The a subunit of rapidly-activating delayed-rectifier K�

current (IKr), encoded by the human ether-a-go-go-relatedgene (hERG), plays a crucial role in action potential repolar-ization in the heart.1) Dysfunction of hERG due either to ge-netic mutation or pharmacological inhibition prolongs car-diac ventricular action potential duration. This manifests asprolongation of the QT interval, leading to long QT (LQT)syndrome characterized by ventricular arrhythmias and sud-den death.2,3) No other cardiac ion channel has been found tobe as strongly related to prolongation of QT interval and life-threatening arrhythmia as hERG.4) Various types of organiccompounds bind to the pore domain of hERG channels andinhibit ion current. Not only cardiac agents such as class Iand class III antiarrhythmics but also non-cardiac drugs suchas antibiotics and antihistamines are known to block hERGcurrents either by direct inhibition of channel activity or byimpairment of protein trafficking. It is important for the pre-vention and treatment of acquired LQT syndrome to identifysubstances that influence hERG expression and function.

We recently reported that heat shock family proteins affectthe stability of hERG. Heat shock protein 70 (Hsp70) stabi-lized hERG, whereas heat shock cognate protein 70 (Hsc70)destabilized it.5) These findings suggested that any substancethat regulates either Hsp70 or Hsc70 levels may modify theexpression of hERG. It has been reported that mushroomscontain substances that influence the function of heat shockproteins. The Galb1-3GalNAca (TF antigen)-binding lectin(ABL) from the common edible mushroom (Agaricus bis-

porus) has a potent anti-proliferative effect on epithelialcells. Preincubation with ABL blocked the transport ofHsp70 into the nucleus in the response to heat shock.6) Toseek novel therapeutic agents for treatment of arrhythmias,we screened actions of five types of mushroom extracts(Gymnopilus junonius, Amanita ibotengutake, Pleurotuseryngii, Omphalotus guepiniformis, Armillaria mellea) onhERG, which were provided by Fungus/Mushroom Resourceand Research Center, Tottori University. In the present study,we found that Gymnopilus junonius and Amanita iboten-gutake influenced the expression of Hsp70 and Hsc70 andthus modified the expression and activity of hERG.

MATERIALS AND METHODS

Purification Scheme Dry powders of Gymnopilus juno-nius, Amanita ibotengutake, and Pleurotus eryngii (Pleurotuseryngii (DC). GILLET) mushrooms which had been harvestedin Tottori prefecture of Japan were suspended in methanol(1.0 g/20 ml). After 2 h agitation at room temperature, themixtures were centrifuged and the supernatants were filteredthrough a 0.2 mm filter. The filtrates were vacuum-dried.

Constituents of Gymnopilus junonius were fractionated asfollows: 0.5 g dry powders of Gymnopilus junonius were sus-pended in 20 ml methanol and vigorously stirred for 1 h. Themixture was filtered and evaporated. The resulting residuewas separated by C18 column chromatography into a water-soluble fraction and methanol-soluble fractions with

1474 Vol. 34, No. 9Regular Article

Novel Effects of Extracts from Poisonous Mushrooms on Expression andFunction of the Human ether-a-go-go-Related Gene Channel

Peili LI,a Saki TANAKA,b Tsuyoshi ICHIYANAGI,b Haruaki NINOMIYA,c Yakuang TING,a

Sulistiyati-Bayu UTAMI,a Tadanori AIMI,b Yasuaki SHIRAYOSHI,a Junichiro MIAKE,d and Ichiro HISATOME*,a

a Division of Regenerative Medicine and Therapeutics, Department of Genetic Medicine and Regenerative Therapeutics,Institute of Regenerative Medicine and Biofunction, Tottori University Graduate School of Medical Science; c Departmentof Biological Regulation, Faculty of Medicine, Tottori University; d Department of Cardiovascular Medicine, TottoriUniversity; 86 Nishimachi, Yonago, Tottori 683–8504, Japan: and b School of Agricultural, Biological and EnvironmentalSciences, Tadanori Aimi Faculty of Agriculture, Tottori University; 4–101 Koyamacho Minami, Tottori, Tottori 680–8553,Japan. Received May 10, 2011; accepted June 21, 2011; published online June 27, 2011

The human ether-a-go-go-related gene (hERG) encodes the aa subunit of the potassium current IKr, whichplays a pivotal role in cardiac action potential repolarization. Inherited mutations of this gene cause Long QTsyndrome type 2. hERG expression is altered by several types of drugs as well as by temperature. Heat shockprotein 70 (Hsp70) and Heat shock cognate protein 70 (Hsc70) have reciprocal effects on hERG proteins. We ex-amined the effects of poisonous mushrooms on hERG protein expression and its channel function. Methods: Weevaluated the effects of several types of poisonous mushrooms on the expression and function of wild-type hERGby Western blotting, reverse transcription polymerase chain reaction (PCR), and patch clamping in transfectedHEK293 cells and mouse HL-1 cardiomyocytes. Results: Extracts of Gymnopilus junonius (junonius) increasedexpression of both hERG and Hsp70 in HEK293 cells with concomitant decrease in Hsc70, whereas extracts ofAmanita ibotengutake (ibotengutake) decreased hERG proteins with increase in Hsc70. Knockdown of Hsp70 andHsc70 by small interfering RNA abolished the effects of the two mushrooms on hERG, respectively. Certain frac-tions of junonius increased expression of hERG proteins. hERG currents were increased by extracts of junonius,resulting in shortening of action potential duration (APD). In contrast, hERG currents were decreased and APDwas prolonged by extracts of ibotengutake. Conclusion: junonius enhanced the expression and function of hERGby increasing Hsp70 and decreasing Hsc70. Ibotengutake decreased hERG expression via increase in Hsc70. Con-stituents of junonius may have the potential for use in treatment of arrhythmia.

Key words human ether-a-go-go-related gene; poisonous mushroom; heat shock protein 70; heat shock cognate 70

Biol. Pharm. Bull. 34(9) 1474—1480 (2011)

© 2011 Pharmaceutical Society of Japan∗ To whom correspondence should be addressed. e-mail: hisatome@med.tottori-u.ac.jp

methanol concentrations from 20 to 100%.Cell Culture and Transfection HEK293 cells were first

used to examine action of mushrooms on exogenous hERG-FLAG. HEK293 cells were cultured in Dulbecco’s modifiedEagle medium (DMEM) (Sigma) supplemented with 10%fetal bovine serum (FBS) and penicillin/streptomycin/geneticin at 37 °C, 5% CO2. An expression construct,pcDNA3/hERG-FLAG, was engineered by ligating anoligonucleotide encoding a FLAG epitope to the carboxy ter-minus of hERG cDNA. The plasmids were transfected intoHEK293 cells using lipofectamine 2000 (Invitrongen) fol-lowing the manufacturer’s instructions. The expression con-struct of GFP was co-tranfected in all transfection experi-ments to trace transfection efficiency. An extracts of mush-room or methanol (control) was added to the culture mediumovernight 36 h after transfection. In order to examine actionof mushrooms on endogenous hERG current and action po-tential, we used HL-1 mouse cardiomyocytes which are acardiac muscle cell line that retains phenotypic characteris-tics of adult cardiomyocytes. The HL-1 cells were maintainedas previously described.7,8) Briefly, HL-1 cells were culturedin Claycomb medium supplemented with 4 mM L-glutamine(Wako, Osaka, Japan), 100 mM norepinephrine, 100 U/mlpenicillin, and 10% fetal bovine serum at 37 °C, 5% CO2.

Small Interference RNA (siRNA) An active oligonu-cleotide against Hsp70 or Hsc70 and a scrambled controlsiRNA were used. Table 1 shows sequences of siRNA againstHsp70 and Hsc70. HEK293 cells were transfected withsiRNA using lipofectamine 2000 (invitrogen) according tomanufacturer’s instructions.

Immunoblotting Cells were harvested 48 h after trans-fection and lysed by sonication in a lysis buffer (phosphatebuffered saline (PBS) 1%, polyoxyethylene (9)octyiphenylether (NP-40), 0.5% sodium deoxycholate, 0.1% sodium do-decyl sulfate (SDS), 10 mg/ml aprotinin, 10 mg/ml leupep-tine, 10 mg/ml pepstatin, and 1 mM phenylmethylsulfonylfluo-ride). After removal of insoluble materials by centrifugation,protein concentrations were determined with a bicinchoninicacid (BCA) protein assay kit (Pierce, Biotechnology, Rock-ford, IL, U.S.A.). Proteins were separated on SDS-polyacryl-amide gel electrophoresis (PAGE) and electrotransferred topolyvinylidene fluoride (PVDF) membranes. The membraneswere blocked with 5% nonfat dry milk in PBS plus 0.1%Tween and immunoblotted with a primary antibody. The fol-lowing antibodies were used: FLAG epitope (Cosmo Bio),Hsp70 (mouse monoclonal; Stressgen), Hsc70 (Rat mono-clonal; Stressgen), b-actin (Oncogene), and GFP (MolecularProbes). The blots were developed using an ECL system(Amersham, Biosciences, Piscataway, NJ, U.S.A.). Band den-sities were quantified using NIH image J software.

Semi-Quantitative Reverse Transcription-PolymeraseChain Reaction (RT-PCR) Total RNAs were extractedfrom HEK293 cells using an RNeasy Plus mini kit (QIA-GEN) and subjected to RT-PCR assay (Prime Scrips RT-PCR

Kit, Takara). RNA samples were treated with DNase I(Promega) to eliminate genomic DNA. The primers were de-signed by Primer 3 software (Source Forge).

The primers used were: hERG (NM_172056) forwardprimer: CGCTACCACACACAGATGCT, reverse: GATGT-CATTCTTCCCCAGGA, Hsp70 (NM_005345) forwardprimer: CGACCTGAACAAGAGCATCA, reverse: AA-GATCTGCGTCTGCTTGGT, Hsc70 (NM_006597) forwardprimer: GGAGGTGGCACTTTTGATGT, reverse: AGCC-AGTACGGAGGCGTCTTA, b-actin (NM_001101) forwardprimer: CAACCGTGAAAAGATGAC, reverse: CAGGAT-CTTCATGAGGTAGT. PCR products were separated onelectrophoresis gel, stained with ethidium bromide, and visu-alized in a UV transilluminator.

Electrophysiological Recordings HEK293 cells stablyexpressing hERG-FLAG were treated overnight with extractsof mushroom. Control cells were treated with vehicle(methanol). hERG channel currents that correspond to therapidly-activating delayed-rectifier K� channel (IKr) weremeasured at 37 °C using a whole-cell patch-clamp techniquewith an Axopatch-200 amplifier (Axon Instrument, U.S.A.).The extracellular solution contained (mM):140 NaCl, 4 KCl,1.8 CaCl2, 0.53 MgCl2, 0.33 NaH2PO4, 5.5 glucose, and 5 N-(2-hydroxyethyl)piperazinyl-N�-2-ethanesulfonic acid (HEPES),with pH adjusted to 7.4 by NaOH. The internal pipette solu-tion contained (mM) 100 K-aspartate, 20 KCl, 1 CaCl2, 5 Mg-ATP, 5 ethylene glycol bis(2-aminoethylether)-N,N,N�,N�-tetraacetic acid (EGTA), 5 HEPES, 5 creatine phosphate, anddipotassium (pH 7.2 with KOH). The holding potential was�80 mV and currents were elicited with 4-s test pulses rang-ing from �40 to �50 mV (in 10 mV increments) followed byrepolarization to �50 mV for 4 s. Peak amplitudes of the cur-rents during the depolarizing pulses and tail currents duringrepolarization were determined and plotted as functions ofthe potentials of the depolarizing pulses. Procedures for de-termination of action potential duration (APD) in HL-1 cellswere described previously.5,9) APD was also measured in thecurrent-clamp mode, with elicitation at a rate of 0.5 Hz by5 ms square current pulses of 1 nA and sampling at 20 kHz.All experiments were carried out at 37 °C.

Statistical Analysis All values are presented as themean�S.E.M. For statistical analysis, repeated-measuresanalysis of variance (two-way ANOVA) were used, with find-ings of p�0.05 considered significant.

RESULTS

Extracts of Mushrooms Modulated Levels of hERGand Heat Shock Proteins Figure 1 shows the effects of ex-tracts from Gymnopilus junonius on the levels of hERG,Hsp70, and Hsc70 proteins. hERG-FLAG yielded two bandson the anti-FLAG immunoblot, a fully glycosylated matureform of 155 kDa and an immature core-glycosylated form of135 kDa. Extracts of Gymnopilus junonius significantly in-

September 2011 1475

Table 1. Sequences of siRNA

Sense Antisense

Hsp70 5�-TTCAAAGTAAATAAACTTTAATT-3� 5�-UUAAAGUUUAUUUACUUUGAATT-3�Hsc70 5�-CUGUCCUCAUCAAGCGUAATT-3� 5�-UUACGCUUGAUGAGGACAGTT-3�

creased the levels of both forms of hERG at high concentra-tions. The extracts of Gymnopilus junonius increased thelevel of Hsp70 (Fig. 1) but decreased the level of Hsc70. Thelevels of GFP and b-actin were not affected in any experi-ments, excluding the possibility of differential transfectionefficiency or protein loading. Figure 2 shows the effects ofextracts from Amanita ibotengutake. The extracts of Amanitaibotengutake decreased the levels of both forms of hERG.The decreases were accompanied by an increase in Hsc70level without changes in the level of Hsp70. We applied adouble amount of proteins in hERG Western blotting in Fig.2 due to Amanita ibotengutake decreased the expression ofhERG-FLAG. Figure 3 shows the effects of extracts fromPleurotus eryngii. Extracts of Pleurotus eryngii did not alterthe level of either hERG, Hsp70 or Hsc70 protein. To furtherdirectly confirm the effects of mushrooms on hERG expres-sion via the changes of Hsp70 and Hsc70, HEK293 cellswere transiently transfected with hERG-FLAG and eitherwith a siRNA against Hsp70 or Hsc70, respectively. The cellswere treated by methanol (C) or an extract of Gymnopilusjunonius or Amanita ibotengutake overnight 36 h after trans-fection. Knockdown of Hsp70 abolished the increased levelsof Hsp70 and hERG by Gymnopilus junonius. While, siRNAagainst Hsc70 erased the effects of Amanita ibotengutake onhERG and Hsc70 (Fig. 4).These results suggested that ex-tracts of some toxic mushrooms influenced the expression ofhERG, Hsp70, and Hsc70, and that each mushroom had dis-tinct effects on hERG protein levels via modulation of thelevels of Hsp70 or Hsc70.

Effects of Mushroom Extracts on hERG, Hsp70, andHsc70 mRNA Next, we examined effects of mushroom ex-

tracts on mRNA levels of hERG, Hsp70, and Hsc70 (Fig. 5).Compared with the levels in control cells treated withmethanol, neither Gymnopilus junonius nor Amanitaibotengutake changed the mRNA levels of these proteins. Noband was detected from PCR amplification of RNA withoutRT.

Mushroom Extracts Regulated hERG Currents andAction Potential Duration To determine whether mush-room extracts affected hERG function, we recorded hERGchannel currents in HEK293 cells stably expressing hERG-FLAG. Depolarizing pulses activated time-dependent out-ward currents that correspond to IKr (Fig. 6Aa). Extracts ofGymnopilus junonius significantly increased both peak andtail current amplitudes (Fig. 6Ab). In contrast, extracts ofAmanita ibotengutake decreased the peak and tail currents(Fig. 6Ac). Extracts of Pleurotus eryngii exhibited no obvi-ous effects (Fig. 6Ad). The magnitude of hERG peak currentincreased progressively with test potentials up to �10 mV,and then progressively decreased, and the amplitude of tailcurrent progressively increased after depolarization and satu-ration at �10 mV.10) We therefore analyzed the peak currentamplitude at �10 mV and tail current amplitude at �50 mV;results are summarized in Figs. 6B and C.

The hERG current is responsible for repolarization of thecardiac action potential and IKr is the dominant outward cur-rent in HL-1 cells.10,11) As shown in Fig. 6D, extracts ofGymnopilus junonius shortened APD at 90% repolarization(APD90) from 131 ms (C) to 77 ms, while those of Amanitaibotengutake prolonged it to 183 ms, without affecting theresting membrane potential. Again, extracts of Pleurotuseryngii had no obvious effects on APD. APD90 values are

1476 Vol. 34, No. 9

Fig. 1. Effects of Gymnopilus junonius on Levels of hERG-FLAG, Hsp70, and Hsc70

HEK293 cells were transiently transfected with hERG-FLAG and treated with Gymnopilus junonius extracts or methanol (C) overnight 36 h after transfection. Cell lysates weresubjected to immunoblotting (IB) with indicated antibodies. Image densities of the hERG, Hsp70, and Hsc70 were quantified and normalized to their levels in the cells withmethanol. ∗ p�0.05 vs. C (n�5—7).

summarized in the lower panel of Fig. 6D. During the record-ings of APD, we confirmed that IKr in HL-1 cells were in-creased by extracts of Gymnopilus junonius but decreased by

Amanita ibotengutake. The currents remained no significantchanges under treatment of Pleurotus eryngii (data notshown).

September 2011 1477

Fig. 2. Effects of Amanita ibotengutake on Levels of hERG-FLAG, Hsp70, and Hsc70

HEK293 cells were transiently transfected with hERG-FLAG and treated with Amanita ibotengutake extracts or methanol (C) overnight 36 h after transfection. Cell lysates weresubjected to IB with indicated antibodies. ∗ p�0.05 vs. C (n�5—7).

Fig. 3. Pleurotus eryngii Did Not Affect Levels of hERG-FLAG, Hsp70, and Hsc70

HEK293 cells were transiently transfected with hERG-FLAG and treated with Pleurotus eryngii extracts overnight 36 h after transfection. Cell lysates were subjected to IB withindicated antibodies (n�4—7).

Presence of an Effective Constituent in Gymnopilusjunonius That Increased hERG Expression To furtherdetermine the effective substance contained in Gymnopilusjunonius, we checked effects of its fraction on hERG. Theconstituents of Gymnopilus junonius was separated by C-18chromatography into a water-soluble fraction and methanol-soluble fractions with methanol concentrations from 20 to

100%. HEK293 cells transiently expressing hERG-FLAGwere treated with each fraction. As shown in Fig. 7, Westernblotting showed that 20% and 100% methanol fractionsmarkedly increased the expression of hERG-FLAG. Thesame fractions increased the level of Hsp70 and decreasedthat of Hsc70. Image densities of hERG, Hsp70, and Hsc70were summarized in graphs in Fig. 7. These findings sug-gested that a methanol-soluble constituent of Gymnopilusjunonius increased hERG expression by regulating the levelsof Hsp70 and Hsc70.

DISCUSSION

Hallucinogenic mushrooms exhibit cardiac toxicity.12) Themuscarinic compounds found in a number of species ofmushrooms have agonist activity on cholinergic receptorsand can cause hypotension or bradycardia. There have beenseveral case reports of arrhythmia and myocardial infarctioncaused by excessive intake of wild mushrooms13,14) In thepresent study, we found that extracts from Gymnopilus juno-nius and Amanita ibotengutake regulated the expression ofhERG proteins and channel function. The levels of hERGmRNAs were not altered by mushroom extracts, suggestingthat they acted on hERG via a post-transcriptional modifica-tion. This is the first report that methanol extracts obtainedfrom toxic mushrooms directly influence cardiac channel ex-pression and function. It has been reported that chaperonemolecules regulate the levels of many channel proteins, suchas Cystic fibrosis transmembrane conductance regulator(CFTR),15) epithelial sodium channel, and hERG.5,16,17) Werecently reported that Hsp70 and Hsc70 exert reciprocal ef-fects on hERG protein. Both Hsp70 and Hsc70 bind to hERGproteins and control their stability. Hsp70 decreases hERGprotein degradation by the proteasome and increases hERGcurrents, whereas Hsc70 destabilizes hERG proteins and de-creases these currents.5) The present results are consistentwith these previous findings. Methanol extract obtained fromGymnopilus junonius increased Hsp70 and the level ofhERG, while methanol extract obtained from Amanita

1478 Vol. 34, No. 9

Fig. 4. siRNA against Hsp70 and Hsc70 Abolished the Effects of Gymnopilus junonius and Amanita ibotengutake on hERG-FLAG, Respectively

HEK293 cells were transfected with hERG-FLAG or with either a scramble siRNA (mock) or siRNA against Hsp70 or Hsc70. The cells were treated with extracts of junonius(Jun), ibotengutake (Ibo), or methanol (C) overnight 36 h after transfection. Cell lysates were subjected to IB with indicated antibodies. Densities of hERG-FLAG, Hsp70, andHsc70 were summarized in graphes. ∗ p�0.05 vs. C; † p�0.01, ∗∗ p�0.05 vs. with a scramble siRNA with mushroom extracts treatment (n�6—7).

Fig. 5. Effects of Mushrooms on Transcriptional Expressions of hERG,Hsp70, and Hsc70

HEK293 cells were transiently expressed with hERG-FLAG and treated withmethanol as a control (C), or either with an extract from Gymnopilus junonius, Amanitaibotengutake or Pleurotus eryngii overnight, respectively. hERG, Hsp70 or Hsc70mRNA was analyzed by semi-quantitative transcription-PCR. b-Actin level was ana-lyzed as control. Image densities of bands were quantified and normalized to their lev-els in the cells with methanol.

ibotengutake increased Hsc70 and decreased the level ofhERG. The mushroom extracts were also able to controlhERG currents in HEK293 cells stably expressing hERG aswell as IKr and APD in mouse HL-1 cardiac myocytes.Changes of other ion channels by mushroom-inducedHsp70/Hsc70 cannot be completely excluded in HL-1 cells.However, changes of APD by mushroom extracts at least par-tially are attributed to changes of IKr.

Anti-arrhythmic effects of hERG have been described inadult rabbit ventricular myocytes and in hERG transgenicmice. In both cases, hERG expression resulted in shorteningof APD and decrease in the incidence of early-after depolar-ization, and thereby exerted anti-arrhythmic effects.18,19)

Since some fractions from Gymnopilus junonius were foundto increase hERG expression, their constituents may be oftherapeutic value for arrhythmias. Recently it has been re-ported that IKr agonist induced short QT syndrome predis-posed to development of atrial fibrillation in dog experimen-tal atrial model.20) Further investigations of electrophysiolog-

ical effects of Gymnopilus junonius in animal models arecrucially necessary. It is noteworthy that suppression ofhERG prolongs APD and results in arrhythmia.21) Amanitaibotengutake may possess pro-arrhythmic chemicals.

The mushrooms we examined altered the protein levels ofheat shock chaperones, Hsp70 and Hsc70, without affectingtheir mRNA levels, indicating effects on post-transcriptionalprocesses. Although edible mushroom lectin has been re-ported to interfere with nuclear transport of Hsp70,22) no sub-stance contained in mushrooms has been reported to directlyregulate the post-translational modification of Hsp/Hsc70.Hsp70 has been shown to protect heart tissues from ischemiaand reperfusion injury. It has also been shown to suppress in-flammation and prevent insulin resistance in the contexts ofgenetic obesity and high-fat feeding.23,24) Geranylgeranylace-tone (GGA), a nontoxic acyclic isoprenoid compound, hasbeen reported to increase Hsp70 expression through activa-tion of HSF-1, and to play a pivotal role in suppression ofcardiac apoptosis.25) We recently reported that GGA in-

September 2011 1479

Fig. 6. Effects of Mushrooms on hERG Currents and Action Potential Duration

(A) Representative current trace recorded from HEK293 cells stably expressing hERG-FLAG treated with methanol or either an extract from mushrooms overnight, respectively.The membrane potential was hold at �80 mV, depolarized by 4 s test pulses ranging from �40 to �50 mV (in 10 mV increments). (Aa) A representative trace of whole-cell currentmediated by hERG-FLAG in presence of methanol. (Ab—d) A representative trace of whole-cell current in presence of either an extract from mushrooms. The peak current ampli-tude at �10 mV and tail current amplitude at �50 mV are summarized in (B) and (C), respectively. ∗ p�0.05 vs. control (n�9-16). (D) Representative action potential recordedfrom HL-1 cells treated with methanol or an extract from mushrooms. The APD90 presents APD at 90% repolarization. Lower panel summarized APD90. ∗ p�0.05 vs. control(n�12—15).

creased HSF-1, Hsp70, SAP97, and Kv1.5.7) The potency ofGymnopilus junonius in increasing Hsp70 was comparable tothat of GGA (data not shown). The substance we isolatedfrom Gymnopilus junonius may have cardioprotective effects.Further investigation will be required to determine this spe-cific constituent in mushrooms and to clarify how it modu-lates the levels of Hsp70 and Hsc70.

REFERENCES

1) Sanguinetti M. C., Tristani-Firouzi M., Nature (London), 440, 463—469 (2006).

2) Thomas D., Kiehn J., Katus H. A., Karle C. A., Cardiovasc. Res., 60,235—241 (2003).

3) Fitzgerald P. T., Ackerman M. J., Heart Rhythm, 2, 30—37 (2005).4) Finlayson K., Witchel H. J., McCulloch J., Sharkey J., Eur. J. Pharma-

col., 500, 129—142 (2004).5) Li P., Ninomiya H., Kurata Y., Kato M., Miake J., Yamamoto Y., Igawa

O., Nakai A., Higaki K., Toyoda F., Wu J., Horie M., Matsuura H.,Yoshida A., Shirayoshi Y., Hiraoka M., Hisatome I., Circ. Res., 108,458—468 (2011).

6) Yu L. G., Fernig D. G., White M. R., Spiller D. G., Appleton P., EvansR. C., Grierson I., Smith J. A., Davies H., Gerasimenko O. V., PetersenO. H., Milton J. D., Rhodes J. M., J. Biol. Chem., 274, 4890—4899(1999).

7) Ting Y. K., Morikawa K., Kurata Y., Li P., Bahrudin U., Mizuta E.,Kato M., Miake J., Yamamoto Y., Yoshida A., Murata M., Inoue T.,Nakai A., Shiota G., Higaki K., Nanba E., Ninomiya H., Shirayoshi Y.,Hisatome I., Br. J. Pharmacol., 162, 1832—1842 (2011).

8) Claycomb W. C., Lanson N. A. Jr., Stallworth B. S., Egeland D. B.,Delcarpio J. B., Bahinski A., Izzo N. J. Jr., Proc. Natl. Acad. Sci.U.S.A., 95, 2979—2984 (1998).

9) Toyoda F., Ding W. G., Zankov D. P., Omatsu-Kanbe M., Isono T.,Horie M., Matsuura H., J. Membr. Biol., 235, 73—87 (2010).

10) Sanguinetti M. C., Jiang C., Curran M. E., Keating M. T., Cell, 81,299—307 (1995).

11) Tan H. L., Hou C. J., Lauer M. R., Sung R. J., Ann. Intern. Med., 122,701—714 (1995).

12) Borowiak K. S., Ciechanowski K., Waloszczyk P., J. Toxicol. Clin. Tox-icol., 36, 47—49 (1998).

13) Caley M. J., Calrk R. A., BMJ, 2, 24—31 (1977).14) Lurie Y., Wasser S. P., Taha M., Shehade H., Nijim J., Hoffmann Y.,

Basis F., Vardi M., Lavon O., Suaed S., Bisharat B., Bentur Y., Clin.Toxicol. (Philadelphia), 47, 562—565 (2009).

15) Younger J. M., Ren H. Y., Chen L., Fan C. Y., Fields A., Patterson C.,Cyr D. M., J. Cell Biol., 167, 1075—1085 (2004).

16) Goldfarb S. B., Kashlan O. B., Watkins J. N., Suaud L., Yan W., Kley-man T. R., Rubenstein R. C., Proc. Natl. Acad. Sci. U.S.A., 103,5817—5822 (2006).

17) Ficker E., Dennis A. T., Wang L., Brown A. M., Circ. Res., 92, 87—100 (2003).

18) Nuss H. B., Marbán E., Johns D. C., J. Clin. Invest., 103, 889—896(1999).

19) Royer A., Demolombe S., El Harchi A., Le Quang K., Piron J., Touma-niantz G., Mazurais D., Bellocq C., Lande G., Terrenoire C., MotoikeH. K., Chevallier J. C., Loussouarn G., Clancy C. E., Escande D.,Charpentier F., Cardiovasc. Res., 65, 128—137 (2005).

20) Nof E., Burashnikov A., Antzelevitch C., Heart Rhythm, 7, 251—257(2010).

21) Pollard C. E., Abi Gerges N., Bridgland-Taylor M. H., Easter A., Ham-mond T. G., Valentin J. P., Br. J. Pharmacol., 159, 12—21 (2010).

22) Liang Y., Lin J. C., Wang K., Chen Y. J., Liu H. H., Luan R., Jiang S.,Che T., Zhao Y., Li de F., Wang da C., Guo L., Sun H., Biochim. Bio-phys. Acta, 1800, 474—480 (2010).

23) Yin C., Salloum F. N., Kukreja R. C., Circ. Res., 104, 572—575(2009).

24) Chung J., Nguyen A. K., Henstridge D. C., Holmes A. G., Chan M. H.,Mesa J. L., Lancaster G. I., Southgate R. J., Bruce C. R., Duffy S. J.,Horvath I., Mestril R., Watt M. J., Hooper P. L., Kingwell B. A., VighL., Hevener A., Febbraio M. A., Proc. Natl. Acad. Sci. U.S.A., 105,1739—1744 (2008).

25) Ooie T., Takahashi N., Saikawa T., Nawata T., Arikawa M., Yamanaka K.,Hara M., Shimada T., Sakata T., Circulation, 104, 1837—1843 (2001).

Fig. 7. Effects of Fractionations of Gymnopilus junonius on hERG Proteins

HEH293 cells were transiently transfected with hERG-FLAG and treated with a fraction of Gymnopilus junonius overnight 36 h after transfection. The whole-cell lysates wereanalyzed by IB against indicated antibodies. Image densities of hERG, Hsp70, and Hsc70 were quantified and normalized to their levels in the cells with control (methanol).∗ p�0.05 vs. C (n�6).

1480 Vol. 34, No. 9