Neurotrophin Receptor Activation and Expression in Human Postmortem Brain: Effect of Suicide

NHYa

Bara

MWi

Rdsdh

Ct

Kb

NTesncp(sm(sd

bNsTlrln

F

A

R

0d

eurotrophin Receptor Activation and Expression inuman Postmortem Brain: Effect of Suicide

ogesh Dwivedi, Hooriyah S. Rizavi, Hui Zhang, Amal C. Mondal, Rosalinda C. Roberts, Robert R. Conley,nd Ghanshyam N. Pandey

ackground: The physiological functions of neurotrophins occur through binding to two receptors: pan75 neurotrophin receptor (p75NTR)nd a family of tropomyosin receptor kinases (Trks A, B, and C). We recently reported that expression of neurotrophins and TrkB wereeduced in brains of suicide subjects. This study examines whether expression and activation of Trk receptors and expression of p75NTR areltered in brain of these subjects.

ethods: Expression levels of TrkA, B, C, and of p75NTR were measured by quantitative reverse transcription polymerase chain reaction andestern blot in prefrontal cortex (PFC) and hippocampus of suicide and normal control subjects. The activation of Trks was determined by

mmunoprecipitation followed by Western blotting using phosphotyrosine antibody.

esults: In hippocampus, lower mRNA levels of TrkA and TrkC were observed in suicide subjects. In the PFC, the mRNA level of TrkA wasecreased, without any change in TrkC. However, the mRNA level of p75NTR was increased in both PFC and hippocampus. Immunolabelingtudies showed similar results as observed for the mRNAs. In addition, phosphorylation of all Trks was decreased in hippocampus, but in PFC,ecreased phosphorylation was noted only for TrkA and B. Increased expression ratios of p75NTR to Trks were also observed in PFC andippocampus of suicide subjects.

onclusions: Our results suggest not only reduced functioning of Trks in brains of suicide subjects but also that increased ratios of p75NTR

o Trks indicate possible activation of pathways that are apoptotic in nature. These findings may be crucial in the pathophysiology of suicide.

ey Words: Depression, gene expression, p75NTR, postmortemrain, suicide, Trk

eurotrophins are a family of secreted proteins that in-clude brain-derived neurotrophic factor (BDNF), nervegrowth factor (NGF), neurotrophin (NT)-3, and NT-4/5.

hese neurotrophins are essential for regulating neuronal differ-ntiation in the developing brain but are also crucial for trophicupport, maintenance of differentiated neuronal phenotypes,eurogenesis, synaptic formation, and regulation of synapticonnections in adult neurons as well as in activity-dependentlasticity, which is a defining feature of the brain throughout life1–6). Neurotrophins are unique in using two classes of cellurface receptors to exert their biological actions: 1) the tropo-ysin receptor kinase (Trk) and 2) pan75 neurotrophin receptor

p75NTR), a member of the tumor necrosis factor �-receptoruperfamily (7). The dual receptor system accounts for theiverse effects exerted by neurotrophins.

There are several subtypes of Trks, which are characterizedy a specific affinity for the different neurotrophins. For example,GF binds preferentially to TrkA, whereas BDNF and NT-4/5how high affinity for TrkB. NT-3, on the other hand, binds torkC with high affinity but can also bind to TrkA and TrkB with

ower affinity (8,9). Structurally, the extracellular domain of Trkeceptors consists of a cysteine-rich cluster, followed by threeeucine-rich repeats, another cysteine-rich cluster and two immu-oglobulin-like domains, involved in ligand binding. The cyto-

rom the Psychiatric Institute (YD, HSR, HZ, ACM, GNP), Department ofPsychiatry, University of Illinois at Chicago; Department of Psychiatry(RCR), University of Alabama at Birmingham; Maryland Psychiatric Re-search Center (RRC), Baltimore, Maryland.

ddress reprint requests to Yogesh Dwivedi, Ph.D., Psychiatric Institute,Department of Psychiatry, University of Illinois at Chicago, 1601 WestTaylor Street, Chicago, IL 60612; E-mail: [email protected].

eceived April 1, 2008; revised July 31, 2008; accepted August 25, 2008.

006-3223/09/$36.00oi:10.1016/j.biopsych.2008.08.035

plasmic domain consists of a tyrosine kinase domain surroundedby several tyrosines. Ligand binding to Trk receptors causes theirdimerization and results in receptor autophosphorylation ofkinases present in the cytoplasmic domain. After it is phosphor-ylated, Trk receptors become scaffolding structures that recruitadaptor proteins that couple the receptor to downstream signal-ing pathways, resulting in alterations in gene expression andneuronal functioning (10). Tyrosine kinase activity is thus essen-tial for the vast majority of Trk receptor-mediated responses toneurotrophins (1,11,12). Both Trk receptors and p75NTR arehighly expressed in human cortical and hippocampal brainareas (13–16).

p75NTR, initially discovered as a low-affinity receptor for NGF,is now known as a class of receptor that can bind to allneurotrophins with equivalent nanomolar affinities (17). The 3.8kb mRNA for p75NTR encodes a 427 amino acid protein contain-ing a 28 amino acid single peptide, a single transmembranedomain, and a 55 amino acid cytoplasmic domain (18). Althoughp75NTR receptors do not contain a catalytic motif, they interactwith several proteins, including Trk receptors, which causesenhancement of ligand specificity and ligand affinities for Trkreceptors (19–21).

Several studies suggest that BDNF may be involved in stressand depressive behavior (22–27), and that the beneficial effectsof antidepressants are associated with an upregulation of BDNFexpression (28–30). In a previous study, we reported thatexpression of BDNF is lower in postmortem brains of suicidesubjects (31), which was associated with decreased expression ofits cognate receptor TrkB (31). In addition, we recently reportedaltered expression of NGF, NT-3, and NT-4/5 in suicide subjectsin a brain region–specific manner (32). The role of neurotrophinsin suicide is further substantiated by other investigators whoshowed altered levels of neurotrophins in suicide brains or inperipheral tissues of suicidal patients (33–35).

Because the physiologic functions of neurotrophins require
binding to Trk receptors and their successive phosphorylation,
BIOL PSYCHIATRY 2009;65:319–328© 2009 Society of Biological Psychiatry

mailto:[email protected]

epiiietom

M

S

tuotpcsnatepd(daI

D

s(wn

kwt

T

P

E

I

ceptondica

320 BIOL PSYCHIATRY 2009;65:319–328 Y. Dwivedi et al.

w

xamining the expression and functional activation of neurotro-hin receptors is an important step in understanding the signif-

cance of the role of neurotrophins in a disease state. Therefore,n this investigation, we examined activation of Trks A, B, and Cn the postmortem brains of suicide subjects. In addition, wexamined the expression levels of TrkA, TrkC, and p75NTR inhese brain areas. Our study provides further insight into the rolef neurotrophins and their receptors in the pathophysiologicechanisms of suicide.

ethods and Materials

ubjectsBrain tissues were obtained from the Maryland Brain Collec-

ion at the Maryland Psychiatric Research Center, Baltimore. Wesed the same brain samples in which we had studied expressionf neurotrophins and TrkB (31,32). The study was performed inhe prefrontal cortex (PFC; Brodmann’s area 9) and hippocam-us obtained from suicide subjects (n � 28) and nonpsychiatricontrol subjects (n � 21), hereafter referred to as normal controlubjects. The demographic characteristics of suicide subjects andormal control subjects are provided in Table 1 in Supplement 1,nd dissection of the brains are described in our earlier publica-ions (31,32). Toxicology and presence of antidepressants werexamined by analysis of urine or blood samples (or both). BrainH was measured in cerebellum (36). All the subjects wereiagnosed on the basis of the Diagnostic Evaluation After Death37) and the Structured Clinical Interview for the DSM-IV (38), asetailed in our earlier publications (31,32,39,40). This study waspproved by the Institutional Review Board of the University ofllinois at Chicago.

etermination of mRNA Levels of TrkA, TrkC, and p75NTR

Total RNA was isolated by CsCl2 ultracentrifugation as de-cribed earlier (39,40). Samples showing an absorbance ratio260/280) � 1.8 and exhibiting strong 28S and 18S rRNA bandsere used. In addition, all the samples showed RNA integrityumber � 7, which is an excellent value for mRNA studies.

The mRNA levels of TrkA, TrkC, p75NTR, and of the house-eeping genes neuron-specific enolase (NSE) and cyclophilinere determined using competitive RT-polymerase chain reac-

able 1. External and Internal Primer Sequences of Trks and p75NTR for Am

rimer Primer Sequence

xternal F: 5=GTGGAGAAGAAGGACGAA ACACTrkA R: 5=GTATTGTGGGTTCTCGATGATGTrkC F: 5=TACAAGCTTTAACCGGCTCACCACACT CTC

R: 5=TACGAATTCCCACCACGT TCTCTGCAA TGCp75NTR F: 5=CTGCAAGCAGAACAAGCAAGGAGC

R: 5=AGGCCTCATGGGTAAAGGAGTNSE F: 5=GGGACTGAGAA CAAATCCAAG

R: 5=CTCCAAGGCTTCACTGTTCTCCyclophilin F: 5=AGCACTGGAGAGA AAGGATTTG

R: 5=CCTCCACAAT ATTCATGCCTTCnternal

TrkA F: 5=TGGGATCAACCTCGAGGCTGTGC TGGTrkC F: 5=GTGTGACCTTCTCGAGATCAGCGTGp75NTR F: 5=ACGCAGACAGCCTCGAGCCAGGCCCTNSE 5=GGCAACAAGCTC GAGATGCAGGAGTTCCyclophilin F:5=GGTGGCAAGTCCATCTAT/AAATGCTGGACCCA

F, forward; NSE, neuron-specific enolase; p75NTR, pan75 neurotrophin reBold and italicized letters indicate the mutated bases. Underline bases i

ion (PCR) as described earlier (39,40). The sequences of external

ww.sobp.org/journal

and internal primers are given in Table 1. Decreasing concentra-tions of TrkA (1.5–.05 pg for PFC and 6.25–.19 pg for hippocam-pus), TrkC (200–12.5 pg), or p75NTR (12–.75 pg for PFC and6.25–.39 pg for hippocampus) internal standard cRNAs and 1.5�Ci [32P]dCTP were added to 1 �g of total RNA. The PCR mixturewas amplified for 28 cycles. Following amplification, aliquotswere digested with Xho I in triplicate and run by 1.5% agarose gelelectrophoresis. The results are expressed as attomoles/�g oftotal RNA.

Preparation of Samples for Immunoprecipitation andWestern Blot

Proteins from PFC or hippocampal tissues were extractedusing radio immunoprecipitation assay buffer (20 mmol/mLTris-HCL [pH 8], 150 mmol/mL NaCl, 1 mmol/mL ethylenedia-mine tetraacetate, 50 mmol/mL NaF, 1 mmol/mL Na2MoO4, .5mmol/mL Na3VO4, 5 mmol/mL Na2P2O7, 1% Triton X-100, 0.5%Na deoxycholate, .1% sodium dodecyl sulfate, 10% glycerol, 10�g/ml leupeptin, 10 �g/ml aprotinin, 0.01 mmol/mL phenylm-ethyl sulfonyl fluoride (PMSF), 1 mg/mL pepstatin A, and 10mmol/mL benzamidine]. S1 fraction was prepared by centrifugationat 1000 rpm for 10 min at 4°C. Protein content was determined bythe Bradford method (Bio-Rad, Hercules, California).

Immunoprecipitation of TrkA, TrkB, and TrkC andImmunolabeling with Phosphotyrosine

Supernatant containing 100 �g protein was incubated withantibodies against TrkA, TrkB, or TrkC (100:1 dilution; SantaCruz Biotechnology, Santa Cruz, California) for 2 hours at 0°C.The samples were added to a suspension of protein-A sepharosebeads (Amersham, Piscataway, New Jersey) in Tris-bufferedsaline (TBS) and incubated at 4°C for 1 hour. The pellet wascollected by centrifugation at 2500 rpm for 30 sec at 4°C andwashed four times with TBS containing .5 mmol/mL Na3VO4 and.01 mmol/mL PMSF. The pellet was resuspended in 15 mL of 2Xsample buffer, boiled for 5 min, and subjected to 10% sodiumdodecyl sulfate-polyacrylamide gel electrophoresis as describedearlier (39). The blots were incubated overnight at 4°C withantimouse phosphotyrosine (1 �g/mL, Chemicon International,Temecula, California), followed by horseradish-peroxidase-

ation

GenBank Accession No. Nucleotide Position (bp)

NM_002529 1222–12431467–1488

S_76475 408–428851–871

NM_002507 831–8541121–1141

NM_001975 295–315655–675

XM_371409 118–139400–421

1344–1369618–642961–990478–504

C 220–237/303–320

r; R, reverse; Trk, tropomyosin receptor kinases.te the Xho I cleavage site.

plific

ACA

linked secondary antimouse immunoglobulin (Ig)-G (.3 �g/mL;

BaS

I

wbfFs(fahso�iilTpp

S

(jttmdthoCwafcovw

strmrmespd

R

pds

Y. Dwivedi et al. BIOL PSYCHIATRY 2009;65:319–328 321

io-Rad) for 5 hours at room temperature. The bands on theutoradiograms were quantified using the Loats Image Analysisystem (Westminister, Maryland).

mmunolabeling of TrkA, TrkC, and p75NTR

Equal volumes (20 �L) of samples containing 60 �g of proteinere electrophoresed on 10% (w/v) polyacrylamide gel. Thelots were incubated overnight at 4°C with primary antibodiesor TrkA (1:650), TrkC (1:1000), or p75NTR (1:200, NeoMarkers,remont, California) followed by horseradish-peroxidase-linkedecondary antigoat IgG (TrkA, 1:1000 dilution), antirabbit IgGTrkC, 1:5000 dilution) or antimouse IgG (p75NTR, 1:800 dilution)or 5 hours at room temperature. The membranes were strippednd reprobed with �-actin monoclonal primary (1:5000 for 1our, Sigma Chemical Co., St. Louis, Missouri) and antimouseecondary antibody (1:5000 for 1 hour). The optical density (OD)f each protein was corrected by the OD of the corresponding-actin band. The antibody for p75NTR has been well character-

zed in human brain for Western blotting (41–43). We character-zed TrkA and TrkC antibodies using positive controls (H4 cellysate, SK-N-SH cell lysate for TrkA; EOC20 whole cell lysate forrkC). Also, the specificity for TrkA and TrkC was confirmed byreincubating the antibodies with the corresponding antigeniceptides (100-fold excess; Santa Cruz Biotechnology).

tatistical AnalysisData analyses were performed using the SPSS version 15

Chicago, Illinois). All the dependent variables were first sub-ected to tests of normality. The assumption of normality wasested using the Shapiro-Wilk test. To adjust for multiplicity ofesting based on multiple endpoints (i.e., dependent variables), aultiple analysis of covariance (MANCOVA) was applied to theata for each brain area. Age, sex, brain pH, race, and postmor-em interval (PMI) were used as covariates. The assumption ofomogeneity of variance was tested using Box’s test of equalityf covariance matrices. In the presence of a significant MAN-OVA for a given brain area, analyses of covariance (ANCOVAs)ere performed for each dependent variable. For the two-groupnalysis (normal control vs. suicide subjects) MANCOVA wasollowed by ANCOVA. For the three-group analysis (normalontrol subjects, depressed suicide subjects, suicide subjects withther psychiatric disorders), if the ANCOVA for that dependentariable was significant, pairwise between-group comparisonsere performed for each dependant variable.The differences in age, sex, brain pH, and PMI between

uicide subjects and normal control subjects were analyzed usinghe independent-sample t test. The relationships between Trkeceptor activation and their respective mRNA and protein levels;RNA and protein levels of p75NTR; and measures of Trk

eceptors and p75NTR with PMI, age, and brain pH were deter-ined by Pearson Product-Moment correlation analyses. The

ffects of sex and comparison between depressed subjects whohowed antidepressant toxicity at the time of death with de-ressed subjects who did not were determined by an indepen-ent sample t test.

esults

There were no significant differences in age (t � .63, df � 47,� .53), PMI (t � .11, df � 47, p � .91), or brain pH (t � 1.00,f � 47, p � .32) between suicide subjects and normal control
ubjects (Table 1 in Supplement 1).
Overall Analysis of DataAll dependent variables in the two brain areas were first

subjected to tests of normality using the Shapiro-Wilk test. Wefound nonsignificant p values (� .05) for tests of normality forall dependent variables in PFC and hippocampus of bothnormal control and suicide groups, which indicated that wecannot reject the null hypothesis that the data are normallydistributed. We used Box’s test of equality of covariancematrices to test the assumption of between-group equality. Nosignificant between-group differences were found for covari-ance matrices in PFC (p � .25) or hippocampus (p � .38). Theoverall MANCOVA for all 11 dependent variables adjusted forcovariates was significant for PFC (F � 17.84, df � 11,32, p � .001)and hippocampus (F � 40.96, df � 11,30, p � .001) when thenormal control group was compared with the suicide group. In thefollowing sections, we describe the results of the individual ANCO-VAs for each dependent variable for PFC and hippocampus. Also,the percent change in various measures of Trks and p75NTR aresummarized in Table 2 in Supplement 1.

mRNA Levels of TrkA, TrkC, and p75NTR

Representative gel electrophoreses of the competitive RT-PCRfor TrkA, TrkC, and p75NTR mRNA in the PFC from one controlsubject are given in Figures 1A–1C, respectively. We found theamplification product arising from the TrkA, TrkC, and p75NTR

mRNA template at 267, 464, and 311 bp respectively, and thecorresponding digestion products from the cRNA at 135�132,223�241, and 144�167 bp respectively. Competitive PCR anal-yses are presented in Figures 1D–1F, where the points ofequivalence represent the absolute amounts of TrkA, TrkC, andp75NTR mRNA present. The absolute amounts (attomoles/�gtotal RNA) of Trk receptor and p75NTR mRNAs in PFC andhippocampus of normal control subjects were as follows: PFC:TrkA, 2.5 � .6; TrkC, 73.17 � 12.7; p75NTR, 12.3 � 2.4;hippocampus: TrkA, 5.1 � .9; TrkC, 98.3 � 20.9; p75NTR, 4.4 �1.4. As can be seen in Figure 2, the expression of TrkC washighest compared with that of TrkA and p75NTR in both PFC andhippocampus. The expression levels of both TrkA and TrkC weregreater in hippocampus than PFC. In contrast, the expression ofp75NTR was greater in PFC than hippocampus.

When compared between normal control subjects and suicidesubjects, the mRNA expression of TrkA was significantly de-creased in PFC of suicide subjects without any change in mRNAlevel of TrkC. However, mRNA levels of TrkA and TrkC weresignificantly lower in hippocampus of suicide subjects. In con-trast, the mRNA level of p75NTR was significantly increased inboth PFC and hippocampus of suicide subjects compared withnormal control subjects (Figure 2).

We used NSE and cyclophilin as housekeeping genes. Asreported previously (31,32,39), we did not find a significantdifference in mRNA levels (attomoles/�g total RNA) of cyclophi-lin between normal control subjects and suicide subjects, eitherin PFC (control subjects: 776.6 � 112.5, suicide: 801.5 � 117.34;df � 1,42, F � .3, p � .57) or in hippocampus (control subjects:783.5 � 110.1, suicide: 768.3 � 102.8; df � 1,40, F � .001, p �.98). Similarly, no significant differences were observed in mRNAlevels of NSE in PFC (control subjects: 360.2 � 47.7, suicide:344.0 � 43.9; df � 1,42, F � .7, p � .39) or hippocampus (controlsubjects: 349.8 � 38.2, suicide: 345.9 � 81.4; df � 1,40, F � .2,p � .62) between normal control subjects and suicide subjects. Wefound similar results when the changes in mRNA levels of TrkA,
TrkC, and p75NTR were calculated as ratios to cyclophilin or NSE.
www.sobp.org/journal

P

k�Ti(ApitPwtic

F(cmhts amplit espec


w

rotein Levels of TrkA, TrkC, and p75NTR

Western blot revealed that TrkA and TrkC migrated to 140Da, whereas p75NTR migrated to 75 kDa (Figures 3A and 3B).-actin was used as a housekeeping protein, and ratios of TrkA,rkC, and p75NTR versus �-actin were calculated. Immunolabel-ng of �-actin was not significantly different in suicide subjects1.3 � .3 AU) compared with normal control subjects (1.2 � .3U). Bar diagrams showing ratios of protein levels of neurotro-hin receptors and �-actin in PFC and hippocampus are shown

n Figures 3C and 3D, respectively. Comparison analysis revealedhat immunolabeling of TrkA was significantly decreased in bothFC and hippocampus of suicide subjects. Protein levels of TrkCere significantly decreased in hippocampus but not changed in

he PFC of suicide subjects. In contrast, the levels of p75NTR werencreased in both PFC and hippocampus of suicide subjects

igure 1. Representative gel electrophoreses showing competitive polymA), TrkC (B), or pan75 neurotrophin receptor (p75NTR) (C) mRNA contents ioncentrations of internal standard cRNA (TrkA, 1.5–.05 pg; TrkC, 200 –12.5ixtures were reverse transcribed and PCR-amplified in the presence of trac

igher molecular size band corresponds to the amplification product arisihe internal standard. Data derived from the agarose gel are plotted as thtandard divided by the counts incorporated into the corresponding mRNAo the test sample. The point of equivalence represents the amount of the r

ompared with normal control subjects.

ww.sobp.org/journal

Correlations Between mRNA and Protein Levels of TrkA, TrkC,and p75NTR

To examine whether the altered protein levels of neurotro-phin receptors were associated with their respective mRNAs, weexamined the correlations between the mRNA and the proteinlevels of the neurotrophic receptors in the combined normalcontrol and suicide groups. We observed significant correlationsbetween mRNA and protein levels of TrkA in PFC (r � .39, p �.006) and hippocampus (r � .42, p � .003). Significant correla-tions were also observed between mRNA and protein levels ofTrkC in hippocampus (r � .52, p � .001), and of p75NTR in bothPFC (r � .42, p � .002), and hippocampus (r � .47, p � .001).

TrkA, TrkB, and TrkC PhosphorylationPhosphorylation states of Trks were determined by immuno-

change reaction (PCR) analysis for tropomyosin receptor kinases (Trk) Afrontal cortex (PFC) obtained from one normal control subject. Decreasing5NTR, 12–.75 pg) were added to a constant amount (1 �g) of total RNA. The

ounts of [32P]dCTP; aliquots were electrophoresed on 1.5% agarose gel. Them the mRNA, whereas the lower bands arise from cRNA generated from

nts incorporated into the amplified TrkA (D), TrkC (E), or p75NTR (F) cRNAfication product versus the known amount of internal standard cRNA addedtive mRNA.

erasen prepg; p7e amng froe cou

precipitation with specific antibodies followed by immunoblot-

ttFaslso

RP

awpdpTpeT

EA

abSop

E

plpbtT

FpptsswpF7


ing with phosphotyrosine antibody. Autoradiograms showinghe phosphorylation in PFC and hippocampus are given inigures 4A and 4B and diagrammatically presented in Figures 4Cnd 4D, respectively. MANCOVA followed by ANCOVA testshowed that there were significant decreases in the phosphory-ation of TrkA and TrkB in both PFC and hippocampus of suicideubjects, whereas the phosphorylation of TrkC was decreasednly in hippocampus without any change in PFC.

atios of p75NTR Versus mRNA and Protein Levels andhosphorylation of TrkA, TrkB, and TrkC

To examine whether there is an imbalance in the expressionnd activation of TrkA, B, and C in relation to p75NTR expression,e determined the mRNA and protein expression ratios of75NTR versus TrkA, TrkB, and TrkC. In addition, we alsoetermined the ratios of protein expression of p75NTR versushosphorylation levels of TrkA, TrkB, and TrkC. As shown inable 2, we observed significant increase in expression ratios of75NTR versus TrkA, B, and C. Similarly, ratios of proteinxpression of p75NTR versus phosphorylation of TrkA, TrkB, andrkC were also increased.

ffects of Age, PMI, pH, Means of Death, andntidepressant Toxicology

We found no significant effects of age, PMI, or brain pH onny of the measures in which we found significant differencesetween normal control subjects and suicide subjects (Table 3 inupplement 1). We also did not find significant effects of meansf suicide (violent versus nonviolent) or the presence of antide-ressant toxicology at the time of death on various measures.

ffects of Major DepressionWe next examined whether the differences in the mRNA and

rotein levels of neurotrophin receptors and in the phosphory-ation states of Trk receptors were related to depression or wereresent in all suicide subjects. ANCOVA followed by pairwiseetween-group comparisons revealed that the mRNA and pro-ein levels of TrkA, TrkC, and p75NTR, as well as the activation of

igure 2. mRNA levels tropomyosin receptor kinases (Trk) A, TrkC, andan75 neurotrophin receptor (p75NTR) in prefrontal cortex (PFC) and hip-ocampus (Hipp) of suicide subjects and normal control subjects. Data are

he mean � SD. PFC samples were from 21 normal control subjects and 28uicide subjects; hippocampus samples were from 21 normal control and 26uicide subjects. Overall analysis of covariance in PFC and hippocampusere as follows: PFC: TrkA, df � 1,40, F � 37, p � .001; TrkC, df � 1,42, F � .5,� .47; p75NTR (df � 1,42, F � 33.6, p � .001); hippocampus: TrkA, df � 1,40,� 37, p � .001; TrkC, df � 1,40, F � 52.1, p � .001; p75NTR, df � 1,40, F �2.4, p � .001). * p � .001.

rkA, TrkB, and TrkC, were not different between suicide

subjects with major depression (n � 12) and suicide subjectswith other psychiatric disorders (n � 16) in either PFC (Table 3)and hippocampus (Table 4). However, the groups of suicidesubjects with major depression and of suicide subjects with otherpsychiatric disorders both showed significant differences in thesemeasures in both PFC (Table 3) and hippocampus (Table 4)when compared separately with normal control subjects.

Discussion

In this study, we found reduced expression of TrkA and C andincreased expression of p75NTR in hippocampus and reducedexpression of TrkA and increased expression of p75NTR in PFC ofsuicide subjects. Decreased phosphorylation of TrkA and B inPFC and TrkA, B, and C in hippocampus was also noted. Thisstudy provides evidence for the first time not only that Trkreceptors are less expressed but also that their activation iscompromised in postmortem brains of suicide subjects. In ourearlier studies, we found that expression levels of neurotrophins,that is, BDNF, NGF, NT-3, and NT4/5, as well as TrkB, weredecreased in the postmortem brains of suicide subjects (31,32).Our previous studies together with the results reported hereclearly demonstrate that there is an overall decrease in expres-sion and functioning of neurotrophins in the brains of suicidesubjects.

Figure 3. Western blots showing the immunolabeling of tropomyosin re-ceptor kinases (Trk) A, TrkC, pan75 neurotrophin receptor (p75NTR), and�-actin in prefrontal cortex (PFC) (A) and hippocampus (B) of three normalcontrol and three suicide subjects and the mean � SD of immunolabeling ofTrkA, TrkC, or p75NTR in PFC (C) and hippocampus (D) from normal controland suicide subjects. Protein samples were subjected to 10% polyacryl-amide gel electrophoresis and transferred to enhanced chemilumines-cence-nitrocellulose membranes, which were then incubated with primaryantibody specific for TrkA, TrkC, p75NTR, or �-actin and corresponding sec-ondary antibody. The bands were quantified as described in Methods andMaterials. Ratios of the optical density of TrkA, TrkC, or p75NTR to that of�-actin were calculated. PFC samples were from 21 normal control and 28suicide subjects; hippocampus samples were from 21 normal control and 26suicide subjects. Suicide group was compared with control group. Overallanalysis of covariance: PFC: TrkA, df � 1,42, F � 20.1, p � .001; TrkC, df �1,42, F � .001, p � .98; p75NTR, df � 1,42, F � 18.9, p � .001; hippocampus:TrkA, df � 1,40, F � 21.7, p � .001; TrkC, df � 1,40, F � 40.3, p � .001;
p75NTR, df � 1,40, F � 13.9, p � .001. *p � .001, ** p � .001.

nstrfrfTIitetacfrlAnon

appan

FTnpndTPhaF1�


w

Our study also indicates that the levels of the receptors foreurotrophins are regulated at the level of transcription, becauseignificant correlations between mRNA and protein levels ofhese receptors were noted. Promoter sequences for all neurot-ophin receptors have been identified, and multiple transcriptionactors are implicated in the regulation of the expression of theseeceptors (44,45). For example, many putative transcriptionactor binding sites within the 5= flanking region of the humanrkA gene have been identified. These include Sp1 and AP-1.nterestingly, the AP-1 site is bound by c-Jun homodimers, whichs blocked by methylation. In many cell lines, it has been shownhat activation of Trk A expression is caused by direct interfer-nce with c-Jun binding to the negative AP-1-like sequence andhat the AP-1 binding site plays a crucial epigenetic role inctivating TrkA expression. In addition, the 138-bp region lo-ated upstream of the transcription initiation site is also crucialor the human TrkA gene. However, p75NTR transcription isegulated by transcription factor Egr-1. The TrkC gene is regu-ated by transcription factors AP-1, AP-2, GC, ATF, and Brn2,ML1, and Nkx2.5. Whether these transcription factors or epige-etic regulation (or both) are involved in the altered expressionf neurotrophin receptor genes in the brains of suicide subjectseeds to be studied.

Functionally, in contrast to Trk receptors, which containutophosphorylation sites and are involved in cell survival,75NTR lacks intrinsic enzymatic activity and can transmit bothositive and negative signals (46). It has been shown that p75NTR

cts as a positive regulator of TrkA activity in a number of

igure 4. Activation of tropomyosin receptor kinases (Trk) (A), TrkB, andrkC in prefrontal cortex (PFC) and hippocampus of suicide subjects andormal control subjects. Autoradiograms showing immunolabeling ofhosphotyrosine in PFC (A) and hippocampus (B) determined after immu-oprecipitation using TrkA, TrkB, or TrkC antibody. Mean � SD of the opticalensity of bands of phosphotyrosine depicting activation of TrkA, TrkB, orrkC in PFC (C) and hippocampus (D) of suicide and normal control subjects.FC samples were from 21 normal control and 28 suicide subjects andippocampus were from 21 normal control and 26 suicide subjects. Overallnalysis of covariance: PFC: TrkA, df � 1,42, F � 26.5, p � .001; TrkB: df � 1,42,� 38.5, p � .001; TrkC, df � 1,42, F � .03, p � .86; hippocampus: TrkA, df �,40, F � 33.7, p � .001; TrkB, df � 1,40, F � 28.2, p � .001; TrkC, df � 1,40, F

27.7, p � .001. * p � .001. Ab, antibody; IP, immunoprecipitation.

euronal cell lines (20,47–49). Coexpression of p75NTR and TrkA

ww.sobp.org/journal

receptors increases TrkA high-affinity binding sites for NGF(19,50) and NGF-mediated TrkA activation (47,49,50). Ligandbinding to p75NTR can potentiate TrkA autophosphorylation at asubsaturating concentration of NGF; this depends on the relativelevels of p75NTR and TrkA (47,50,51). Also, in the presence ofp75NTR, NT-3 is less effective in activating TrkA, and NT-3 andNT-4 are much less effective in activating TrkB, which thusenhances the affinity for NGF and BDNF to bind to TrkA andTrkB respectively (20,52–54). In contrast to these positive ac-tions, p75NTR can mediate neuronal apoptosis when the cognateTrk receptor is less activated or not activated. For example, inneuronal cell lines, expression of p75NTR in the absence of TrkA

Table 2. Ratios of p75NTR/Trks in PFC and Hippocampus of NormalControl and Suicide Subjects

Group Mean SD

PFCmRNA

TrkA Control 5.18 1.62Suicide 9.84 2.74b

TrkB Control .02 .008Suicide .05 .013b

TrkC Control .17 .04Suicide .25 .05b

ImmunolabelingTrkA Control 1.03 .31

Suicide 1.95 .59b

TrkB Control 1.05 .36Suicide 2.12 .47b

TrkC Control 1.03 .25Suicide 1.42 .40b

PhosphorylationTrkA Control 1.04 .31

Suicide 2.02 .69b


TrkC Control 1.07 .42Suicide 1.38 .43a

HippocampusmRNA

TrkA Control .91 .35Suicide 2.55 .74b

TrkB Control .002 .001Suicide .007 .002b

TrkC Control .05 .02Suicide .14 .04b

ImmunolabelingTrkA Control 1.05 .37

Suicide 1.93 .60b



PhosphorylationTrkA Control 1.05 .34

Suicide 2.00 .51b



p75NTR, pan75 neurotrophin receptor; PFC, prefrontal cortex; Trk, tropo-myosin receptor kinases.

ap � .013.
bp � .0010.

rdnc

T

V

P

m

I

wop

p

T

V

P

m

I

dla

p


eceptors induces cell death (55). Similarly, p75NTR can causeeveloping hippocampal neuronal death induced by any of theeurotrophins in the absence of a Trk receptor (56–58). Inontrast, mice lacking p75NTR show an increased number of

able 3. Effect of Major Depression on Neurotrophin Receptors in PFC of S

ariable

Suicide Subjects (n

Normal ControlSubjects(n � 21)

1

With a History ofMDD (n � 12)

2

WiOth

Mean SD Mean SD Me

hosphorylationa

TrkA 100 20 69 19 72TrkB 100 21 65 15 77TrkC 100 25 107 26 98RNA Levelsb

TrkA 2.5 .5 1.6 .5 1TrkC 73.2 12.7 70.9 11.8 68P75NTR 12.3 2.4 16.9 2.4 16

mmunolabelinga

TrkA 100 18 74 19 71TrkC 100 20 97 20 98P75NTR 100 22 126 26 134

Data were analyzed using MANCOVA. Overall MANCOVA (Pillai’s Trace Teere then subjected to ANCOVA followed by pairwise between-group comf TrkA, TrkC, p75NTR, NSE, and cyclophilin; and protein levels of TrkA, TrkC, postmortem interval were used as covariates. df � 2,41.

ANCOVA, analysis of covariance; MANCOVA, multivariate analysis of covrefrontal cortex; Trk, tropomyosin receptor kinases.

aPercent of control.bAttomoles/�g total RNA.

able 4. Effect of Major Depression on Neurotrophin Receptors in Hippoca

ariable

Suicide Subjects (n

Normal ControlSubjects(n � 21)

1

With a History ofMDD (n � 10)

2

WiOth

Mean SD Mean SD Me

hosphorylationa

TrkA 100 22 60 7 7TrkB 100 21 71 19 6TrkC 100 24 72 22 6RNA Levelsb

TrkA 5.1 .9 2.9 .6TrkC 98.2 20.9 62.2 12.6 5p75NTR 4.4 1.4 7.9 1.5

mmunolabelinga

TrkA 100 19 69 18 7TrkC 100 19 71 13 6P75NTR 100 23 137 23 12

Data were analyzed using MANCOVA. Overall MANCOVA (Pillai’s Trace Tata were then subjected to ANCOVA followed by pairwise between-group

evels of TrkA, TrkC, p75NTR, NSE, and cyclophilin; and protein levels of TrkA, Tnd postmortem interval were used as covariates. df � 2,39.

ANCOVA, analysis of covariance; MANCOVA, multivariate analysis of covrefrontal cortex; Trk, tropomyosin receptor kinases.

aPercent of control.
bAttomoles/�g total RNA.
cholinergic neurons in the basal forebrain (59). In adult centralnervous system, it has been shown that excitotoxin-inducedneuronal apoptosis is accompanied by the induction of p75NTR inthe dying neurons (60), which suggests that p75NTR may repre-

Subjects

)

istory ofychiatricrders

16)Overall ANCOVA Multiple Comparison

SD F p 1 vs. 2 1 vs. 3 2 vs. 3

14 13 � .001 .001 � .001 .8917 21 � .001 � .001 � .001 .1219 .6 .55 .38 .71 .28

.6 8 .001 � .001 .02 .0814 .8 .47 .87 .27 .32

2.45 16.6 � .001 � .001 � .001 .65

22 10 � .001 .006 � .001 .6519 .3 .97 .84 .92 .7925 9.3 � .001 .005 � .001 .83

s found to be statistically significant (F � 2.73, df � 22,64, p � .001). The datans. Eleven dependent variables (activation of TrkA, TrkB, TrkC; mRNA levels) were considered during multivariate analysis. Age, sex, brain pH, race, and

e; NSE, neuron-specific enolase; p75NTR, pan75 neurotrophin receptor; PFC,

s of Suicide Subjects

istory ofychiatricrders

16)Overall ANCOVA Multiple Comparison

SD F p 1 vs. 2 1 vs. 3 2 vs. 3

14 18.8 � .001 � .001 � .001 .1116 13.7 � .001 .001 � .001 .8716 13.9 � .001 .003 � .001 .48

.9 19.7 � .001 � .001 � .001 .1913.1 25.7 � .001 � .001 � .001 .59

1.2 35.3 � .001 � .001 � .001 .81

18 10.6 � .001 .004 � .001 .8614 19.8 � .001 � .001 � .001 .6718 8.1 .001 .001 .01 .16

as found to be statistically significant (F � 3.65, df � 22, 60, p � .001). Theparisons. Eleven dependent variables (activation of TrkA, TrkB, TrkC; mRNA75NTR) were considered during multivariate analysis. Age, sex, brain pH, race,

e; NSE, neuron-specific enolase; p75NTR, pan75 neurotrophin receptor; PFC,

uicide

� 28

th a Her PsDiso(n �

3

an

.9

.2

.9

st) wapariso75NTR

arianc

mpu

�26)

th a Her PsDiso(n �

3

an

273

3.68.98.2

395

est) wcom

rkC, p

arianc


seaarssrptstdTmrapabaidap(apbscprppnsaaaqstgsao

toartdapaptttpp


w

ent a general stress-induced apoptotic mechanism (44). How-ver, it is pertinent to note that apoptotic mechanisms of p75NTR

re active only when Trk receptors are less expressed or lessctive. Moreover, ectopic expression of the appropriate Trkeceptor can convert a proapoptotic neurotrophin to a pro-urvival neurotrophin. Thus, it appears that the ratio of expres-ion levels or activation states of Trk receptors and p75NTR iselevant in neurotrophin-mediated functions. Given that manyhysiological functions are associated with Trk receptor activa-ion, including cell survival and enhancement of the efficacy ofynaptic neurotransmission, and, therefore, neural plasticity, andhe strong evidence of a role of p75NTR in the mediation of celleath, our findings of increased expression ratios of p75NTR torks appear to be of great relevance to the pathophysiology ofood disorders and suicide. The PFC plays a major role in mood

egulation and has been implicated in the pathophysiology offfective disorders and suicide (61). In contrast, the hippocam-us is involved in cognition (62) and is the primary brain areaffected by stress (63), one of the major factors in suicidalehavior (64,65). Interestingly, structural abnormalities in corticalnd hippocampal brain areas and reduced hippocampal plastic-ty have been demonstrated in affective disorder patients anduring stress (66–72). Some studies even suggest structuralbnormalities in the brains of suicide subjects (73,74). Ourreviously observed reduced expression of neurotrophins31,32) together with the present findings of reduced expressionnd activation of Trks and concomitant increased expression75NTR indicate that the possible consequences is a tipping of thealance away from cell survival, which could be associated withtructural abnormalities and reduced neuronal plasticity in sui-ide brains. In addition to the modulation of hippocampallasticity (75), Greferath et al. (76) and Hennigan et al. (77)ecently showed that p75NTR is involved in negative regulation oflasticity such that mice lacking p75NTR display intact long-termotentiation but impairment in long-term depression. It is perti-ent to mention that Saarelainen et al. (78) recently demon-trated that normal TrkB signaling is required for antidepressantction and that the phosphorylation of TrkB in response tontidepressants is greater in cortical and hippocampal brain areasfter chronic treatment, suggesting that TrkB activation is re-uired to produce the effects of antidepressants. Moreover,tress, a major risk factor of suicide (79–81), causes a decrease inhe expression of TrkA, TrkB, and TrkC in rat brain (27). A recentenetic study suggests that the S205L polymorphism, whichubstitutes serine with leucine residue, of the p75NTR gene isssociated with attempted suicide (82), revealing the crucial rolef p75NTR in suicide.

The physiologic relevance of Trk receptors is further substan-iated by the fact that Trk receptors and p75NTR cross talk to eachther at the level of the signal transduction mechanisms and theyctivate transautophosphorylation of tyrosine that leads to theecruitment of proteins containing PTB and SH2 domains. Thewo major signaling pathways activated by Trks through theseomains are Ras-Raf-extracellular signal regulated kinase (ERK)nd phosphoinositide 3-kinase (PI 3-kinase)-Akt. In addition,hospholipase C binds to activated Trk receptors and initiatesn intracellular signaling cascade that results in the activation ofrotein kinase C. In contrast, p75NTR stimulates several proapop-otic pathways, which include Jun kinase signaling, sphingolipidurnover, and association with adaptor proteins, such as neuro-rophin receptor-interacting MAGE homolog (NRAGE) and75NTR-associated cell death executor (NADE), that directly
romote cell-cycle arrest and apoptosis (83–86). Trk receptors
ww.sobp.org/journal

suppress the major proapoptotic signaling pathway, c-Jun ki-nase, initiated by p75NTR (87). In sympathetic neurons, Ras-mediated activation of PI3-kinase is required to suppress thissignaling pathway (88). Activation of Trk receptors completelysuppresses the activation by p75NTR of sphingomyelinasethrough the association of activated PI3-kinase with acidic sphin-gomyelinase (89,90). Sphingomyelinase activation results in gen-eration of ceramide, which promotes apoptosis by inactivatingERK and PI3-kinase pathways (91–93). Contrary to their pro-apoptotic action, p75NTR enhances cell survival by activatingNF-B signaling in the presence of Trk receptor activation. Thus,p75NTR acts as a switch between pro- and antiapoptotic actions inneurons. Interestingly, we have reported less-activated ERK1/2(39), B-Raf (94), and PI-3 kinase (95) in both PFC and thehippocampus of suicide subjects. These findings could be asso-ciated with less activation/expression of Trks. These findingsalso indicate suboptimal activation of prosurvival pathways.Conversely, if p75NTR is more abundantly expressed, it may leadto proapoptotic signaling. Further studies are required to deter-mine whether proapoptotic pathways are activated in brains ofsuicide subjects and how Trk- and p75NTR-mediated signaltransduction pathways interplay in the pathophysiology of sui-cide.

In this study, we observed that the changes in Trk and p75NTR

were present in all suicide subjects regardless of psychiatricdiagnosis, suggesting that these changes could be associatedwith suicide. However, one should be cautious to draw such aconclusion. One of the limitations of our study is that the studypopulation did not have subjects who had psychiatric disordersand died naturally. In addition, a majority of suicide subjects hadsome form of mental illness. As mentioned earlier in this article,several studies demonstrate alterations in expression of neuro-trophic factors and Trk receptors in mood disorders and duringstress. For example, decreased expression of neurotrophins orTrkB receptors in depressed patients as well as in animalssubjected to several types of stresses have been reported (22–27).Likewise, several genetic studies indicate a linkage of BDNF tobipolar disorder (96–98). Thus, whether the observed changes inTrks and p75NTR are specifically related to suicide or are associ-ated with mental disorders, needs to be further clarified.

This research was supported by grants from the NationalInstitute of Mental Health (NIMH) (Grant Nos. R0168777 andR21MH081099), the National Alliance for Research on Schizo-phrenia and Depression, the Marshall Reynolds Foundation, andthe American Foundation for Suicide Prevention to YD; NIMHGrant No. RO1MH48153 to GNP; and Grant Nos. MH60744 andMH66123 to RR. We thank Miljana Petkovic, Barbara Brown,and Joy K. Roche for their help in organizing the brain tissues.We also thank the members of the Maryland Brain Collection fortheir efforts, particularly in family interviews and dissection. Weare grateful for the cooperation of the Office of the Chief MedicalExaminer in Baltimore, Maryland. The authors report no bio-medical financial interests or potential conflicts of interest.

Supplementary material cited in this article is availableonline.

1. Huang EJ, Reichardt LF (2001): Neurotrophins: Roles in neuronal devel-opment and function. Annu Rev Neurosci 24:677–736.

2. Sofroniew MV, Galletly NP, Isacson O, Svendsen CN (1990): Survival ofadult basal forebrain cholinergic neurons after loss of target neurons.
Science 247:338 –342.

1

1

1

1

1

1

1

1

1

1

2

2

2

2

2

2

2

2

2

2


3. McAllister T, Saykin A, Flashman L (1999): Brain activation during work-ing memory 1 month after mild traumatic brain injury: A functional MRIstudy. Neurology 53:1300 –1308.

4. Poo M (2001): Neurotrophins as synaptic modulators. Nat Rev Neurosci2:24 –32.

5. Lessmann V, Gottmann K, Malcangio M (2003): Neurotrophin secretion:Current facts and future prospects. Prog Neurobiol 69:341–374.

6. Lu B (2003): BDNF and activity-dependent synaptic modulation. LearnMem 10:86 –98.

7. Huang EJ, Reichardt LF (2003): Trk receptors: Role in signal transduction.Annu Rev Biochem 72:609 – 642.

8. Barbacid M (1994): The trk family of neurotrophin receptors. J Neurobiol25:1386 –1403.

9. Chao MV (1994): The p75 neurotrophin receptor. J Neurobiol 25:1373–1385.

0. Reichardt LF (2006): Neurotrophin-regulated signaling pathways. PhilTrans R Soc B 361:1545–1564.

1. Bibel M, Barde YA (2000): Neurotrophins: Key regulators of cell fate andcell shape in the vertebrate nervous system. Genes Dev 14:2919 –2937.

2. Kaplan D, Miller F (2000): Neurotrophin signal transduction in the ner-vous system. Curr Opin Neurobiol 10:381–391.

3. Hock C, Heese K, Müller-Spahn F, Hulette C, Rosenberg C, Otten U (1998):Decreased trkA neurotrophin receptor expression in the parietal cortexof patients with Alzheimer’s disease. Neurosci Lett 241:151–154.

4. Counts SE, Nadeem M, Wuu J, Ginsberg SD, Saragovi HU, Mufson EJ(2004): Reduction of cortical TrkA but not p75(NTR) protein in early-stage Alzheimer’s disease. Ann Neurol 56:520 –531.

5. Ozbas-Gerceker F, Gorter JA, Redeker S, Ramkema M, van der Valk P(2004): Neurotrophin receptor immunoreactivity in the hippocampus ofpatients with mesial temporal lobe epilepsy. Neuropathol Appl Neuro-biol 30:651– 664.

6. Dechant G, Neumann H (2002): Neurotrophins. Adv Exp Med Biol 513:303–334.

7. Frade JM, Barde YA (1998): Nerve growth factor: Two receptors, multiplefunctions. BioEssays 20:137–145.

8. Hasegawa Y, Yamagishi S, Fujitani M, Yamashita T (2004): p75 neurotro-phin receptor signaling in the nervous system. Biotechnol Annu Rev10:123–149.

9. Hempstead BL, Martin-Zanca D, Kaplan DR, Parada LF, Chao MV (1991):High-affinity NGF binding requires co-expression of the trk proto-onco-gene and the low-affinity NGF receptor. Nature 350:678 – 683.

0. Benedetti M, Levi A, Chao MV (1993): Differential expression of nervegrowth factor receptors leads to altered binding affinity and neurotro-phin responsiveness. Proc Natl Acad Sci U S A 90:7859 –7863.

1. Esposito D, Patel P, Stephens RM, Perez P, Chao MV, Kaplan DR, et al.(2001): The cytoplasmic and transmembrane domains of the p75 andTrk A receptors regulate high affinity binding to nerve growth factor.J Biol Chem 276:32687–32695.

2. Barbany G, Persson H (1992): Regulation of neurotrophin mRNA expres-sion in the rat brain by glucocorticoids. Eur J Neurosci 4:396 – 403.

3. Smith MA, Makino S, Kvetnanský R, Post RM. (1995): Effects of stress onneurotrophic factor expression in the rat brain. Ann N Y Acad Sci 771:234 –239.

4. Shimizu E, Hashimoto K, Okamura N, Koike K, Komatsu N, Kumakiri C,et al. (2003): Alterations of serum levels of brain-derived neurotrphicfactor (BDNF) in depressed patients with or without antidepressants.Biol Psychiatry 54:70 –75.

5. Karege F, Perret G, Bondolfi G, Schwald M, Bertschy G, Aubry J-M (2002):Decreased serum brain-derived neurotrophic factor levels in major de-pressed patients. Psychiatry Res 109:143–148.

6. Siuciak JA, Lewis DR, Wiegand SJ, Lindsay R (1996): Antidepressant-likeeffect of brain derived neurotrophic factor (BDNF). Pharmacol BiochemBehav 56:131–137.

7. Ueyama T, Kawai Y, Nemoto K, Sekimoto M, Tone S, Senba E (1997):Immobilization stress reduced the expression of neurotrophins andtheir receptors in the rat brain. Neurosci Res 28:103–110.

8. Shirayama Y, Chen ACH, Nakagawa S, Russell DS, Duman RS (2002):Brain-derived neurotrophic factor produces antidepressant effects inbehavioral models of depression. J Neurosci 22:3251–3261.

9. Nibuya M, Morinobu S, Duman RS (1995): Regulation of BDNF and trkBmRNA in rat brain by chronic electroconvulsive seizure and antidepres-
sant drug treatments. J Neurosci 15:7539 –7547.
30. Lindefors N, Brodin E, Metsis M (1995): Spatiotemporal selective effectson brain-derived neurotrophic factor and trkB messenger RNA in rathippocampus by electroconvulsive shock. Neuroscience 65:661– 670.

31. Dwivedi Y, Rizavi HS, Conley RR, Roberts RC, Tamminga CA, Pandey GN(2003): Altered gene expression of brain-derived neurotrophic factorand receptor tyrosine kinase B in postmortem brain of suicide subjects.Arch Gen Psychiatry 60:804 – 815.

32. Dwivedi Y, Mondal AC, Rizavi HS, Conley RR (2005): Suicide brain isassociated with decreased expression of neurotrophins. Biol Psychiatry58:315–324.

33. Karege F, Perret G, Bondolfi G, Schwald M, Bertschy G, Aubry JM (2002):Decreased serum brain-derived neurotrophic factor levels in major de-pressed patients. Psychiatry Res 109:143–148.

34. Tsai P (2005): Predictors of distress and depression in elders with ar-thritic pain. J Adv Nursing 51:158 –165.

35. Kim YK, Lee HP, Won SD, Park EY, Lee HY, Lee BH, et al. (2007): Lowplasma BDNF is associated with suicidal behavior in major depression.Prog Neuropsychopharmacol Biol Psychiatry 31:78 – 85.

36. Harrison PJ, Heath PR, Eastwood SL, Burnet PW, McDonald B, Pearson RC(1995): The relative importance of premortem acidosis and postmorteminterval for human brain gene expression studies: Selective mRNA vul-nerability and comparison with their encoded proteins. Neurosci Lett200:151–154.

37. Salzman S, Endicott J, Clayton P, Winokur G (1983): Diagnostic EvaluationAfter Death (DEAD). Rockville, MD: National Institute of Mental Health,Neuroscience Research Branch.

38. Spitzer RL, Williams JBW, Gibbon M, First MD (1995): Structural ClinicalInterview for DSM-IV (SCID). New York: New York State Psychiatric Insti-tute Biometrics Research.

39. Dwivedi Y, Rizavi HS, Roberts RC, Conley RC, Tamminga CA, Pandey GN(2001): Reduced activation and expression of ERK1/2 MAP kinase in thepostmortem brain of depressed suicide subjects. J Neurochem 77:916 –928.

40. Dwivedi Y, Rizavi H, Conley RR, Roberts RC, Tamminga CA, Pandey GN(2002): mRNA and protein expression of selective alpha subunits of Gproteins are abnormal in prefrontal cortex of suicide victims. Neuropsy-chopharmacology 27:499 –517.

41. Mufson EJ, Bothwell M, Hersh LB, Kordower JH (1989): Nerve growthfactor receptor immunoreactive profiles in the normal, aged humanbasal forebrain: Colocalization with cholinergic. J Comp Neurol 285:196 –217.

42. Mufson EJ, Ma SY, Dills J, Cochran EJ, Leurgans S, Wuu J, et al. (2002): Lossof basal forebrain P75(NTR) immunoreactivity in subjects with mildcognitive impairment and Alzheimer’s disease. J Comp Neurol 443:136 –153.

43. Counts SE, Mufson EJ (2005): The role of nerve growth factor receptorsin cholinergic basal forebrain degeneration in prodromal Alzheimerdisease. J Neuropathol Exp Neurol 64:263–272.

44. Miller FD, Kaplan DR (2001): Neurotrophin signaling pathways regulat-ing neuronal apoptosis. Cell Mol Life Sci 58:1045–1053.

45. Lei L, Parada LF (2007): Transcriptional regulation of Trk family neuro-trophin receptors. Cell Mol Life Sci 64:522–523.

46. Meldolesi J, Sciorati C, Clementi E (2000): The p75 receptor: First insightsinto the transduction mechanisms leading to either cell death or sur-vival. Trends Pharmacol Sci 21:242–243.

47. Verdi JM, Birren SJ, Ibanez CF, Persson H, Kaplin DR, Benedetti M, et al.(1994): p75LNGFR regulates Trk signal transduction and NGF-inducedneuronal differentiation in MAH cells. Neuron 12:733–745.

48. Ip NY, Stitt TN, Tapley P, Klein R, Glass DJ, Fandl J, Greene LA, et al. (1993):Similarities and differences in the way neurotrophins interact with theTrk receptors in neuronal and nonneuronal cells. Neuron 10:137–149.

49. Baker PA, Shooter EM (1994): Disruption of NGF binding to the lowaffinity neurotrophin receptor p75 LNTR reduces NGF binding to TrkAon PC12 cells. Neuron 13:203–215.

50. Mahadeo D, Kaplan D, Chao MV, Hempstead BL (1994): High affinitynerve growth factor binding displays a faster rate of association thanp140trk binding: implications for multi-subunit polypeptide receptors.J Biol Chem 269:6884 – 6891.

51. Twiss JL, Wada HG, Fok KS, Chan SDH, Verity AN, Baxter GT, et al. (1998):Duration and magnitude of nerve growth factor signaling depend on
the ratio of p75LNTR to TrkA. J Neurosci Res 51:442– 453.

5

5

5

5

5

5

5

5

6

6

6

6

666

6

6

6

7

7

7

7

7

7

7

7

7


w

2. Clary DO, Weskamp G, Austin LA, Reichardt LF (1994): TrkA cross-linkingmimics neuronal responses to nerve growth factor. Mol Biol Cell 5:549 –563.

3. Mischel PS, Smith SG, Vining ER, Valletta JS, Mobley WC, Reichardt LF(2001): The extracellular domain of p75NTR is necessary to inhibit neu-rotrophin-3 signaling through TrkA. J Bio Chem 276:11294 –11301.

4. Brennen T, Martinussen M, Hansen BO, Hjemdal O (1999): Arctic cogni-tion: A study of cognitive performance in summer and winter at 69degrees N. Appl Cogn Psychol 13:561–580.

5. Rabizadeh S, Oh J, Zhong L, Yang J, Bitler CM, Butcher LL (1993): Induc-tion of apoptosis by the low-affinity NGF receptor. Science 261:345–358.

6. Friedman WJ, Grossman J (1999): Neurotrophins induce death of cul-tured hippocampal neurons. Soc Neurosci Abstr 25:767.

7. Friedman W (2000): Neurotrophins induce death of hippocampal neu-rons via the p75 receptor. J Neurosci 28:6340 – 6346.

8. Casaccia-Bonnefil P, Carter BD, Dobrowsky RT, Chao MV (1996): Death ofoligodendrocytes mediated by the interaction of nerve growth factorwith its receptor p75. Nature 383:716 –719.

9. Van der Zee CEE, Ross GM, Ripelle RJ, Hagg T (1996): Survival of cholin-ergic forebrain neurons in developing p75 NGFR-deficient mice. Science274:1729 –1732.

0. Roux PP, Colicos MA, Barker PA, Kennedy TE (1999): p75 neurotrophinreceptor expression is induced in apoptotic neurons after seizure. J Neu-rosci 19:6887– 6896.

1. George MS, Ketter TA, Post RM (1994): Prefrontal cortex dysfunction inclinical depression. Depression 2:59 –72.

2. Sweatt JD (2004): Hippocampal function in cognition. Psychopharma-cology 174:99 –110.

3. Sala M, Perez J, Soloff P, Ucelli di Nemi S, Caverzasi E, Sores JC, et al.(2004): Stress and hippocampal abnormalities in psychiatric disorders.Eur Neuropsychopharmacol 14:393– 405.

4. Clayton PJ (1985): Suicide. Psychiatr Clin North Am 8:203–214.5. Monk M (1987): Epidemiology of suicide. Epidemiol Rev 9:51– 69.6. Benes FM, Kwok EW, Vincent SL, Todtankopf MS (1998): A reduction of

nonpyramidal cells in sector CA2 of schizophrenics and manic depres-sives. Biol Psychiatry 15:88 –97.

7. Drevets WC, Price JL, Simpson JR Jr, Todd RD, Reich T, Vannier M, et al.(1997): Subgenual prefrontal cortex abnormalities in mood disorders.Nature 386:824 – 827.

8. MacQueen GM, Campbell S, McEwen BS, Macdonald K, Amano S, JoffeRT, et al. (2003): Course of illness, hippocampal function, and hippocam-pal volume in major depression. Proc Natl Acad Sci USA 100:1387–1392.

9. Miguel-Hidalgo JJ, Rajkowska G (2002): Morphological brain changes indepression: Can antidepressants reverse them? CNS Drugs 16:361–372.

0. Sheline YI, Gado MH, Kraemer HC (2003): Untreated depression andhippocampal volume loss. Am J Psychiatry 160:1516 –1518.

1. McEwen BS (1999): Stress and hippocampal plasticity. Ann Rev Neurosci22:105–122.

2. Sapolsky RM (1996): Why stress is bad for your brain. Science 273:749 –750.

3. Altschuler DL, Casanova MF, Goldberg TE, Kleinman JE (1990): The hip-pocampus and parahippocampus in schizophrenia, suicide and controlbrains. Arch Gen Psychiatry 47:1029 –1034.

4. Rajkowska G (1997): Morphometric methods for studying the prefrontalcortex in suicide victims and psychiatric patients. Ann NY Acad Sci U S A836:253–268.

5. Zakharenko SS, Patterson SL, Dragatsis I, Zeitlin SO, Siegelbaum SA,Kandel ER, et al. (2003): Presynaptic BDNF required for a presynaptic butnot postsynaptic component of LTP at hippocampal CA1–CA3 syn-apses. Neuron 39:957–990.

6. Greferath U, Bennie A, Kourakis A, Barrett GL (2000): Impaired spatiallearning in aged rats is associated with loss of p75-positive neurons inthe basal forebrain. Neuroscience 100:363–370.

7. Hennigan A, Trotter C, Kelly AM (2007): Lipopolysaccharide impairslong-term potentiation and recognition memory and increases p75NTRexpression in the rat dentate gyrus. Brain Res 1130:158 –166.

8. Saarelainen T, Hendolin P, Lucas G, Koponen E, Sairanen M, MacDonaldE, et al. (2003): Activation of the TrkB neurotrophin receptor is induced
by antidepressant drugs and is required for antidepressant-inducedbehavioral effects. J Neurosci 23:349 –357.
ww.sobp.org/journal

79. Lopez JF, Vazquez DM, Chalmers DT, Watson SJ (1997): Regulation of5-HT receptors and the hypothalamic-pituitary-adrenal axis. Implica-tions for the neurobiology of suicide. Ann N Y Acad Sci 836:106 –134.

80. Arato M, Banki CM, Bissette G, Nemeroff CB (1989): Elevated CSF CRH insuicide victims. Biol Psychiatry 25:355–359.

81. Nemeroff CB, Owens MJ, Bissette G (1988): Reduced corticotropin re-leasing factor binding sites in the frontal cortex of suicide victims. ArchGen Psychiatry 45:577–579.

82. Kunugi H, Hashimoto R, Yoshida M, Tatsumi M, Kamijima K (2004): Amissense polymorphism (S205L) of the low-affinity neurotrophin recep-tor p75NTR gene is associated with depressive disorder and attemptedsuicide. Am J Med Gene Part B (Neuropsych Genet) 129B:44 – 46.

83. Mukai J, Hachiya T, Shoji-Hoshino S, Kimura MT, Nadano D, Suvanto P,et al. (2000): NADE, a p75NTR -associated cell death executor, is involvedin signal transduction mediated by the common neurotrophin receptorp75NTR. J Biol Chem 275:17566 –17570.

84. Salehi AH, Roux PP, Kubu CJ, Zeindler C, Bhakar C, Tannis LL, et al. (2000):NRAGE, a novel MAGE protein, interacts with the p75 neurotrophinreceptor and facilitates nerve growth factor-dependent apoptosis. Neu-ron 27:279 –288.

85. Jordan BW, Dinev D, LeMellay V, Troppmair J, Gotz R, Wixler L, et al.(2001): Neurotrophin receptor-interacting mage homologue is an in-ducible inhibitor of apoptosis protein-interacting protein that aug-ments cell death. J Biol Chem 276:39985–39989.

86. Whitfield J, Neame SJ, Paquet L, Bernard O, Ham J (2001): Dominant-negative c-Jun promotes neuronal survival by reducing BIM expressionand inhibiting mitochondrial cytochrome c release. Neuron 29:629 –643.

87. Yoon SO, Cassaccia-Bonnefil P, Carter B, Chao MV (1998): Competitivesignaling between TrkA and p75 nerve growth factor receptors deter-mines cell survival. J Neurosci 18:3273–3281.

88. Mazzoni IE, Said FA, Aloyz R, Miller FD, Kaplan D (1999): Ras regulatessympathetic neuron survival by suppressing the p53-mediated celldeath pathway. J Neurosci 19:9716 –9727.

89. Dobrowsky RT, Jenkins GM, Hannun YA (1995): Neurotrophins inducesphingomyelin hydrolysis-modulation by co-expression of p75NTRwith trk receptors. J Biol Chem 270:22135–22142.

90. Bilderback TR, Gazula VR, Dobrowsky RT (2001): Phosphoinositide 3-ki-nase crosstalk between Trk A tyrosine kinase and p75NTR dependentsphingolipid signaling pathways. Neurochem 76:1540 –1551.

91. Müller G, Storz P, Bourteele S, Dšppler H, Pfizenmaier K, Mischak H(1998): Regulation of Raf-1 kinase by TNF via its second messengerceramide and cross-talk with mitogenic signalling. EMBO J 17:732–742.

92. Zhou H, Summers SA, Birnbaum MJ, Pittman RN (1998): Inhibition of Aktkinase by cell-permeable ceramide and its implications for ceramide-induced apoptosis. J Biol Chem 273:16568 –16575.

93. Zundel W, Schindler C, Haas-Kogan D, Koong A, Kaper F, Chen E, et al.(2000): Loss of PTEN facilitates HIF-1-mediated gene expression. GenesDev 14:391–396.

94. Dwivedi Y, Rizavi HS, Conley RR, Pandey GN (2006): ERK MAP kinasesignaling in post-mortem brain of suicide subjects: Differential regula-tion of upstream Raf kinases Raf-1 and B-Raf. Mol Psychiatry 11:86 –98.

95. Dwivedi Y, Rizavi HS, Teppen T, Zhang H, Mondal A, Roberts RC, et al.(2008): Lower phosphoinositide 3-kinase (PI 3-kinase) activity and dif-ferential expression levels of selective catalytic and regulatory PI 3-ki-nase subunit isoforms in prefrontal cortex and hippocampus of suicidesubjects. Neuropsychopharmacology 33:2324 –2340.

96. Neves-Pereira M, Mundo E, Muglia P, King N, Macciardi F, Kennedy JL(2002): The brain-derived neurotrophic factor gene confers susceptibil-ity to bipolar disorder: Evidence from a family-based association study.Am J Hum Genet 71:651– 655.

97. Sklar P, Gabriel SB, McInnis MG, Bennett P, Lim YM, Tsan G, et al. (2002):Family-based association study of 76 candidate genes in bipolar disor-der: BDNF is a potential risk locus. Brain-derived neutrophic factor. MolPsychiatry 7:579 –593.

98. Nakata K, Ujike H, Sakai A, Uchida N, Nomura A, Imamura T, et al. (2003):Association study of the brain-derived neurotrophic factor (BDNF) gene
with bipolar disorder. Neurosci Lett 337:17–20.

Documents

Neurotrophin Receptor Activation and Expression in Human Postmortem Brain: Effect of Suicide