APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2010, p. 680–687 Vol. 76, No. 30099-2240/10/$12.00 doi:10.1128/AEM.02416-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

New Architectures for Tet-On and Tet-Off Regulation inStaphylococcus aureus�

Elena Stary,§ Rosmarie Gaupp,§ Sabrina Lechner, Martina Leibig, Evelyn Tichy,Martina Kolb, and Ralph Bertram*

Lehrbereich Mikrobielle Genetik, Eberhard Karls Universitat Tubingen, Waldhauser Str. 70/8, 72076 Tubingen, Germany

Received 5 October 2009/Accepted 30 November 2009

Inducible expression is a valuable approach for the elucidation of gene functions. Here, we present newconfigurations of the tetracycline-dependent gene regulation (tet) system for Staphylococcus aureus. To provideimproved and expanded modes of control, strains and plasmids were constructed for the constitutive expres-sion of tetR or a variant allele, rev-tetRr2. The encoded regulators respond differently to the effector anhydrotet-racycline (ATc), which causes target gene expression to be induced with TetR or repressed with rev-TetR. Toquantify and compare regulation mediated by episomal or chromosomal (rev-)tetR constructs, expression froma chromosomal Pxyl/tet-gfpmut2 fusion was measured. Chromosomally encoded TetR showed tight repressionand allowed high levels of dose-dependent gene expression in response to ATc. Regulatory abilities were furtherverified using a strain in which a native S. aureus gene (zwf) was put under tet control in its native chromosomallocation. Tight repression was reflected by transcript amounts, which were barely detectable under repressedconditions and high in ATc-treated cells. In reporter gene assays, this type of control, termed Tet-on, was moreefficient than Tet-off regulation, in which addition of ATc causes downregulation of a target gene. The latter wasachieved and quantified by direct rev-TetR control of Pxyl/tet-gfpmut2. Additionally, TetR was used in trans tocontrol the expression of antisense RNA for posttranscriptional gene silencing. Induction of antisense RNAexpression of the fabI gene caused pronounced growth retardation lasting several hours. These results dem-onstrate the efficiency of the new tet systems and their flexible use for different purposes.

Staphylococcus aureus is a frequent colonizer of human skinand mucosal surfaces but is also an opportunistic pathogen.Superficial infections, such as impetigo, carbuncles, or scaled-skin syndrome, are attributed to S. aureus; furthermore, thesebacteria are capable of infecting internal organs of the humanbody to, e.g., elicit osteomyelitis, endocarditis, or sepsis. Thequest for the elucidation of gene-function relationships in S.aureus is facilitated by the availability of various molecularbiology techniques (47); in particular, obtaining deletion mu-tants is aided by a number of protocols (2, 4, 10). Naturally, inthe case of essential genes, the respective deletion mutantscannot be cultured. Those genes, however, represent promis-ing targets for anti-infective compounds needed to combatstrains that withstand treatment with current antibiotics (41).

To circumvent deletion, recalcitrant genes can be put underinducible expression control within the chromosome (16, 31,49). The most prominent gene regulation systems for S. aureusemploy the following promoters and regulators: Pxyl and XylR(53), Pspac and LacI (31), and Pxyl/tet and TetR (32). All threesystems are characterized by induction of target gene expres-sion upon detachment of the effector-bound repressors fromDNA but differ in terms of efficiency and regulatory windows(54). It was shown that a one-plasmid-based TetR-dependent(tet) regulation system displayed considerable leakiness in therepressed state. However, this architecture, in which tetR is

expressed under the control of the autoregulated promoterPR* while the adjacent divergently oriented promoter, Pxyl/tet,mediates conditional expression of a target gene, is the mostprominent for tet regulation in S. aureus to date. Both PR* andthe Bacillus subtilis PxylA-derived Pxyl/tet promoter (20) arevested with tetO sequences as cognate sites for TetR, whoseDNA binding capacity is abrogated by inducers like tetracy-cline (Tc) or anhydro-Tc (ATc) (14). Expression of a targetgene in canonical prokaryotic tet control is thus achieved uponTetR induction by (A)Tc.

If the gene of interest proves to be essential for growth orduring the course of infection, a strain then requires the per-manent presence of an inducer to ensure survival or to sustainvirulence, respectively. It would, however, be beneficial to havesuch genes active by default and to be able to shut them downrapidly at a given time point. In TetR-regulated antisenseRNA expression, short fragments transcribed under Pxyl/tet

control from the nontemplate strand of a target gene lead to itsdownregulation in a posttranscriptional fashion (32). With theemergence of mutant TetR variants, this outcome can also beachieved by direct tet regulation. Among the transcriptionalrepressors used for transgene regulation to date, TetR isunique in displaying a reversed phenotype when mutated atselected positions (51). Such reverse TetR regulators (rev-TetR) require ATc as a corepressor to bind tetO and thus tosilence a downstream target gene. rev-TetR has been appliedin Gram-positive and Gram-negative bacteria (22, 31, 48), fre-quently employing the rev-TetR variant r2 (rev-TetRr2), char-acterized by the amino acid exchanges E15A, L17G, and L25V(51).

Although tet regulation systems in higher eukaryotes employ

* Corresponding author. Mailing address: Lehrbereich MikrobielleGenetik, Eberhard Karls Universitat Tubingen, Waldhauser Str. 70/8,72076 Tubingen, Germany. Phone: 49 7071 29-78855. Fax: 49 707129-5937. E-mail: ralph.bertram@uni-tuebingen.de.

§ E.S. and R.G. contributed equally to the work.� Published ahead of print on 4 December 2009.

680

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

other cis elements, modified TetR-based regulators, and dis-tinct effectors (7), it seems timely to adapt established nomen-clature of eukaryotic tet regulation to bacterial systems, aspreviously suggested (19). Thus, Tet-on control prevails in aconfiguration in which the addition of an effector (in this case,ATc) leads to gene expression in control, whereas Tet-off de-fines the silencing of a target gene under these conditions. Newsetups are presented in this study to enable both types ofcontrol and to provide improved regulation capacities.

MATERIALS AND METHODS

Chemicals, enzymes, molecular weight markers, and oligonucleotides. Chem-icals were generally purchased from Merck (Darmstadt, Germany), AppliChem(Darmstadt, Germany), or Sigma (Munich, Germany) at the highest purity avail-able. ATc was purchased from Acros (Geel, Belgium). DNA enzymes and mo-lecular weight markers were obtained from Fermentas (St. Leon-Rot, Germany),New England Biolabs (Frankfurt/Main, Germany), Roche Diagnostics (Mann-heim, Germany), Peqlab (Erlangen, Germany), or GE Healthcare (Munich,Germany). Lysostaphin was obtained from Dr. Petry Genmedics (Reutlingen,Germany). Oligonucleotides were purchased from biomers.net (Ulm, Germany)and are given in Table 1.

Bacterial strains, growth conditions, and manipulations. Bacteria were grownin liquid or on solid BM (6), BOG (BM without glucose), or tryptic soy broth(TSB) (Sigma, Munich, Germany). Antibiotics were used, where appropriate, atthe following final concentrations: ampicillin, 100 �g/ml; kanamycin, 15 �g/ml;chloramphenicol, 10 �g/ml; and spectinomycin, 150 �g/ml. As the effector for(rev-)TetR, ATc (prepared as a 10 mM stock solution in 70% ethanol) was addedto bacterial cultures at a final concentration of 0.4 �M unless otherwise stated.Escherichia coli was made competent and transformed using standard techniques(26). Competent B. subtilis cells were obtained as described previously (38), andthe integration of plasmid DNA into the amyE locus was verified by the loss ofamylase activity. S. aureus cells were subjected to electroporation according tothe method of Augustin and Gotz (3). Transformation of Staphylococcus carno-sus was achieved using protoplast cells (23). Plasmids cloned in E. coli wereshuttled through the restriction-deficient S. aureus RN4220 or tetR-expressingderivatives thereof (see below) prior to transformation of S. aureus SA113 or itsdescendants. Chromosomal integration of plasmid DNA into S. aureus wasachieved as described previously (10). lox-flanked aphAIII kanamycin resistancecassettes were excised from modified strains’ genomes using plasmid pRAB1carrying cre, encoding a site-specific recombinase (40). Exchange of DNA be-tween different S. aureus strains was achieved by bacteriophage �11 transduction(27). The strains and plasmids used in this study are listed in Table 2.

Isolation, manipulation, and detection of nucleic acids and proteins. PlasmidDNA was prepared from E. coli or staphylococci by using commercially availablekit systems from Peqlab (Erlangen, Germany) or Qiagen (Hilden, Germany).Staphylococcus cells were treated with lysostaphin at a final concentration of 12.5�g/ml for 30 min at 37°C. Chromosomal DNA of S. aureus or S. carnosus wasprepared by phenol-chloroform extraction or by using the InstaGene system(Bio-Rad, Munich, Germany). DNA sequencing was carried out at GATC (Con-stance, Germany). For detection and quantification of tet-controlled zwf tran-script amounts (see below), RNA preparation and Northern blots were con-ducted as described previously (18, 21, 45) using primers G6PDH-North_for andG6PDH-NorthT7_rev. The hybridization signals were detected using Lumi-Film(Roche, Mannheim, Germany). Soluble protein fractions of relevant strains weresubjected to (rev-)TetR-directed Western blotting using rabbit polyclonal anti-bodies diluted 1:20,000 (35) in combination with the ECL Western BlottingDetection System (GE Healthcare, Munich, Germany). Chemiluminescent sig-nals were detected using a Konica Medical Film Processor QX-150U machine(Konica Minolta, Munich, Germany) and Hyperfilm ECL (GE Healthcare, Mu-nich, Germany).

Fluorescence measurements. Cells from 2 ml of mid-log-phase cultures grownin BOG with or without ATc were harvested, washed, and resuspended in 200 �lphosphate-buffered saline (PBS). Cell densities and fluorescence were deter-mined using 150 �l of each sample in a flat-bottom 96-well microtiter plate(Greiner Bio-One, Nurtingen, Germany) using a GENios microplate reader(Tecan, Crailsheim, Germany). Raw fluorescence data were obtained by usingfilters for excitation at a � of 485 nm and emission at a � of 535 nm. The valuesobtained were correlated with the respective optical density at 595 nm (OD595)and then subtracted from background obtained from cells without gfpmut2 grownwith or without ATc.

Construction of a plasmid for conditional complementation of S. aureus�arcABDCR. Unless otherwise stated, plasmids were propagated and cloned inE. coli DH5� or XL1-Blue throughout this study. The final constructs wereverified by analytical restriction and sequencing. A plasmid for tet-regulatedcomplementation of an arc operon deletion strain (40) was cloned as follows.The arcABDCR genes were amplified from chromosomal DNA of S. aureus withprimers Karcfw_pcx19 and Komp_arc_rw. The 5.7-kbp Ecl136I/BglII-digestedproduct was cloned into the BamHI/SmaI-digested plasmid pCX19 (28). A0.84-kbp Pxyl/tet-PR*-tetR regulatory region generated from pWH1935-1a withprimers tet_arc_native_fw and tet_arc_native_rev was inserted into the obtainedplasmid via AhdI/BlpI to yield pRAB8.

Cloning of vectors for episomal expression of tetR or rev-tetR. Throughout thisarticle, rev-tetRr2 and rev-TetRr2 are referred to as rev-tetR and rev-TetR, re-spectively, for convenience. A 0.86-kbp PCR product consisting of Pt17–rev-tetRwas obtained from pRAB2-r2 using the primers tet_pCX_fw and tet_pCX_rev.The undigested fragment was cloned into the SmaI/ScaI-digested staphylococcalvector pCX19 (28). The resulting plasmid, in which rev-tetR had the sameorientation as the plasmid’s cat gene, was termed pRAB7-r2. To clone pRAB7for tetR expression, a fragment containing the wild-type (wt) regulator gene wasamplified from plasmid pWH1935-1a (9) using primers DP10gh and pxt_rev. A

TABLE 1. Oligonucleotides used in this study

Primer Sequence (5�33�)

DP10gh ...................................CTATTTGCAACAGTGCCGTfabI_fw....................................TGAAAGGTACCCATATGTCATCAT

GGGAATCGfabI_rev...................................TTTTAGGTCGACGAGCCACAATTG

TTAATGAGG6PDH-NorthT7_rev ...........CTAATACGACTCACTATAGGGAG

ACATGTGGTTTTGCACCATATCG6PDH-North_for ................GACGCGTTTATGGAACATGgfp_fdh_fw..............................TTATCTTGATCATAAGGGTAAC

TATTgfp_fdh_rev ............................TGACACCTGATCAACTGGTAATGKarcfw_pcx19.........................ATTATAGATCTGAATTCAAAGATA

AAAGGAGGKomp_arc_rw.........................ATATTGAGCTCATCACCTTAAATT

TTACTGlip_fw ......................................TTAATAGGTACCTTACTATTlip_rev .....................................TCACTTAAGCGTCTGCTAAATPt17_tet_fw.............................TCAAGAGGATCCACTCCAAATAT

AGCTPt17_tet_rev ...........................ACTGTGAGGATCCGGATGAGTA

GGTApxt_rev ....................................GGGATCCTCTAGAGTCGACCTGpxt_fw......................................TCTGGTAAGCTTGAAGTTACCACSA0171KOP1F.......................AAGTCGAATTCCCACAATCACAA

ATCATCACSA0171KOP2R......................AATATGGATCCCCCTTGAATTATT

GTTAAATTCSA0171KOP3F.......................TATTAGTCGACGCTAGCGATTAAC

GCTTTCSA0171KOP4R......................AATTAGATATCTGATAACGACTTG

CATGCCTCtet arc native fw.....................ATTATGCTTAGCAGACTATTTGCA

ACAGTGCtet arc native rev ...................AATTTGGACCATCTGTCATGTCTA

TTCCTCTAGAGTCGACCTGCtet-G6PDH_B_for .................TATATGTCGACCATATTGTATGAC

CTACTGAATGGtet-G6PDH_B_rev.................TATATAAGCTTTTCGTAATCAATC

CTTGTCATTCGtet-G6PDH_A_for.................ATTATGAGCTCTGTTATTTGGCAA

GCATTGTTTATTACtet-G6PDH_A_rev ................TTATATCCGGACGATTCATGTATC

ATGTTTAATGTGtet_pCX_fw ............................GATCTGTACACTCGAGAGGATCC

ACTCCAAATATAGCTtet_pCX_rev...........................CGAGGCATCACTTGCCGAACGGT

AAGGAACCCAGACTGT

VOL. 76, 2010 TET-ON AND TET-OFF REGULATION IN S. AUREUS 681

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

510-bp XbaI/Eco47III part of tetR was ligated with the likewise cut pRAB7-r2 toreplace the codons responsible for the reverse phenotype with those of wt TetR.

Construction of strains for chromosomal expression of tetR or rev-tetR. Toprovide homologous regions for chromosomal integration of (rev-)tetR, a majorpart of S. aureus lip was amplified with primers lip_fw and lip_rev. The obtainedsequence was introduced into the allelic replacement vector pBT2 (10) viaAcc65I/AflII to yield pBT2-lip. A sequence containing the synthetic promoterPt17, tetR, and an aphAIII cassette flanked by the lox66 and lox71 sequences (1)was obtained from B. subtilis WH558 (9) by PCR using primers Pt17_tet_fw andPt17_tet_rev. The BamHI-cut fragment was inserted into pBT2-lip, in which theenzyme cuts once within the lip sequence. Cloning of Pt17-containing sequenceswas generally performed in S. carnosus, because propagation in E. coli usuallyresulted in massive deletions within the synthetic promoter region. One candi-date in which tetR was colinear to the plasmid backbone cat resistance markerwas designated pRAB2. To obtain pRAB2-r2, tetR of pRAB2 was partiallyreplaced with an Eco47III/XbaI fragment of rev-tetR of pWH1925-r2. The Pt17–(rev-)tetR lox66–aphAIII–lox72 sequences were integrated into SA113 lip, yield-ing strain RAB200 (tetR) or RAB220 (rev-tetR), respectively. In vivo Cre recom-binase treatment (40) led to the excision of the aphAIII sequence. The obtained

kanamycin-sensitive strains were designated RAB210 (tetR) and RAB230(rev-tetR).

Construction of strains with chromosomally borne gfpmut2 for tet control. Inorder to obtain a chromosomal integration mutant for Pxyl/tet-gfpmut2, the S.aureus fdh gene (SAOUHSC_00142) encoding formate dehydrogenase was cho-sen. To construct an fdh replacement vector, a 1.1-kbp fragment upstream of fdhwas amplified using primers SA0171KOP1F and SA0171KOP2R, which intro-duced EcoRI and BamHI restriction sites, respectively. A 1.25-kbp spectinomy-cin resistance cassette was obtained from plasmid pIC156 (52) via BamHI/SalIcleavage. To provide a downstream homologous sequence, a PCR product of0.99 kbp obtained with the primers SA0171KOP3F and SA0171KOP4R was cutwith SalI/EcoRV and cloned into pBT2. The resulting vector was cut withSalI/EcoRI to insert the upstream and marker fragments to obtain pBT2-fdh.pWH105-gfpmut2, a derivative of pWH105 (35) in which lacZ has been replacedby the triple gfp mutant gfpmut2 (12) via HindIII/BlpI, was used as a template toamplify Pxyl/tet-gfpmut2 using the primers gfp_fdh_fw and gfp_fdh_rev. BclI di-gestion was used to ligate the fragment with the BamHI-cut pBT2-fdh. Onecandidate in which gfpmut2 had been inserted divergently to cat was designatedpRAB4. Insertion of the Pxyl/tet-gfpmut2 portion into SA113, RAB210, and

TABLE 2. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s) Reference

B. subtilisWH557 trpC2 lacA::Pt17-tetR lox66-aphAIII-lox71 9WH557-gfp trpC2 lacA::Pt17-tetR lox66-aphAIII-lox71 amyE::Pxyl/tet-gfpmut2 9WH558 trpC2 lacA::Pt17-tetR lox66-aphAIII-lox71 amyE::Pxyl/tet-lacZ 9

E. coliDH5� �� �80dlacZ�M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17(rK

� mK�) supE44 thi-1 gyrA relA1 26

XL1-Blue hsdR17(rK� mK

) recA1 endA1 gyrA96 thi-1 supE44 relA1 lac F� proAB lacIq Z�M15 Tn10 (Tetr)� Stratagene

S. aureusSA113 (ATCC 35556) NCTC8325 derivative; agr negative; 11-bp deletion in rbsU 29RN4220 NCTC8325-4 derivative; acceptor of foreign DNA 29RAB133 arcABDCR::lox72 40RAB171 SA113 fdh::Pxyl/tet-gfpmut2 This workRAB180 RN4220 lip::Pt17-tetR lox66-aphAIII-lox71 This workRAB190 RN4220 lip::Pt17-tetR lox72 This workRAB200 SA113 lip::Pt17-tetR lox66-aphAIII-lox71 This workRAB210 SA113 lip::Pt17-tetR lox72 This workRAB211 SA113 lip::Pt17-tetR lox72 fdh::Pxyl/tet-gfpmut2 This workRAB215 SA113 lip::Pt17-tetR lox66-aphAIII-lox71 Pxyl/tet-zwf This workRAB216 SA113 lip::Pt17-tetR lox72 Pxyl/tet-zwf This workRAB220 SA113 lip::Pt17-revtetR lox66-aphAIII-lox71 This workRAB230 SA113 lip::Pt17-revtetR lox72 This workRAB231 SA113 lip::Pt17-revtetR lox72 fdh::Pxyl/tet-gfpmut2 This workRAB235 SA113 lip::Pt17-revtetR lox66-aphAIII-lox71 Pxyl/tet-zwf This workRAB236 SA113 lip::Pt17-revtetR-r2 lox72 Pxyl/tet-zwf This work

S. carnosusTM300 Wild type 50

PlasmidspBT2 cat bla; E. coli/Staphylococcus shuttle vector; thermosensitive ori for staphylococci 10pCX19 cat xylR lip; Staphylococcus vector 28pIC156 Source of specR 52pRAB1 cat bla PpagA-cre; pBT2 derivative 40pRAB2(-r2) cat bla �lip�-Pt17-(rev-)tetR-lox66-aphAIII-lox72-�lip�; pBT2 derivative This workpRAB4 cat bla �SAOUHSC_00139-141-Pxyl/tet-gfpmut2-specR-SAOUHSC_00143�; pBT2 derivative This workpRAB6 cat bla ble Pxyl/tet-AS �fabI�; pRB473 derivative This workpRAB7(-r2) cat Pt17-(rev-)tetR; pCX19 derivative This workpRAB8 cat PR*-tetR Pxyl/tet-arcABDCR; pCX19 derivative This workpRAB9 cat bla SAOUHSC_01599-lox66-aphAIII-lox72-Pxyl/tet-zwf; pBT2 derivative This workpRB473 cat bla ble; E. coli/Staphylococcus shuttle vector 11pWH105-gfpmut2 bla �amyE�-cat-Pxyl/tet-gfpmut2-�amyE�; pWH105 derivative This workpWH1925-r2 Source of revtetR 51pWH1935-1a Source of tetR 9pWH1935-2 Source of Pxyl/tet 9

682 STARY ET AL. APPL. ENVIRON. MICROBIOL.

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

RAB230 gave rise to RAB171 (Pxyl/tet-gfpmut2), RAB211 (tetR Pxyl/tet-gfpmut2),and RAB231 (rev-tetR Pxyl/tet-gfpmut2), respectively.

Construction of strains for chromosomal tet regulation of the S. aureus zwfgene. Primers tet-G6PDH_B_for and tet-G6PDH_B_rev were used to amplifyand modify the zwf gene (SAOUHSC_01599; glucose-6-phosphate 1-dehydroge-nase), including its Shine-Dalgarno sequence, from the chromosomal DNA of S.aureus. The SalI/HindIII-digested PCR product (1.2 kbp) was ligated into like-wise cut pBT2 (10), creating pBT2B. Primers tet-G6PDH_A_for and tet-G6PDH_A_rev were used to obtain a 1.6-kbp upstream flanking region of zwf.Pxyl/tet with a divergent lox66-aphAIII-lox71 cassette was obtained from the plas-mid pWH1935-2 by Kpn2I/SalI digestion and ligated with both the SacI/Kpn2I-restricted PCR fragment and SacI/SalI-digested pBT2B, resulting in pRAB9.Prior to chromosomal integration into SA113-derived strains, pRAB9 was shut-tled through the tetR expression strain RAB190, which was constructed likeRAB210, albeit in an RN4220 background. Insertion of the Pxyl/tet-zwf portion ofpRAB9 into RAB210 gave rise to RAB215. The Pxyl/tet-zwf sequence was trans-duced into RAB230 with phage �11, resulting in RAB235. Cre-dependent re-moval of the aphAIII fragment (40) yielded the kanamycin-sensitive strainsRAB216 (tetR Pxyl/tet-zwf) and RAB236 (rev-tetR Pxyl/tet-zwf).

Construction of a plasmid for antisense tet regulation of fabI. Pxyl/tet wasamplified from pWH1935-2 (9) with the primers pxt_fw and pxt_rev. The XbaI/HindIII-digested 131-bp fragment was cloned into the shuttle vector pRB473(11). The resulting intermediate construct was cut with Acc65I and SalI, and asimilarly restricted 372-bp PCR product containing part of the fabI gene[SAOUHSC_00947; enoyl-(acyl carrier protein) reductase] generated with prim-ers fabI_fw and fabI_rev from chromosomal S. aureus DNA was ligated to yieldplasmid pRAB6. After propagation in the kanamycin-resistant RAB190 ante-cessor RAB180, pRAB6 was used to transform RAB210.

RESULTS

Construction and analysis of new tetR and rev-tetR expres-sion plasmids and strains. In order to conditionally comple-ment an S. aureus arc operon deletion strain (termed RAB133[40]), plasmid pRAB8 was constructed. It carries tetR underthe control of the autoregulated promoter PR* and a divergentPxyl/tet promoter controlling transcription initiation of thearcABDCR genes. The encoded arginine deiminase pathwayenzymes lead to degradation of arginine with concomitant re-lease of ammonia (46). Initial experiments conducted with S.aureus RAB133(pRAB8) under anaerobic conditions showedan increase in pH in the absence of ATc, indicative of ammo-nia production (data not shown). This gave reason to assumethat repression of the plasmid-borne arc operon in the absenceof inducer was not extremely pronounced.

This, among other considerations, prompted us to generatenew tet regulation configurations that (i) show increased effi-ciency and (ii) exploit different regulatory architectures. Thebasic concept included constitutive expression of tetR and itsspatial uncoupling of the target gene. To provide a new plas-mid for tetR expression, pRAB7, which harbors tetR down-stream of the synthetic �A-dependent promoter Pt17, was con-structed (9). Due to its origin of replication, this plasmid isprobably present at about 15 copies per Staphylococcus cell(30). In combination with a target gene cloned downstream ofa tet-regulatable promoter, this setup was expected to obeyTet-on logic. In order to exploit rev-TetR as a Tet-off regula-tor in S. aureus, a derivative of pRAB7 containing rev-tetRr2,was cloned to express TetR E15A L17G L25V with reversebehavior.

As an alternative configuration, we sought to have the re-pressors also expressed from the S. aureus chromosome. Thedispensable lip gene seemed to be a suitable locus of (rev-)tetRintegration, so replacement vectors were used to constructstrains RAB210 and RAB230 for Pt17-dependent expression

of tetR or rev-tetR, respectively, from the chromosome. InitialWestern blot analyses showed that RAB210 TetR levels werecomparable to those of Bacillus subtilis WH557, which alsoharbors a chromosomal Pt17-tetR fusion (9). TetR was moreabundant than rev-TetR (not shown). To provide a quantifi-able readout system for the new regulation systems, a reportergene under tet control was integrated into a different locus ofthe S. aureus chromosome. In previous studies, it had beenshown that an S. aureus formate dehydrogenase (fdh)-deficientstrain had an unaffected phenotype concerning growth and pHunder aerobic conditions (our unpublished results). Hence, afragment containing a Pxyl/tet-gfpmut2 sequence was integratedinto the fdh genes of SA113, RAB210, and RAB230 to obtainRAB171 (no tetR), RAB211 (tetR and gfpmut2 control), andRAB231 (rev-tetR and gfpmut2 control). For reasons of com-parison, B. subtilis WH557-gfp was constructed, which, next toPt17-tetR, also harbors Pxyl/tet-gfpmut2 in a distinct chromo-somal site. Finally, S. aureus RAB171 was transformed withpRAB7 and pRAB7-r2 for episomal (rev-)tetR expression tocomplete the set of reporter strains. Upon quantification ofATc-dependent fluorescence intensity, clear (rev-)TetR-de-pendent regulation of the reporter gene was observed. In thecase of episomal-regulator expression, the efficiencies ofTet-on [RAB171(pRAB7)] and Tet-off [RAB171(pRAB7-r2)]control were comparable. For TetR, 127 relative fluores-cence units in the repressed state and 710 when cells weregrown with ATc were determined, resulting in an inductionfactor (IF) of 5.6. In the case of rev-TetR, values averagedaround 903 and 105 in the derepressed state and for core-pression with ATc, respectively (IF, 8.6). Measurements ofstrains with chromosomally located (rev-)tetR revealed a par-ticularly efficient regulation capacity for the Tet-on system(RAB211). Here, relative fluorescence of approximately 2,016determined with ATc was accompanied by an extremely lowlevel of about 23 in the repressed state, resulting in an IF of 88. RevTetR-mediated Tet-off control quantified withRAB231 resulted in values of 1,098 (without ATc) and 345(with ATc), resulting in an IF of 3.2 (Fig. 1). B. subtilisWH557-gfp gave values of 79 in the repressed state and 1,115 when induced by ATc (IF, 14) (data not shown). Inorder to check for dose dependence of the response, the fluo-rescences of RAB211 and RAB231 cells grown with differentATc concentrations (5 nM, 0.1 �M, and 0.4 �M) were quan-tified. ATc dose dependence appeared to be pronounced withRAB211, where the addition of 0.1 �M ATc elicited about halfthe response of cells grown with 0.4 �M inducer. The responsewas less concentration dependent with rev-TetR in RAB231,for which corepression with 5 nM ATc could hardly be en-hanced by concentrations of up to 0.4 �M ATc (Fig. 2). Tocorrelate the regulation capacities with cytosolic-regulatoramounts, Western blot analyses of RAB171(pRAB7),RAB171(pRAB7-r2), RAB211, and RAB231 were conducted,which confirmed that TetR was abundantly expressed, irre-spective of the episomal or chromosomal localization of thegene. Signal intensities were comparable in both configura-tions, with somewhat smaller amounts of rev-TetR (Fig. 3).

Chromosomal Tet-on and Tet-off regulation of a native S.aureus gene. Ribose and 2-deoxyribose sugars are major con-stituents of nucleic acids. When unavailable, ribose compo-nents are supplied by decarboxylation of hexoses in the pen-

VOL. 76, 2010 TET-ON AND TET-OFF REGULATION IN S. AUREUS 683

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

tose phosphate pathway. We aimed to regulate the glucose-6-phosphate 1-dehydrogenase-encoding gene zwf in its nativechromosomal locus. To this end, the (rev-)TetR addressablePxyl/tet promoter was positioned in the chromosomes ofRAB210 and RAB230, upstream of zwf’s Shine-Dalgarno se-quence. zwf directed Northern blots were conducted withRAB216 (tetR and zwf control), RAB236 (rev-tetR and zwfcontrol), RAB210, and RAB230. In the last two, only weak zwfexpression was observed. In the case of Tet-on control(RAB216), strong signals were observed in the induced state,

whereas repression appeared to be very efficient, as a specificproduct was virtually undetectable. In RAB236 without ATc,zwf mRNA was about as abundant as that in induced RAB216cells, whereas corepression had only moderate effects (Fig. 4).The appearance of two specific zwf signals speaks in favor oftwo distinct terminators. This assumption, as well as furtheranalyses of zwf gene dosage effects, will be addressed in furtherstudies.

Episomal antisense control by trans-encoded TetR. Severalprevious studies employed tet regulation in S. aureus to expressantisense (AS) RNA for posttranscriptional gene silencing. Totest the efficiency of RAB210 as a host for the control ofepisomal AS-RNA expression, fabI, which encodes enoyl-(acylcarrier protein) reductase, involved in fatty acid biosynthesis,was chosen as a target. A part of fabI was attached in in-verse orientation to Pxyl/tet in plasmid pRAB6. The impact ofAS-fabI expression on the fitness of RAB210 was analyzedin liquid media. Although growth of the ATc-treatedRAB210(pRAB6) culture eventually accelerated, pro-nounced retardation was observed during the first 9 h

FIG. 1. Regulation capacities of strains RAB171 (with eitherpRAB7 or pRAB7-r2) for episomal expression and RAB211 andRAB231 for chromosomal expression of (rev-)tetR as determined by achromosomal Pxyl/tet-gfpmut2 fusion. The white bars represent relativefluorescence values obtained without ATc, and the black bars show theresults of cultures grown with 0.4 �M ATc. The error bars representthe standard deviations of triplicate determinations.

FIG. 2. ATc dose dependence of target gene response by TetR andrev-TetR. The values obtained for RAB211 (wt TetR) and RAB231(rev-TetR) are shown. The error bars represent the standard devia-tions of triplicate determinations.

FIG. 3. Western blot of 35 �g of soluble protein obtained fromstrains RAB171(pRAB7-r2) with an episomal location or RAB211 andRAB231 with a chromosomal location of (rev-)tetR. A signal obtainedwith approximately 50 ng of purified TetR is shown as a positivecontrol for comparison. Protein extracts of RAB171 were used as anegative control.

FIG. 4. Northern blots directed against zwf. The strains analyzedcontained the unaffected gene (RAB210 or RAB230) or Pxyl/tet-zwffusions controlled by chromosome-borne TetR (RAB216) or rev-TetR(RAB236). The lanes display transcript amounts obtained from cul-tures grown with ATc () or without the compound (�). Analyseswere conducted with total RNA from log-phase (A) or early-station-ary-phase (B) cultures. (C) Representative loading controls with 23Sand 16S rRNA.

684 STARY ET AL. APPL. ENVIRON. MICROBIOL.

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

postinoculation. Control cultures of RAB210 harboring theempty vector pRB473 treated equally did not show anygrowth difference, ruling out cytotoxicity of ATc (Fig. 5).

DISCUSSION

tet regulation has been employed in more than a dozendifferent Gram-positive and Gram-negative bacterial species todate (8) and is particularly popular for studying genes in S.aureus. This study provides second-generation tet systems forenhanced repression, multiple modes of application, and rev-TetR control (Fig. 6). S. aureus tet regulation plasmids, such aspYJ335 (32), pYH4 (33), or pALC2073 (5), exploit the pro-moter Pxyl/tet with a single tetO sequence between the �35 and�10 sites (20). Although a comparable one-plasmid setup hasshown considerable leakiness (54) and Pxyl/tet equipped with anadditional tetO site conferred tighter repression in B. subtilis(20, 35), this second version of Pxyl/tet has notably been ne-glected for use in S. aureus to date. Our observations withpRAB8, however, suggested that this two-tetO version alsoproduced discernible transcript amounts when repressed.Hence, the target gene promoter may not be the most criticalparameter for the efficiency of tet control.

FIG. 5. Effects of episomal �fabI� AS expression controlled by chro-mosomally encoded TetR. The growth curves of RAB210(pRAB6) andthe growth phenotype of RAB210(pRB473) (no AS expression) (control)are shown. The filled symbols indicate the presence of 0.4 �M ATc.

FIG. 6. Overview of different configurations applied for S. aureus tet regulation in this study. The bent arrows denote promoters involved in tetregulation, and the rectangles represent tetO sites. lox72 sequences are shown as triangles. The arrows representing (rev-)tetR are black, and genessubject to tet control are gray. The dotted lines indicate the genetic sources of repressors that are directed to control of the respective targetpromoters. (A) A one-plasmid setup was used to control expression of arcABDCR. Here, tetR regulates its own transcription by not only promoterPR�, but also Pxyl/tet in cis. (B) pRAB7 and pRAB7-r2 were applied to episomal (rev-)TetR expression to control a chromosomal Pxyl/tet-gfpmut2fusion. The latter is represented within the adjacent genes SAOUHSC_00141 and SAOUHSC_00143. Chromsomally embedded (rev-)tetRconfigurations were applied to control a reporter gene (C), a gene in its native chromosomal locus (D), or an episomally localized antisensefragment (E). In all cases, a double-tetO version of Pxyl/tet was addressed by the repressors, which were expressed by Pt17 (B to E). Within itself,each representation is drawn to scale.

VOL. 76, 2010 TET-ON AND TET-OFF REGULATION IN S. AUREUS 685

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

In E. coli, B. subtilis, or mycobacteria (15, 35, 44), constitu-tive tetR expression provided tight repression, presumably byincreasing the cellular TetR-to-tetO ratio. In a very recentstudy, Corrigan and Foster improved the regulation capacitiesof a one-plasmid configuration for S. aureus (13). Adaptationof the �10 sequence of the tetR-driving promoter PR* to fit theconsensus was unintentionally accompanied by inactivation ofthe overlapping tetO site in plasmid pRMC1. We reckon thatthe latter effect mainly accounted for improved repression byproviding increased amounts of TetR. In fact, the resultingpromoter largely resembles Pt17, which provided valuable ser-vices in B. subtilis (9, 35) and also expressed tetR well in S.aureus (Fig. 3). At the moment, the reason why chromosomalexpression of TetR provided more pronounced regulation thanthe pRAB7 system despite comparable cellular proteinamounts remains elusive. Since previous studies had shownthat the lipase activity of an in vitro-grown SA113 �lip strainwas unaffected (our unpublished results), lip was chosen as alocus for tetR integration. In contrast to previous studies (16,24), which inserted tetR into the intragenic phage L54a attach-ment site of geh, encoding an active lipase (39), the lipaseactivity of RAB210 should be unaffected, which may haveimplications for future virulence studies (42).

Regarding its induction factor, RAB211 does not at firstglance meet the superb regulation capacities of tet regulationreporter strains, such as E. coli DH5�Z1/PLtetO-1 (IF, 5,050)or B. subtilis WH558 (IF, 314) (9, 44). The impacts of dif-ferent reporter genes on the determination of this parametershould not be underestimated, as exemplified by correlatingthe IF of B. subtilis WH557-gfp in retrospect with that ofWH558. The two strains share common tet architectures, but incontrast to WH558 (Pxyl/tet-lacZ), an IF of only 14 was de-termined with the Pxyl/tet-gfpmut2 sequence. The calculated IFof 88, measured with a Pxyl/tet-gfpmut2 fusion, thus under-scores RAB211’s salient regulation efficiency.

Although not found to be essential for S. aureus in twodifferent studies (17, 34), initial deletion approaches for the zwfgene failed in our laboratory (unpublished results). Hence, zwfwas placed under tet control in its native chromosomal locusfor analysis of transcript amounts, as well as for further futureexaminations. Northern blots of Pxyl/tet-zwf strains confirmedthe particularly tight repression capacities of the chromosomaltetR expression architecture. As only extremely small transcriptamounts were detected in the repressed state (Fig. 4),RAB210-mediated target gene repression by chromosomallylocated tetR may be capable of mimicking knockout pheno-types. On the other hand, in accordance with data of Zhangand colleagues (54), Pxyl/tet appeared to produce very largeamounts of target transcript when induced. Besides adjustingthe physiologic conditions for target gene expression by apply-ing lower ATc concentrations (Fig. 2), it might also be practi-cable to design and apply alleviated versions of Pxyl/tet forfuture applications.

Using a fabI fragment that was largely congruent with onedescribed previously (33), we could demonstrate that the AS-RNA-dependent Tet-off mode (32–34) was also functionalwhen TetR was supplied in trans by RAB210 (Fig. 5). Possibleexplanations for the mitigation of ATc-dependent growth in-clude effector decomposition, tetR mutations rendering therepressor induction defective, or promoter down-mutations in

Pxyl/tet. By employing rev-TetR, this study marks the establish-ment of a second mode of Tet-off regulation in S. aureus.Evidently, rev-TetR allows the control of the flow of geneticinformation at a point further upstream than AS-RNA. Therepression capacities exerted by rev-TetR were considerablyless pronounced than chromosomal Tet-on control (Fig. 1). Itis tempting to speculate that larger amounts of rev-TetR mayenhance corepression capacities. Promising approaches in-clude codon adaptation (37), the use of different promotersdriving rev-tetR (25, 35), and the adaptation of single-chainTetR (36) to a reverse variant. For RAB231 (rev-TetR-con-trolled gfpmut2), only minor changes in reporter activity weredetermined between 5 nM and 0.4 �M ATc (Fig. 2). Previousstudies of E. coli and Mycobacterium smegmatis (25, 48) haddemonstrated graded responses of rev-TetR control to be mostdistinctive between 0 and 6 nM ATc. It can be assumed thatdosable target gene expression using rev-TetR in S. aureus maybe elicited within a similar range of ATc concentrations.

Figure 6 summarizes various versatile architectures for tetregulation in S. aureus. For the purpose of tet-dependent one-plasmid-based complementation of deletion strains (Fig. 6A),the recently described pRMC1 and -2 vectors seem to be wellsuited due to their exquisite regulation capacities (13). In con-trast, the architecture of RAB216 may be exemplary for theregulation and analysis of S. aureus genes in their native chro-mosomal locus (Fig. 6D). Regulated complementation of tar-get genes is also feasible by their ectopic integration, e.g., intoan intergenic chromosomal phage attachment site (43). Ge-netic stability, absence of resistance markers, and tight repres-sion capacities make strains configured like RAB216 attractivefor analysis in infection models. Finally, RAB210-based episo-mal AS control (Fig. 6E) can also be exploited for minimallyinvasive target gene control. Recently, S. carnosus (22) andStaphylococcus epidermidis (H. Rohde, personal communica-tion) have been shown to be amenable to tet regulation. Hence,it can be assumed that the new configurations can also beemployed in these and other staphylococci.

ACKNOWLEDGMENTS

We thank Annette Kamionka and Jose Vazquez Ramos for con-struction of pWH105-gfp and Volker Winstel and Sonja Mayer forcloning of pRAB6. We are grateful to Anne-Katrin Ziebandt for as-sistance with Northern blot analyses and to Gunther Thumm and SilviaHerbert for analyses of lip. Steffen Schlag, Wolfgang Hillen, andFriedrich Gotz are acknowledged for fruitful discussions and support.

This work was supported by the Deutsche Forschungsgemeinschaftthrough grants BE4038, SPP1316, and TR-SFB34 and the researchtraining group GC685.

REFERENCES

1. Albert, H., E. C. Dale, E. Lee, and D. W. Ow. 1995. Site-specific integrationof DNA into wild-type and mutant lox sites placed in the plant genome. PlantJ. 7:649–659.

2. Arnaud, M., A. Chastanet, and M. Debarbouille. 2004. New vector forefficient allelic replacement in naturally nontransformable, low-GC-content,gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–6891.

3. Augustin, J., and F. Gotz. 1990. Transformation of Staphylococcus epidermi-dis and other staphylococcal species with plasmid DNA by electroporation.FEMS Microbiol. Lett. 54:203–207.

4. Bae, T., and O. Schneewind. 2006. Allelic replacement in Staphylococcusaureus with inducible counter-selection. Plasmid 55:58–63.

5. Bateman, B. T., N. P. Donegan, T. M. Jarry, M. Palma, and A. L. Cheung.2001. Evaluation of a tetracycline-inducible promoter in Staphylococcus au-reus in vitro and in vivo and its application in demonstrating the role of sigBin microcolony formation. Infect. Immun. 69:7851–7857.

686 STARY ET AL. APPL. ENVIRON. MICROBIOL.

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6. Bera, A., S. Herbert, A. Jakob, W. Vollmer, and F. Gotz. 2005. Why arepathogenic staphylococci so lysozyme resistant? The peptidoglycan O-acetyl-transferase OatA is the major determinant for lysozyme resistance of Staph-ylococcus aureus. Mol. Microbiol. 55:778–787.

7. Berens, C., and W. Hillen. 2003. Gene regulation by tetracyclines. Con-straints of resistance regulation in bacteria shape TetR for application ineukaryotes. Eur. J. Biochem. 270:3109–3121.

8. Bertram, R., and W. Hillen. 2008. The application of Tet repressor inprokaryotic gene regulation and expression. Microb. Biotechnol. 1:2–16.

9. Bertram, R., M. Kostner, J. Muller, J. Vazquez Ramos, and W. Hillen. 2005.Integrative elements for Bacillus subtilis yielding tetracycline-dependentgrowth phenotypes. Nucleic Acids Res. 33:e153.

10. Bruckner, R. 1997. Gene replacement in Staphylococcus carnosus and Staph-ylococcus xylosus. FEMS Microbiol. Lett. 151:1–8.

11. Bruckner, R. 1992. A series of shuttle vectors for Bacillus subtilis and Esch-erichia coli. Gene 122:187–192.

12. Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimizedmutants of the green fluorescent protein (GFP). Gene 173:33–38.

13. Corrigan, R. M., and T. J. Foster. 2009. An improved tetracycline-inducibleexpression vector for Staphylococcus aureus. Plasmid 61:126–129.

14. Degenkolb, J., M. Takahashi, G. A. Ellestad, and W. Hillen. 1991. Structuralrequirements of tetracycline-Tet repressor interaction: determination ofequilibrium binding constants for tetracycline analogs with the Tet repressor.Antimicrob. Agents Chemother. 35:1591–1595.

15. Ehrt, S., X. V. Guo, C. M. Hickey, M. Ryou, M. Monteleone, L. W. Riley, andD. Schnappinger. 2005. Controlling gene expression in mycobacteria withanhydrotetracycline and Tet repressor. Nucleic Acids Res. 33:e21.

16. Fan, F., R. D. Lunsford, D. Sylvester, J. Fan, H. Celesnik, S. Iordanescu, M.Rosenberg, and D. McDevitt. 2001. Regulated ectopic expression and allelic-replacement mutagenesis as a method for gene essentiality testing in Staph-ylococcus aureus. Plasmid 46:71–75.

17. Forsyth, R. A., R. J. Haselbeck, K. L. Ohlsen, R. T. Yamamoto, H. Xu, J. D.Trawick, D. Wall, L. Wang, V. Brown-Driver, J. M. Froelich, K. G. C., P.King, M. McCarthy, C. Malone, B. Misiner, D. Robbins, Z. Tan, Z. Y. ZhuZy, G. Carr, D. A. Mosca, C. Zamudio, J. G. Foulkes, and J. W. Zyskind.2002. A genome-wide strategy for the identification of essential genes inStaphylococcus aureus. Mol. Microbiol. 43:1387–1400.

18. Fuchs, S., J. Pane-Farre, C. Kohler, M. Hecker, and S. Engelmann. 2007.Anaerobic gene expression in Staphylococcus aureus. J. Bacteriol. 189:4275–4289.

19. Gandotra, S., D. Schnappinger, M. Monteleone, W. Hillen, and S. Ehrt.2007. In vivo gene silencing identifies the Mycobacterium tuberculosis protea-some as essential for the bacteria to persist in mice. Nat. Med. 13:1515–1520.

20. Geissendorfer, M., and W. Hillen. 1990. Regulated expression of heterolo-gous genes in Bacillus subtilis using the Tn10 encoded tet regulatory ele-ments. Appl. Microbiol. Biotechnol. 33:657–663.

21. Gertz, S., S. Engelmann, R. Schmid, K. Ohlsen, J. Hacker, and M. Hecker.1999. Regulation of sigmaB-dependent transcription of sigB and asp23 in twodifferent Staphylococcus aureus strains. Mol. Gen. Genet. 261:558–566.

22. Giese, B., S. Dittmann, K. Paprotka, K. Levin, A. Weltrowski, D. Biehler,T. T. Lam, B. Sinha, and M. J. Fraunholz. 2009. Staphylococcal alpha-toxinis not sufficient to mediate escape from phagolysosomes in upper-airwayepithelial cells. Infect. Immun. 77:3611–3625.

23. Gotz, F., and B. Schumacher. 1987. Improvements of protoplast transfor-mation in Staphylococcus carnosus. FEMS Microbiol. Lett. 40:285–288.

24. Grundling, A., and O. Schneewind. 2007. Genes required for glycolipidsynthesis and lipoteichoic acid anchoring in Staphylococcus aureus. J. Bacte-riol. 189:2521–2530.

25. Guo, X. V., M. Monteleone, M. Klotzsche, A. Kamionka, W. Hillen, M.Braunstein, S. Ehrt, and D. Schnappinger. 2007. Silencing Mycobacteriumsmegmatis by using tetracycline repressors. J. Bacteriol. 189:4614–4623.

26. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

27. Herbert, S., A. Bera, C. Nerz, D. Kraus, A. Peschel, C. Goerke, M. Meehl, A.Cheung, and F. Gotz. 2007. Molecular basis of resistance to muramidase andcationic antimicrobial peptide activity of lysozyme in staphylococci. PLoSPathog. 3:e102.

28. Hussain, M., K. Becker, C. von Eiff, J. Schrenzel, G. Peters, and M. Her-rmann. 2001. Identification and characterization of a novel 38.5-kilodaltoncell surface protein of Staphylococcus aureus with extended-spectrum bindingactivity for extracellular matrix and plasma proteins. J. Bacteriol. 183:6778–6786.

29. Iordanescu, S., and M. Surdeanu. 1976. Two restriction and modificationsystems in Staphylococcus aureus NCTC8325. J. Gen. Microbiol. 96:277–281.

30. Iordanescu, S., M. Surdeanu, P. Della Latta, and R. Novick. 1978. Incom-patibility and molecular relationships between small staphylococcal plasmidscarrying the same resistance marker. Plasmid 1:468–479.

31. Jana, M., T. T. Luong, H. Komatsuzawa, M. Shigeta, and C. Y. Lee. 2000. Amethod for demonstrating gene essentiality in Staphylococcus aureus. Plas-mid 44:100–104.

32. Ji, Y., A. Marra, M. Rosenberg, and G. Woodnutt. 1999. Regulated antisenseRNA eliminates alpha-toxin virulence in Staphylococcus aureus infection. J.Bacteriol. 181:6585–6590.

33. Ji, Y., D. Yin, B. Fox, D. J. Holmes, D. Payne, and M. Rosenberg. 2004.Validation of antibacterial mechanism of action using regulated antisenseRNA expression in Staphylococcus aureus. FEMS Microbiol. Lett. 231:177–184.

34. Ji, Y., B. Zhang, S. F. Van Horn, P. Warren, G. Woodnutt, M. K. Burnham,and M. Rosenberg. 2001. Identification of critical staphylococcal genes usingconditional phenotypes generated by antisense RNA. Science 293:2266–2269.

35. Kamionka, A., R. Bertram, and W. Hillen. 2005. Tetracycline-dependentconditional gene knockout in Bacillus subtilis. Appl. Environ. Microbiol.71:728–733.

36. Kamionka, A., M. Majewski, K. Roth, R. Bertram, C. Kraft, and W. Hillen.2006. Induction of single chain tetracycline repressor requires the binding oftwo inducers. Nucleic Acids Res. 34:3834–3841.

37. Klotzsche, M., S. Ehrt, and D. Schnappinger. 2009. Improved tetracyclinerepressors for gene silencing in mycobacteria. Nucleic Acids Res. 37:1778–1788.

38. Kraus, A., C. Hueck, D. Gartner, and W. Hillen. 1994. Catabolite repressionof the Bacillus subtilis xyl operon involves a cis element functional in thecontext of an unrelated sequence, and glucose exerts additional xylR-depen-dent repression. J. Bacteriol. 176:1738–1745.

39. Lee, C. Y., S. L. Buranen, and Z. H. Ye. 1991. Construction of single-copyintegration vectors for Staphylococcus aureus. Gene 103:101–105.

40. Leibig, M., B. Krismer, M. Kolb, A. Friede, F. Gotz, and R. Bertram. 2008.Marker removal in staphylococci via Cre recombinase and different lox sites.Appl. Environ. Microbiol. 74:1316–1323.

41. Levy, S. B., and B. Marshall. 2004. Antibacterial resistance worldwide:causes, challenges and responses. Nat. Med. 10:S122–S129.

42. Lowe, A. M., D. T. Beattie, and R. L. Deresiewicz. 1998. Identification ofnovel staphylococcal virulence genes by in vivo expression technology. Mol.Microbiol. 27:967–976.

43. Luong, T. T., and C. Y. Lee. 2007. Improved single-copy integration vectorsfor Staphylococcus aureus. J. Microbiol. Methods 70:186–190.

44. Lutz, R., and H. Bujard. 1997. Independent and tight regulation of tran-scriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 25:1203–1210.

45. Majumdar, D., Y. J. Avissar, and J. H. Wyche. 1991. Simultaneous and rapidisolation of bacterial and eukaryotic DNA and RNA: a new approach forisolating DNA. Biotechniques 11:94–101.

46. Makhlin, J., T. Kofman, I. Borovok, C. Kohler, S. Engelmann, G. Cohen, andY. Aharonowitz. 2007. Staphylococcus aureus ArcR controls expression of thearginine deiminase operon. J. Bacteriol. 189:5976–5986.

47. Novick, R. P. 1991. Genetic systems in staphylococci. Methods Enzymol.204:587–636.

48. Resch, M., H. Striegl, E. M. Henssler, M. Sevvana, C. Egerer-Sieber, E.Schiltz, W. Hillen, and Y. A. Muller. 2008. A protein functional leap: how asingle mutation reverses the function of the transcription regulator TetR.Nucleic Acids Res. 36:4390–4401.

49. Rohrer, S., K. Ehlert, M. Tschierske, H. Labischinski, and B. Berger-Bachi.1999. The essential Staphylococcus aureus gene fmhB is involved in the firststep of peptidoglycan pentaglycine interpeptide formation. Proc. Natl. Acad.Sci. U. S. A. 96:9351–9356.

50. Schleifer, K.-H., and U. Fischer. 1982. Description of a new species of thegenus Staphylococcus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32:153–156.

51. Scholz, O., E. M. Henssler, J. Bail, P. Schubert, J. Bogdanska-Urbaniak, S.Sopp, M. Reich, S. Wisshak, M. Kostner, R. Bertram, and W. Hillen. 2004.Activity reversal of Tet repressor caused by single amino acid exchanges.Mol. Microbiol. 53:777–789.

52. Steinmetz, M., and R. Richter. 1994. Plasmids designed to alter the antibioticresistance expressed by insertion mutations in Bacillus subtilis, through invivo recombination. Gene 142:79–83.

53. Wieland, K. P., B. Wieland, and F. Gotz. 1995. A promoter-screening plas-mid and xylose-inducible, glucose-repressible expression vectors for Staphy-lococcus carnosus. Gene 158:91–96.

54. Zhang, L., F. Fan, L. M. Palmer, M. A. Lonetto, C. Petit, L. L. Voelker, A. St.John, B. Bankosky, M. Rosenberg, and D. McDevitt. 2000. Regulated geneexpression in Staphylococcus aureus for identifying conditional lethal pheno-types and antibiotic mode of action. Gene 255:297–305.

VOL. 76, 2010 TET-ON AND TET-OFF REGULATION IN S. AUREUS 687

on October 5, 2020 by guest

http://aem.asm

.org/D

ownloaded from