be selective for HCK 141

Initially, the HCK C-terminal 40 amino acids (“HCK C1 fragment”) was the shortest HCK 142

fragment from a positive clone that interacted with the bait, NLRP12’s PYD + NBD (Figure 2A). 143

NLRP 3 and NLRP8 were chosen based on the phylogenetic trees of the PYD + NBD domains 144

of members of the NLRP family: phylogenetically, NLRP3’s PYD + NBD is the most closely 145

related NLRP PYD + NBD to that of NLRP12, while NLRP8’s PYD + NBD is among the 146

furthest related PYD + NBD to that of NLRP12 (Figure 2B). In Figure 2C, yeast clones grew on 147

the 4 drop out (DO) (synthetic dropout (SD) plus amino acids supplements minus tryptophan, 148

leucine, histidine, and adenine (-Trp-Leu-His-Ade)) and 4DO + 3-Amino-1,2,4-triazole (3-AT) 149

high stringency plates when the yeast were co-transformed with NLRP12’s PYD + NBD and 150

HCK C1 fragment; and thus, this result is indicative of an interaction between the two constructs. 151

However, yeast clones were not observed on 4DO and 4DO + 3-AT plates when NLRP3’s PYD 152

+ NBD and HCK C1 fragment were co-transformed, nor when NLRP8’s PYD + NBD and HCK 153

C1 fragment were co-transformed. These results suggest that the HCK C1 fragment binds to 154

NLRP12’s PYD + NBD, but not to those from either NLRP3 or NLRP8, results consistent with a 155

selective interaction between NLRP12’s PYD + NBD and the HCK C1 fragment. 156

NLRP12 binds to HCK

8

157


HCK C1 fragment was co-transformed with NLRP12’s PYD + NBD. However, clones did not 159

grow on the 4DO and 4DO + 3-AT plates when the C1 fragment of other members of the c-SRC 160

family of non-receptor tyrosine kinases were co-transformed with NLRP12’s PYD + NBD 161

(Figure 2D). This experiment suggests that the interaction of HCK C1 fragment with NLRP12 is 162

selective for HCK; the C1 fragment of other members of the c-SRC family of non-receptor 163

tyrosine kinases did not bind to NLRP12’s PYD + NBD (Figure 2D). 164

165

In directed screens using the yeast two-hybrid assay, amino acids F503, I506, Q507, L510, 166

and D511 of HCK are critical for the binding between NLRP12’s PYD + NBD and HCK C-167

terminal 40 amino acids 168

The HCK C1 fragment were divided into four helical regions according to its atomic structure 169

(32) (protein data bank (PDB) accession number: 1AD5): R1, R2, R3, and R4 (designated by us) 170

(Figure 3A). As shown in the sequence alignments in Figure 3B, the primary amino acid 171

sequences of R2, R3, and R4 are very well conserved among members of the c-SRC family of 172

non-receptor tyrosine kinases, while R1 is not. To characterize further the important structural 173

features of HCK’s binding to NLRP12’s PYD + NBD, all of the amino acids comprising each of 174

the R2, R3, and R4 domains were mutated to alanine, but only one section at a time was mutated, 175

and these were denoted as the HCK M2 fragment, HCK M3 fragment, and HCK M4 fragment, 176

respectively. The amino acids comprising the R1 region were mutated to those amino acids in 177

the R1 region of the c-SRC family non-receptor tyrosine kinase LYN, which has the closest 178

phylogenetic relationship to HCK (Figure 3C). All of the mutated constructs are illustrated in 179

NLRP12 binds to HCK

9

Figure 3D. Yeast still grew on the high stringency 4DO + 3AT plates when NLRP12’s PYD + 180

NBD was co-transformed with the HCK M1 fragment, HCK M2 fragment, and HCK M4 181

fragment. But, yeast could not grow when NLRP12’s PYD + NBD was co-transformed with 182

HCK M3 fragment (Figure 3E). These experiments suggested that the R1, R2, and R4 regions 183

are dispensable for binding, while R3 may be important for binding. Further analysis was 184

conducted to identify individual critical amino acids of HCK’s R3 region binding to NLRP12’s 185

PYD + NBD using alanine scanning mutagenesis. However, the intervening sequences between 186

R1, R2, R3, and R4 were not examined for binding. 187

188

To identify the key amino acid residues involved in binding of R3 to NLRP12’s PYD + NBD, 189

each amino acid in R3 was individually mutated to alanine in an alanine scanning mutagenesis 190

analysis, on the background of the HCK C1 fragment. As shown by the yeast two-hybrid assay, 191

the mutations of F503A, I506A, Q507A, L510A, and D511A abolished the growth of yeast 192

clones on the high stringency 4DO when these yeast strains were co-transformed with NLRP12’s 193

PYD + NBD (Figure 3F). These experiments suggest that these four amino acids are critical for 194

binding. On the other hand, yeast clones still grew on the high stringency 4DO plates when the 195

HCK C1 fragments with the E504A, Y505A, S508A, or V509A mutations were co-transformed 196

with NLRP12’s PYD + NBD (Figure 3F). These experiments suggest that E504A, Y505, S508, 197

and V509 are dispensable for binding of HCK C1 fragment to NLRP12’s PYD + NBD. Overall, 198

however, these results suggest that the amino acids F503, I506, Q507, L510, and D511 in HCK 199

are critical for the binding of HCK C1 fragment to NLRP12’s PYD + NBD. 200

201

NLRP12 binds to HCK

10

On the other hand, YES also has these five amino acid residues,(Figure 3A), suggesting that, 202

while they are important for binding, they cannot account for the specificity or selectivity of 203

binding between NLRP12 and HCK. In addition, the amino acids R500, P501, T502, D512, 204

T515, Q520, and Y521, are 100% conserved among all other members of the c-SRC family of 205

non-receptor tyrosine kinases and are therefore unlikely to play a role in specificity and 206

selectivity of binding of NLRP12 with HCK. But, it is possible that two or more amino acids in 207

the intervening sections between the R1-R4 regions, which were not analyzed by mutagenesis, 208

may then actually account for the specificity and selectivity of binding of HCK to NLRP12. One 209

example is that the combination of R496, P497, and Q522 is unique to HCK compared to other 210

members of the c-SRC family of non-receptor tyrosine kinases. 211

212

In directed screens using the yeast two-hybrid assay, the shortest fragment of HCK that 213

binds to NLRP12’s PYD + NBD is its C-terminal 30 amino acids 214

The shortest form of HCK that bound to NLRP12’s PYD + NBD was determined by observing 215

whether the yeast clones grew on high stringency 4DO or 4DO +3AT plates when NLRP12’s 216

PYD + NBD was co-transformed with HCK fragments C1 to C7 and N1 to N5 (Figure 4) (data of 217

NLRP12’s PYD + NBD co-transformed with HCK fragment C7 not shown). HCK’s C1 to C7 218

fragments were gradually truncated from the N-terminus of the HCK C-terminal 40 amino acid 219

fragment (Figure 4A). HCK N1 to N5 fragments were gradually truncated from the C-terminus 220

of the HCK C-terminal 40 amino acid fragment (Figure 4B). Yeast strains grew on high 221

stringency 4DO or 4DO +3AT plates when either the HCK C1, C2, or C3 fragment was co-222

transformed with NLRP12’s PYD + NBD. Thus, of all of the constructs screened, the shortest 223

fragment of HCK that can apparently bind to NLRP12’s PYD + NBD is the C-terminal 30 amino 224

NLRP12 binds to HCK

11

acids, as indicated by the HCK C3 fragment (Figure 4). In addition, the last C-terminal 5 amino 225

acids of the HCK C-terminus also appear to be important for binding, as clones co-transformed 226

with NLRP12’s PYD + NBD with N1, with a deletion of the C-terminal 5 amino acids of HCK, 227

did not grow on the high stringency 4DO and 4DO + 3AT plates (Figure 4B). The structures of 228

both inactive HCK (PDB accession number: 1AD5) and active c-SRC (PDB accession number: 229

1Y57), the prototypical member of this family of nonreceptor tyrosine kinases related to HCK, 230

show that the last C-terminal 4 amino acids of c-SRC are surface-exposed, indicating that these 231

four amino acids that are critical for binding are available to interact with NLRP12 (33,34). 232

233

NLRP12 co-immunoprecipitates with HCK from mammalian cells, and NLRP12 is co-234

localized with HCK in mammalian cells 235

NLRP12 and HCK could be co-immunoprecipitated when they were both heterologously co-236

expressed in 293T cells (Figure 5A). Also, semi-endogenous conditions were used for co-237

immunoprecipitations from cells in which HCK is endogenously expressed, and NLRP12 was 238

heterologously stably expressed in epitope-tagged form, such as in macrophage-like RAW 264.7 239

cells (Figure 5B), monocyte-like THP-1 cells (Figure 5C), and lymphocyte -like U937 cells 240

(Figure 5D). Semi-endogenous conditions have been used in previous reports where NLRP12 241

was shown to interact with TRAF3 (3), NIK (35), and IRAK1(9). In all cases, NLRP12 co-242

immunoprecipitated with the p59 and p61 isoforms of HCK, but from these experiments, it is not 243

clear that whether NLRP12 interacts with p59, p61, or both isoforms of HCK. In U937 cells and 244

THP-1 cells, since heterologous NLRP12 expression level was low, adding phorbol 12-myristate 245

13-acetate (PMA) (1 µM for 24 hr) increased NLRP12 expression level by stimulating the PMA-246

sensitive cytomegalovirus promoter of NLRP12’s expression plasmid (Figure 5C and 5D). 247

NLRP12 binds to HCK

12

Taken together, these data suggest that NLRP12 and HCK (either p59, p61, or both isoforms) 248

can interact with each other in a mammalian cell system, a result that in part validates the 249

findings from the yeast two-hybrid assay. 250

251

After heterologous co-expression of NLRP12 with either the p61 or the p59 isoform of HCK in 252

293T cells, immunofluorescent staining of NLRP12 and HCK showed that NLRP12 can be co-253

localized with either p61 or p59 isoforms of HCK in most of the 293T cells (Figure 5E and 254

Supplementary materials, Figure S1). The co-localization of NLRP12 and HCK is consistent 255

with an intracellular interaction between the two proteins. In addition, the lack of selectivity of 256

NLRP12 co-localizing with either p61 or p59 isoform of HCK is consistent with the results from 257

the screening assay, where the putative binding region of HCK to NLRP12 is identical in both 258

the p61 and p59 isoforms. 259

260

The steady-state level of NLRP12 protein may decrease when HCK protein is co-expressed 261

Figure 6 shows that in 293T cells, the co-expression of increasing amount of HCK may led to a 262

decrease in steady-state protein expression levels of NLRP12. Although, alternatively, the 263

apparent decrease in expression level of NLRP12 might be due actually to a decrease in the 264

epitope-tag itself or a decrease in the expression of the epitope-tagged protein only. Interestingly, 265

HCK protein levels did not show a linearly increasing level of expression upon transfection with 266

increasing amounts of plasmid DNA, possibly due to HCK’s maximum expression levels in 267

these cells being achieved with the lowest amounts of plasmid DNA, which may be resolved if 268

the transfections are performed with lower amounts of plasmid DNA. This lack of linearity in 269

protein expression could also be due to saturation of the signal for HCK on the blot at relatively 270

NLRP12 binds to HCK

13

low levels of HCK expression or a combination of HCK’s maximum expression levels has been 271

reached as well as saturation of the blot, as mentioned above. Alternatively, reduction of 272

NLRP12 expression could be due to plasmid competition; that is, since the expression of both 273

genes from either plasmid are driven from the same promoter, an increase in the amount of one 274

plasmid may competitively decrease expression of the gene from the other plasmid due to their 275

competition for transcription factors. 276

277

In blood and marrow samples from patients with AML, NLRP12 and HCK co-occur and 278

are co-expressed 279





tests to The Cancer Genome Atlas (TCGA) provisional data sets for AML patients (36-38), 284

NLRP12 and NLRP1 are the only two NLRP family members that show a statistically significant 285

co-occurrence with HCK (Table 2). However, NLRP1’s co-occurrence has a P value of 0.048, 286

while NLRP12’s co-occurrence has a P value of <0.001. Therefore, NLRP12 is most likely the 287

only NLRP family mRNAs that shows co-occurrence with HCK in samples from patients with 288

AML. 289

290

Moreover, in this analysis, NLRP12 is significantly co-expressed with HCK (Pearson coefficient 291

= 0.80 and Spearman coefficient = 0.73, Pearson and Spearman coefficients show the possibility 292

of a linear relationship of two factors, Figure 7). This analysis is also consistent with NLRP12 293

NLRP12 binds to HCK

14

and HCK co-occurring in the same patients with AML. However, NLRP12 was not the only 294

NLRP mRNA that shows significant co-expression with HCK. NLRP1 and NLRP3 also showed 295

significant co-expression with HCK. This can be explained by the fact that co-expression is less 296

stringent than co-occurrence. In summary, NLRP12 is the only NLRP protein that shows co-297

occurrence with HCK, and it also shows co-expression with HCK, although it is not the only 298

member of the NLRP family to do so. Other data sets, including Hausera data, Metzeler 1 data, 299

Metzeler2 data, and Raponi data, were not available to evaluate the co-expression of NLRP12 300

versus HCK, as these other data sets did not incorporate data regarding NLRP12 expression. 301

302

Other potential binding partners of NLRP12 from the yeast two-hybrid screen 303

Other potentially interesting and unique genes that whose products may interact with NLRP12’s 304

PYD + NBD were identified in the yeast two-hybrid screen (Table 1 and Supplementary 305

materials, Table S1). Table 1 only shows those hits with frequency larger than 2, and these hits 306

were analyzed through an Ingenuity Pathway Analysis (IPA) diagram (Figure 8). In the IPA 307

diagram, protein-protein interactions found by our yeast two-hybrid screen are connected by 308

solid lines and interactions between protein binding partners collated by IPA are connected by 309

dashed lines. In addition, those molecules that are associated with AML are colored purple. 310

Interestingly, NLRP12 is also associated with AML from the database Catalogue of somatic 311

mutations in cancer (COSMIC). Although the mutation occurs in the NBD of NLRP12, only 2 312

samples of these mutations are observed within 175 samples and may be worthy of follow-up 313

study. 314

315

NLRP12 binds to HCK

15

The interaction of one of the putative binding partners to NLRP12 identified in our screen, 316

TRAF3 interacting protein 3 (TRAF3IP3), was validated in a co-immunoprecipitation 317

experiment where the FLAG-tagged form of TRAF3IP3 and V5-tagged form of NLRP12 were 318

overexpressed in 293T cells. TRAF3IP3 was coimmunoprecipitated by adding mouse 319

monoclonal anti-TRAF3IP3 antibody, and a band that showed the same molecular weight size of 320

NLRP12 was detected by rabbit monoclonal anti-V5 antibody (Figure 8). However, further 321

validation of these other putative interactors detected by the yeast two-hybrid needs to be done. 322

323

Discussion 324

In this paper, the yeast two-hybrid assay was used to screen for NLRP12 binding partners. This 325

approach identified 48 genes as positive hits encoding proteins that could possibly bind to 326

NLRP12. Among the hits, the c-SRC non-receptor tyrosine kinase family member HCK was 327

selected to focus upon as a potentially interesting target, particularly given its association with 328

hematopoiesis and AML. Further direct screens found that NLRP12 specifically binds to HCK, 329

but not to NLRP8 or NLRP3. Conversely, HCK, but not other members of the c-SRC non-330

receptor tyrosine kinase family, specifically binds to NLRP12. HCK’s C-terminal 30 amino 331

acids are sufficient for binding to NLRP12. And, amino acids F503, I506, Q507, L510, and 332

D511 of HCK are critical for binding to NLRP12. Co-immunoprecipitation experiments from 333

mammalian cells confirmed that NLRP12 and HCK interact. Co-expression of NLRP12 and 334

HCK results in a significantly lower steady-state expression level of NLRP12; thus, the 335

interaction may affect NLRP12 protein stability. Finally, a bioinformatics analysis shows that 336

NLRP12 and HCK essentially exclusively co-occur, and mRNA levels for both are correlated in 337

NLRP12 binds to HCK

16

blood samples from AML patients. Together, these data suggested that NLRP12 and HCK 338

protein and mRNA co-expression may have an effect on the AML. 339

340





maintain stable binding of HCK’s C-terminal 40 amino acids to NLRP12’s PYD + NBD. Thus, 345

binding of NLRP12’s PYD + NBD to this fragment of HCK may occur initially through binding 346

to R3, followed by stabilization of the interaction by secondarily binding to R2. This model is 347

also consistent with the finding that when we mutated the R3 region, the binding of HCK’s C-348

terminal 40 amino acid fragment to the NLRP12’s PYD + NBD was lost despite the R2 region 349

being present. The above evidences are consistent with the model that R2 and R3 regions 350

together are both necessary for binding, but the stabilization of binding to the R3 region may 351

require the presence of R2. 352

353

The yeast two-hybrid screen with NLRP12 also identified products from 47 other genes as 354

potential interactors. According to the Search Tool for Recurring Instances of Neighbouring 355

Genes (STRING) protein network and previous publications, NLRP12 interactors include 356

IRAK1 (39), NIK (35), TRAF3(3), heat shock protein 90 (HSP90) (40), Fas associated factor 1 357

(FAF1) (41), and apoptosis-associated speck-like protein containing a caspase activation and 358

recruitment domain (ASC) proteins. IRAK1, NIK, TRAF3, and Heat shock protein (HSP) 90 359

were only found in experiments involving semi-endogenous protein co-immunoprecipitations 360

NLRP12 binds to HCK

17

with NLRP12. FAF1 was found to be an interacting protein in NMR experiments by showing a 361

difference in the chemical shift perturbation of FAF1’s ubiquitin-associated domains (UBA) 362

domain alone and NLRP12’s PYD domain bound to FAF1’s UBA domain. And FAF1 was also 363

found to interact with NLRP12 in a yeast two-hybrid study where the PYD domain of different 364

NLRP proteins were screened (42). However, in our study, IRAK1 (43), NIK (44), TRAF3 (45), 365

HSP90 (46), FAF1 (47), and ASC (48) proteins were not found in our results of interacting 366

proteins, although they are all expressed in leukocytes. Therefore, given these differences, the 367

results from this yeast two-hybrid screen may provide a unique database for future investigations 368

on the proteins that interact with NLRP12, and the functional outcomes of these interactions. 369

370

How HCK co-expression affects NLRP12 expression can be further investigated to determine the 371

functional outcomes of the NLRP12-HCK interaction relative to protein stability or degradation. 372

For example, MG-132 and chloroquine, which are a proteasomal inhibitor and an inhibitor of 373

lysosomal degradation, respectively, can be added to cells in these experiments to determine 374

whether the decreasing protein expression level of NLRP12 in the presence of HCK is due to 375

proteasomal degradation or lysosomal degradation. In addition, an NLRP12 stable cell line, with 376

a typically lower level of NLRP12 expression, compared to transiently transfected cells, can be 377

used to test formally whether NLRP12 protein expression levels are increasingly decreased when 378

the expression of HCK is increased. Moreover, the rate of NLRP12 degradation, in the absence 379

or presence of HCK, can be studied and compared in pulse-chase assays (35). 380

381

Given the interaction that was characterized between NLRP12 and HCK, we sought to identify 382

diseases in which their interaction may be relevant. AML is a type of blood and bone marrow 383

NLRP12 binds to HCK

18

cancer that is characterized by an unusually high level of circulating immature white blood cells 384

(49). HCK is found to be highly expressed in hematopoietic stem cells of AML patients (24). 385

The overexpression of HCK is linked with the development of AML (24,50). Therefore, HCK 386

may be potentially used as a blood biomarker to identify those patients with potential to develop 387

of AML disease. In addition, activation of HCK and its signaling pathways often causes the 388

development of AML (25,51). HCK has been reported to be involved in the feline McDonough 389

sarcoma (fms)-like tyrosine kinase 3 (FLT3)-HCK- cyclin D-dependent kinase (CDK6) pathway. 390

The mutation in FLT3-internal tandem duplications (FLT3-ITD) causes the activation of HCK, 391

and subsequently results in overexpression of CDK6 in MV4-11 cells, a human AML cell line 392

with the FLT3-ITD mutation. CDK6 siRNA resulted in MV4-11 cells with the FLT3-ITD 393

mutation having a lower proliferation rate compared to MV4-11 control cells (25). Also, it has 394

been reported that in AML patients, HCK, LYN, and FGR phosphorylation levels are high (51). 395

In summary, the above evidence suggests that either high expression and/or high activation of 396

HCK could occur in AML patients as well. 397

398

Our bioinformatics analysis revealed that NLRP12 is likely the only member of the NLRP family 399

that shows significant co-occurrence with HCK at the level of mRNA expression. However, our 400

cellular functional study revealed that NLRP12 protein expression levels decreased when it is co-401

expressed with HCK. This discrepancy might be due NLRP12 mRNA expression level not 402

correlating with protein expression level (52-54). Nevertheless, these data are still consistent 403

with the possibility that NLRP12 may have an effect on AML through its binding to HCK. 404

NLRP12 and HCK co-expression and co-occurrence may then also be relevant to the prognosis 405

NLRP12 binds to HCK

19

of AML. However, further analyses need to be performed to evaluate the ability of NLRP12 and 406

HCK to serve as biomarkers in the prognosis of AML. 407

408

NLRP12 and HCK co-expression and co-occurrence may indicate that NLRP12 and HCK mRNA 409

or protein expression can impact the same pathway or both be regulated by the same molecule. 410

For example, in the case two molecules exhibiting co-occurrence, they may interact in the same 411

signaling pathway, for example, Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) 412

and glycogen synthase kinase 3 beta (GSK3β) showed co-occurrence in the AML provisional 413

data, and they are in the same signaling pathway (55). 414

415

Although many HCK inhibitors have been developed, they often lack specificity, with HCK 416

inhibitors also inhibiting other members of the c-SRC non-receptor tyrosine kinase family 417

(24,56-59). If the potential for the development of AML can be decreased when NLRP12 does 418

not bind to HCK, then an inhibitor to the interaction between NLRP12 and HCK can be designed. 419

On the other hand, if the potential for AML is increased when NLRP12 and HCK does not bind, 420

then a drug that facilitates NLRP12 and HCK interaction could be developed. By this approach, 421

the non-specificity problem with NLRP inhibitors may still exist but perhaps to a smaller extent, 422

as NLRP proteins are less conserved overall compared to the members of the c-SRC non-423

receptor tyrosine kinase family. For example, the amino acid identity between NLRP12’s PYD 424

+ NBD versus another NLRP PYD + NBD most closely related to NLRP12, NLRP3’s PYD + 425

NBD, is 54%. But, the protein identity between the HCK C1 fragment versus the one with the 426

closest relationship, the LYN C1 fragment, is 78%. 427

428

NLRP12 binds to HCK

20

In conclusion, this paper reports the preliminary findings of NLRP12 interacting with HCK, and 429

NLRP12 co-occurs with HCK in AML patients. The binding data presented here will expand the 430

database regarding the interactors of NLRP12, and additional bioinformatic and functional in 431

vitro and in vivo analyses may shed light on the functional consequence of the interaction of 432

NLRP12 with HCK. 433

434




Collection (ATCC) (Manassas, VA). pCDNA-NLRP12 plasmid and pCDNA-NLRP3 plasmid 438

were gifts from Dr. Jenny P. Y. Ting (University of North Carolina-Chapel Hill). pCDNA-439

NLRP8 plasmid was purchased from Genescript (Piscataway, NJ). All other chemicals were 440

reagent grade. The mouse monoclonal anti-FLAG antibody and the rabbit monoclonal anti-441

FLAG antibody were purchased from Sigma-Aldrich (St. Louis, MO). The mouse monoclonal 442

anti-HCK antibody, the mouse monoclonal anti-TRAF3IP3 antibody, and the mouse IgGκ 443

binding protein-horseradish peroxidase (HRP) for detecting the anti-HCK antibody were 444

purchased from Santa Cruz Biotechnology (Dallas, TX). The rabbit monoclonal anti-V5 445

antibody and polyclonal rabbit HRP-conjugated anti-mouse IgG secondary antibodies were 446

purchased from Cell Signaling (Beverly, MA). The goat anti-rabbit IgG HRP-linked secondary 447

antibody was purchased from Cell Signaling. The Clean-Blot™ IP Detection Reagent was 448

purchased from Thermo Fisher Scientific (Grant Island, NY). Goat anti-mouse IgG (H+L) cross-449

adsorbed secondary antibody, conjugated to Alexa Fluor 488 and goat anti-rabbit IgG (H+L) 450

cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555 were purchased from Thermo 451

NLRP12 binds to HCK

21

Fisher Scientific (Grant Island, NY). The 4',6-diamidino-2-phenylindole, dihydrochloride (DAPI) 452

was purchased from Thermo Fisher Scientific. 453

454

Cloning 455

NLRP12’s PYD + NBD (corresponding to a.a. 1-531) was amplified by polymerase chain 456

reaction (PCR) (primers see Table 3), from a pCDNA-NLRP12 plasmid, was digested with 457

enzymes NdeI and SalI, and subcloned into the pGBKT7 vector (Takara). The sequence 458

encoding the PYD + NBD of NLRP3 (corresponding to a.a. 1-536) was amplified by PCR (see 459

table 3 for primers), digested with enzymes NdeI and BamHI, and subcloned in the pGBKT7 460

vector. The sequence encoding the PYD + NBD of NLRP8 (corresponding to a.a. 1- 527) was 461

amplified by PCR (see Table 3 for primers), digested with enzymes EcoRI and BamHI, and 462

subcloned into the pGBKT7 vector. The entire sequences corresponding to the C-terminal 42 463

amino acids of FGR, c-SRC, YES, and FYN, and 40 amino acids of BLK, LCK, LYN, and HCK 464

(The C terminal 40 (or 42) amino acids is called “C1”), and HCK constructs C2, C3, C4, C5, C6, 465

C7, N1, N2, N3, N4, N5, M1, M2, M3, M4, and HCK C1 mutations for alanine scanning with 466

F503A, E504A, Y505A, I506A, Q507A, S508A, V509A, L510A, and D511A, were all 467

synthesized from IDT DNA (Coralville, IA) and cloned into the pACT2 vector (Takara). 468

NLRP12 was amplified by PCR (see Table 3 for primers), digested with AflII and XbaI, and 469

subcloned into pEFIRES-P-3FLAG (60) and pEFIRES -P-V5 (60). 3FLAG and V5 are 470

homemade, i.e., added later into pEFIRES-P. The peptide sequence of the 3FLAG epitope is 471

DYKDDDDKDYKDDDDKDYKDDDDK. The peptide sequence of the V5 epitope is 472

GKPIPNPLLGLDST. The multiple cloning sites of pEFIRES-P were modified according to our 473

needs. Sequences encoding HCK p61 and p59 isoforms were amplified by PCR (see Table 3 for 474

NLRP12 binds to HCK

22

primers), digested with AflII and XbaI, and subcloned into pEFIRES -3FLAG vector. Final 475

plasmids were sequenced to confirm the constructs. 476

477


Yeast transformed with the plasmid PGBKT7- NLRP12’s PYD + NBD 479





shaking at 30°C. Then they were transformed with NLRP12’s PYD + NBD plasmid, following 484

recommendations in the Takara manual (MatchmakerTM Gal4 Two-hybrid System 3 and 485

Libraries User Manual). A 4ml of 1 M of 3-AT was added into 800 mL of the YPDA medium 486

that were used for making the plates due to a leakage problem. 3-AT is a competitive inhibitor 487

for the product of the HIS3 reporter gene. Yeast cells were lysed using a trichloroacetic acid 488

(TCA) method, and western blots were performed to check NLRP12’s PYD + NBD protein 489

expression (data not shown). 490

491


PGBKT7- NLRP12 PYD + NBD plasmid 493





NLRP12 binds to HCK

23








505




hybrid System 3 & Libraries User’s Manual. The direct screens were to test whether NLRP12 509

PYD + NBD and HCK specifically interact; identification of HCK F503, Q507, L510, and D511 510

being critical for binding with NLRP12 PYD + NBD; and the characterization of the HCK C-511

terminal 30 amino acid fragment binding to NLRP12 PYD + NBD. 512

513







purification (61) and 5 µl of P3000TM reagent were added into another aliquot of 125 µl of Opti-520

NLRP12 binds to HCK

24

MEM® medium. Then these two tubes were mixed together, and the mixed tube was incubated 521

at room temperature for 15 min. 250 µl of this mixture was added to the cells. The cells were 522

incubated at 37 °C with 5% CO2 for two days until analysis. 523

524

NLRP12 stable cell lines 525

THP-1 cells, U937 cells, and RAW 264.7 cells were transfected with pEFIRES-P-NLRP12-526


After two weeks, the cells were considered to be stably expressing NLRP12 after screening for 528

expression. The stable cells were “pooled” clones, and they are maintained by adding 2.5 μg/ml 529

puromycin. 530

531







538





HCK mouse monoclonal primary antibody overnight. On the second day, 30 μl of protein A/G 543

NLRP12 binds to HCK

25

agarose, from a 50% slurry and previously washed with lysis buffer three times, were added to 544

the tube, and the tube was incubated for 3 hrs at 4C. The beads were then washed with lysis 545




549

Immunoblotting 550







mouse monoclonal anti-HCK antibody (diluted 1:1000) were added and the membrane incubated 557

overnight. For detection of bands in the cell lysate, rabbit anti-mouse IgG HRP-linked secondary 558

antibody (diluted 1:2000) (for anti-FLAG antibody) and mouse IgGκ binding protein-HRP 559

secondary antibody (for anti-HCK antibody) (diluted 1:1000) were added, and the membrane 560

was incubated for 1 hr at room temperature. For immunoprecipitations, Clean-Blot™ IP 561

detection reagent (HRP) secondary antibody (1:300) (Thermo Fisher Scientific) was used. The 562

detection signal was visualized by using enhanced chemiluminescence (ECL) reagent (Thomas 563

Scientific, Swedesboro, NJ). Immoblots were analyzed by chemiluminescence on a Bio-Rad 564

ChemiDocTM Touch Gel imaging system (Bio-Rad, Hercules, CA). 565

566

NLRP12 binds to HCK

26


The coverslips were autoclaved and coated with 0.1 mg/ml of poly-D-lysine hydrobromide (mol 568

wt 70,000-150,000) (Sigma-Aldrich). Cells were plated onto the coverslips. The cells were 569

fixed in 4% paraformaldehyde (Alfa Aesar, Ward Hill, MA) in phosphate buffered saline (PBS) 570

for 15 mins. And fixation was stopped by adding 50 mM NH4Cl in PBS for 15 min at room 571

temperature. After raising with PBS, the fixed cells were permeabilized by adding 0.5% 572

Triton®-X-100 in PBS for 10 min. The cells were then washed with PBS three times and 573

blocked with 0.1% of BSA in PBS at room temperature for 1 hr. The rabbit monoclonal anti-574

FLAG antibody (diluted 1:100) and mouse monoclonal anti-HCK antibody (diluted 1:100) were 575

added to each cover slip and incubated overnight. Goat anti-mouse IgG (H+L) cross-adsorbed 576

secondary antibody, conjugated to Alexa Fluor 488 (diluted 1:100) and goat anti-rabbit IgG 577

(H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555 (1: 100) were added. 578

After incubation with secondary antibodies for 1 hr, the cells were washed five times with PBS. 579

During the first step, DAPI (InvitrogenTM by Thermo Fisher Scientific) was also added at 1:1000 580

in PBS for 2 min. Finally, the coverslips were mounted in ProLong™ Gold Antifade mounting 581

medium (Life Technologies Corporation by Thermo Fisher Scientific, Eugene, OR). The stained 582

slides were viewed on a ZEISS LSM 880 (Pleasanton, CA) with Airyscan. The images were 583

viewed and processed using Fiji software (62). 584

585

IPA diagram 586



589

NLRP12 binds to HCK

27



cBioPortal website (37,38,63). Clinical samples from the Oncomine website 592

(https://www.oncomine.org) were downloaded and checked for NLRP12 and Hck mRNA 593

expression levels. The Fisher exact test and the odds ratio test used for co-occurrence were 594

generated by the cBioPortal website. Analysis of variance (ANOVA) was performed to check 595

whether a significant difference of the treatment exists among all the groups. A p-value < 0.05 596

was considered statistically significant. If P < 0.05, then the Tukey test was used to determine 597

whether a pair-wise difference exists. Quantification of the western blot bands was performed 598

by FIJI software (62) and made into graphs by Prism 6.0 (GraphPad Software, Inc., San Diego, 599

CA).600

601

Acknowledgement 602





607

Abbreviations 608

3-AT: 3-Amino-1,2,4-triazole; AML: acute myeloid leukemia; ANOVA: analysis of variance; 609

ASC: apoptosis-associated speck-like protein containing a caspase activation and 610

recruitment domain; ATCC: American Type Culture Collection; C1: self-named truncations of 611

C-terminal 40 (or 41) amino acids fragment of c-SRC family non-receptor tyrosine kinases; C2-612


NLRP12 binds to HCK

28

C7 and N1-N5: self-named truncations HCK C1 fragment; CD40: cluster of differentiation 40; 613

CDK6: cyclin D-dependent kinase; CFU; colony-forming units; COSMIC: catalogue of somatic 614

mutations in cancer; CsCl: cesium chloride; DAMP: damage-associated molecular patterns; 615

DAPI: 4',6-diamidino-2-phenylindole, dihydrochloride; DC: dendritic cells; DO: drop out (2DO: 616

SD/-Trp-Leu; 4DO: SD/-Trp-Leu-His-Ade); ECL: enhanced chemiluminescence; FAf1: Fas 617

associated factor 1; FLT3-ITD: FLT3-internal tandem duplications; FLT3: feline McDonough 618

sarcoma (fms)-like tyrosine kinase 3; GSK3b: glycogen synthase kinase 3 beta; HCK C1 619

fragment: HCK C-terminal 40 amino acids; HCK: hematopoiesis cell kinase; HRP: horseradish 620

peroxidase; HSP90: heat shock protein 90; IL: interleukin; IPA: ingenuity pathway analysis; 621

IRAK1: IL-1 receptor-associated kinase 1; KO: knock out; KRAS; Ki-ras2 Kirsten rat sarcoma 622

viral oncogene homolog; LRR: leucine rich repeat domain; M1: the amino acids in the R1 region 623

were mutated to the amino acids identical to the R1 region in Lyn; M2: the amino acids in the 624

R2 region were all mutated to Alanine; M3: the amino acids in the R3 region were all mutated to 625

Alanine; M4: the amino acids in the R4 region were all mutated to Alanine; NBD: nucleotide 626

binding domain; NF-κB: nuclear factor kappa-light-chain-enhancer of activated B cells; NIK: 627

NF-κB-inducing kinase; NLR: nucleotide binding domain and leucine-rich repeat; NLRP: NLR 628

pyrin domain-containing protein; PAMP: pathogen-associated molecular patterns; PBS: 629

phosphate buffered saline; PCR: polymerase chain reaction; PDB: protein data bank; PMA: 630

phorbol 12-myristate 13-acetate; PRR: pattern recognition receptors; PVDF: polyvinylidene 631

difluoride; PYD: pyrin domain; R1, R2, R3, and R4: self-named four regions in the HCK C 632

terminal 40 amino acids fragment; SD: synthetic dropout; SD/-Trp-Leu: SD base plus amino 633

acids supplements minus tryptophan and leucine; SD/-Trp-Leu-His-Ade: SD base plus amino 634

acids supplements minus tryptophan, leucine, and histidine, and adenine; STRING: search tool 635

NLRP12 binds to HCK

29

for recurring instances of neighboring genes; TBST: tris-buffered saline with Tween 20, pH=8.0; 636

TCA: trichloroacetic acid; TCGA: the cancer genome atlas; TLR: toll-like receptor; TRAF3: 637

tumor necrosis factor receptor associated factor 3; TRAF3IP3: TRAF3 interacting protein 3; 638

UBA: ubiquitin-associated domains; WT: wild type; YPDA: yeast extract, peptone, dextrose, and 639

adenine hemisulfate. 640

641

Competing Interest 642

The authors have declared that no competing conflict exists. 643

644




648

References 649

1. Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell. 2010; 140: 650

805-820. 651

2. Tuncer S, Fiorillo MT, Sorrentino R. The multifaceted nature of NLRP12. J Leukoc Biol. 652

2014; 96: 991-1000. 653

3. Allen IC, Wilson JE, Schneider M, Lich JD, Roberts RA, Arthur JC, Woodford RM, 654

Davis BK, Uronis JM, Herfarth HH, Jobin C, Rogers AB, Ting JP. NLRP12 suppresses 655

colon inflammation and tumorigenesis through the negative regulation of noncanonical 656

NF-kappaB signaling. Immunity. 2012; 36: 742-754. 657

4. Zaki MH, Vogel P, Malireddi RK, Body-Malapel M, Anand PK, Bertin J, Green DR, 658

Lamkanfi M, Kanneganti TD. The NOD-like receptor NLRP12 attenuates colon 659

inflammation and tumorigenesis. Cancer Cell. 2011; 20: 649-660. 660

5. Zaki MH, Man SM, Vogel P, Lamkanfi M, Kanneganti TD. Salmonella exploits 661

NLRP12-dependent innate immune signaling to suppress host defenses during infection. 662

Proc Natl Acad Sci U S A. 2014; 111: 385-390. 663

6. Chen ST, Chen L, Lin DS, Chen SY, Tsao YP, Guo H, Li FJ, Tseng WT, Tam JW, Chao 664

CW, Brickey WJ, Dzhagalov I, Song MJ, Kang HR, Jung JU, Ting JP. NLRP12 regulates 665

anti-viral RIG-I activation via interaction with TRIM25. Cell Host Microbe. 2019; 25: 666

602-616.e607. 667

NLRP12 binds to HCK

30

7. Chen L, Wilson JE, Koenigsknecht MJ, Chou WC, Montgomery SA, Truax AD, Brickey 668

WJ, Packey CD, Maharshak N, Matsushima GK, Plevy SE, Young VB, Sartor RB, Ting 669

JP. NLRP12 attenuates colon inflammation by maintaining colonic microbial diversity 670

and promoting protective commensal bacterial growth. Nat Immunol. 2017; 18: 541-551. 671

8. Truax AD, Chen L, Tam JW, Cheng N, Guo H, Koblansky AA, Chou WC, Wilson JE, 672

Brickey WJ, Petrucelli A, Liu R, Cooper DE, Koenigsknecht MJ, Young VB, Netea MG, 673

Stienstra R, Sartor RB, Montgomery SA, Coleman RA, Ting JP. The Inhibitory Innate 674

Immune Sensor NLRP12 maintains a threshold against obesity by regulating gut 675

microbiota homeostasis. Cell Host Microbe. 2018; 24: 364-378.e366. 676

9. Ye, Z, Lich JD, Moore CB, Duncan JA, Williams KL, Ting JP. ATP binding by 677

monarch-1/NLRP12 is critical for its inhibitory function. Mol Cell Biol. 2008; 28: 1841-678

1850. 679

10. Jeru I, Le Borgne G, Cochet E, Hayrapetyan H, Duquesnoy P, Grateau G, Morali A, 680

Sarkisian T, Amselem S. Identification and functional consequences of a recurrent 681

NLRP12 missense mutation in periodic fever syndromes. Arthritis Rheum. 2011; 63: 682

1459-1464. 683

11. Jeru I, Duquesnoy P, Fernandes-Alnemri T, Cochet E, Yu JW, Lackmy-Port-Lis M, 684

Grimprel E, Landman-Parker J, Hentgen V, Marlin S, McElreavey K, Sarkisian T, 685

Grateau G, Alnemri ES, Amselem S. Mutations in NALP12 cause hereditary periodic 686

fever syndromes. Proc Natl Acad Sci U S A. 2008; 105: 1614-1619. 687

12. Arthur J C, Lich JD, Ye Z, Allen IC, Gris D, Wilson JE, Schneider M, Roney KE, 688

O'Connor BP, Moore CB, Morrison A, Sutterwala FS, Bertin J, Koller BH, Liu Z, Ting 689

JP. Cutting edge: NLRP12 controls dendritic and myeloid cell migration to affect contact 690

hypersensitivity. J Immunol. 2010; 185: 4515-4519. 691

13. Lukens JR, Gurung P, Shaw PJ, Barr MJ, Zaki MH, Brown SA, Vogel P, Chi H, 692

Kanneganti TD. The NLRP12 sensor negatively regulates autoinflammatory disease by 693

modulating interleukin-4 production in T cells. Immunity. 2015; 42: 654-664. 694

14. Vladimer GI, Weng D, Paquette SWM, Vanaja SK, Rathinam VA, Aune MH, Conlon J E, 695

Burbage JJ, Proulx MK, Liu Q. The NLRP12 inflammasome recognizes Yersinia pestis. 696

Immunity. 2012; 37: 96-107. 697

15. Udden SN, Kwak YT, Godfrey V, Khan MAW, Khan S, Loof N, Peng L, Zhu H, Zaki H. 698

NLRP12 suppresses hepatocellular carcinoma via downregulation of cJun N-terminal 699

kinase activation in the hepatocyte. Elife. 2019; 8: e40396. 700

16. Hornick EE, Banoth B, Miller AM, Zacharias ZR, Jain N, Wilson ME, Gibson-Corley 701

KN, Legge KL, Bishop GA, Sutterwala FS, Cassel SL. NLRP12 mediates adverse 702

neutrophil recruitment during influenza virus infection. J Immunol. 2018; 200: 1188-703

1197. 704

17. Damiano JS, Oliveira V, Welsh K, Reed JC. Heterotypic interactions among NACHT 705

domains: implications for regulation of innate immune responses. The Biochemical 706

journal. 2004; 381: 213-219. 707

18. Janowski AM, Kolb R, Zhang W, Sutterwala FS. Beneficial and detrimental roles of 708

NLRs in carcinogenesis. Frontiers in immunology. 2013; 4: 370-370. 709

19. Faustin B, Lartigue L, Bruey JM, Luciano F, Sergienko E, Bailly-Maitre B, Volkmann N, 710

Hanein D, Rouiller I, Reed JC. Reconstituted NALP1 inflammasome reveals two-step 711

mechanism of caspase-1 activation. Mol Cell. 200; 25: 713-724. 712

NLRP12 binds to HCK

31

20. Martinon F, Agostini L, Meylan E, Tschopp J. Identification of bacterial muramyl 713

dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr Biol. 2004; 14: 714

1929-1934. 715

21. Kanneganti TD, Lamkanfi M, Nunez G. Intracellular NOD-like receptors in host defense 716

and disease. Immunity. 2007; 27: 549. 717

22. Sharif H, Wang L, Wang WL, Magupalli VG, Andreeva L, Qiao Q, Hauenstein AV, Wu 718

Z, Núñez G, Mao Y, Wu H. Structural mechanism for NEK7-licensed activation of 719

NLRP3 inflammasome. Nature. 2019; 570: 338-343. 720

23. Hafner-Bratkovič I, Sušjan P, Lainšček D, Tapia-Abellán A, Cerović K, Kadunc L, 721

Angosto-Bazarra D, Pelegrin P, Jerala R. NLRP3 lacking the leucine-rich repeat domain 722

can be fully activated via the canonical inflammasome pathway. Nature Communications. 723

2018; 9: 5182. 724

24. Roversi FM, Pericole FV, Machado-Neto JA, da Silva Santos Duarte A, Longhini AL, 725

Corrocher FA, Palodetto B, Ferro KP, Rosa RG, Baratti MO, Verjovski-Almeida S, 726

Traina F, Molinari A, Botta M, Saad ST. Hematopoietic cell kinase (HCK) is a potential 727

therapeutic target for dysplastic and leukemic cells due to integration of 728

erythropoietin/PI3K pathway and regulation of erythropoiesis: HCK in 729

erythropoietin/PI3K pathway. Biochim Biophys Acta Mol Basis Dis. 2017; 1863: 450-730

461. 731

25. Lopez S, Voisset E, Tisserand JC, Mosca C, Prebet T, Santamaria D, Dubreuil P, De 732

Sepulveda, P. An essential pathway links FLT3-ITD, HCK and CDK6 in acute myeloid 733

leukemia. Oncotarget. 2016; 7: 51163-51173. 734

26. Roversi FM, Pericole FV, Duarte AdSS, Ferro KP, Corrocher FA, Palodetto B, Longhini 735

AL, Botta M, Saad STO. Knockdown of HCK reduces cell death and erythroid 736

differentiation in human CD34+ hematopoietic progenitor cells. Blood. 737

2015; 126: 2860. 738

27. Normand S, Waldschmitt N, Neerincx A, Martinez-Torres RJ, Chauvin C, Couturier-739

Maillard A, Boulard O, Cobret L, Awad F, Huot L, Ribeiro-Ribeiro A, Lautz K, Ruez R, 740

Delacre M, Bondu C, Guilliams M, Scott C, Segal A, Amselem S, Hot D, Karabina S, 741

Bohn E, Ryffel B, Poulin LF, Kufer TA, Chamaillard M. Proteasomal degradation of 742

NOD2 by NLRP12 in monocytes promotes bacterial tolerance and colonization by 743

enteropathogens. Nature Communications. 2018; 9: 5338. 744

28. Linz BM, Neely CJ, Kartchner LB, Mendoza AE, Khoury AL, Truax A, Sempowski G, 745

Eitas T, Brickey J, Ting JP, Cairns BA, Maile R. Innate immune cell recovery is 746

positively regulated by NLRP12 during emergency hematopoiesis. J Immunol. 2017; 198: 747

2426-2433. 748

29. Robbins SM, Quintrell NA, Bishop, JM. Myristoylation and differential palmitoylation of 749

the HCK protein-tyrosine kinases govern their attachment to membranes and association 750

with caveolae. Mol Cell Biol. 1995; 15: 3507-3515. 751

30. Carreno S, Gouze ME, Schaak S, Emorine LJ, Maridonneau-Parini I. Lack of 752

palmitoylation redirects p59HCK from the plasma membrane to p61HCK-positive 753

lysosomes. J Biol Chem. 2000; 275: 36223-36229. 754

31. Guiet R, Poincloux R, Castandet J, Marois L, Labrousse A, Le Cabec V, Maridonneau-755

Parini I. Hematopoietic cell kinase (HCK) isoforms and phagocyte duties - from 756

signaling and actin reorganization to migration and phagocytosis. Eur J Cell Biol. 2008; 757

87: 527-542. 758

NLRP12 binds to HCK

32

32. Sicheri F, Moarefi I, Kuriyan J. Crystal structure of the c-SRC family tyrosine kinase 759

HCK. Nature. 1997; 385: 602-609. 760

33. Ma B, Elkayam T, Wolfson H, Nussinov R. Protein–protein interactions: Structurally 761

conserved residues distinguish between binding sites and exposed protein surfaces. Proc 762

Natl Acad Sci U S A. 2003; 100: 5772. 763

34. Knappe M, Bodevin S, Selinka HC, Spillmann D, Streeck RE, Chen XS, Lindahl U, Sapp 764

M. Surface-exposed amino acid residues of HPV16 L1 protein mediating interaction with 765

cell surface heparan sulfate. J Biol Chem. 2007; 282: 27913-27922. 766

35. Lich JD, Williams KL, Moore CB, Arthur JC, Davis BK, Taxman DJ, Ting, JP. 767

Monarch-1 suppresses non-canonical NF-kappaB activation and p52-dependent 768

chemokine expression in monocytes. J Immunol. 2007; 178: 1256-1260. 769

36. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, 770

Heuer ML, Larsson E, Antipin Y, Reva B, Goldberg AP, Sander C, Schultz N. The cBio 771

Cancer Genomics Portal: An open platform for exploring multidimensional cancer 772

genomics data. Cancer Discovery. 2012; 2: 401. 773

37. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, 774

Sinha R, Larsson E, Cerami E, Sander C, Schultz N. Integrative analysis of complex 775

cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013; 6: pl1. 776

38. Cancer Genome Atlas Research Network. Genomic and epigenomic landscapes of adult 777

de novo acute myeloid leukemia. NEJM. 2013, 368: 2059-2074. 778

39. Williams KL, Lich JD, Duncan JA, Reed W, Rallabhandi P, Moore C, Kurtz S, Coffield 779

VM, Accavitti-Loper MA, Su L, Vogel SN, Braunstein M, Ting JP. The CATERPILLER 780

protein monarch-1 is an antagonist of toll-like receptor-, tumor necrosis factor alpha-, and 781

Mycobacterium tuberculosis-induced pro-inflammatory signals. J Biol Chem. 2005; 280: 782

39914-39924. 783

40. Arthur JC, Lich JD, Aziz RK, Kotb M, Ting JP. Heat shock protein 90 associates with 784

monarch-1 and regulates its ability to promote degradation of NF-kappaB-inducing 785

kinase. J Immunol. 2007; 179: 6291-6296. 786

41. Pinheiro AS, Eibl C, Ekman-Vural Z, Schwarzenbacher R, Peti W. The NLRP12 pyrin 787

domain: structure, dynamics, and functional insights. Journal of molecular biology. 2011; 788

413: 790-803. 789

42. Kinoshita T, Kondoh C, Hasegawa M, Imamura R, Suda, T. Fas-associated factor 1 is a 790

negative regulator of PYRIN-containing Apaf-1-like protein 1. Int Immunol. 2006; 18: 791

1701-1706. 792

43. Shi C, Miley J, Nottingham A, Morooka T, Prosdocimo DA, Simon DI. Leukocyte 793

integrin signaling regulates FOXP1 gene expression via FOXP1-IT1 long non-coding 794

RNA-mediated IRAK1 pathway. Biochim Biophys Acta Gene Regul Mech. 2019; 1862: 795

493-508. 796

44. Fu G, Xu Q, Qiu Y, Jin X, Xu T, Dong S, Wang J, Ke Y, Hu H, Cao X, Wang D, Cantor 797

H, Gao X, Lu L. Suppression of Th17 cell differentiation by misshapen/NIK-related 798

kinase MINK1. J Exp Med. 2017; 214: 1453-1469. 799

45. Wang Q, Liu F, Zhang M, Zhou P, Xu C, Li Y, Bian L, Liu Y, Yao Y, Wang F, Fang Y, 800

Li D. NLRP12 promotes mouse neutrophil differentiation through regulation of non-801

canonical NF-kappaB and MAPK(ERK1/2) signaling. Int J Biol Sci. 2018; 14: 147-155. 802

https://www.ncbi.nlm.nih.gov/pubmed/?term=Cancer%20Genome%20Atlas%20Research%20Network%5BCorporate%20Author%5D

NLRP12 binds to HCK

33

46. Kinnaird JH, Singh M, Gillan V, Weir W, Calder ED, Hostettler I, Tatu U, Devaney E, 803

Shiels BR. Characterization of HSP90 isoforms in transformed bovine leukocytes 804

infected with Theileria annulata. Cell Microbiol. 2017; 19: e12669. 805

47. Ryu SW, Lee SJ, Park MY, Jun JI, Jung YK, Kim E. Fas-associated factor 1, FAF1, is a 806

member of Fas death-inducing signaling complex. J Biol Chem. 2003; 278: 24003-24010. 807

48. Martin BN, Wang C, Zhang CJ, Kang Z, Gulen MF, Zepp JA, Zhao J, Bian G, Do JS, 808

Min B, Pavicic PG Jr, El-Sanadi C, Fox PL, Akitsu A, Iwakura Y, Sarkar A, Wewers MD, 809

Kaiser WJ, Mocarski ES, Rothenberg ME, Hise AG, Dubyak GR, Ransohoff RM, Li X. 810

T cell-intrinsic ASC critically promotes T(H)17-mediated experimental autoimmune 811

encephalomyelitis. Nat Immunol. 2016; 17: 583-592. 812

49. Prada-Arismendy J, Arroyave JC, Rothlisberger S. Molecular biomarkers in acute 813

myeloid leukemia. Blood Rev. 2017; 31: 63-76. 814

50. Poh AR, O'Donoghue RJ, Ernst M. Hematopoietic cell kinase (HCK) as a therapeutic 815

target in immune and cancer cells. Oncotarget. 2015; 6: 15752-15771. 816

51. Dos Santos C, Demur C, Bardet V, Prade-Houdellier N, Payrastre B, Récher C. A critical 817

role for LYN in acute myeloid leukemia. Blood. 2008; 111: 2269. 818

52. Greenbaum D, Colangelo C, Williams K, Gerstein M. Comparing protein abundance and 819

mRNA expression levels on a genomic scale. Genome Biol. 2003; 4: 117. 820

53. Vogel C, Marcotte EM. Insights into the regulation of protein abundance from proteomic 821

and transcriptomic analyses. Nat Rev Genet. 2012; 13: 227-232. 822

54. Liu Y, Beyer A, Aebersold R. On the dependency of cellular protein levels on mRNA 823

abundance. Cell. 2016; 165: 535-550. 824

55. Prochnicki T, Latz E. Inflammasomes on the crossroads of innate immune recognition 825

and metabolic control. Cell Metab. 2017; 26: 71-93. 826

56. Saito Y, Yuki H, Kuratani M, Hashizume Y, Takagi S, Honma T, Tanaka A, Shirouzu M, 827

Mikuni J, Handa N, Ogahara I, Sone A, Najima Y, Tomabechi Y, Wakiyama M, Uchida 828

N, Tomizawa-Murasawa M, Kaneko A, Tanaka S, Suzuki N, Kajita H, Aoki Y, Ohara O, 829

Shultz LD, Fukami T, Goto T, Taniguchi S, Yokoyama S, Ishikawa F. A pyrrolo-830

pyrimidine derivative targets human primary AML stem cells in vivo. Sci Transl Med. 831

2013; 5: 181ra152. 832

. 833

57. Pene-Dumitrescu T, Peterson LF, Donato NJ, Smithgall TE. An inhibitor-resistant mutant 834

of HCK protects CML cells against the antiproliferative and apoptotic effects of the 835

broad-spectrum c-SRC family kinase inhibitor A-419259. Oncogene. 2008; 27: 7055-836

7069. 837

58. Naganna N, Opoku-Temeng C, Choi EY, Larocque E, Chang ET, Carter-Cooper BA, 838

Wang M, Torregrosa-Allen SE, Elzey BD, Lapidus RG, Sintim HO. Amino 839

alkynylisoquinoline and alkynylnaphthyridine compounds potently inhibit acute myeloid 840

leukemia proliferation in mice. EBioMedicine. 2019; 40: 231-239. 841

59. Hu Y, Liu Y, Pelletier S, Buchdunger E, Warmuth M, Fabbro D, Hallek M, Van Etten 842

RA, Li S. Requirement of c-SRC kinases LYN, HCK and FGR for BCR-ABL1-induced 843

B-lymphoblastic leukemia but not chronic myeloid leukemia. Nat Genet. 2004; 36: 453-844

461. 845

60. Hobbs S, Jitrapakdee S, Wallace JC. Development of a bicistronic vector driven by the 846

human polypeptide chain elongation factor 1α promoter for creation of stable mammalian 847

NLRP12 binds to HCK

34

cell lines that express very high levels of recombinant proteins. Biochem Biophys Res 848

Commun. 1998; 252: 368-372. 849

61. Brakke MK. Density Gradient Centrifugation: A New Separation Technique1. JACS. 850

1951; 73: 1847-1848. 851

62. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, 852

Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, 853

Tomancak P, Cardona A. Fiji: an open-source platform for biological-image analysis. Nat 854

Methods. 2012; 9: 676-682. 855

63. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, 856

Heuer ML, Larsson E, Antipin Y, Reva B, Goldberg AP, Sander C, Schultz N. The cBio 857

cancer genomics portal: an open platform for exploring multidimensional cancer 858

genomics data. Cancer Discov. 2012; 2: 401-404. 859

860


Name Frequency



Hematopoietic cell kinase (HCK) proto-oncogene, c-SRC family tyrosine kinase (HCK) 9

Chaperone DnaJ (a.k.a., heat shock protein 40 kD(Hsp40)) homolog, subfamily B,

member 1 (DNAJB1) 9




Talin 1 (TLN1) 5




Tumor necrosis factor (TNF) receptor associated factor 3 (TRAF3) interacting protein 3 3

NLRP12 binds to HCK

35

(TRAF3IP3)


862

Table 2: Co-occurrence of mRNA expression level of HCK and all of the NLRP family 863

proteins (from the provisional data, assessed on July 11 2019) 864

HCK + NLRP

family genes



P-value

NLRP1 C 0.048

NLRP2 M 0.546

NLRP3 C 0.415

NLRP4 M 0.936

NLRP5 M 0.877

NLRP6 M 0.670

NLRP7 M 0.475

NLRP8 M 0.877

NLRP9 M 0.491

NLRP10 M 0.626

NLRP11 M 0.233

NLRP12 C <0.001

NLRP13 C 1.000

NLRP14 M 0.509

865


NLRP12 binds to HCK

36

Name Primers

NLRP12 5’ primer



NLRP12 3’ primer



NLRP3 5’ primer (cloned

into pGBKT7)



into PGBKT7)



into pGBKT7)

GATCTAGAATTCATGAGTGACGTGAATCCACCCTCTG


into PGBKT7)


NLRP12 5’ (cloned into

pEFIRES-P-3FLAG and

pIRES-V5)


NLRP12 3’ (cloned into

PIRES-3FLAG and

pEFIRES-P-V5)


HCK p61 5’ (cloned into

pEFIRES-P-3FLAG)


HCK p59 5’ (cloned into

pEFIRES-P-3FLAG)


NLRP12 binds to HCK

37

HCK p61/p59 3’ (cloned



867

Figure legends: 868

Figure 1: (A) Schematic drawing of the domain structure of full-length NLRP12 (top) and the 869

domains used as the construct for the yeast two-hybrid screen (bottom). PYD: Pyrin domain; NBD: 870

Nucleotide binding domain; and LRR: Leucine rich repeat domain. (B) The domain structures of the 871

two alternatively spliced isoforms of HCK, HCK p59 and HCK p61. (C) Identification of the 872

clones of HCK interacting with NLRP12 (“hits”) obtained from the yeast two-hybrid screen. 873

Among the nine of the clones positive for HCK, one clone encoded for the smallest interacting 874

fragment of HCK, the C-terminal 40 amino acids of HCK. The numbers in parentheses indicate 875

the total number of hits obtained in the screen. 876

877

Figure 2: Specificity of binding of NLRP12 with HCK. (A) Schematic drawing of HCK (p61 878

isoform, top) and, for comparison, the region of HCK (“HCK C1 fragment,” lower) used for 879

testing the specificity of binding of HCK to other members of the NLRP family of proteins. The 880

numbers represent the amino acid residues of the protein or protein fragment (B) Phylogenetic 881

tree showing the relationships among the PYD + NBD region of all of the members of the human 882

NLRP family of proteins. The phylogenetic tree was produced through Clustal Omega 883

(https://www.ebi.ac.uk/Tools/msa/clustalo/). For each NLRP family member, the PYD + NBD 884

of the longest isoform was selected for generating the phylogenetic tree. NLRP3 is 885

phylogenetically the closest NLRP to NLRP12, while NLRP8 is phylogenetically among the 886

most distant from NLRP12. NLRP3 and NLRP8 are highlighted in red color. (C) When 887


NLRP12 binds to HCK

38

NLRP12’s PYD + NBD and HCK C1 fragment were co-transformed into yeast, they grew on the 888

highest stringency plates (4DO + 3AT), consistent with an interaction between the two constructs. 889

On the other hand, neither NLRP3’s PYD + NBD co-transformed with the C1 fragment nor 890

NLRP8’s PYD + NBD co-transformed the C1 fragment grew on the highest stringency plates. 891

These results are consistent with a specific interaction between NLRP12 and the HCK C1 892

fragment, but not with the other NLRPs. (D) Yeast clones grew on the high stringency plates 893

4DO + 3AT when HCK’s C1 fragment and NLRP12’s PYD + NBD were co-transformed, but 894

they did not grow on the high stringency 4DO + 3AT plates when the C1 fragments of other 895

members of the c-SRC family of non-receptor tyrosine kinases were co-transformed with 896

NLRP12’s PYD + NBD. These results are again consistent with a specific interaction between 897

NLRP12 and HCK. 898

899

Figure 3: (A) Structure of the HCK C1 fragment generated by Chimera from the University of 900

California, San Francisco (version 1.13.1), extracted from its structure within the entire HCK 901

protein. HCK C1 fragment was thus divided into four helical domains: R1, R2, R3, and R4. The 902

side chains of amino acids F503, I506, Q507, L510, and D511 are shown. However, it is not 903

clear whether the C1 fragment retains the structural features shown here when it expressed on its 904

own. (B) Primary amino acid sequence alignments showing of the C1 fragments of all members 905

of the c-SRC non-receptor tyrosine kinase family (40 amino acids for HCK, BLK, LCK, and 906

LYN; 42 amino acids for FGR, c-SRC, YES, and FYN). The black lines indicate the R1, R2, R3, 907

or R4 regions. The arrows denote the four critical amino acids for binding of HCK C1 fragment 908

to NLRP12’s PYD + NBD. (C) Phylogenetic tree showing the relationship among all of the C1 909

fragments of the members of the c-SRC family of non-receptor tyrosine kinases. The 910

NLRP12 binds to HCK

39

phylogenetic tree was produced through Clustal Omega (https://www.ebi.ac.uk/Tools/msa/ 911

clustalo/). HCK is highlighted in red color. (D) Four sets of distinct mutations were made within 912

the HCK C1 fragment. M1: the amino acids in the R1 region were mutated to the amino acids 913

identical to the R1 region in LYN (highlighted in red color); M2: the amino acids in the R2 914

region were all mutated to alanine (Ala); M3: the amino acids in the R3 region were all mutated 915

to Ala; and M4: the amino acids in the R4 region were all mutated to Ala. (E) Yeast did not 916

grow on high stringency 4DO + 3AT plates when HCK C1 fragment with the M3 mutations was 917

co-transformed with NLRP12’s PYD + NBD. But yeast can grow on the high stringency 4DO + 918

3AT plates when the HCK C1 fragment contained either the M1, M2, or M4 mutations, 919

suggesting that the R3 region within the C1 fragment was necessary for binding to NLRP12 920

NBD + PYD. (E) Yeast did not grow on high stringency 4DO plates when NLRP12’s PYD + 921

NBD was co-transformed with HCK C1 fragment with single Ala substitutions at either F503, 922

I506, Q507, L510, or D511. But yeast grew on high stringency 4DO plates when NLRP12’s 923

PYD + NBD was co-transformed with HCK’s C1 fragment in which the following amino acids in 924

the R3 region were individually mutated to Ala: E504, Y505, S508, or V509. 925

926

Figure 4: (A) Top: schematic drawing of HCK truncations comprising the C1 to C7 fragments. 927

Bottom: yeast grew on the high stringency 4DO plates and 4DO +3AT plates when HCK’s C-928

terminal 40 amino acid fragment (C1), HCK’s C-terminal 35 amino acid fragment (C2), and 929

HCK’s C-terminal 30 amino acid fragment (C3), individually, were co-transformed with 930

NLRP12’s PYD + NBD. But yeast did not grow on the high stringency 4DO plates nor 4DO+ 931

3AT plates when C4 to C7 fragments were co-transformed to with NLRP12’s PYD + NBD. The 932

lack of yeast growth upon co-transformation of the C7 fragment and NLRP12 are not shown. (B) 933

NLRP12 binds to HCK

40

Top: schematic drawing of Hck truncations comprising the N1 to N5 fragments. Bottom: yeast 934

grew on the high stringency 4DO plates and 4DO +3AT plates when HCK’s C-terminal 40 935

amino acid fragment (C1) was co-transformed with NLRP12’s PYD + NBD (control). But yeast 936

did not grow on the high stringency 4DO plates nor 4DO+ 3AT plates when N1 and N5 937

fragments were co-transformed with NLRP12’s PYD + NBD, suggesting that the very C-terminal 938

5 amino acids are also necessary for binding of NLRP12. The colored boxes represent different 939

fragments that were deleted each time. 940

941

Figure 5: NLRP12 co-immunoprecipitates with HCK and co-localizes with HCK by 942

immunofluorescence. (A) NLRP12 co-immunoprecipitated with HCK when both proteins were 943

transiently exogenously co-expressed in 293T cells, with NLRP12 having to be expressed as 944

epitope-tagged forms. Cells were lysed using a non-denaturing cell lysis buffer (see Material 945

and Methods). Co-immunoprecipitations were done using a mouse monoclonal anti-HCK 946

antibody followed by protein A/G agarose. The immunoprecipitated proteins were analyzed by 947

immunoblotting. The same method was used for experiments shown in (B), (C), and (D). (B) 948

NLRP12 co-immunoprecipitated with endogenous HCK in macrophage-like RAW 264.7 cells, 949

when NLRP12 is exogenously and stably expressed. Arrows show the two isoforms of HCK p59 950

and p61 that were immunoprecipitated by the anti-HCK antibody, although it is not clear 951

whether NLRP12 co-immunopreciptitated with one form or the other, or both. (C) Exogenously 952

and stably expressed NLRP12 co-immunoprecipitated with endogenously expressed HCK in 953

monocyte-like THP-1 cells. In these cells, phorbol 12-myristate 13-acetate (PMA) (1µM) was 954

added to enhance the expression of NLRP12 under the PMA-sensitive cytomegalovirus promoter 955

of the NLRP12 plasmid. (D) Left panel shows that NLRP12 was exogenously and stably 956

NLRP12 binds to HCK

41

expressed in lymphoblast-like U937 cells. Right panel shows that NLRP12 co-957

immunoprecipitated with endogenously expressed HCK in U937 cells after PMA was added to 958

1µM, as was done for THP-1 cells, to enhance expression of NLRP12. (E) Immunofluorescent 959

images showing the colocalization of a cohort of NLRP12 with either HCK p59 or p61. HCK 960

was immunolabeled with a mouse monoclonal anti-HCK antibody, followed by a secondary goat 961

anti-mouse IgG (H+L) cross-adsorbed, conjugated to Alexa Fluor 488. For NLRP12, the 962

primary antibody was a rabbit monoclonal anti-FLAG antibody, and the secondary antibody was 963

a goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555. 964

Nuclei were counterstained by DAPI. 965

966

Figure 6: The co-expression of HCK protein significantly decreased the steady-state protein 967

expression levels of NLRP12 (A) Epitope-tagged NLRP12-V5 and HCK p61 were co-968

transfected into 293T cells. Cell lysates were immunoblotted with rabbit monoclonal anti-V5 969

antibody for NLRP12 and mouse monoclonal anti-HCK antibody. Comparing lane 2 (basal level 970

of NLRP12 expression) with lanes 5, 6, and 7, co-expression of HCK protein leads to a 971

significant decrease of protein expression levels of NLRP12 over three times they are co-972

expressed. Increasing protein expression of HCK, relative to the plasmid DNA added (ramp: 973

lanes 5, 6, and 7; 2.5-20 μg of DNA) was not observed possibly because the amount of plasmid 974

for HCK transfection were already too high, resulting in the maximum expression of HCK at all 975

plasmid DNA amounts. The figure is representative of the results from three experiments. (B) 976

Quantification of the NLRP12 protein bands (mean + standard error) to show that NLRP12 977

protein expression levels decreased in the presence of co-expressed HCK, relative to equal 978

amounts of cell lysate being assayed. The NLRP12 protein expression levels are indicated as 979

NLRP12 binds to HCK

42

arbitrary units. (C) Quantification of the HCK protein bands (mean + standard error) confirming 980

that HCK protein expression levels did not change although the amount of plasmid DNA for 981

HCK increased. Figure (B) and (C) were generated by Prism 6.0 (GraphPad Software, Inc., San 982

Diego, CA). Twenty μg of cell lysate proteins were loaded for each lane. ANOVA and Tukey 983

tests were used to compare the NLRP12 and HCK protein bands. 984

985

Figure 7: NLRP12 is co-expressed with Hck in acute myeloid leukemia (AML) patient samples. 986

Both NLRP12 expression and Hck expression data are shown as log2 values. The data are RNA 987

seq data obtained from cBioportal (provisional) database assessed on July 11, 2019. The graph 988

was taken from the cBioportal website. Spearman coefficient, indicating the association of 989

NLRP12 and Hck mRNA expression level (if NLRP12 and Hck mRNA expression levels are 990

non-parametric) = 0.80. Pearson coefficient, indicating the degree of the linear relationship 991

between the NLRP12 mRNA expression level and Hck mRNA expression level (if NLRP12 and 992

Hck mRNA expression levels are parametric) = 0.73. The p-values for Spearman coefficient and 993

Pearson coefficient are both < 0.001. 994

995


results of the yeast two-hybrid screen for proteins that interacted with NLRP12. The figure only 997

shows the NLRP12-interacting proteins with hits that have a frequency larger than 2. The solid 998

lines indicate interacting proteins found through our yeast two-hybrid screen. The dashed lines 999

are the NLRP12-interacting proteins previously reported in published data. The purple-colored 1000

molecules are those associated with AML. (B) To validate an interaction shown in the IPA 1001

diagram, tumor necrosis factor receptor-associated factor 3 interacting protein 3 (TRAF3IP3)-1002

NLRP12 binds to HCK

43

3FLAG and NLRP12-V5 were co-immunoprecipitated from co-transfected 293T cells. A non-1003

denaturing cell lysate buffer (see Material and Methods) was used to lyse the cell, and co-1004

immunoprecipitations were performed with a mouse monoclonal anti-TRAF3IP3 antibody 1005

followed by protein A/G agarose. The immunoprecipitates were analyzed for NLRP12 by 1006

immunoblotting with rabbit monoclonal anti-V5 antibody. The results from the co-1007

immunoprecipitation are consistent with a confirmation of an interaction between TRAF3IP3 1008

and NLRP12. 1009

1010

1011

1012

1013

1014

1015

1016

NLRP12 binds to HCK

44

1017

Figure 1 1018

1019

1020

1021

1022

1023

1024

1025

1026

1027

NLRP12 binds to HCK

45

1028

1029

Figure 2 1030

1031

1032

NLRP12 binds to HCK

46

1033

1034

1035

1036

NLRP12 binds to HCK

47

1037

Figure 3 1038

1039

NLRP12 binds to HCK

48

1040

1041

1042

NLRP12 binds to HCK

49

Figure 4 1043

1044

1045

NLRP12 binds to HCK

50

1046

Figure 5 1047

1048

NLRP12 binds to HCK

51

1049

1050

Figure 6 1051

1052

NLRP12 binds to HCK

52

1053

Figure 7 1054

1055

1056

1057

1058

1059

1060

1061

1062

1063

NLRP12 binds to HCK

53

1064

Figure 8 1065

1066

1





2



5

*Correspondence: 6

Yue Zhang 7

[email protected] 8

9

Running title: Nlrp12 binds to Hck 10

11

Key words: yeast two-hybrid, innate immunity, protein‐protein interaction, Nlrp12, Hck, acute 12

myeloid leukemia13

14

15

Abstract 16


and leucine-rich repeat (LRR), pyrin domain (PYD)-containing family of proteins 12 (Nlrp12). 18

cDNA encoding the human PYD + NBD of Nlrp12 was used as bait in a yeast two-hybrid screen 19


Nlrp12 binds to Hck

2

with a human leukocyte cDNA library as prey. Hematopoiesis cell kinase (Hck), a member of 20

the Src family of non-receptor tyrosine kinases, was among the top hits. The C-terminal 40 21

amino acids of Hck specifically bound to Nlrp12’s PYD + NBD, but not to that of Nlrp3 and 22

Nlrp8. Amino acids F503, Q507, L510, and D511 of Hck are critical for the binding of Hck’s C-23

terminal 40 amino acids to Nlrp12’s PYD + NBD. Additionally, the C-terminal 30 amino acids 24

of Hck are sufficient to bind to Nlrp12’s PYD + NBD, but not to its PYD alone nor to its NBD 25

alone. In cell lines that express Hck endogenously, it was co-immunoprecipitated with stably 26

expressed exogenous Nlrp12. Also, Nlrp12 co-immunoprecipitated and co-localized with Hck 27

when both were overexpressed in 293T cells. In addition, in this overexpression system, steady-28

state Nlrp12 protein expression levels significantly decreased when Hck was co-expressed. 29

Bioinformatic analysis showed that Hck mRNA co-occurred with Nlrp12 mRNA, but not with 30

other Nlrp proteins, in blood and marrow samples from acute myeloid leukemia (AML) patients. 31

The mRNA of Nlrp12 is also co-expressed with Hck in AML patient samples, and the levels of 32

mRNA expression of each are correlated. Together these data suggest that Nlrp12, through its 33

binding to Hck, may have an effect on the progression of AML. 34

35

Introduction 36


associated molecular patterns (DAMP) and pathogen-associated molecular patterns 38

(PAMP)(Takeuchi and Akira, 2010). Among PRR, one class of proteins is the nucleotide-39

binding domain (NBD) and leucine-rich repeat (LRR) receptor family (NLR). NBD and LRR 40

PYD protein 12 (Nlrp12) is one protein that belongs to the PYD subfamily of the NLR class and 41

is a multi-functional protein (Tuncer et al., 2014). Nlrp12’s functions likely all depend on 42

Nlrp12 binds to Hck

3

defined protein-protein interactions. For example, in anti-inflammatory functions of Nlrp12, 43

Nlrp12 interacts with tumor necrosis factor receptor associated factor 3 (TRAF3) and nuclear 44

factor kappa-light-chain-enhancer of activated B cells (NF-κB)-inducing kinase (NIK) in the 45

non-canonical NF-κB pathway, when toll-like receptors (TLR) are stimulated with Pam3Cys4 46

triacylated lipopeptides followed by addition of cluster of differentiation 40 (CD40) (Allen et al., 47

2012). Nlrp12’s inhibition of the non-canonical NF-κB pathway, thereby effecting an anti-48

inflammatory function, has been reported in many publications (7-11). For example, in colitis-49

driven colon cancer, Nlrp12 knock-out (KO) mice experience a higher frequency of death, weigh 50

less, have a shorter colon length, and have more severe disease progression than wild type (WT) 51

mice, all of which may occur through Nlrp12’s inhibition of the non-canonical NF-κB pathway 52

(Zaki et al., 2011; Allen et al., 2012). In addition, Nlrp12 KO mice have been reported to exhibit 53

higher innate immunity when it is infected by the virus because Nlrp12 inhibits the non-54

canonical NF-κB pathway; thus, in a KO mice, a more significant increase of NF- κB activity is 55

observed compared to WT mice when it is infected by the virus (Chen et al., 2019). And in the 56

case of Nlrp12 protecting the diversity of intestinal microbiota (Chen et al., 2017), thereby 57

preventing obesity (Truax et al., 2018), it has also been reported that Nlrp12 KO mice display 58

significantly decreased intestinal microbial diversity due to increased innate immunity, resulting 59

from the lack of inhibition of the non-canonical NF-κB pathway. 60

61

In addition, Nlrp12 also interacts with interleukin (IL)-1 receptor-associated kinase 1 (IRAK1) in 62

the canonical NF-κB pathway when TLRs are stimulated, also to inhibit the inflammatory 63

response (Ye et al., 2008). In contrast, for human studies of Nlrp12-associated autoinflammatory 64

disorders, no protein-protein interactions have been reported (Jeru et al., 2008; Jeru et al., 2011). 65

Nlrp12 binds to Hck

4

Functionally, however, Nlrp12 KO mice had a higher immunological response in the 66

autoimmune model of contact hypersensitivity (Arthur et al., 2010); thus, these mice are more 67

prone to develop contact hypersensitivity. This results most likely from Nlrp12 KO mice having 68

defective migration of their dendritic cells (DC). But, in the mouse study, no protein-protein 69

interactions had been reported either (Arthur et al., 2010). And Nlrp12 is protective against 70

Yersinia pestis infection through Nlrp12’s activation of the inflammasome which results in 71

secretion of IL-18 and IL-1β. But again, no protein-protein interactions of Nlrp12 within 72

inflammasomes had been characterized (Vladimer et al., 2012). Thus, there is a further need to 73

find and to characterize previously unreported Nlrp12-binding proteins. Knowing Nlrp12’s 74

protein binding partners may help to gain mechanistic insight into pathways previously 75

characterized as being regulated by Nlrp12. Moreover, identifying and validating potentially 76

novel binding partners of Nlrp12 may suggest novel functions for Nlrp12. 77

78

In humans, Nlrp12 is mainly expressed in macrophages, DCs, and neutrophils. In mice, Nlrp12 79

is primarily expressed in DCs and neutrophils (Arthur et al., 2010; Hornick et al., 2018; Chen et 80

al., 2019). The Nlrp12 protein has three domains, from N- to C-terminus: PYD, NBD, and LRR 81

domains (Damiano et al., 2004; Janowski et al., 2013; Tuncer et al., 2014). It is generally 82

accepted that the LRR domain, like Nlrp1’s LRR domain and Nlrp3’s LRR domain, is 83

responsible for sensing ligands or other types of activators of Nlrps in modulating their role in an 84

immunologic response (Martinon et al., 2004; Faustin et al., 2007; Kanneganti et al., 2007; 85

Sharif et al., 2019). However, interestingly, it has been reported that without the LRR domain, 86

Nlrp3 still can be activated by triggers of the canonical NF-κB pathway (Hafner-Bratkovič et al., 87

2018). The NBD domain is responsible for self-oligomerization when Nlrp is activated, and the 88

Nlrp12 binds to Hck

5

PYD domain is responsible for regulating downstream signaling pathways (and thus, it is called 89

the “interaction domain”) (Hafner-Bratkovič et al., 2018; Hornick et al., 2018). Here we used a 90

truncated form of Nlrp12 (PYD + NBD) to identify possible protein-protein interactions that may 91

regulate signaling pathways in which Nlrp12 is involved. In addition, to our knowledge, there 92

are currently no protein-protein interaction studies that have been performed for this truncated 93

form of Nlrp12 and may thus represent a new general approach to screening for protein-protein 94

interactions involved in signaling complexes with Nlrps. 95

96

A yeast two-hybrid screen was performed to identify potential binding partners of Nlrp12’s PYD 97

+ NBD. Hck, a member of the Src family of non-receptor tyrosine kinases, was one of the top 98

positive clones (“hits”) among all of the proteins that appeared to interact with Nlrp12. Further 99

experiments were done to confirm the novel binding of Nlrp12 to Hck and to characterize key 100

structural features of the binding interaction. In addition, co-expression of Hck with Nlrp12 101

resulted in a significant decrease of steady-state Nlrp12 protein expression levels. In 102

consideration together with a bioinformatics analysis included here, a potential interaction 103

between Nlrp12 and Hck may be involved in modulating the role of Hck in the pathogenesis of 104

AML (Roversi et al., 2015; Lopez et al., 2016; Roversi et al., 2017). 105

106

Results 107

Nlrp12 interacts with Hck in the yeast two-hybrid assay 108


Nlrp12 using the yeast two-hybrid assay. The basic principle of the yeast two-hybrid assay is 110

that if the cDNA library contains clones that express proteins, or parts thereof, that interact with 111

Nlrp12 binds to Hck

6

the co-expressed bait, the Nlrp12 PYD + NBD (Figure 1A) in this case, then the co-transformed 112

yeast clones will grow. The cDNA clones from the library that supported growth would then be 113

isolated and characterize, to identify what proteins interact with Nlrp12’s PYD + NBD. The 114

leukocyte library was used because Nlrp12 is mainly expressed in leukocytes in humans (Tuncer 115

et al., 2014; Linz et al., 2017; Hornick et al., 2018; Normand et al., 2018), and thus putative 116

binding partners for Nlrp12 are also likely to be expressed there. 117

118

The screening resulted in 119 positive clones from the leukocyte cDNA library (“hits”) 119

expressed from 48 distinct genes (Supporting information, Table S1) that were subsequently 120

identified as encoding for proteins (or portions thereof) that potentially interact with Nlrp12’s 121

PYD + NBD. The clones with the most hits are listed in Table 1. Among the 119 hits, which 122

included repeated hits of the same genes, 9 were individual clones that encoded fragments of a 123

member of the Src family of non-receptor tyrosine kinases, Hck, which was among the highest 124

number of hits for a single gene (Figure 1B and Table 1). Moreover, of the 9 positive Hck 125

clones, 5 were distinct Hck fragments (Figure 1C). Full-length Hck p61 was also obtained as a 126

hit in another independent yeast two-hybrid screen (data not shown). Hck has two isoforms, p59 127

and P61, in Homo sapiens. P61 and p59 share the same transcript, but p61 uses an uncommon 128

start codon CTG, and p59 uses the common one, ATG (Robbins et al., 1995), to give rise to two 129

distinct transcripts. Endogenously expressed in phagocytes, Hck p59 is mainly localized to the 130

plasma membrane, while Hck p61 is primarily localized to lysosomes, and both of them are also 131

found in the Golgi apparatus (Carreno et al., 2000). It has been suggested that overexpression of 132

p59 promotes the formation of membrane protrusions such as pseudopodia and overexpression of 133

p61 induces podosome rosettes and triggers actin polymerization around lysosomes (Carreno et 134

Nlrp12 binds to Hck

7

al., 2000; Guiet et al., 2008). However, there are no differences between p61 and p59 in the 135

region of Hck that appears to bind to Nlrp12’s PYD + NBD (see below), the C-terminal part of 136

Hck. Thus, detecting a full-length clone of only p61 as a hit, opposed to p59, appeared to be 137

coincidental. 138

139

In directed screens using the yeast two-hybrid assay, Nlrp12’s PYD + NBD domain binding 140

to Hck C-terminal 40 amino acids appears to be selective for Nlrp12 and Hck binding to 141

Nlrp12 appears to be selective for Hck 142

Initially, the Hck C-terminal 40 amino acids (“Hck C1 fragment”) was the shortest Hck fragment 143

from a positive clone that interacted with the bait, Nlrp12’s PYD + NBD (Figure 2A). Nlrp 3 144

and Nlrp8 were chosen based on the phylogenetic trees of the PYD + NBD domains of members 145

of the Nlrp family: phylogenetically, Nlrp3’s PYD + NBD is the most closely related Nlrp PYD 146

+ NBD to that of Nlrp12, while Nlrp8’s PYD + NBD is among the furthest related PYD + NBD 147

to that of Nlrp12 (Figure 2B). In Figure 2C, yeast clones grew on the 4 drop out (DO) (synthetic 148

dropout (SD) plus amino acids supplements minus tryptophan, leucine, histidine, and adenine (-149

Trp-Leu-His-Ade) and 4DO + 3-Amino-1,2,4-triazole (3-AT) high stringency plates when the 150

yeast were co-transformed with Nlrp12’s PYD + NBD and Hck C1 fragment; and thus, this 151

result is indicative of an interaction between the two constructs. However, yeast clones were not 152

observed on 4DO and 4DO + 3-AT plates when Nlrp3’s PYD + NBD and Hck C1 fragment were 153

co-transformed, nor when Nlrp8’s PYD + NBD and Hck C1 fragment were co-transformed. 154

These results suggest that the Hck C1 fragment binds to Nlrp12’s PYD + NBD, but not to those 155

from either Nlrp3 or Nlrp8, results consistent with a selective interaction between Nlrp12’s PYD 156

+ NBD and the Hck C1 fragment. 157

Nlrp12 binds to Hck

8

158


Hck C1 fragment was co-transformed with Nlrp12’s PYD + NBD. However, clones did not 160

grow on the 4DO and 4DO + 3-AT plates when the C1 fragment of other members of the Src 161

family of non-receptor tyrosine kinases were co-transformed with Nlrp12’s PYD + NBD (Figure 162

2D). This experiment suggests that the interaction of Hck C1 fragment with Nlrp12 is selective 163

for Hck; the C1 fragment of other members of the Src family of non-receptor tyrosine kinases 164

did not bind to Nlrp12’s PYD + NBD (Figure 2D). 165

166

In directed screens using the yeast two-hybrid assay, amino acids F503, Q507, L510, and 167

D511 of Hck are critical for the binding between Nlrp12’s PYD + NBD and Hck C-terminal 168

40 amino acids 169

The Hck C1 fragment were divided into four helical regions according to its atomic structure 170

(Sicheri et al., 1997) (protein data bank (PDB) accession number: 1AD5): R1, R2, R3, and R4 171

(designated by us) (Figure 3A). As shown in the sequence alignments in Figure 3B, the primary 172

amino acid sequences of R2, R3, and R4 are very well conserved among members of the Src 173

family of non-receptor tyrosine kinases, while R1 is not. To characterize further the important 174

structural features of Hck’s binding to Nlrp12’s PYD + NBD, all of the amino acids comprising 175

each of the R2, R3, and R4 domains were mutated to alanine, but mutated one section at a time, 176

and were denoted as the Hck M2 fragment, Hck M3 fragment, and Hck M4 fragment, 177

respectively. The amino acids comprising the R1 region were mutated to those amino acids in 178

the R1 region of the Src family non-receptor tyrosine kinase Lyn, which has the closest 179

phylogenetic relationship to Hck (Figure 3C). All of the mutated constructs are illustrated in 180

Nlrp12 binds to Hck

9

Figure 3D. Yeast still grew on the high stringency 4DO + 3AT plates when Nlrp12’s PYD + 181

NBD was co-transformed with the Hck M1 fragment, Hck M2 fragment, and Hck M4 fragment. 182

But, yeast could not grow when Nlrp12’s PYD + NBD was co-transformed with Hck M3 183

fragment (Figure 3E). These experiments suggested that the R1, R2, and R4 regions are 184

dispensable for binding, while R3 may be important for binding. Further analysis was conducted 185

to identify individual critical amino acids of Hck’s R3 region binding to Nlrp12’s PYD + NBD 186

using alanine scanning mutagenesis. However, the intervening sequences between R1, R2, R3, 187

and R4 were not examined for binding. 188

189

To identify the key amino acid residues involved in binding of R3 to Nlrp12’s PYD + NBD, 190

each amino acid in R3 was individually mutated to alanine in an alanine scanning mutagenesis 191

analysis, on the background of the Hck C1 fragment. As shown by the yeast two-hybrid assay, 192

the mutations of F503A, Q507A, L510A, and D511A abolished the growth of yeast clones on the 193

high stringency 4DO when these yeast strains were co-transformed with Nlrp12’s PYD + NBD 194

(Figure 3F). These experiments suggest that these four amino acids are critical for binding. On 195

the other hand, yeast clones still grew on the high stringency 4DO plates when the Hck C1 196

fragments with the Y505A, S508A, or V509A mutations were co-transformed with Nlrp12’s 197

PYD + NBD (Figure 3F). These experiments suggest that Y505, S508, and V509 are 198

dispensable for binding of Hck C1 fragment to Nlrp12’s PYD + NBD. Whether E504 and I506 199

are critical for binding is unfortunately not clear as the yeast did not grow on the control plates 200

(SD/-Trp-Leu). Overall, however, these results suggest that the amino acids F503, Q507, L510, 201

and D511 in Hck are critical for the binding of Hck C1 fragment to Nlrp12’s PYD + NBD. 202

203

Nlrp12 binds to Hck

10

On the other hand, these four amino acid residues are all conserved in all members of the Src 204

family of non-receptor tyrosine kinases (Figure 3A), suggesting that, while they are important for 205

binding, they cannot account for the specificity or selectivity of binding between Nlrp12 and Hck. 206

In addition, these four critical residues, as shown in Figure 3C, appear to be in the same plane 207

along a helix, which may then form an interface that is important for binding to Nlrp12. 208

However, it is unclear whether the structure of the isolated Hck C-terminus used in the screens 209

here will retain its structural features that it possesses in full-length Hck, due to the loss of 210

intermolecular interactions for the C-terminal region. Moreover, for example, the amino acids 211

R500, P501, T502, D512, T515, Q520, and Y521, are 100% conserved among all other members 212

of the Src family of non-receptor tyrosine kinases and are therefore unlikely to play a role in 213

specificity and selectivity of binding of Nlrp12 with Hck. But, it is possible that two or more 214

amino acids in the intervening sections between the R1-R4 regions, which were not analyzed by 215

mutagenesis, may then actually account for the specificity and selectivity of binding of Hck to 216

Nlrp12. One example is that the combination of R496, P497, and Q522 is unique to Hck 217

compared to other members of the Src family of non-receptor tyrosine kinases. 218

219

In directed screens using the yeast two-hybrid assay, the shortest fragment of Hck that 220

binds to Nlrp12’s PYD + NBD is its C-terminal 30 amino acids 221

The shortest form of Hck that bound to Nlrp12’s PYD + NBD was determined by observing 222

whether the yeast clones grew on high stringency 4DO or 4DO +3AT plates when Nlrp12’s PYD 223

+ NBD was co-transformed with Hck fragments C1 to C7 and N1 to N5 (Figure 4) (data of 224

Nlrp12’s PYD + NBD co-transformed with Hck fragment C7 did not shown). Hck’s C1 to C7 225

fragments were gradually truncated from the N-terminus of the Hck C-terminal 40 amino acid 226

Nlrp12 binds to Hck

11

fragment (Figure 4A and 4B). Hck N1 to N5 fragments were gradually truncated from the C-227

terminus of the Hck C-terminal 40 amino acid fragment (Figure 4C and 4D). Yeast strains grew 228

on high stringency 4DO or 4DO +3AT plates when either the Hck C1, C2, or C3 fragment was 229

co-transformed with Nlrp12’s PYD + NBD. Thus, of all of the constructs screened, the shortest 230

fragment of Hck that can apparently bind to Nlrp12’s PYD + NBD is the C-terminal 30 amino 231

acids, as indicated by the Hck C3 fragment (Figure 4B and 4D). In addition, the C-terminal 5 232

amino acids also appear to be important for binding, as clones co-transformed with Nlrp12’s 233

PYD + NBD with N1, with a deletion of the C-terminal 5 amino acids of Hck, did not grow on 234

the high stringency 4DO and 4DO + 3AT plates (Figure 4D). The structures of both inactive 235

Hck (PDB accession number: 1AD5) and active c-Src (PDB accession number: 1Y57), the 236

prototypical member of this family of nonreceptor tyrosine kinases related to Hck, show that the 237

C-terminal 4 amino acids are surface-exposed, indicating that these four amino acids that are 238

critical for binding are available to interact with Nlrp12. 239

240

Nlrp12 co-immunoprecipitates with Hck from mammalian cells, and Nlrp12 is co-localized 241

with Hck in mammalian cells 242

Nlrp12 and Hck could be co-immunoprecipitated when they were both heterologously co-243

expressed in 293T cells (Figure 5A). Also, semi-endogenous conditions were used for co-244

immunoprecipitations from cells in which Hck is endogenously expressed, and Nlrp12 was 245

heterologously stably expressed in epitope-tagged form, such as in macrophage-like RAW 264.7 246

cells (Figure 5B), monocyte-like THP-1 cells (Figure 5C), and lymphocyte -like U937 cells 247

(Figure 5D). Semi-endogenous conditions have been used in previous reports where Nlrp12 was 248

shown to interact with TRAF3 (Allen et al., 2012), NIK (Lich et al., 2007), and IRAK-1(Ye et al., 249

Nlrp12 binds to Hck

12

2008). In all cases, Nlrp12 co-immunoprecipitated with the p59 and p61 isoforms of Hck, but 250

from these experiments, it is not clear that whether Nlrp12 interacts with p59, p61, or both 251

isoforms of Hck. In U937 cells and THP-1 cells, since heterologous Nlrp12 expression level was 252

low, adding phorbol 12-myristate 13-acetate (PMA) (1 µM for 24 hr) increased Nlrp12 253

expression level by stimulating the PMA-sensitive cytomegalovirus promoter of Nlrp12’s 254

expression plasmid (Figure 5C and 5D). Taken together, these data suggest that Nlrp12 and Hck 255

(either p59, p61, or both isoforms) can interact with each other in a mammalian cell system, a 256

result that in part validates the findings from the yeast two-hybrid assay. 257

258

After heterologous co-expression of Nlrp12 with either the p61 or the p59 isoform of Hck in 259

293T cells, immunofluorescent staining of Nlrp12 and Hck showed that Nlrp12 can be co-260

localized with either p61 or p59 isoforms of Hck in most of the 293T cells (Figure 5E and 261

Supporting Information Figure S1). The co-localization of Nlrp12 and Hck is consistent with an 262

intracellular interaction between the two proteins. In addition, the lack of selectivity of Nlrp12 263

co-localizing with either p61 or p59 isoform of Hck is consistent with the results from the 264

screening assay, where the putative binding region of Hck to Nlrp12 is identical in both the p61 265

and p59 isoforms. 266

267

The steady-state level of Nlrp12 protein is significantly decreased when Hck protein is co-268

expressed 269

Figure 6 shows that in 293T cells, the co-expression of Hck led to a significant decrease in 270

steady-state protein expression levels of Nlrp12. Although, alternatively, the apparent decrease in 271

expression level of Nlrp12 might be due actually to a decrease in the epitope-tag itself or a 272

Nlrp12 binds to Hck

13

decrease in the expression of the epitope-tagged protein only. Interestingly, Hck protein levels 273

did not show an increasing level of expression upon transfection with increasing amounts of 274

plasmid DNA, possibly due to Hck’s maximum expression levels in these cells being achieved 275

with the lowest amounts of plasmid DNA, which may be resolved if the transfections are 276

performed with lower amounts of plasmid DNA. 277

278

In blood and marrow samples from patients with AML, Nlrp12 and Hck co-occur and are 279

co-expressed 280





tests to The Cancer Genome Atlas (TCGA) provisional data sets for AML patients (Cerami et al., 285

2012a; 2013; Gao et al., 2013), Nlrp12 and Nlrp1 are the only two Nlrp family members that 286

show a statistically significant co-occurrence with Hck (Table 2). However, Nlrp1’s co-287

occurrence has a P value of 0.048, while Nlrp12’s co-occurrence has a P value of <0.001. 288

Therefore, Nlrp12 is most likely the only Nlrp family protein that shows co-occurrence with Hck 289

in samples from patients with AML. 290

291

Moreover, in this analysis, Nlrp12 is significantly co-expressed with Hck (Pearson coefficient = 292

0.80 and Spearman coefficient = 0.73, Pearson and Spearman coefficients show the possibility of 293

a linear relationship of two factors, Figure 7). This analysis is also consistent with Nlrp12 and 294

Hck co-occurring in the same patients with AML. However, Nlrp12 was not the only Nlrp 295

Nlrp12 binds to Hck

14

protein that shows significant co-expression with Hck. Nlrp1 and Nlrp3 also showed significant 296

co-expression with Hck. This can be explained by the fact that co-expression is less stringent 297

than co-occurrence. In summary, Nlrp12 is the only Nlrp protein that shows co-occurrence with 298

Hck, and it also shows co-expression with Hck, although it is not the only member of the Nlrp 299

family to do so. Other data sets, including Hausera data, Metzeler 1 data, Metzeler2 data, and 300

Raponi data, were not available to evaluate the co-expression of Nlrp12 versus Hck, as these 301

other data sets did not have information regarding Nlrp12 expression. 302

303

Other potential binding partners of Nlrp12 from the yeast two-hybrid screen 304

Other potentially interesting and unique genes that whose products may interact with Nlrp12’s 305

PYD + NBD were identified in the yeast two-hybrid screen (Table 1 and Supporting information 306

Table S1). Table 1 only shows those hits with frequency larger than 2, and these hits were 307

analyzed through an Ingenuity Pathway Analysis (IPA) diagram (Figure 8). In the IPA diagram, 308

protein-protein interactions found by our yeast two-hybrid screen are connected by solid lines 309

and interactions between protein binding partners collated by IPA are connected by dashed lines. 310

In addition, those molecules that are associated with AML are colored purple. Interestingly, 311

Nlrp12 is also associated with AML from the database Catalogue of somatic mutations in cancer 312

(COSMIC). Although the mutation occurs in the NBD of Nlrp12, only 2 samples of these 313

mutations are observed within 175 samples. 314

315

The interaction of one of the putative binding partners to Nlrp12 identified in our screen, TRAF3 316

interacting protein 3 (TRAF3IP3), was validated in a co-immunoprecipitation experiment where 317

the FLAG-tagged form of TRAF3IP3 and V5-tagged form of Nlrp12 were overexpressed in 318

Nlrp12 binds to Hck

15

293T cells. TRAF3IP3 was coimmunoprecipitated by adding mouse monoclonal anti-319

TRAF3IP3 antibody, and a band that showed the same molecular weight size of Nlrp12 was 320

detected by rabbit monoclonal anti-V5 antibody (Figure 8). However, further validation of these 321

other putative interactors detected by the yeast two-hybrid needs to be done. 322

323

Discussion 324

In this paper, the yeast two-hybrid assay was used to screen for Nlrp12 binding partners. This 325

approach identified 48 genes as positive hits encoding proteins that could possibly bind to 326

Nlrp12. Among the hits, the Src non-receptor tyrosine kinase family member Hck was selected 327

to focus upon as a potentially interesting target, particularly given its association with 328

hematopoiesis and AML. Further direct screens found that Nlrp12 specifically binds to Hck, but 329

not to Nlrp8 or Nlrp3. Conversely, Hck, but not other members of the Src non-receptor tyrosine 330

kinase family, specifically binds to Nlrp12. Hck’s C-terminal 30 amino acids are sufficient for 331

binding to Nlrp12. And, amino acids F503, Q507, L510, and D511 of Hck are critical for 332

binding to Nlrp12. Co-immunoprecipitation experiments from mammalian cells confirmed that 333

Nlrp12 and Hck interact. Co-expression of Nlrp12 and Hck results in a significantly lower 334

steady-state expression level of Nlrp12; thus, the interaction may affect Nlrp12 protein stability. 335

Finally, a bioinformatics analysis shows that Nlrp12 and Hck essentially exclusively co-occur, 336

and mRNA levels for both are correlated in blood samples from AML patients. Together, these 337

data suggested that Nlrp12 and Hck protein and mRNA co-expression may have an effect on the 338

AML. 339

340

Nlrp12 binds to Hck

16





maintain stable binding of Hck’s C-terminal 40 amino acids to Nlrp12’s PYD + NBD. Thus, 345

binding of Nlrp12’s PYD + NBD to this fragment of Hck may occur initially through binding to 346

R3, followed by stabilization of the interaction by secondarily binding to R2. This model is also 347

consistent with the finding that when we mutated the R3 region, the binding of Hck’s C-terminal 348

40 amino acid fragment to the Nlrp12’s PYD + NBD was lost despite the R2 region being 349

present. The above evidences are consistent with the model that R2 and R3 regions together are 350

both necessary for binding, but the stabilization of binding to the R3 region requires the presence 351

of R2. 352

353

The yeast two-hybrid screen with Nlrp12 also identified 47 other genes as potential interactors. 354

According to the Search Tool for Recurring Instances of Neighbouring Genes (STRING) protein 355

network and previous publications, Nlrp12 interactors include IRAK1 (Williams et al., 2005), 356

NIK (Lich et al., 2007), TRAF3(Allen et al., 2012), heat shock protein 90 (HSP90) (Arthur et al., 357

2007), Fas associated factor 1 (FAF1) (Pinheiro et al., 2011), and apoptosis-associated speck-like 358

protein containing a caspase activation and recruitment domain (ASC) proteins. IRAK1, NIK, 359

TRAF3, and Heat shock protein (HSP) 90 were only found in experiments involving semi-360

endogenous protein co-immunoprecipitations with Nlrp12. FAF1 was found to be an interacting 361

protein in NMR experiments by showing a difference in the chemical shift perturbation of 362

FAF1’s ubiquitin-associated domains (UBA) domain alone and Nlrp12’s PYD domain bound to 363

Nlrp12 binds to Hck

17

FAF1’s UBA domain. And FAF1 was also found to interact with Nlrp12 in a yeast two-hybrid 364

study where the PYD domain of different Nlrp proteins were screened (Kinoshita et al., 2006). 365

However, in our study, IRAK1 (Shi et al., 2019), NIK (Fu et al., 2017), TRAF3 (Wang et al., 366

2018), HSP90 (Kinnaird et al., 2017), FAF1 (Ryu et al., 2003), and ASC (Martin et al., 2016) 367

proteins were not found in our results of interacting proteins, although they are all expressed in 368

leukocytes. Therefore, given these differences, the results from this yeast two-hybrid screen 369

may provide a unique database for future investigations on the proteins that interact with Nlrp12, 370

and the functional outcomes of these interactions. 371

372

How Hck co-expression affects Nlrp12 expression can be further investigated to determine the 373

functional outcomes of the Nlrp12-Hck interaction relative to protein stability or degradation. 374

For example, MG-132 and chloroquine, which are a proteasomal inhibitor and an inhibitor of 375

lysosomal degradation, respectively, can be added to cells in these experiments to determine 376

whether the decreasing protein expression level of Nlrp12 in the presence of Hck is due to 377

proteasomal degradation or lysosomal degradation. In addition, an Nlrp12 stable cell line, with a 378

typically lower level of Nlrp12 expression, compared to transiently transfected cells, can be used 379

to test formally whether Nlrp12 protein expression levels are increasingly decreased when Hck is 380

expression is increased. Moreover, the rate of Nlrp12 degradation, in the absence or presence of 381

Hck, can be studied and compared in pulse-chase assays (Lich et al., 2007). 382

383

Given the interaction that was characterized between Nlrp12 and Hck, we sought to identify 384

diseases in which their interaction may be relevant. AML is a type of blood and bone marrow 385

cancer that is characterized by an unusually high level of circulating immature white blood cells 386

Nlrp12 binds to Hck

18

(Prada-Arismendy et al., 2017). Hck is found to be highly expressed in hematopoietic stem cells 387

of AML patients (Roversi et al., 2017). The overexpression of Hck is linked with the 388

development of AML (Poh et al., 2015; Roversi et al., 2017). Therefore, Hck may be potentially 389

used as a blood biomarker to identify those patients with potential to develop of AML disease. 390

In addition, activation of Hck and its signaling pathways often causes the development of AML 391

(Dos Santos et al., 2008; Lopez et al., 2016). Hck has been reported to be involved in the feline 392

McDonough sarcoma (fms)-like tyrosine kinase 3 (FLT3)-HCK- cyclin D-dependent kinase 393

(CDK6) pathway. The mutation in FLT3-internal tandem duplications (FLT3-ITD) causes the 394

activation of Hck, and subsequently results in overexpression of CDK6 in MV4-11 cells, a 395

human AML cell line with the FLT3-ITD mutation. CDK6 siRNA resulted in MV4-11 cells 396

with the FLT3-ITD mutation having a lower proliferation rate compared to MV4-11 control cells 397

(Lopez et al., 2016). Also, it has been reported that in AML patients, Hck, Lyn, and Fgr 398

phosphorylation levels are high (Dos Santos et al., 2008). In summary, the above evidence 399

suggests that either high expression and/or high activation of Hck could occur in AML patients 400

as well. 401

402

Our bioinformatics analysis revealed that Nlrp12 is likely the only member of the Nlrp family 403

that shows significant co-occurrence with Hck at the level of mRNA expression. However, our 404

cellular functional study revealed that Nlrp12 protein expression levels decreased when it is co-405

expressed with Hck. This discrepancy might be due Nlrp12 mRNA expression level not 406

correlating with protein expression level (Greenbaum et al., 2003; Vogel and Marcotte, 2012; 407

Liu et al., 2016). Nevertheless, these data are still consistent with the possibility that Nlrp12 may 408

have an effect on AML through its binding to Hck. Nlrp12 and Hck co-expression and co-409

Nlrp12 binds to Hck

19

occurrence may then also be relevant to the prognosis of AML. However, further analyses need 410

to be performed to evluate the ability of Nlrp12 and Hck to serve as biomarkers in the prognosis 411

of AML. 412

413

Nlrp12 and Hck co-expression and co-occurrence may indicate that Nlrp12 and Hck mRNA or 414

protein expression can impact the same pathway or both be regulated by the same molecule. For 415

example, in the case two molecules exhibiting co-occurrence, they may interact in the same 416

signaling pathway, for example, Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) 417

and glycogen synthase kinase 3 beta (GSK3β) showed co-occurrence in the AML provisional 418

data, and they are in the same signaling pathway (Prochnicki and Latz, 2017). However, further 419

analyses need to be performed to evaluate the ability of Nlrp12 and Hck to serve as biomarkers 420

in the prognosis of AML. 421

422

Although many Hck inhibitors have been developed, they often lack specificity, with Hck 423

inhibitors also inhibiting other members of the Src non-receptor tyrosine kinase family (Hu et al., 424

2004; Pene-Dumitrescu et al., 2008; Saito et al., 2013; Patel et al., 2017; Roversi et al., 2017; 425

Naganna et al., 2019). If the potential for the development of AML can be decreased when 426

Nlrp12 does not bind to Hck, then an inhibitor to the interaction between Nlrp12 and Hck can be 427

designed. On the other hand, if the potential for AML is increased when Nlrp12 and Hck does 428

not bind, then a drug that facilitates Nlrp12 and Hck interaction could be developed. By this 429

approach, the non-specificity problem with Nlrp inhibitors may still exist but perhaps to a 430

smaller extent, as Nlrp proteins are less conserved overall compared to the members of the Src 431

non-receptor tyrosine kinase family. For example, the amino acid identity between Nlrp12’s 432

Nlrp12 binds to Hck

20

PYD + NBD versus another Nlrp PYD + NBD most closely related to Nlrp12, Nlrp3’s PYD + 433

NBD, is 54%. But, the protein identity between the Hck C1 fragment versus the one with the 434

closest relationship, the Lyn C1 fragment, is 78%. 435

436

In conclusion, this paper reports the preliminary findings of Nlrp12 interacting with Hck, and 437

Nlrp12 co-occurs with Hck in AML patients. The binding data presented here will expand the 438

database regarding the interactors of Nlrp12, and additional bioinformatic and functional in vitro 439

and in vivo analyses may shed light on the functional consequence of the interaction of Nlrp12 440

with Hck. 441

442




Collection (ATCC) (Manassas, VA). pCDNA-Nlrp12 plasmid and pCDNA-Nlrp3 plasmid were 446

gifts from Dr. Jenny P. Y. Ting (University of North Carolina-Chapel Hill). pCDNA-Nlrp8 447

plasmid was purchased from Genescript (Piscataway, NJ). All other chemicals were reagent 448

grade. The mouse monoclonal anti-FLAG antibody and the rabbit monoclonal anti-FLAG 449

antibody were purchased from Sigma-Aldrich (St. Louis, MO). The mouse monoclonal anti-Hck 450

antibody, the mouse monoclonal anti-TRAF3IP3 antibody, and the mouse IgGκ binding protein-451

horseradish peroxidase (HRP) for detecting the anti-Hck antibody were purchased from Santa 452

Cruz Biotechnology (Dallas, TX). The rabbit monoclonal anti-V5 antibody and polyclonal 453

rabbit HRP-conjugated anti-mouse IgG secondary antibodies were purchased from Cell 454

Signaling (Beverly, MA). The goat anti-rabbit IgG HRP-linked secondary antibody was 455

Nlrp12 binds to Hck

21

purchased from Cell Signaling. The Clean-Blot™ IP Detection Reagent was purchased from 456

Thermo Fisher Scientific (Grant Island, NY). Goat anti-mouse IgG (H+L) cross-adsorbed 457

secondary antibody, conjugated to Alexa Fluor 488 and goat anti-rabbit IgG (H+L) cross-458

adsorbed secondary antibody, conjugated to Alexa Fluor 555 were purchased from Thermo 459

Fisher Scientific (Grant Island, NY). The 4',6-diamidino-2-phenylindole, dihydrochloride (DAPI) 460

was purchased from Thermo Fisher Scientific. 461

462

Cloning 463

Nlrp12’s PYD + NBD (a.a. 1-531) was amplified by polymerase chain reaction (PCR) (primers 464

see Table 3), from a pCDNA-Nlrp12 plasmid, was digested with enzymes NdeI and SalI, and 465

subcloned into the pGBKT7 vector (Takara). The sequence encoding the PYD + NBD of Nlrp3 466

(a.a. 1-536) was amplified by PCR (see table 3 for primers), digested with enzymes NdeI and 467

BamHI, and subcloned in the pGBKT7 vector. The sequence encoding the PYD + NBD of 468

Nlrp8 (a.a. 1- 527) was amplified by PCR (see Table 3 for primers), digested with enzymes 469

EcoRI and BamHI, and subcloned into the pGBKT7 vector. The entire sequences of the C-470

terminal 42 amino acids of Fgr, Src, Yes, and Fyn, and 40 amino acids of Blk, Lck, Lyn, and 471

Hck (The C terminal 40 (or 42) amino acids is called “C1”), and Hck constructs C2, C3, C4, C5, 472

C6, C7, N1, N2, N3, N4, N5, M1, M2, M3, M4, and Hck C1 mutations for alanine scanning with 473

F503A, E504A, Y505A, I506A, Q507A, S508A, V509A, L510A, and D511A, were all 474

synthesized from IDT DNA (Coralville, IA) and cloned into the pACT2 vector (Takara). Nlrp12 475

was amplified by PCR (see Table 3 for primers), digested with AflII and XbaI, and subcloned 476

into pEFIRES-P-3FLAG (Hobbs et al., 1998) and pEFIRES -P-V5 (Hobbs et al., 1998). 3FLAG 477

and V5 are homemade, i.e., added later into pEFIRES-P. The peptide sequence of the 3FLAG 478

Nlrp12 binds to Hck

22

epitope is DYKDDDDKDYKDDDDKDYKDDDDK. The peptide sequence of the V5 epitope is 479

GKPIPNPLLGLDST. The multiple cloning sites of pEFIRES-P were modified according to our 480

needs. Sequences encoding Hck p61 and p59 isoforms were amplified by PCR (see Table 3 for 481

primers), digested with AflII and XbaI, and subcloned into pEFIRES -3FLAG vector. Final 482

plasmids were sequenced to confirm the constructs. 483

484


Yeast transformed with the plasmid PGBKT7- Nlrp12’s PYD + NBD 486





shaking at 30°C. Then they were transformed with Nlrp12’s PYD + NBD plasmid, following 491

recommendations in the Takara manual (MatchmakerTM Gal4 Two-hybrid System 3 and 492

Libraries User Manual). A 4ml of 1 M of 3-AT was added into 800 mL of the YPDA medium 493

that were used for making the plates due to a leakage problem. 3-AT is a competitive inhibitor 494

for the product of the HIS3 reporter gene. Yeast cells were lysed using a trichloroacetic acid 495

(TCA) method, and western blots were performed to check Nlrp12’s PYD + NBD protein 496

expression (data not shown). 497

498


PGBKT7- Nlrp12 PYD + NBD plasmid 500

Nlrp12 binds to Hck

23












512




hybrid System 3 & Libraries User’s Manual. The direct screens were to test whether Nlrp12 516

PYD + NBD and Hck specifically interact; identification of Hck F503, Q507, L510, and D511 517

being critical for binding with Nlrp12 PYD + NBD; and the characterization of the Hck C-518

terminal 30 amino acid fragment binding to Nlrp12 PYD + NBD. 519

520




Nlrp12 binds to Hck

24




purification (Brakke, 1951) and 5 µl of P3000TM reagent were added into another aliquot of 125 527

µl of Opti-MEM® medium. Then these two tubes were mixed together, and the mixed tube was 528

incubated at room temperature for 15 min. 250 µl of this mixture was added to the cells. The 529

cells were incubated at 37 °C with 5% CO2 for two days until analysis. 530

531

Nlrp12 stable cell lines 532

THP-1 cells, U937 cells, and RAW 264.7 cells were transfected with pEFIRES-P-Nlrp12-533


After two weeks, the cells were considered to be stably expressing Nlrp12 after screening for 535

expression. The stable cells were “pooled” clones, and they are maintained by adding 2.5 μg/ml 536

puromycin. 537

538







545

Nlrp12 binds to Hck

25





Hck mouse monoclonal primary antibody overnight. On the second day, 30 μl of protein A/G 550

agarose, from a 50% slurry and previously washed with lysis buffer three times, were added to 551

the tube, and the tube was incubated for 3 hrs at 4C. The beads were then washed with lysis 552




556

Immunoblotting 557







mouse monoclonal anti-Hck antibody (diluted 1:1000) were added and the membrane incubated 564

overnight. For detection of bands in the cell lysate, rabbit anti-mouse IgG HRP-linked secondary 565

antibody (diluted 1:2000) (for anti-FLAG antibody) and mouse IgGκ binding protein-HRP 566

secondary antibody (for anti-Hck antibody) (diluted 1:1000) were added, and the membrane was 567

incubated for 1 hr at room temperature. For immunoprecipitations, Clean-Blot™ IP detection 568

Nlrp12 binds to Hck

26

reagent (HRP) secondary antibody (1:300) (Thermo Fisher Scientific) was used. The detection 569

signal was visualized by using enhanced chemiluminescence (ECL) reagent (Thomas Scientific, 570

Swedesboro, NJ). Immoblots were analyzed by chemiluminescence on a Bio-Rad ChemiDocTM 571

Touch Gel imaging system (Bio-Rad, Hercules, CA). 572

573


A protocol for immunofluorescence was followed 575

(https://www.cellsignal.com/contents/resources-protocols/immunofluorescence-general-576

protocol/if), with the following modifications. Coverslips were autoclaved and coated with 0.1 577

mg/ml of poly-D-lysine hydrobromide (mol wt 70,000-150,000) (Sigma-Aldrich). Cells were 578

plated onto the coverslips. Fixation was stopped by adding 50 mM NH4Cl in PBS for 15 min at 579

room temperature. Fixed cells were permeabilized by adding 0.5% Triton®-X-100 in PBS for 580

10 min. The cells were then washed with PBS three times and blocked with 0.1% of BSA in 581

PBS at room temperature for 1 hr. The rabbit monoclonal anti-FLAG antibody (diluted 1:100) 582

and mouse monoclonal anti-Hck antibody (diluted 1:100) were added to each cover slip and 583

incubated overnight. Goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody, 584

conjugated to Alexa Fluor 488 (diluted 1:100) and goat anti-rabbit IgG (H+L) cross-adsorbed 585

secondary antibody, conjugated to Alexa Fluor 555 (1: 100) were added. After incubation with 586

secondary antibodies, the cells were washed five times with PBS. During the first step, DAPI 587

(InvitrogenTM by Thermo Fisher Scientific) was also added at 1:1000 in PBS for 2 min. Finally, 588

the coverslips were mounted in ProLong™ Gold Antifade mounting medium (Life Technologies 589

Corporation by Thermo Fisher Scientific, Eugene, OR). The stained slides were viewed on a 590

https://www.cellsignal.com/contents/resources-protocols/immunofluorescence-general-protocol/if

https://www.cellsignal.com/contents/resources-protocols/immunofluorescence-general-protocol/if

Nlrp12 binds to Hck

27

ZEISS LSM 880 (Pleasanton, CA) with Airyscan. The images were viewed and processed using 591

Fiji software (Schindelin et al., 2012). 592

593

IPA diagram 594



597



cBioPortal website (Cerami et al., 2012b; 2013; Gao et al., 2013). Clinical samples from the 600

Oncomine website (https://www.oncomine.org) were downloaded and checked for Nlrp12 601

expression levels and Hck levels. The Fisher exact test and the odds ratio test used for co-602

occurrence were generated by the cBioPortal website. Analysis of variance (ANOVA) was 603

performed to check whether a significant difference of the treatment exists among all the groups. 604

A p-value < 0.05 was considered statistically significant. If P < 0.05, then the Tukey test was 605

used to determine whether a pair-wise difference exists. Quantification of the western blot bands 606

was performed by FIJI software (Schindelin et al., 2012) and made into graphs by Prism 6.0 607

(GraphPad Software, Inc., San Diego, CA).608

609

Acknowledgement 610


Nlrp12 binds to Hck

28





615

Abbreviations 616

3-AT, 3-Amino-1,2,4-triazole 617

AML, acute myeloid leukemia 618

ANOVA, analysis of variance 619

ASC, apoptosis-associated speck-like protein containing a caspase activation and 620

recruitment domain 621

ATCC, American Type Culture Collection 622

C1, self-named truncations of C-terminal 40 (or 41) amino acids fragment of Src family non-623

receptor tyrosine kinases 624

C2-C7 and N1-N5, self-named truncations Hck C1 fragment 625

CD40, cluster of differentiation 40 626

CDK6, cyclin D-dependent kinase 627

CFU, colony-forming units 628

COSMIC, catalogue of somatic mutations in cancer 629

CsCl, cesium chloride 630

DAMP, damage-associated molecular patterns 631

DAPI, 4',6-diamidino-2-phenylindole, dihydrochloride 632

DC, dendritic cells 633

Nlrp12 binds to Hck

29

DO, drop out (2DO: SD/-Trp-Leu; 4DO: SD/-Trp-Leu-His-Ade); 634

ECL, enhanced chemiluminescence 635

FAf1, Fas associated factor 1 636

FLT3-ITD, FLT3-internal tandem duplications 637

FLT3, feline McDonough sarcoma (fms)-like tyrosine kinase 3 638

GSK3b, glycogen synthase kinase 3 bet 639

Hck C1 fragment, Hck C-terminal 40 amino acids 640

Hck, Hematopoiesis cell kinase 641

HRP, horseradish peroxidase 642

HSP90, heat shock protein 90 643

IL, interleukin 644

IPA, ingenuity pathway analysis 645

IRAK1, IL-1 receptor-associated kinase 1 646

KO, knock out 647

KRAS, Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 648

LRR, leucine rich repeat domain 649

M1, the amino acids in the R1 region were mutated to the amino acids identical to the R1 region 650

in Lyn; 651

M2, the amino acids in the R2 region were all mutated to Alanine 652



NBD, nucleotide binding domain 655

NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells 656

Nlrp12 binds to Hck

30

NIK, NF-κB-inducing kinase 657

NLR, nucleotide binding domain and leucine-rich repeat 658

Nlrp, NLR pyrin domain-containing protein 659

PAMP, pathogen-associated molecular patterns 660

PCR, polymerase chain reaction 661

PDB, protein data bank 662

PMA, phorbol 12-myristate 13-acetate 663

PRR, pattern recognition receptors 664

PVDF, polyvinylidene difluoride 665

PYD, pyrin domain 666

R1, R2, R3, and R4, self-named four regions in the Hck C terminal 40 amino acids fragment 667

SD, synthetic dropout 668

SD/-Trp-Leu, SD base plus amino acids supplements minus tryptophan and leucine 669

SD/-Trp-Leu-His-Ade, SD base plus amino acids supplements minus tryptophan, leucine, and 670

histidine, and adenine 671

STRING: search tool for recurring instances of neighboring genes 672

TBST: tris-buffered saline with Tween 20, pH=8.0 673

TCA, trichloroacetic acid 674

TCGA, the cancer genome atlas 675

TLR, toll-like receptor 676

TRAF3, tumor necrosis factor receptor associated factor 3 677

TRAF3IP3, TRAF3 interacting protein 3 678

UBA, ubiquitin-associated domains 679

Nlrp12 binds to Hck

31

WT, wild type 680

YPDA, yeast extract, peptone, dextrose, and adenine hemisulfate. 681

682

Conflict of Interest 683

The authors declare no conflict of interest regarding publication of this article. 684

685




689

References 690

Allen, I. C., Wilson, J. E., Schneider, M., Lich, J. D., Roberts, R. A., Arthur, J. C., et al. (2012). 691

NLRP12 suppresses colon inflammation and tumorigenesis through the negative 692

regulation of noncanonical NF-kappaB signaling. Immunity. 36(5), 742-754. 693

doi:10.1016/j.immuni.2012.03.012 694

Arthur, J. C., Lich, J. D., Aziz, R. K., Kotb, M., and Ting, J. P. (2007). Heat shock protein 90 695

associates with monarch-1 and regulates its ability to promote degradation of NF-696

kappaB-inducing kinase. J. Immunol. 179(9), 6291-6296. 697

Arthur, J. C., Lich, J. D., Ye, Z., Allen, I. C., Gris, D., Wilson, J. E., at al. (2010). Cutting edge: 698

NLRP12 controls dendritic and myeloid cell migration to affect contact hypersensitivity. 699

J. Immunol. 185(8), 4515-4519. doi:10.4049/jimmunol.1002227 700

Brakke, M. K. (1951). Density Gradient Centrifugation: A New Separation Technique1. Journal 701

of the American Chemical Society. 73(4), 1847-1848. doi:10.1021/ja01148a508 702

Carreno, S., Gouze, M. E., Schaak, S., Emorine, L. J., and Maridonneau-Parini, I. (2000). Lack 703

of palmitoylation redirects p59Hck from the plasma membrane to p61Hck-positive 704

lysosomes. J. Biol. Chem. 275(46), 36223-36229. doi:10.1074/jbc.M003901200 705

Cerami, E., Gao, J., Dogrusoz, U., Gross, B. E., Sumer, S. O., Aksoy, B. A., et al. (2012). The 706

cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer 707

Genomics Data. Cancer Discovery. 2(5), 401. doi:10.1158/2159-8290.CD-12-0095 708

Cerami, E., Gao, J., Dogrusoz, U., Gross, B. E., Sumer, S. O., Aksoy, B. A., et al. (2012). The 709

cBio cancer genomics portal: an open platform for exploring multidimensional cancer 710

genomics data. Cancer Discov. 2(5), 401-404. doi:10.1158/2159-8290.cd-12-0095 711

Chen, L., Wilson, J. E., Koenigsknecht, M. J., Chou, W. C., Montgomery, S. A., Truax, A. D., et 712

al (2017). NLRP12 attenuates colon inflammation by maintaining colonic microbial 713

Nlrp12 binds to Hck

32

diversity and promoting protective commensal bacterial growth. Nat. Immunol. 18(5), 714

541-551. doi:10.1038/ni.3690 715

Chen, S. T., Chen, L., Lin, D. S., Chen, S. Y., Tsao, Y. P., Guo, H., et al (2019). NLRP12 716

Regulates Anti-viral RIG-I Activation via Interaction with TRIM25. Cell Host Microbe. 717

25(4), 602-616.e607. doi:10.1016/j.chom.2019.02.013 718

Damiano, J. S., Oliveira, V., Welsh, K., and Reed, J. C. (2004). Heterotypic interactions among 719

NACHT domains: implications for regulation of innate immune responses. The 720

Biochemical journal. 381(Pt 1), 213-219. doi:10.1042/BJ20031506 721

Dos Santos, C., Demur, C., Bardet, V., Prade-Houdellier, N., Payrastre, B., and Récher, C. 722

(2008). A critical role for Lyn in acute myeloid leukemia. Blood. 111(4), 2269. 723

doi:10.1182/blood-2007-04-082099 724

Faustin, B., Lartigue, L., Bruey, J. M., Luciano, F., Sergienko, E., Bailly-Maitre, B., et al. (2007). 725

Reconstituted NALP1 inflammasome reveals two-step mechanism of caspase-1 726

activation. Mol. Cell. 25(5), 713-724. doi:10.1016/j.molcel.2007.01.032 727

Fu, G., Xu, Q., Qiu, Y., Jin, X., Xu, T., Dong, S., et al. (2017). Suppression of Th17 cell 728

differentiation by misshapen/NIK-related kinase MINK1. J. Exp. Med. 214(5), 1453-729

1469. doi:10.1084/jem.20161120 730

Gao, J., Aksoy, B. A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S. O., et al. (2013). 731

Integrative analysis of complex cancer genomics and clinical profiles using the 732

cBioPortal. Sci. Signal. 6(269), pl1. doi:10.1126/scisignal.2004088 733

Genomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia. (2013). New 734

England Journal of Medicine. 368(22), 2059-2074. doi:10.1056/NEJMoa1301689 735

Greenbaum, D., Colangelo, C., Williams, K., and Gerstein, M. (2003). Comparing protein 736

abundance and mRNA expression levels on a genomic scale. Genome Biol. 4, 117. 737

Guiet, R., Poincloux, R., Castandet, J., Marois, L., Labrousse, A., Le Cabec, V., and 738

Maridonneau-Parini, I. (2008). Hematopoietic cell kinase (Hck) isoforms and phagocyte 739

duties - from signaling and actin reorganization to migration and phagocytosis. Eur. J. 740

Cell Biol. 87(8-9), 527-542. doi:10.1016/j.ejcb.2008.03.008 741

Hafner-Bratkovič, I., Sušjan, P., Lainšček, D., Tapia-Abellán, A., Cerović, K., Kadunc, L., el al. 742

(2018). NLRP3 lacking the leucine-rich repeat domain can be fully activated via the 743

canonical inflammasome pathway. Nature Communications. 9(1), 5182. 744

doi:10.1038/s41467-018-07573-4 745

Hobbs, S., Jitrapakdee, S., and Wallace, J. C. (1998). Development of a Bicistronic Vector 746

Driven by the Human Polypeptide Chain Elongation Factor 1α Promoter for Creation of 747

Stable Mammalian Cell Lines That Express Very High Levels of Recombinant Proteins. 748

Biochemical and Biophysical Research Communications. 252(2), 368-372. 749

doi:https://doi.org/10.1006/bbrc.1998.9646 750

Hornick, E. E., Banoth, B., Miller, A. M., Zacharias, Z. R., Jain, N., Wilson, M. E., et al. (2018). 751

Nlrp12 Mediates Adverse Neutrophil Recruitment during Influenza Virus Infection. J. 752

Immunol. 200(3), 1188-1197. doi:10.4049/jimmunol.1700999 753

Hu, Y., Liu, Y., Pelletier, S., Buchdunger, E., Warmuth, M., Fabbro, D., et al. (2004). 754

Requirement of Src kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic 755

leukemia but not chronic myeloid leukemia. Nat. Genet. 36(5), 453-461. 756

doi:10.1038/ng1343 757

https://doi.org/10.1006/bbrc.1998.9646

Nlrp12 binds to Hck

33

Janowski, A. M., Kolb, R., Zhang, W., and Sutterwala, F. S. (2013). Beneficial and Detrimental 758

Roles of NLRs in Carcinogenesis. Frontiers in immunology. 4, 370-370. 759

doi:10.3389/fimmu.2013.00370 760

Jeru, I., Duquesnoy, P., Fernandes-Alnemri, T., Cochet, E., Yu, J. W., Lackmy-Port-Lis, M., et al. 761

(2008). Mutations in NALP12 cause hereditary periodic fever syndromes. Proc. Natl. 762

Acad. Sci. U. S. A. 105(5), 1614-1619. doi:10.1073/pnas.0708616105 763

Jeru, I., Le Borgne, G., Cochet, E., Hayrapetyan, H., Duquesnoy, P., Grateau, G., et al. (2011). 764

Identification and functional consequences of a recurrent NLRP12 missense mutation in 765

periodic fever syndromes. Arthritis Rheum. 63(5), 1459-1464. doi:10.1002/art.30241 766

Kanneganti, T. D., Lamkanfi, M., and Nunez, G. (2007). Intracellular NOD-like receptors in host 767

defense and disease. Immunity. 27(4), 549-559. doi:10.1016/j.immuni.2007.10.002 768

Kinnaird, J. H., Singh, M., Gillan, V., Weir, W., Calder, E. D., Hostettler, I., et al. (2017). 769

Characterization of HSP90 isoforms in transformed bovine leukocytes infected with 770

Theileria annulata. Cell Microbiol. 19(3). doi:10.1111/cmi.12669 771

Kinoshita, T., Kondoh, C., Hasegawa, M., Imamura, R., and Suda, T. (2006). Fas-associated 772

factor 1 is a negative regulator of PYRIN-containing Apaf-1-like protein 1. Int. Immunol. 773

18(12), 1701-1706. doi:10.1093/intimm/dxl104 774

Lich, J. D., Williams, K. L., Moore, C. B., Arthur, J. C., Davis, B. K., Taxman, D. J., and Ting, J. 775

P. (2007). Monarch-1 suppresses non-canonical NF-kappaB activation and p52-776

dependent chemokine expression in monocytes. J. Immunol. 178(3), 1256-1260. 777

Linz, B. M., Neely, C. J., Kartchner, L. B., Mendoza, A. E., Khoury, A. L., Truax, A., et al. 778

(2017). Innate Immune Cell Recovery Is Positively Regulated by NLRP12 during 779

Emergency Hematopoiesis. J. Immunol. 198(6), 2426-2433. 780

doi:10.4049/jimmunol.1601048 781

Liu, Y., Beyer, A., and Aebersold, R. (2016). On the Dependency of Cellular Protein Levels on 782

mRNA Abundance. Cell. 165, 535-50. 783

Lopez, S., Voisset, E., Tisserand, J. C., Mosca, C., Prebet, T., Santamaria, D., et al. (2016). An 784

essential pathway links FLT3-ITD, HCK and CDK6 in acute myeloid leukemia. 785

Oncotarget. 7(32), 51163-51173. doi:10.18632/oncotarget.9965 786

Martin, B. N., Wang, C., Zhang, C. J., Kang, Z., Gulen, M. F., Zepp, J. A., et al. (2016). T cell-787

intrinsic ASC critically promotes T(H)17-mediated experimental autoimmune 788

encephalomyelitis. Nat. Immunol. 17(5), 583-592. doi:10.1038/ni.3389 789

Martinon, F., Agostini, L., Meylan, E., and Tschopp, J. (2004). Identification of bacterial 790

muramyl dipeptide as activator of the NALP3/cryopyrin inflammasome. Curr. Biol. 791

14(21), 1929-1934. doi:10.1016/j.cub.2004.10.027 792

Naganna, N., Opoku-Temeng, C., Choi, E. Y., Larocque, E., Chang, E. T., Carter-Cooper, B. A., 793

et al. (2019). Amino alkynylisoquinoline and alkynylnaphthyridine compounds potently 794

inhibit acute myeloid leukemia proliferation in mice. EBioMedicine. 40, 231-239. 795

doi:10.1016/j.ebiom.2019.01.012 796

Normand, S., Waldschmitt, N., Neerincx, A., Martinez-Torres, R. J., Chauvin, C., Couturier-797

Maillard, A., et al. (2018). Proteasomal degradation of NOD2 by NLRP12 in monocytes 798

promotes bacterial tolerance and colonization by enteropathogens. Nature 799

Communications. 9(1), 5338. doi:10.1038/s41467-018-07750-5 800

Patel, R. K., Weir, M., Hellwig, S., Dorman, H., and Smithgall, T. E. (2017). Abstract 2363: 801

Targeting Src-family kinases to combat acquired inhibitor resistance in FLT3-802

Nlrp12 binds to Hck

34

ITD+ AML. Cancer Research. 77(13 Supplement), 2363-2363. 803

doi:10.1158/1538-7445.am2017-2363 804

Pene-Dumitrescu, T., Peterson, L. F., Donato, N. J., and Smithgall, T. E. (2008). An inhibitor-805

resistant mutant of Hck protects CML cells against the antiproliferative and apoptotic 806

effects of the broad-spectrum Src family kinase inhibitor A-419259. Oncogene. 27(56), 807

7055-7069. doi:10.1038/onc.2008.330 808

Pinheiro, A. S., Eibl, C., Ekman-Vural, Z., Schwarzenbacher, R., and Peti, W. (2011). The 809

NLRP12 pyrin domain: structure, dynamics, and functional insights. Journal of molecular 810

biology. 413(4), 790-803. doi:10.1016/j.jmb.2011.09.024 811

Poh, A. R., O'Donoghue, R. J., and Ernst, M. (2015). Hematopoietic cell kinase (HCK) as a 812

therapeutic target in immune and cancer cells. Oncotarget. 6(18), 15752-15771. 813

doi:10.18632/oncotarget.4199 814

Prada-Arismendy, J., Arroyave, J. C., and Rothlisberger, S. (2017). Molecular biomarkers in 815

acute myeloid leukemia. Blood Rev. 31(1), 63-76. doi:10.1016/j.blre.2016.08.005 816

Prochnicki, T., and Latz, E. (2017). Inflammasomes on the Crossroads of Innate Immune 817

Recognition and Metabolic Control. Cell Metab. 26(1), 71-93. 818

doi:10.1016/j.cmet.2017.06.018 819

Robbins, S. M., Quintrell, N. A., and Bishop, J. M. (1995). Myristoylation and differential 820

palmitoylation of the HCK protein-tyrosine kinases govern their attachment to 821

membranes and association with caveolae. Mol. Cell Biol. 15(7), 3507-3515. 822

doi:10.1128/mcb.15.7.3507 823

Roversi, F. M., Pericole, F. V., Duarte, A. d. S. S., Ferro, K. P., Corrocher, F. A., Palodetto, B., 824

et al. (2015). Knockdown of HCK Reduces Cell Death and Erythroid Differentiation in 825

Human CD34+ Hematopoietic Progenitor Cells. Blood. 126(23), 2860. 826

Roversi, F. M., Pericole, F. V., Machado-Neto, J. A., da Silva Santos Duarte, A., Longhini, A. L., 827

Corrocher, F. A., et al. (2017). Hematopoietic cell kinase (HCK) is a potential therapeutic 828

target for dysplastic and leukemic cells due to integration of erythropoietin/PI3K pathway 829

and regulation of erythropoiesis: HCK in erythropoietin/PI3K pathway. Biochim. 830

Biophys. Acta Mol. Basis Dis. 1863(2), 450-461. doi:10.1016/j.bbadis.2016.11.013 831

Ryu, S. W., Lee, S. J., Park, M. Y., Jun, J. I., Jung, Y. K., and Kim, E. (2003). Fas-associated 832

factor 1, FAF1, is a member of Fas death-inducing signaling complex. J. Biol. Chem. 833

278(26), 24003-24010. doi:10.1074/jbc.M302200200 834

Saito, Y., Yuki, H., Kuratani, M., Hashizume, Y., Takagi, S., Honma, T., et al. (2013). A 835

pyrrolo-pyrimidine derivative targets human primary AML stem cells in vivo. Sci. Transl. 836

Med. 5(181), 181ra152. doi:10.1126/scitranslmed.3004387 837

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., et al. (2012). 838

Fiji: an open-source platform for biological-image analysis. Nat. Methods. 9(7), 676-682. 839

doi:10.1038/nmeth.2019 840

Sharif, H., Wang, L., Wang, W. L., Magupalli, V. G., Andreeva, L., Qiao, Q., et al. (2019). 841

Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature. 842

570(7761), 338-343. doi:10.1038/s41586-019-1295-z 843

Shi, C., Miley, J., Nottingham, A., Morooka, T., Prosdocimo, D. A., and Simon, D. I. (2019). 844

Leukocyte integrin signaling regulates FOXP1 gene expression via FOXP1-IT1 long non-845

coding RNA-mediated IRAK1 pathway. Biochim. Biophys. Acta Gene Regul. Mech. 846

1862(4), 493-508. doi:10.1016/j.bbagrm.2019.02.008 847

Nlrp12 binds to Hck

35

Sicheri, F., Moarefi, I., and Kuriyan, J. (1997). Crystal structure of the Src family tyrosine kinase 848

Hck. Nature. 385(6617), 602-609. doi:10.1038/385602a0 849

Takeuchi, O., and Akira, S. (2010). Pattern recognition receptors and inflammation. Cell. 140(6), 850

805-820. doi:10.1016/j.cell.2010.01.022 851

Tian, Q. Y., Zhao, Y. P., and Liu, C. J. (2012). Modified yeast-two-hybrid system to identify 852

proteins interacting with the growth factor progranulin. J. Vis. Exp. (59). 853

doi:10.3791/3562 854

Truax, A. D., Chen, L., Tam, J. W., Cheng, N., Guo, H., Koblansky, A. A., et al. (2018). The 855

Inhibitory Innate Immune Sensor NLRP12 Maintains a Threshold against Obesity by 856

Regulating Gut Microbiota Homeostasis. Cell Host Microbe. 24(3), 364-378.e366. 857

doi:10.1016/j.chom.2018.08.009 858

Tuncer, S., Fiorillo, M. T., and Sorrentino, R. (2014). The multifaceted nature of NLRP12. J. 859

Leukoc. Biol. 96(6), 991-1000. doi:10.1189/jlb.3RU0514-265RR 860

Vladimer, G. I., Weng, D., Paquette, S. W. M., Vanaja, S. K., Rathinam, V. A., Aune, M. H., et 861

al. (2012). The NLRP12 inflammasome recognizes Yersinia pestis. Immunity. 37(1), 96-862

107. 863

Vogel, C., and Marcotte, E.M. (2012). Insights into the regulation of protein abundance from 864

proteomic and transcriptomic analyses. Nat. Rev. Genet. 13, 227-32. 865

866

Wang, Q., Liu, F., Zhang, M., Zhou, P., Xu, C., Li, Y., et al. (2018). NLRP12 Promotes Mouse 867

Neutrophil Differentiation through Regulation of Non-canonical NF-kappaB and 868

MAPK(ERK1/2) Signaling. Int. J. Biol. Sci. 14(2), 147-155. doi:10.7150/ijbs.23231 869

Williams, K. L., Lich, J. D., Duncan, J. A., Reed, W., Rallabhandi, P., Moore, C., et al. (2005). 870

The CATERPILLER protein monarch-1 is an antagonist of toll-like receptor-, tumor 871

necrosis factor alpha-, and Mycobacterium tuberculosis-induced pro-inflammatory 872

signals. J. Biol. Chem. 280(48), 39914-39924. doi:10.1074/jbc.M502820200 873

Ye, Z., Lich, J. D., Moore, C. B., Duncan, J. A., Williams, K. L., and Ting, J. P. (2008). ATP 874

binding by monarch-1/NLRP12 is critical for its inhibitory function. Mol. Cell Biol. 875

28(5), 1841-1850. doi:10.1128/mcb.01468-07 876

Zaki, M. H., Vogel, P., Malireddi, R. K., Body-Malapel, M., Anand, P. K., Bertin, J., et al. 877

(2011). The NOD-like receptor NLRP12 attenuates colon inflammation and 878

tumorigenesis. Cancer Cell. 20(5), 649-660. doi:10.1016/j.ccr.2011.10.022 879

880


Name Frequency



Hematopoietic cell kinase (HCK) proto-oncogene, Src family tyrosine kinase (HCK) 9

Chaperone DnaJ (a.k.a., heat shock protein 40 kD(Hsp40)) homolog, subfamily B, 9

Nlrp12 binds to Hck

36

member 1 (DNAJB1)




Talin 1 (TLN1) 5




Tumor necrosis factor (TNF) receptor associated factor 3 (TRAF3) interacting protein 3

(TRAF3IP3) 3


882

Table 2: Co-occurrence of mRNA expression level of Hck and all of the Nlrp family 883

proteins (from the provisional data, assessed on July 11 2019) 884

Hck + Nlrp

family proteins



P-value

Nlrp1 C 0.048

Nlrp2 M 0.546

Nlrp3 C 0.415

Nlrp4 M 0.936

Nlrp5 M 0.877

Nlrp6 M 0.670

Nlrp12 binds to Hck

37

Nlrp7 M 0.475

Nlrp8 M 0.877

Nlrp9 M 0.491

Nlrp10 M 0.626

Nlrp11 M 0.233

Nlrp12 C <0.001

Nlrp13 C 1.000

Nlrp14 M 0.509

885

886

887


Name Primers

Nlrp12 5’ primer (cloned

into PGBKT7)



into PGBKT7)



into pGBKT7)



into PGBKT7)


Nlrp8 5’ primer (cloned GATCTAGAATTCATGAGTGACGTGAATCCACCCTCTG

Nlrp12 binds to Hck

38

into pGBKT7)


into PGBKT7)


Nlrp12 5’ (cloned into

pEFIRES-P-3FLAG and

pIRES-V5)


Nlrp12 3’ (cloned into

PIRES-3FLAG and

pEFIRES-P-V5)


Hck p61 5’ (cloned into

pEFIRES-P-3FLAG)


Hck p59 5’ (cloned into

pEFIRES-P-3FLAG)


Hck p61/p59 3’ (cloned



889

Figure legends: 890

Figure 1: (A) Schematic drawing of the domain structure of full-length Nlrp12 (top) and the 891

domains used as the construct for the yeast two-hybrid screen (bottom). PYD: Pyrin domain; NBD: 892

Nucleotide binding domain; and LRR: Leucine rich repeat domain. (B) The domain structures of the 893

two alternatively spliced isoforms of Hck, Hck p59 and Hck p61. (C) Identification of the clones 894

of Hck interacting with Nlrp12 (“hits”) obtained from the yeast two-hybrid screen. Among the 895

nine of the clones positive for Hck, one clone encoded for the smallest interacting fragment of 896

Nlrp12 binds to Hck

39

Hck, the C-terminal 40 amino acids of Hck. The numbers in parentheses indicate the total 897

number of hits obtained in the screen. 898

899

Figure 2: Specificity of binding of Nlrp12 with Hck. (A) Schematic drawing of Hck (p61 900

isoform, top) and, for comparison, the region of Hck (“Hck C1 fragment,” lower) used for testing 901

the specificity of binding of Hck to other members of the Nlrp family of proteins. The numbers 902

represent the amino acid residues of the protein or protein fragment (B) Phylogenetic tree 903

showing the relationships among the PYD + NBD region of all of the members of the human 904

Nlrp family of proteins. The phylogenetic tree was produced through Clustal Omega 905

(https://www.ebi.ac.uk/Tools/msa/clustalo/). For each Nlrp family member, the PYD + NBD of 906

the longest isoform was selected for generating the phylogenetic tree. Nlrp3 is phylogenetically 907

the closest Nlrp to Nlrp12, while Nlrp8 is phylogenetically among the most distant from Nlrp12. 908

Nlrp3 and Nlrp8 were highlighted in red color. (C) When Nlrp12’s PYD + NBD and Hck C1 909

fragment were co-transformed into yeast, they grew on the highest stringency plates (4DO + 910

3AT), consistent with an interaction between the two constructs. On the other hand, neither 911

Nlrp3’s PYD + NBD co-transformed with the C1 fragment nor Nlrp8’s PYD + NBD co-912

transformed the C1 fragment grew on the highest stringency plates. These results are consistent 913

with a specific interaction between Nlrp12 and the Hck C1 fragment, but not with the other Nlrps. 914

(D) Yeast clones grew on the high stringency plates 4DO + 3AT when Hck’s C1 fragment and 915

Nlrp12’s PYD + NBD were co-transformed, but they did not grow on the high stringency 4DO + 916

3AT plates when the C1 fragments of other members of the Src family of non-receptor tyrosine 917

kinases were co-transformed with Nlrp12’s PYD + NBD. These results are again consistent with 918

a specific interaction between Nlrp12 and Hck. 919


Nlrp12 binds to Hck

40

920

Figure 3: (A) Structure of the Hck C1 fragment generated by Chimera from the University of 921

California, San Francisco (version 1.13.1), extracted from its structure within the entire Hck 922

protein. Hck C1 fragment was thus divided into four helical domains: R1, R2, R3, and R4. The 923

side chains of amino acids F503, Q507, L510, and D511 are shown. However, it is not clear 924

whether the C1 fragment retains the structural features shown here when it expressed on its own. 925

(B) Primary amino acid sequence alignments showing of the C1 fragments of all members of the 926

Src non-receptor tyrosine kinase family (40 amino acids for Hck, Blk, Lck, and Lyn; 42 amino 927

acids for Fgr, Src, Yes, and Fyn). The black lines indicate the R1, R2, R3, or R4 regions. The 928

arrows denote the four critical amino acids for binding of Hck C1 fragment to Nlrp12’s PYD + 929

NBD. (C) Phylogenetic tree showing the relationship among all of the C1 fragments of the 930

members of the Src family of non-receptor tyrosine kinases. The phylogenetic tree was 931

produced through Clustal Omega (https://www.ebi.ac.uk/Tools/msa/ clustalo/). Hck was 932

highlighted in red color. (D) Four sets of distinct mutations were made within the Hck C1 933

fragment. M1: the amino acids in the R1 region were mutated to the amino acids identical to the 934

R1 region in Lyn (highlighted in red color); M2: the amino acids in the R2 region were all 935

mutated to alanine (Ala); M3: the amino acids in the R3 region were all mutated to Ala; and M4: 936

the amino acids in the R4 region were all mutated to Ala. (E) Yeast did not grow on high 937

stringency 4DO + 3AT plates when Hck C1 fragment with the M3 mutations was co-transformed 938

with Nlrp12’s PYD + NBD. But yeast can grow on the high stringency 4DO + 3AT plates when 939

Hck C1 fragment contained either M1, M2, or M4 mutations, suggesting that the R3 region 940

within the C1 fragment was necessary for binding to Nlrp12 NBD + PYD. (E) Yeast did not 941

grow on high stringency 4DO plates when Nlrp12’s PYD + NBD was co-transformed with Hck 942

Nlrp12 binds to Hck

41

C1 fragment with single Ala substitutions at either F503, Q507, L510, or D511. But yeast grew 943

on high stringency 4DO plates when Nlrp12’s PYD + NBD was co-transformed with Hck’s C1 944

fragment in which the following amino acids in the R3 region were individually mutated to Ala: 945

Y505, S508, or V509. Yeast did not grow on either 2DO nor 4DO plates when Nlrp12’s PYD + 946

NBD was co-transformed with Hck C1 fragment in which either E504 or I506 was individually 947

mutated to Ala, making the results with these particular mutants inconclusive. 948

949

Figure 4: (A) Schematic drawing of Hck truncations comprising the C1 to C7 fragments. (B) 950

Yeast grew on the high stringency 4DO plates and 4DO +3AT plates when Hck’s C-terminal 40 951

amino acid fragment (C1), Hck’s C-terminal 35 amino acid fragment (C2), and Hck’s C-terminal 952

30 amino acid fragment (C3), individually, were co-transformed with Nlrp12’s PYD + NBD. 953

But yeast did not grow on the high stringency 4DO plates nor 4DO+ 3AT plates when C4 to C7 954

fragments were co-transformed to with Nlrp12’s PYD + NBD. The lack of yeast growth upon 955

co-transformation of the C7 fragment and Nlrp12 are not shown. (C) Schematic drawing of Hck 956

truncations comprising the N1 to N5 fragments. (D) Yeast grew on the high stringency 4DO 957

plates and 4DO +3AT plates when Hck’s C-terminal 40 amino acid fragment (C1) was co-958

transformed with Nlrp12’s PYD + NBD (control). But yeast did not grow on the high stringency 959

4DO plates nor 4DO+ 3AT plates when N1 and N5 fragments were co-transformed to with 960

Nlrp12’s PYD + NBD, suggesting that the very C-terminal 5 amino acids are also necessary for 961

binding of Nlrp12. The colored boxes represent different fragments that were deleted each time. 962

963

Figure 5: Nlrp12 co-immunoprecipitates with Hck and co-localizes with Hck by 964

immunofluorescence. (A) Nlrp12 co-immunoprecipitated with Hck when both proteins were 965

Nlrp12 binds to Hck

42

transiently exogenously co-expressed in 293T cells, with Nlrp12 having to be expressed as 966

epitope-tagged forms. Cells were lysed using a non-denaturing cell lysis buffer (see Material 967

and Methods). Co-immunoprecipitations were done using a mouse monoclonal anti-Hck 968

antibody followed by protein A/G agarose. The immunoprecipitated proteins were analyzed by 969

immunoblotting. The same method was used for experiments shown in (B), (C), and (D). (B) 970

Nlrp12 co-immunoprecipitated with endogenous Hck in macrophage-like RAW 264.7 cells, 971

when Nlrp12 is exogenously and stably expressed. Arrows show the two isoforms of Hck p59 972

and p61 that were immunoprecipitated by the anti-Hck antibody, although it is not clear whether 973

Nlrp12 co-immunopreciptitated with one form or the other, or both. (C) Exogenously and stably 974

expressed Nlrp12 co-immunoprecipitated with endogenously expressed Hck in monocyte-like 975

THP-1 cells. In these cells, phorbol 12-myristate 13-acetate (PMA) (1µM) was added to 976

enhance the expression of Nlrp12 under the PMA-sensitive cytomegalovirus promoter of the 977

Nlrp12 plasmid. (D) Left panel shows that Nlrp12 was exogenously and stably expressed in 978

lymphoblast-like U937 cells. Right panel shows that Nlrp12 co-immunoprecipitated with 979

endogenously expressed Hck in U937 cells after PMA was added to 1µM, as was done for THP-980

1 cells, to enhance expression of Nlrp12. (E) Immunofluorescent images showing the 981

colocalization of a cohort of Nlrp12 with either Hck p59 or p61. Hck was immunolabeled with a 982

mouse monoclonal anti-Hck antibody, followed by a secondary goat anti-mouse IgG (H+L) 983

cross-adsorbed, conjugated to Alexa Fluor 488. For Nlrp12, the primary antibody was a rabbit 984

monoclonal anti-FLAG antibody, and the secondary antibody was a goat anti-rabbit IgG (H+L) 985

cross-adsorbed secondary antibody, conjugated to Alexa Fluor 555. Nuclei were counterstained 986

by DAPI. 987

988

Nlrp12 binds to Hck

43

Figure 6: The co-expression of Hck protein significantly decreased the steady-state protein 989

expression levels of Nlrp12 (A) Epitope-tagged Nlrp12-V5 and Hck p61 were co-transfected into 990

293T cells. Cell lysates were immunoblotted with rabbit monoclonal anti-V5 antibody for 991

Nlrp12 and mouse monoclonal anti-Hck antibody. Comparing lane 2 (basal level of Nlrp12 992

expression) with lanes 5, 6, and 7, co-expression of Hck protein leads to a significant decrease of 993

protein expression levels of Nlrp12 over three time are they co-expressed. Increasing protein 994

expression of Hck, relative to the plasmid DNA added (ramp: lanes 5, 6, and 7; 2.5-20 μg of 995

DNA) was not observed possibly because the amount of plasmid for Hck transfection were 996

already too high, resulting in the maximum expression of Hck’s at all plasmid DNA amounts. 997

The figure is a representative of one of three results. (B) Quantification of the Nlrp12 protein 998

bands (mean + standard error) to show that Nlrp12 protein expression levels decreased in the 999

presence of co-expressed Hck, relative to equal amounts of cell lysate being assayed. The 1000

Nlrp12 protein expression levels are indicated as arbitrary units. (C) Quantification of the Hck 1001

protein bands (mean + standard error) confirming that Hck protein expression levels did not 1002

change although the amount of plasmid DNA for Hck increased. Figure (B) and (C) were 1003

generated by Prism 6.0 (GraphPad Software, Inc., San Diego, CA). Twenty μg of cell lysate 1004

proteins were loaded for each lane. ANOVA and Tukey tests were used to compare the Nlrp12 1005

and Hck protein bands. 1006

1007

Figure 7: Nlrp12 is co-expressed with Hck in acute myeloid leukemia (AML) patient samples. 1008

Both Nlrp12 expression and Hck expression data are shown as log2 values. The data are RNA 1009

seq data obtained from cBioportal (provisional) database assessed on July 11, 2019. The graph 1010

was taken from the cBioportal website. Spearman coefficient, indicating the association of 1011

Nlrp12 binds to Hck

44

Nlrp12 and Hck mRNA expression level (if Nlrp12 and Hck mRNA expression levels are non-1012

parametric) = 0.80. Pearson coefficient, indicating the degree of the linear relationship between 1013

the Nlrp12 mRNA expression level and Hck mRNA expression level (if Nlrp12 and Hck mRNA 1014

expression levels are parametric) = 0.73. The p-values for Spearman coefficient and Pearson 1015

coefficient are both < 0.001. 1016

1017


results of the yeast two-hybrid screen for proteins that interacted with Nlrp12. The figure only 1019

shows the Nlrp12-interacting proteins with hits that have a frequency larger than 2. The solid 1020

lines indicate interacting proteins found through our yeast two-hybrid screen. The dashed lines 1021

are the Nlrp12-interacting proteins previously reported in published data. The purple-colored 1022

molecules are those associated with AML. (B) To validate an interaction shown in the IPA 1023

diagram, tumor necrosis factor receptor-associated factor 3 interacting protein 3 (TRAF3IP3)-1024

3FLAG and Nlrp12-V5 were co-immunoprecipitated from co-transfected 293T cells. A non-1025

denaturing cell lysate buffer (see Material and Methods) was used to lyse the cell, and co-1026

immunoprecipitations were performed with a mouse monoclonal anti-TRAF3IP3 antibody 1027

followed by protein A/G agarose. The immunoprecipitates were analyzed for Nlrp12 by 1028

immunoblotting with rabbit monoclonal anti-V5 antibody. The results from the co-1029

immunoprecipitation are consistent with a confirmation of an interaction between TRAF3IP3 1030

and Nlrp12. 1031

1032

1033

1034

Nlrp12 binds to Hck

45

1035

Figure 1 1036

1037

1038

1039

1040

1041

1042

1043

1044

1045

Nlrp12 binds to Hck

46

1046 Figure 2 1047

1048

1049

1050

1051

Nlrp12 binds to Hck

47

1052

Figure 3 1053

1054

Nlrp12 binds to Hck

48

1055

Figure 4 1056

1057

Nlrp12 binds to Hck

49

1058

Figure 5 1059

1060

Nlrp12 binds to Hck

50

1061

Figure 6 1062

Nlrp12 binds to Hck

51

1063

Figure 7 1064

1065

1066

1067

1068

1069

1070

1071

1072

Nlrp12 binds to Hck

52

1073

Figure 8 1074

1075

Documents

Nucleotide binding domain and leucine-rich repeat pyrin domain- … · NLRPlrp12 binds to HCKck 2 20 yeast two-hybrid screen with a human leukocyte cDNA library as prey. Hematopoiesis