Upload
-
View
86
Download
0
Tags:
Embed Size (px)
Citation preview
Next Generation Sequencing
Basics of NGS
• Fragmentation of DNA into a Library of smaller fragments.
• Libraries are then sequenced to be duplicated.
• Bioinformatics piece together the small fragments to create a map and reference it to the human genome.
Differences between methods
PCR PCR + SNP Next GenaCGH arrays* Sequencing
Detects aneuploidy no yes yes yesDetects gene defects yes yes yes yesDetects mitotic errors no yes no yes1-2 month of Preparation yes yes no noRequires affected proband no no yes noApplicable to any case yes yes no yes
* Karyomapping using BlueGnome
CAGCGGCAGATGATTCGGGGATATTG
AGGATACGACTTGCAGCGGCAGATGATT
GTACCATAGGATACGACTTGCAGCGGCA ATATTGCGTATA
CAGATGATTCGGGGATATTGCGTA
TGCGTATAGG
ACCATAGGATACGACTTGCAGCGGC
TAGAGTACCATAGGATACGACTTGCAACGGCAGATGATTCGGGGATATTGCGTATAGGCTA
Known sequence (CFTR gene chromosome 7)
Each region of the genome sequenced multiple times
Millions of short sequences produced
Sequences are compared to the known human genome
Mutations identified and amount of DNA (aneuploidy) revealed
Fragmentation
Next Generation Sequencing (NGS)
Sample Cost1 819.98112 435.79113 307.72784 243.69615 205.27716 179.66447 161.36978 147.64869 136.9766
10 128.439111 121.453812 115.632854 65.8303555 65.5716456 65.3221657 65.0814458 64.8490259 64.6244860 64.4074261 64.1974862 63.9943263 63.797664 63.60703
0
100
200
300
400
500
600
700
800
900
1 3 5 7 9 111315171921232527293133353739414345474951535557596163
Co
st
Number of Samples
Chart Title
Number of samples
Price
Multiplexing
PGD for aneuploidy and gene defects using NGS: Method
• With WGA only <10% is sequenced
• Solution: enrich the sequences of interest prior to NGS. An aliquot of the WGA product was used to amplify by PCR the CF ΔF508 mutation site on a cell line
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: useful for DIRECT mutation analysis and aneuploid
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
Cystic fibrosis gene (CFTR) DF508 mutation sequenced in a single blastomere
PGD for aneuploidy and gene defects using NGS: Results
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
Yin et al (2013) Biol Reprod 88, 69
• 38 blastocysts from 13 couples with structural chromosomal abnormalities
• Whole genome sequence by Illumina HiSeq2000
• Results: 0.07x depth with average 5.5% genome coverage
• 26 (68%) blastocysts euploid, 6 (16%) aneuploid, 4 (11%) unbalanced only, 2 (5%) unbalanced and aneuploid
• Highly concordant with SNP array results
Treff et al (2013) Fertility and Sterility 99, 1377-1384
• 21 blastocysts from couples at risk of cystic fibrosis and one of Walker-Warburg syndrome
• Whole genome amplification was followed by targeted Taqmanamplification of mutation site, sequenced by Ion Torrent and 8 barcoded samples per chip
• Real time qPCR used for 24 chromosome aneuploidy testing
• 17 (81%) blastocysts euploid, 4 (19%) aneuploid
• 100% concordance of mutation status with STR and minisequencing
PGD for aneuploidy and gene defects using NGS: Results
• A homozygotic cell line for ΔF508 was used
• The gene was sequenced with a x30 depth
• All cells were found to be euploid and homozygotic for ΔF508.
• Conclusion: this method can be use for DIRECT mutation analysis and aneuploid
• Other methods such as SNPs can only do haplotype analysis
D Wells, KKaur, A Rico, J Grifo, S Anderson, J Sherlock, JC Taylor , S Munne (submitted) Rapid genetic analysis of single cells using a next generation sequencing methodology: application to human embryos reveals aneuploidy and DNA sequence mutations
Summary Next Gene Sequencing
Current Advantages:- Same resolution for chromosome abnormalities than aCGH- Detection of mitochondrial DNA: potentially useful- Simultaneous detection of aneuploidy and gene defects
Future advantages: - Whole gene sequencing
Vendors of Next Generation Sequencing
Company Models Benchtop Chemistry
Roche (454) GS FLX/GS Junior
Yes Pyrosequencing
Illumina MiSeq/HiSeq/Genome Analyzer
Yes Sequencing by synthesis
Ion Torrent PGM/Proton/SOLiD 4
Yes Semiconductor sequencing
PACBio PACBIO RS II No SMRT technology
Vendors of Next Generation Sequencing or Equivalent Company Models Benchtop Chemistry
Oxford NanoporeTechnologies
GridION System/MinION No Nanopore Sensing
RainDance Technologies ThunderStormSystem/RDT 1000
Yes High-Throughput/Low-Med Targeted Sequencing
Helicos (Bankrupt) N/A N/A N/A
Complete Genomics Proprietary Sequencing N/A Proprietary (Long Fragment Reads?)
Ion Torrent for Aneuploidy Validation
• 10 single cells from cell lines with known aneuploidies
• 40 embryo cells (previously diagnosed using aCGH)• Calculated amount of sequence from each chromosome
• 50/50 (100%) of samples gave a result
• 48 separate aneuploidies detected
• 100% diagnostic accuracy (in a blinded experiment)
First baby born from NGS
First NGS baby:David Levy
A collaboration of Reprogenetics-US and Reprogenetics-UK (Dagan Wells) and Main Line Fertility (Dr. Glassner)
Helpful tools for NGS
• https://genohub.com/next-gen-sequencing-services/