Neuroprotective Effects of GDNF-expressing Human Amniotic Fluid Cells

Neuroprotective Effects of GDNF-expressingHuman Amniotic Fluid Cells

Anna Jezierski & Kerry Rennie & Bogdan Zurakowski &Maria Ribecco-Lutkiewicz & Julie Haukenfrers & Abdellah Ajji &Andrée Gruslin & Marianna Sikorska & Mahmud Bani-Yaghoub

# Crown Copyright as represented by: Danica Stanimirovic 2014

Abstract Brain injury continues to be one of the leadingcauses of disability worldwide. Despite decades of research,there is currently no pharmacologically effective treatment forpreventing neuronal loss and repairing the brain. As a result,novel therapeutic approaches, such as cell-based therapies, arebeing actively pursued to repair tissue damage and restoreneurological function after injury. In this study, we examinedthe neuroprotective potential of amniotic fluid (AF) single cellclones, engineered to secrete glial cell derived neurotrophicfactor (AF-GDNF), both in vitro and in a surgically inducedmodel of brain injury. Our results show that pre-treatment withGDNF significantly increases cell survival in cultures of AFcells or cortical neurons exposed to hydrogen peroxide. Sinceimproving the efficacy of cell transplantation depends onenhanced graft cell survival, we investigated whether AF-GDNF cells seeded on polyglycolic acid (PGA) scaffoldscould enhance graft survival following implantation into the

lesion cavity. Encouragingly, the AF-GDNF cells survivedlonger than control AF cells in serum-free conditions andcontinued to secrete GDNF both in vitro and following im-plantation into the injured motor cortex. AF-GDNF implanta-tion in the acute period following injury was sufficient toactivate the MAPK/ERK signaling pathway in host neuralcells in the peri-lesion area, potentially boosting endogenousneuroprotective pathways. These results were complementedwith promising trends in beam walk tasks in AF-GDNF/PGAanimals during the 7 day timeframe. Further investigation isrequired to determine whether significant behavioural im-provement can be achieved at a longer timeframe.

Keywords Amniotic fluid cells . Brain injury . GDNF .

Neuroprotection . Polyglycolic acid . Stem cells

Introduction

Brain injury, after surgically removing tumors or epileptic focior as a result of trauma or stroke, may cause neuronal death,reduced connectivity as well as cognitive and motor impair-ments [1]. Despite considerable preclinical progress, pharma-cological interventions have not yet proven effective in clin-ical trials. Hence, there is growing interest in novel therapeuticapproaches, such as cell-based therapies, to repair tissue dam-age and restore neurological function following brain injury[2, 3]. Stem cells have been proposed as a powerful tool in thetreatment of several human conditions, and recent advanceshave boosted efforts to explore the potential of stem cells toenhance neural repair following brain injury (reviewed in[3–6]). Ultimately the most appropriate cell source for cell-based therapies in the injured brain will depend on several keyfactors including accessibility, scalability, safety, efficacy andethical considerations. To this end, embryonic stem (ES) cellsare subject to ethical issues and the added risk of

Electronic supplementary material The online version of this article(doi:10.1007/s12015-013-9484-x) contains supplementary material,which is available to authorized users.

A. Jezierski :K. Rennie : B. Zurakowski :M. Ribecco-Lutkiewicz :J. Haukenfrers :M. Sikorska :M. Bani-Yaghoub (*)Department of Translational Biosciences, National Research CouncilCanada, Building M-54, 1200 Montreal Road, Ottawa, CanadaK1A 0R6e-mail: [email protected]

A. Jezierski :A. Gruslin :M. Bani-YaghoubDepartment of Cellular and Molecular Medicine, Faculty ofMedicine, University of Ottawa, Ottawa, ON, Canada

A. AjjiDepartment of Chemical Engineering, Polytechnique Montréal,Montréal, Québec, Canada

A. GruslinDepartment of Obstetrics and Gynecology, Faculty of Medicine,University of Ottawa, Ottawa, ON, Canada

Stem Cell Rev and RepDOI 10.1007/s12015-013-9484-x

http://dx.doi.org/10.1007/s12015-013-9484-x

tumorigenicity, whereas adult stem cells are hindered by re-duced proliferative rates, limiting their numbers for use intransplantation studies. Therefore, other stem cell sources,such as human amniotic fluid (AF) cells are being pursuedas a novel source of therapeutic cells. AF cells are routinelyobtained by amniocentesis and in addition to being readilyavailable and easily procured, they are easily expanded inculture and not subject to ethical issues or in vivo teratomaformation. More importantly, sub-populations of AF cellswith stem cell characteristics have been isolated based on C-KIT expression and shown to harbour the potential to differ-entiate towards the three embryonic germ layers [7]. Thesecharacteristics, along with their low antigenicity [8–11], havemadeAF cells a promising alternative source of cells for use intissue engineering and cell-based therapies [12–17] and theirapplication for nervous system repair has met with somesuccess [18–26].

The delivery of survival-promoting neurotrophic factors tothe injured brain is a promising application of cell-basedtherapies [27–29]. In particular, glial cell line-derived neuro-trophic factor (GDNF) has received considerable attention as apotent neuroprotective factor on a wide spectrum of neuronalpopulations in different experimental models of brain injury[30–32], and efforts to enhance the neuroprotective potentialof cell-based therapies by genetically engineering stem cells tosecrete GDNF have proven successful in a number of animalmodels of neural injury [30, 33–35]. Recently, AF and amni-otic epithelial cells engineered to secrete GDNF have alsobeen shown to ameliorate motor deficits and reduce infarctsize in rats subjected to sciatic nerve crush injury and middlecerebral artery occlusion, respectively [23, 36, 37].

Despite the promise of cell-based therapies for brain injury,the poor survival of engrafted cells is a major limitation in celltransplantation studies [38]. Combining cells with a syntheticpolymer scaffold delivery system, implanted at the target site,provides a promising strategy for increasing cell viability andlocalized neurotrophic factor delivery [39, 40]. Scaffolds pro-vide a three-dimensional lattice that can be engineered tosupport cell attachment and survival in vitro as well as servingas a temporary extracellular matrix after transplantationin vivo [39]. Polyglycolic acid (PGA) is a synthetic, biode-gradable polymer which has been approved by Health Canadaand the Food and Drug Administration (FDA) for a number ofclinical applications. Experimental data shows that PGA is anattractive template for cell transplantation into the brain[40–42]. Results from our laboratory demonstrate that PGApolymer scaffolds permit optimal adhesion, survival and dif-ferentiation of mouse neural cells in addition to providing aplatform for the delivery of cytokines, growth factors andneurotrophic factors [43]. Here we describe the generation ofGDNF-expressing AF cells capable of protecting neural cellsin vitro, and examine the ability of AF-GDNF cells seeded onPGA scaffolds to deliver GDNF and modulate behaviour and

neuroprotective signaling cascades in an in vivo model ofbrain injury.

Materials and Methods

Cell Culture

Human amniotic fluid (AF) cells were obtained from theOttawa Hospital (Ottawa, Ontario, Canada), following amnio-centesis in women at 15 to 35 weeks of gestation, as previ-ously described [44, 45]. The study was approved by theOttawa Hospital and National Council Canada-ResearchEthics Boards and a written informed consent was obtainedfrom each donor. AF-derived single cell clones (AF(F5),AF(C2) and AF(C12)) were cultured in Dulbecco’s ModifiedEagle Medium (DMEM, Invitrogen) supplemented with 20%Fetal Bovine Serum (FBS, Hyclone) and maintained at 37 °Cand 5 % CO2, as previously described [44, 45]. To ensureconsistency throughout this study, AF(F5) clonal cell popula-tion was used for both in vitro and in vivo experiments,henceforth referred to as AF cells. This homogenous popula-tion was positive for SOX2 (transient) and NESTIN expres-sion (Figure S1), which have been extensively used asmarkers of neural progenitor cells and previously used in amodel of traumatic brain injury in rat [29]. AF cells werepassaged at 70 % confluency every 2–3 days, using 0.05 %Trypsin/EDTA (Invitrogen) at a 1:3 split ratio.

Sox2 and Nestin positive mouse cortical progenitors(Figure S2) were isolated from the Embryonic day 13 (E13)ventricular zone, plated onto poly-L-lysine (PLL)-coated cov-erslips (9×105 living cells/ml) in DMEM+10 % FBS [46].MAP2 positive cortical neurons were generated from neuralprogenitors by reducing the serum concentration (i.e., 0.5 %FBS) during the first 24 h, followed by treatment withDMEM+N2 supplement (Invitrogen) to limit the generationof glial cells. Medium was replenished every 48 hfor 7 days [46].

RNA Extraction QPCR and RT-PCR

Total RNA was extracted from cells, using TriReagent(Molecular Research Centre), as previously described [44].Total RNA was quantified with NanoDrop (Thermo FisherScientific) and 1 μg was reverse transcribed (RT) usingQuantitect Reverse Transcriptase (Qiagen). QuantitativePCR (QPCR) was performed using Fast SYBR Green MasterMix (Bio-Rad) on 7500 Fast Real-Time PCR System(Applied Biosystems). Approximately 10 ng of cDNA wasused per individual reaction with primer concentrations of5 μM. Quantitative PCR amplifications were performed usingthe following conditions: Initial denaturation at 94 °C, 20 sand 40 cycles at 94 °C, 5 secs; 60 °C, 30 s. All data was

Stem Cell Rev and Rep

normalized to β-ACTIN (ACTB), using the ΔΔCT methodand specific primers were designed using publicly availablePrimer3 software [47] and Primer Express software (AppliedBiosystems) (Table 1).

Generation of GDNF Lentivector(pTet07CSII-CMV-GDNF-DsRed)

A third generation lentiviral vector (pTet07CSII-CMV-DsRed, a generous gift from Dr. Bernard Massie, NRC, Mon-treal, QC) and a commercially available plasmid containingthe full-length cDNA sequence of human GDNF (pCR-BluntII-TOPO-GDNF, Invitrogen) were used to clone a con-stitutively active GDNF lentivector (pTet07CSII-CMV-GDNF-DsRed). Briefly, the full-length GDNF fragment wascut from the pCR-BluntII-TOPO-GDNF plasmid with endo-nucleases XhoI and BamHI (New England Biolabs) and sub-cloned into pTet07CSII-CMV-DsRed lentivector, which waslinearized with the same endonucleases for directional cloning(Figure S3). The GDNF DNA fragment was ligated upstreamof an Internal Ribosome Entry Site (IRES) and the geneencoding Discosoma red fluorescent protein (DsRed), usingT4 DNA ligase (New England Biolabs). The resulting vectorplasmid, pTet07CSII-CMV-GDNF-DsRed, represents a thirdgeneration lentivector with the transgenes GDNF and DsRedseparated by an IRES under the control of a single Cytomeg-alovirus (CMV) promoter; the pTet07-CMV- DsRed back-bone vector was used as a control. Sequence analysis con-firmed that there were no mutations in the pTet07CSII-CMV-GDNF-DsRed. The plasmids were prepared and expanded

from transformed Escherichia coli DH5α chemi-competentcultures, using Qiagen MaxiPrep kits (Qiagen), as per manu-facturer’s instructions.

Transfection and Lentiviral Production

The human embryonic kidney packaging cell line HEK293SF-PacLV (293SF) was used to produce the third generationGDNF lentivirus [48]. This cell line constitutively expressesthe lentiviral proteins gag/pol and rev, while expressing VSV-G under the control of the transcriptional regulators Cumate(50 μg/ml, Sigma) and Doxycycline (Dox, 1 μg/ml, Sigma)[48]. Briefly, 293SF cells were plated the night before in a10 cm culture dish in FreeStyle EX media and 1 % FBS(Invitrogen). Fifteen micrograms of the pTet07CSII-CMV-GDNF-DsRed or pTet07CSII-CMV-DsRed control vectorwas diluted in 300 μl of serum free medium (DMEM) andincubated at room temperature for 20 min with 15 μl ofLipofectamine2000 (Invitrogen), also previously diluted into300 μl of DMEM. The DNA-Lipofectamine complex wasadded drop-wise to 293SF cells at 70 % confluency. Mediumwas replaced 7 h post-transfection and the transfection effi-ciency was estimated based on DsRed expression 24 h later,using fluorescence microscopy (Zeiss). The following day, themedium was replaced with fresh DMEM supplemented with1 μg/ml Dox and 50 μg/ml Cumate for the induction of theVSV-G. The virus conditioned medium was collected andreplenished daily for a span of 3 days, filtered through a0.45 μm low protein binding filter (Millipore) and concentratedusing Lenti-X Concentrator (Clontech), as previously described

Table 1 Sequence and annealingtemperatures of primers Designation Sequence (5′-3′) Annealing temp. (°C) Amplicon size (bp)

mGDNF-F TCGGCCGAGACAATGTATGA 60 79mGDNF-R CAACATGCCTGGCCTACTTTG 60

mGFRα1-F CCAGCGGGAACTCCTTTGT 60 79mGFRα1-R GCCCTGTAGCAGTTCTTCAACA 60

mGFRα2-F CACCACCTGCACATCTATCCA 60 79mGFRα2-R GAGCTCTGTGAAACACATGCTTAAC 60

mGFRα3-F CAGACCCACTGTCATCCTATGGA 60 75mGFRα3-R CAGGTATGCCCGCAGACAT 60

mGFRα4-F GGCAGAAACAGTCCTTGTTTTGT 60 75mGFRα4-R GGAGAGCCAGGGCAGTGA 60

mc-Ret-F TGACCATGGGTGACCTCATCT 60 77mc-Ret-R TACAAGCTTCATTTCTGCCAAGTACT 60

mACTB-F GCTCTGGCTCCTAGCACCAT 60 75mACTB-R GCCACCGATCCACACAGAGT 60

hNANOG-F GACTGAGCTGGTTGCCTCAT 56 276hNANOG-R TTTCTTCAGGCCCACAAATC 56

hACTIN-F

hACTIN-R

TCACCCACACTGTGCCCATCTACGA

CAGCGGAACCGCTCATTGCCAATGG

60 295

hNESTIN-F GCGTTGGAACAGAGGTTGGA 60 327hNESTIN-R TGGGAGCAAAGATCCAAGAC 60


[49]. The concentrated virus was either used directly toinfect AF cells or stored at −80 °C in 10 % FBS + DMEMfor future use. Following infection, cells were enriched byFluorescence Activated Cell Sorting (FACS) based on DsRedexpression using a MoFlo Cell Sorter (Beckman Coulter,StemCore Laboratories).

GDNF ELISA

Conditioned media from cultures of GDNF-secreting AF cells(AF-GDNF) and control AF-DsRed cells were collected atvarious time points post-infection. GDNF protein levels weredetermined using a GDNF ELISA kit, according to the man-ufacturer’s instructions (Promega). In brief, Maxisorp 96-wellflat-bottomed ELISA plates (Nunc) were coated with a GDNFmonoclonal antibody diluted in carbonate coating buffer(pH 8.2) and incubated overnight at 4 °C. Plates were thenincubated in blocking solution for 1 h at room temperature.GDNF standards ranging from 0 to 1,000 pg/ml and undilutedsamples were added and incubated at room temperature for 6 hwith shaking and washed with TBST. The captured GDNFwas incubated with a polyclonal antibody specific to GDNFovernight at 4 °C. After washing, the amount of bound GDNFwas detected by a specific horseradish-peroxidase conjugatedantibody following a 2 h incubation, with shaking at roomtemperature. Plates were then washed, and incubated with100 μl of enzyme substrate (TMB solution) for 15 min atroom temperature. The enzyme reaction was stopped byadding 100 μl of 1NHCl (Sigma) per well and the absorbanceat 450 nm was recorded on a SpectraMAX (Molecular De-vices) microplate reader. GDNF levels were calculated fromthe standard curve in the linear range. To determine in vivoGDNF secretion from AF-GDNF seeded scaffolds, cell andbrain tissue extracts were prepared using a GDNF lysis buffer(137 mM NaCl, 20 mM Tris (pH 8.0), 1 % NP40, 10 %glycerol), containing a protease inhibitor cocktail [48] andprocessed as described.

Cytotoxicity Assay

To test the effect of GDNF on hydrogen peroxide-inducedcytotoxicity in AF cells, cultures were exposed to mediumalone or pre-treated with varying concentrations of recombi-nant GDNF (1.5 and 10 ng/ml, R&D Systems) for 2 h prior toaddition of 200 μM H2O2 for 18 h. Surviving, adherent cellswere scored based on Carboxyfluorescein Diacetate (CFDA,Invitrogen) fluorescence (a cell-permeant esterase substratethat can serve as a viability probe) and the data were expressedas percent of surviving cells. Cellular fluorescence was quan-titated using a CytoFluor (Millipore) fluorescence measure-ment system with excitation filter 480/20 nm and emissionfilter 530/25 nm. To determine whether GDNF secreted fromvirally-infected AF cells was able to confer protection on

cortical neurons in vitro, GDNF secreting cells (3×105 cells;AF-GDNF) were seeded onto 0.4 μM pore size Transwellfilters (Costar) in 12-well tissue culture plates in DMEM andco-cultured with recipient cortical neurons, allowing the trans-fer of secreted GDNF into the culture media. Following 24 hco-culture, H2O2 was added at 50–100 μM overnight and thecortical neuron viability was assessed, as described. The acti-vation of Caspase3 was assessed in H2O2—treated culturesusing the CellEvent Caspase3/7 green detection reagent(Invitrogen), as per manufacturer’s instructions. Briefly, theCaspase3/7 Detection Reagent was added to cell cultures,incubated for 30 min and apoptotic cells with activatedcaspase-3/7 were visualized as bright green cells under anAxiovert 200 M fluorescence microscope (Zeiss). The fluo-rescence emission of the dye when bound to DNA is ~530 nm.

Polyglycolic Acid (PGA) Scaffolds

The PGA implants were synthesized by electrospinning pro-cedures (Patent Publication No. EP2448605 A1). The PGAfibres have a mean fibre diameter of approximately 50μm andcomprise a network of randomly oriented fibres, engineered todegrade approximately 12 weeks after implantation in thebrain (unpublished data). The electrospun PGA sheets werecut into pieces of 2 mm×1 mm in size, tailored to the cavitypost-surgery. Prior to cell seeding and transplantation, thePGA scaffolds were sterilized with 50 μg/ml Penicillin andStreptomycin (Sigma) for 30 min, washed twice in PBS andsoaked overnight in DMEM. The sterile PGA scaffolds werecoated with poly-L-lysine (Sigma) for 2 h at room temperatureto enhance AF cell adhesion. The poly-L-lysine was subse-quently removed and the scaffolds were left to air-dry for30 min. AF cells were seeded at a density of 3×105 cells/well onto the poly-L-lysine coated PGA scaffolds and culturedwith regular replacement of culture medium every 2 days.Cell adhesion and viability were assessed by CFDA andPropidium iodide (PI) staining, as previously described.The AF-GDNF and AF-DsRed/PGA implants were main-tained in serum free culture for 2 days prior to beingtransplanted into the lesioned cavity.

Surgically Induced Motor Cortex Brain Injury

Brain injury studies were approved by the Animal Care Com-mittee at the National Research Council Canada. Briefly,6 week old C57Bl/6 mice (Charles River) weighing approxi-mately 25–30 g were anesthetized using isoflurane (Aerrane,Baxter), placed in a stereotaxic frame, and a dorsal midlineincision was made. The skull overlying the left motor cortexwas removed using a dental drill according to stereotaxic coor-dinates (from “(Anterior-Posterior) AP −0.25 mm to −1.0 mm,Lateral (Lat) +0.7 mm”, to “AP +1.25 mm to +3.0 mm, Lat +2.4 mm”) with respect to Bregma (Figure S4), as previously


described [50]. Injury to the cortex was performed using asterile needle to remove neural tissue to a depth of 1 mmwithinthe above coordinates. The scaffold alone, or containing eitherAF-DsRed or AF-GDNF cells, was placed inside the injury site,sealed with bone wax, covered with topical anesthetic(Marcaine Bupivacaine Hydrochloride 0.50 %, Sigma) andthe skin was sutured. Two additional groups of animals weresubjected to injury with no scaffold or cells implanted, or asham surgery consisting of incision and suturing of the skin, butno damage to the skull or underlying tissue.

3D Brain Injury Rendering

Serial images from the mouse brain atlas of Paxinos andWatson [51] spanning from Bregma +4.28 to −5.34 mm werealigned using Reconstruct software (http://synapses.bu.edu).On each image the entire brain, as well as the primary motorcortex (M1), were outlined. Serial 8 μM sections, stained with0.1 % cresyl violet, from the brain of a mouse sacrificed 3 hafter motor cortex injury were used to outline the lesioned areaon each corresponding image from the atlas. A 3-dimensional(3D) rendering of the brain showing the location of the motorcortex and the actual lesion was generated from the tracedoutlines using a Boissonnat surface reconstruction algorithm(Figure S4B).

Beam-Walk Behavior Task

The effect of motor cortex injury on forelimb and hindlimbcoordination was examined at 3, 5 and 7 days post-surgeryusing the beam walk task. The apparatus consisted of a seriesof interchangeable round and square beams (each 100 cm inlength), which were elevated off the floor by two supportstands. One of the stands also supported an enclosed goalbox. Mice were trained to cross the elevated beam for aminimum of 3 days prior to surgery. During training, latencyto traverse the beam was recorded, and mice that did notreadily cross the beam (latencies greater than 20 s) were givenadditional days of training before surgery or were removedfrom the study. All mice were performing at a similar levelprior to surgery. Each mouse was given four consecutive trialson the beam on each post-surgical test day. For each trial, themouse was placed at the start and allowed to traverse the beamand was given 30 s inside the goal box between trials. For thefirst two trials on the beam, the right side of each animal wasrecorded, and for the last two trials, the left side of each animalwas recorded. The total number of left and right forelimb andhindlimb faults were scored by watching video recordings ofeach trial in slow motion. To be considered a fault, the mous-e’s forelimb or hindlimb had to fall completely off the beam(see Fig. 8b hindlimb fault, 8C forelimb fault, 8D no fault).Analysis was performed blinded to the treatment group.

Antibodies

The following antibodies were used in this study: β-ACTIN(1:5,000,WB, Sigma), ERK (1:000,WB,Cell Signaling), pERK(1:1,000, WB, Cell Signaling), Caspase3 (1:1,000, WB, CellSignaling), NeuN (1:5,000, WB; 1:500 IHC, Abcam), GFAP(1:200, IHC, DAKO), IBA1 (1:2,500, IHC, Wako), SOX2(1:300, ICC, in house), NESTIN (1:100, IHC, Millipore) andfluorescence-conjugated secondary antibodies (Alexa Fluor 488anti-rabbit or mouse, Rhodamine anti-mouse, 1:500, MolecularProbes). Hoechst (1:1,000, Sigma) was used to stain nuclei.

Immunohistochemistry

Mice were sacrificed 8 days after surgery by transcardialperfusion with saline, then 10 % neutral buffered formalin,and processed for cryostat sectioning as previously described.Thin (8 μM) frozen sections were thawed at room temperaturefor 15 min and then placed in PBS for 15 min. The sectionswere then blocked for 30 min in 5 % goat serum+0.25 %Triton-X in PBS, incubated with primary antibodies for 1 h atroom temperature and then washed 3 times with PBS. Thesections were then incubated with species-specific secondaryantibodies for 1 h at room temperature and following subse-quent washes the sections were counterstained with Hoechst(Sigma) for 5 min at room temperature and coverslipped usingVectashield mounting medium (Vector Laboratories). Immu-noreactivity was examined under an Axiovert 200 M fluores-cence microscope (Zeiss) and a confocal microscope(Olympus). For cell counts, the peri-lesion area analyzed wasoffset from the lesion boundary by 140 μM to avoid introduc-ing error by edge irregularities and 2,000 μM from the midlineto ensure the same region was analyzed in all animals, irre-spective of lesion size. Five random imageswere captured withthe confocal microscope within a defined region, lateral to thelesion edge andmidway through the cortical depth. Cell countswere acquired by placing the same size box in five randomregions within the pre-defined area for each section analyzed.To quantify astrocyte and microglial infiltration, the number ofGFAP and IBA1 positive cells, satisfying the criteria for sizeand staining intensity, were automatically counted using theNorthern Eclipse image analysis software (Empix).

Western Blotting

Animals were perfused with cold saline, the brains were re-moved and the tissue surrounding the injured region was re-moved using a scalpel. The excised tissuewaswashedwith coldTBS and lysed using ice-cold lysis buffer (25 mM Tris–HCl,pH 7.6, 150 mM NaCl, 1 % Triton-X, 1 % Na.Deoxycholate),containing a protease inhibitor cocktail [48] and phosStopphosphatase inhibitor cocktail [48] specifically for ERK blots(Sigma). Cell lysates were incubated for 30 min on ice and


http://synapses.bu.edu/

clarified by centrifugation at 20 000×g at 4 °C for 20 min.Protein samples (40 μg) and a molecular weight rainbowmark-er (Amersham) were electrophoresed on a 10 % sodium dode-cyl sulfate-polyacrylamide gel (SDS-PAGE) and transferred toa nitrocellulose membrane (Amersham), using a wet transferapparatus (Bio-Rad) at 20 Vovernight at 4 °C. The membraneswere incubated in TBS containing 5 % non-fat milk or 5 %BSA (Bovine serum albumin (Sigma), for ERK blots) with0.1 % Tween-20 (Sigma) for 1 h at room temperature to blocknon-specific binding and then incubated in primary antibodiesovernight at 4 °C. The membranes were then washed threetimes for 10 min with TBS containing 0.1 % Tween-20 andincubated with a peroxidase conjugated secondary antibody for1 h at room temperature. All secondary antibodies, anti-rabbitand anti-mouse IgG-HRP conjugates (Bio-Rad, 1:5,000), werediluted in 5 % non-fat milk or BSA and the membranes wereincubated for 1 h at room temperature. Immunoreactivity wasvisualized using chemiluminescent substrate (New EnglandNuclear) and captured by FluorChem 8900 (Alpha Innotech).Fold-change in pERK levels between test groups was assessedusing densitometry analysis with Image J software (NIH).

Statistical Analysis

Results were analyzed using a one-way or two-way analysisof variance (ANOVA), followed by Newman-Keuls andBonferroni post-hoc test; respectively, where appropriate. Re-sults are expressed as mean ± standard error of mean (SEM)and considered significant at p <0.05. For the beam-walk data,Levene’s test was conducted to evaluate the assumption ofhomogeneity of error variance between the treatment groups.In cases where Levene’s statistic was significant, the raw datawere subjected to square root transformations to reduce theerror variability prior to conducting any further statistical tests.Repeated measures ANOVAs with treatment (sham, injury,scaffold, AF-DsRed, and AF-GDNF) as the between-subjectsvariable and post-surgical interval as the within-subjects var-iable were carried out. If the overall ANOVAwas significant,post-hoc Dunnett’s tests with injury alone as the comparisongroup were conducted to determine which groups differedsignificantly. In cases where there was a significant interactionbetween treatment group and post-surgical interval, subse-quent one-way ANOVAs with post-hoc Dunnett’s tests wereperformed at each post-surgical time point to determine whichgroups differed significantly.

Results

Motor Cortex Injury Model

In this study, we used a surgically induced brain injury modelto reproducibly mimic the incidental damage inflicted on the

brain during neurosurgical procedures [52, 53]. The injuryproduced a cavity in the dorsal cortex that extended from thecortical surface to the deeper cortical layers, but not theunderlying corpus callosum. To confirm accuracy in our sur-gical parameters, a 3D reconstruction of the injury mapped theactual lesioned region, relative to the mouse brain atlas coor-dinates corresponding to the primary motor cortex(Figure S4). The lesion was shown to overlap the motor cortexregion (Figure S4B).

Expression of Endogenous GDNF and Its SignalingComponents Following Brain Injury

We performed QPCR analysis at different time pointspost-injury (3 h, 3 and 7 days) to determine the expressionof endogenous c-Ret and the GDNF family receptor(GFRα1, 2, 3 and 4) in the peri-lesion area of the leftmotor cortex following injury (Fig. 1a). QPCR analysisrevealed an upregulation of GFRα1 and c-Ret expression,relative to sham animals at all time points (Fig. 1b–d),whereas GFRα2 and 3 were not expressed within the timeframe examined (data not shown). Although GFRα4 wasinitially upregulated at 3 h post-injury, its expressiondecreased at later time points (Fig. 1d).

Genetically Engineering AF Cells to Constitutively SecreteGDNF

Using DsRed as a reporter, we successfully achieved a mini-mum of 75 % infection rate of AF cells with pTet07CSII-CMV-GDNF-DsRed (AF-GDNF) and pTet07CSII-CMV-DsRed (AF-DsRed) (Fig. 2a), which were further enrichedby FACS sorting into pure AF-GDNF and AF-DsRed (back-bone control) populations (Fig. 2b). Since AF cells did notexpress endogenous GDNF protein, Western blotting andELISA analysis confirmed the virally-driven expression ofGDNF in infected AF cells and the secretion of GDNF intothe culture media, respectively (Fig. 2c–d). The media col-lected from virally-transduced AF-GDNF cells contained highlevels of secreted GDNF (1.0 ng/ml), comparable to the levelsdetected in AF-GDNF cell lysates (1.2 ng/ml; Fig. 2d), incontrast to the undetectable levels in the media collected fromAF-DsRed and non-transduced AF cultures (0 ng/ml). Hence,GDNF expression in AF cells was purely driven from thelentivector and the virally-infected cultures continued tosecrete GDNF for at least 3 weeks post-infection, ingrowth media conditions (Fig. 2e). Constitutive GDNFexpression was not toxic to transduced AF cells in culturenor did it commit the cells towards any particular pheno-type when compared to AF-DsRed and non-transducedcultures (data not shown).


Neuroprotective Effect of GDNF against Cytotoxicityin Vitro

To examine the protective role of GDNF in vitro, AF cellswere exposed to hydrogen peroxide (H2O2), which has beenshown to induce neuronal cell death that proceeds via anapoptotic pathway [54]. In culture, H2O2 significantly reducedAF cell viability, in a dose-dependent manner, compared tountreated cells (Figure S5). Treatment of AF cells for 18 hwith 200 μMH2O2 resulted in approximately 50 % cell death(Fig. 3a and Figure S5). Using a live cell in vitro Caspase3detection assay, we confirmed that the cell death observedfollowing H2O2 treatment was mediated, in part, via theactivation of Caspase3 resulting in cell shrinkage and mem-brane blebbing (Fig. 3b) accompanied by DNA fragmen-tation, evident as early as 3 h post-treatment (Fig. 3c).Furthermore, we examined the effects of H2O2 treatmenton cortical neuron cultures. Western blotting analysis, fol-lowing exposure of cortical neurons to increasing concen-tration of H2O2, demonstrated an increase in Caspase3 anda decrease in NeuN protein expression, indicative of neu-ronal death 18 h following treatment (Fig. 3d). We also

observed a decrease in phosphorylated (pERK) and totalERK levels (Fig. 3d).

GDNF pre-treatment for 2 h markedly decreased AF cellsusceptibility to H2O2 in vitro at concentrations as low as1.5 ng/ml (Fig. 4a), although a higher GDNF concentration(100 ng/ml) appeared to be toxic in vitro, resulting in in-creased cell death (data not shown). When AF-GDNF cellswere plated onto Transwell filters to allow the transfer ofsecreted GDNF to recipient cortical neurons in co-culture(as illustrated in Fig. 4b), ELISA experiments confirmedGDNF protein levels of 1.6 ng/ml inside the shared co-culture media (Fig. 4c). As shown in Fig. 4d, co-culture ofcortical neurons with the Transwell inserts containing AF-GDNF cells for 18 h prior to the addition of 100 μM H2O2

led to a significant increase in the survival of cortical neuronscompared to neurons co-cultured with AF-DsRed cells, orthose treated with H2O2 alone.

Biocompatible Polymer Scaffolds

To test the ability of PGA scaffolds to support AF cell attach-ment and survival in vitro, AF cells were seeded directly onto

Fig. 1 Expression of GDNFreceptors in the sham and injuredcortices. a Schematicrepresentation outlining tissuesample collection from the peri-lesion area (yellow) surroundingthe implantation site (black). b–dQPCR analysis of GFRα1,c-Ret and GFRα4 expression inbrain tissue samples surroundingthe peri-lesion area in the motorcortex at 3 h, 3 days and 7 days(3 h, 3 d and 7 d) post injuryrelative to sham (sh) animals(mean + SEM, n =3; *p<0.05, **p <0.01, ***p<0.001 vs sham)


PGA scaffolds in growth media (Fig. 5a) and evaluated byCFDA and PI staining two weeks later (Fig. 5b). The CFDApositive AF cells readily attached to the 3D-PGA scaffold.Robust CFDA and negligible PI staining observed during theentire culture period suggests a lack of toxicity. Based on theseresults, we seeded 3×105 AF-GDNF or AF-DsRed cells ontothe PGA scaffolds in serum free media for subsequent implan-tation into the injured brain cavity. The AF-GDNF or AF-DsRed/PGA implants were monitored in vitro to parallel

in vivo implantation studies. In vitro, media was collectedfrom the wells containing either AF-GDNF or AF-DsRed/PGA implants for 9 days, which reflected the length of timethe scaffolds were implanted in the injured brain. During thistimeframe, the AF-GDNF and AF-DsRed cells readily at-tached to the PGA scaffold (Fig. 6a, a–b ) and ELISA analysisconfirmed GDNF protein secretion from AF-GDNF/PGAcultures, compared to undetectable level in AF-DsRed/PGAcontrol media (Fig. 6b). The decrease in GDNF levels over

Fig. 2 GDNF lentivector design and infection of AF cells. a (a–b) AFcells were infected with pTet07CSII-CMV-GDNF-DsRed (AF-GDNF,Red) and GDNF-DsRed expression was confirmed by fluorescence mi-croscopy. (c) Higher magnification of cells infected with GDNF-DsRed.b Infected AF-GDNF cells were enriched by fluorescence activated cellsorting (FACS), based on DsRed expression. c Western blot analysesconfirmed expression of GDNF protein in AF-GDNF cells, but not in

pTet07CSII-CMV-DsRed (AF-DsRed) and non-infected AF cells. β-actin (ACTB)was used as an internal control. d ELISA confirmedGDNFsecretion into culture media and expression in cell lysates from AF-GDNF cells compared to undetectable levels in AF-DsRed and non-transduced cultures (data not shown). e ELISA analysis confirmed thatAF-GDNF cells consistently secrete GDNF for at least 3 weeks post-infection (mean + SEM, n=3). Scale bar: 150 μm (a , b) and 50 μm (c)


Fig. 3 Hydrogen peroxideinduces cell death in AF andcortical neurons. a Cell viabilitywith CFDA (green) showedapproximately 50 % cell death18 h after H2O2 treatment. b TheH2O2- induced cell death wasmediated, in part, via theactivation of Caspase3 (green)resulting in cell shrinkage andmembrane blebbing c . DNAfragmentation seen as early as 3 hafter treatment. CTL control cellsnot exposed to H2O2; bp basepairs; L 1Kb DNA ladder. dWestern blotting analyses ofcortical neurons treated withH2O2 indicate a decrease in pErkand NeuN and increase inCaspase3 protein levels. β-actin(ACTB) was used as a loadingcontrol. Scale bar: 50 μm

Fig. 4 GNDF pre-treatment reduces hydrogen peroxide-mediated celldeath a Pre-treatment of AF cells with GDNF for 2 h, prior to addition ofH2O2, significantly reduced cell death compared to H2O2 treated cells(mean + SEM, n =3; *** p <0.001 vs H2O2). b Schematic of GDNF-secreting AF cells (AF-GDNF) seeded in Transwell filters co-culturedwith cortical neurons as recipient cells. c ELISA confirming AF-GDNF

cells in Transwell cultures actively secrete GDNF compared to undetect-able levels in AF-DsRed cells. d Cell death was significantly decreased incortical neurons exposed to GDNF secreted from AF-GDNF cells inTranswells following addition of H2O2 (mean + SEM, n =3, ** p <0.01vs H2O2). Percent survival was scored based on CFDA assay. CTLcontrol cells not exposed to H2O2


time was paralleled by a gradual reduction in the number ofcells due to serum free culture conditions. At day 7 in culture,AF-GDNF cells showed greater survival on the scaffolds(Fig. 6a, c, e ) compared to AF-DsRed cells based on sustainedDsRed expression (Fig. 6a, d ).

Evaluation of GDNF Secretion from AF-GDNF Cells in Vivoand ex Vivo

ELISA analysis confirmed that significantly higher amountsof GDNF (up to 1.8 ng/ml) were detected in the peri-lesionarea of the motor cortex (Fig. 1a) surrounding the AF-GDNF/PGA implants, compared to the other test groupsat 3 and 7 days post-implantation (Fig. 7a). IncreasedGDNF levels were sustained through day 7 post-implantation in AF-GDNF animals (0.4 ng/ml, Fig. 7a).In a separate set of animals, AF-GDNF/PGA implantswere removed from the brain at 3 and 7 days post-implantation and placed in tissue culture plates contain-ing DMEM media for subsequent ex vivo ELISA analy-sis at day 4 and 8 (1 day following removal from thebrain). Ex vivo AF-GDNF/PGA implants continued tosecrete GDNF in culture to comparable levels observedin vivo (1.59 ng/ml at day 4 and 0.34 ng/ml at day 8;Fig. 7b), which suggests that the majority of the GDNFdetected in the peri-lesion area was derived from AF-GDNF/PGA implants. No evidence of AF-GDNF or AF-DsRed cell migration into host brain was observed at7 days post-implantation (data not shown).

Effect of AF-GDNF/PGA Implants on MAPK/ERKSignaling Pathway

We examined the ability of AF-GDNF/PGA implants to mod-ulate the MAPK/ERK signaling pathway after brain injuryin vivo. We observed a consistent 6.6 and 5.4 fold increase inthe phosphorylation level of ERK1/2 in the peri-lesion areasurrounding AF-GDNF/PGA implants, at 3 and 7 days post-transplantation, respectively, compared to sham and injuryalone animals (Fig. 7c). A transient increase in ERK1/2 phos-phorylation was also observed for AF-DsRed/PGA implants,but this was observed only at day 3.

Assessment of Motor Ability on the Beam Walk Task

The total number of contralateral hindlimb and forelimbfaults on the beam walk task (Fig. 8a–d) at each post-surgical interval (3 days, post injury test 1; 5 days, postinjury test 2; 7 days, post injury test 3) are summarizedin Fig. 8e–g. At post injury test 1, the average numberof contralateral faults was similar amongst all the in-jured groups and significantly higher compared to non-injured shams (Fig. 8e). The number of contralateralfaults decreased from post injury test 1 to post injurytests 2 and 3 for all injured groups. Interestingly, AF-GDNF animals had the fewest number of faults com-pared with the injury, AF-DsRed and scaffold groupswithin the 7 day timeframe (Fig. 8f–g). However, thisdifference was not statistically significant, suggestingthat a longer timeframe may be required.

Fig. 5 Survival of AF cells on PGA scaffolds a Schematic outline for thegeneration of GDNF-secreting AF cells seeded on polyglycolic acid (PGA)polymers. b (a–c) AF cells seeded on PGA scaffolds readily attached andimpregnated the PGA scaffold. Cell survival and death assays with CFDA

(green) and PI (red) revealed that the majority of seeded AF cells werealive (green) with very few dead cells (red) observed 2weeks post-seeding.Higher magnification in (c) shows AF cells (CFDA, green) attached toindividual PGA fibres. Scale bar: 150 μm (a), (b) and 50 μm (c)


Histological Evaluation of Injured Brains

The number of surviving neurons (identified with NeuN)as well as the number of GFAP positive astrocytes andIBA1 positive microglia in the peri-lesion area (Fig. 9a, inset)after injury alone or AF-GDNF implantation are shown inFig. 9. The number of NeuN positive cells was decreased inthe peri-lesion area of mice subjected to motor cortex injurycompared to the corresponding cortical region in sham mice;however, GDNF did not decrease the loss of NeuN cells inAF-GDNF mice compared to injury alone (Fig. 9b–c). Fur-thermore, both astrocyte and microglial infiltration were ob-served in the peri-lesion area in injury and AF-GDNF mice

(Fig. 9d–g) with the latter being less pronounced in the AF-GDNF compared to injury mice (Fig. 9g).

Discussion

Secondary brain injury is caused by a combination of inflam-matory, cytotoxic and apoptotic processes that proceed theimmediate injury, resulting in a second wave of cell death[55]. Several lines of evidence suggest that neurotrophic fac-tors play an important role in the cellular events that ensuefollowing brain injury, and neurotrophic factor delivery to thelesion site can protect against neural cell death and help re-establish neuronal networks by stimulating the sprouting ofinjured neurons [56]. GDNF is a potent neurotrophic factorthat plays an important role in the survival of several neuralpopulations in the CNS by increasing the production of anti-apoptotic proteins and cell survival factors, while reducing theproduction of pro-apoptotic proteins [57–61]. In our surgicallyinduced brain injury model, we found that GFRα1 and itssignaling moiety c-Ret were upregulated immediately afterinjury in vivo, which provides a rationale for deliveringGDNF as a therapeutic agent in the early stages post-injuryto stimulate endogenous neuroprotective mechanisms.

Previous research has shown that pre-treatment with GDNFby intracerebroventricular or intraparenchymal injection[62–64], topical application on cortical surfaces [31, 65–68],delivery using viral vectors [69–73] and transplantation ofGDNF-expressing cells [33, 74–78] prior to injury reducedcerebral infarct volume and neuronal death, and improvedbehavioural deficits. Specifically, GDNF administrationprevented the activation of Caspase3 [31, 32, 66, 68, 71, 79,80] and enhanced neurite outgrowth [80], suggesting thatGDNF may inhibit apoptotic pathways as well as beingessential for the formation of appropriate neuronal circuitspost-injury. In fact, prevention of apoptosis has beenproposed as the mechanism of GDNF-induced neuropro-tection in dopaminergic neurons [57] and animal modelsof ischemia [30, 32, 72]. To confirm whether GDNF pre-treatment modulates neuronal outcome after injury, westudied the effects of GDNF on cortical neurons exposedto hydrogen peroxide-induced cell death in vitro. Consis-tent with previous findings [30], GDNF pre-treatmentfrom AF-GDNF cells significantly protected both AF cellsand cortical neurons from hydrogen peroxide-mediatedcell death. Our results demonstrated that hydrogenperoxide-induced cell death involved Caspase3 activa-tion, and although we did not investigate the directmechanism by which GDNF exerted its protective ef-fects against H2O2-mediated death in vitro, it is verylikely that it may have acted through its ability toinhibit apoptosis by preventing Caspase3 activation.

Fig. 6 GDNF production by AF-GDNF cells seeded on PGA scaffolds aFollowing infection, AF-GDNF (a, c) and AF-DsRed (b, d) cells wereseeded on PGA scaffolds for a total of 9 days in culture in serum freemedia. (e) Higher magnification of the AF-GDNF cells on the PGAscaffold. Scale bar: 20 μm (e). b Culture media were collected dailyfrom AF-GDNF and AF-DsRed seeded scaffolds to examine levels ofGDNF secreted into the media (mean ± SEM)


In addition, a recent study has shown that treatment of AFcells with GDNF enhanced their therapeutic potential in amurine model of acute kidney injury [26]. This effect waslikely mediated through an increase in the secretion of cyto-kines and growth factors including IL-6, VEGF, SDF-1 andIGF-1 which were detected in GDNF-treated AF cell condi-tioned media [26]. These factors are also known to exertneuroprotective effects in the brain [81–84] and can work inconcert with GDNF to stimulate an endogenous neuroprotec-tive response. Thus, GDNF, acting in an autocrine fash-ion, may also increase the neuroprotective capacity ofAF cells by stimulating the production or secretion ofother beneficial factors.

Furthermore, we observed that AF-GDNF/PGA implantssurvived longer in serum-free conditions compared to the AF-DsRed/PGA implants, suggesting that constitutive GDNFsecretion from AF cells may potentially improve the survivalof the transplanted cells. Since poor cell viability is a majorlimitation in cell-based therapies [85, 86], the increased sur-vival of the AF-GDNF/PGA implant graft is a promisingstrategy for improving clinical efficacy of cell transplantationtherapies. In fact, many strategies have been pursued to im-prove graft survival in vivo [87–91] of which protection ofdonor cells or modulation of the host tissue environment has

proven to be most promising [92]. Our observations supportprevious studies that have shown that even short-term pre-treatment of cellular grafts with neurotrophic factors promotesgraft survival in vivo [86, 93, 94]. These data raise the possi-bility that, by genetically modifying AF cells to secreteGDNF, AF-GDNF/PGA secretion of GDNF in vivo may actin both an autocrine and paracrine fashion to confer protectionof transplanted AF cells, while potentially protecting hostneural cells from secondary injury, respectively. Longer-termstudies will need to be conducted to determine how long AFcells seeded on PGA scaffolds can survive within the injuredbrain, and whether AF-GDNF cells continue to exhibit anadvantage over AF-DsRed cells.

Despite the growing evidence suggesting that increasingthe supply of neurotrophic factors to the injured brain can be apotent way to protect host cells and restore neural function,delivery to the brain has proven to be quite difficult. Thepresence of the blood–brain barrier makes it nearly impossiblefor large proteins and complex compounds to cross from theblood into the brain. Undeniably, two of the major limitationsto the success of GDNF in clinical trials for Parkinson’sdisease (PD) have been the effective delivery of GDNF tothe CNS due to its inability to cross the blood–brain barrier,and peripheral side-effects following systemic administration

Fig. 7 In vivo and ex vivo GDNF expression following transplantation.a ELISA quantitation of the amount of GDNF protein secreted in braintissue surrounding the peri-lesion area at 3 and 7 days (d) post-injury.There was a significant increase in GDNF in the brain samples frommicereceiving the AF-GDNF implants compared to controls (mean + SEM,n =3; *** p <0.001, ** p <0.01 vs injury). b AF-GDNF/PGA implantswere removed 3 and 7 days post-surgery and the levels of GDNFsecretion were measured by ELISA at 4 and 8 days, following 24 h in

serum free culture. GDNF protein secretion levels were very similar tothose observed in cultures. c The ability of GDNF to activate the MAPK/ERK pathway was assessed byWestern blotting of ERK phosphorylation(pErk) in vivo at 3 and 7 days post-transplantation of AF-GDNF and AF-DsRed/PGA implants. Increased pErk was observed for AF-GDNF cellsat day 3 and 7 compared to a transient increase for AF-DsRed cells at day3. Embryonic day 14 (E14) and total Erk levels were used as positive andinternal controls


[95, 96]. Clinical trials in PD have attempted to overcomethese problems by using local intracerebroventricular andintraputamenal injections for precise delivery of GDNF tothe target areas [97–101]. However, in the case of brain injurymodels, which often result in the formation of an infarct orlesion cavity, injecting GDNF directly into the injury site isfutile. To circumvent this delivery issue, we used PGA scaf-folds to deliver GDNF-secreting AF cells locally into thecavity, an approach which could potentially reduce systemicside effects and increase therapeutic efficacy by ensuring thevirally-encoded GDNF is delivered to the target region. An

important advantage of PGA scaffolds is that they areeasily shaped to fit the injured cavity and are biodegrad-able via hydrolysis into monomers of glycolate, a normalmetabolic product of saccharide metabolism in humancells [102, 103], which is non-toxic to donor or hostcells. By providing a temporary extracellular matrix[104], we found that PGA scaffolds were able to supportAF-GDNF cell attachment, survival and GDNF secretionin vitro and in vivo. This is a promising approach par-ticularly in a surgically induced brain injury model inwhich the excision of tumor or epileptic tissue leaves a

Fig. 8 Effect of GDNF on hindlimb and forelimb faults during beam-walk.a Schematic of timeline of experimental procedures for behavioural studies.Following injury, the animals were tested on the beamwalk and the numberof foot faults was scored by whether the b hindlimb or c . forelimb pawslipped off the beam compared to d sham animals (no faults). Animals werescored at three post-test (PT) intervals: 3 (PT-1), 5 (PT-2) and 7 (PT-3) days

post-surgery. Total contralateral limb faults were scored and summarizedin e–g , respectively, for each post-injury test (mean + SEM, n=8; ***p<0.001 vs injury). Although there was a reduction in contralateralhindlimb and forelimb faults in AF-GDNF mice compared to injuryalone, the changes were not statistically significant


cavity. Accordingly, implantation of AF-GDNF/PGA im-plants, at the time of surgery, can ensure the efficientdelivery of the right factor in a clinically relevant timeframe (when the neurosurgical intervention is carried out)to potentially improve functional recovery.

In the current study, we assessed motor deficits in ananimal model of surgically induced brain injury to evaluatethe neuroprotective potential of AF-GDNF/PGA implants.Despite some promising trends, we did not observe a signif-icant functional improvement of AF-GDNF animals

Fig. 9 Histological analysis of neuroprotective effect in injured brains. aCresyl violet staining of coronal sections of (a) sham, (b) injury and (c)AF-GDNF mice showing relationship of the peri-lesion area (square)examined in b , d , f relative to the injured cavity. Confocal immunoflu-orescence staining for b neurons (NeuN, red), d astrocytes (GFAP, red)and f microglia (IBA1, red) in the peri-lesion area. Insets represent a

higher magnification of astrocytic and microglial morphology. Hoechst(blue) was used to label nuclei. c , e , g Quantification of neurons andastrocyte and microglial activation based on cell counts in the peri-lesionarea (inset in a ; mean + SEM, n =8; *** p <0.001, ** p<0.01 vs sham).Scale bar: 1,000 μm (a), 50 μm (b , d , f)


compared to the other test groups within the 7 day timeframe.A major limitation of the beam walk task in our motor cortexinjury model is the rapid, spontaneous recovery of injuredanimals within the first week post-injury. As a result, thewindow of opportunity to detect GDNF-mediated functionalimprovements was significantly limited. Spontaneous recov-ery may be attributed to the use of compensatory motorstrategies by lesioned mice. The use of a tapered ledged beam,which provides a step support so that the animals are notinduced to compensate using alternative motor strategies,could potentially aid in unmasking the deficit in lesionedmice, thereby increasing the detectability of treatment effects.Although we did not observe an effect of GDNF on functionaloutcomes, we cannot exclude the possibility that a beneficialeffect of GDNF might be detected in other behavioural tasks[105, 106]. Furthermore, while we examined behaviouraldeficits only for a period of 7 days to determine theneuroprotective effect of GDNF post-injury, it is possi-ble that testing the mice at a longer post-surgical inter-val may have revealed a significant effect of GDNF, asobserved by Minnich et al. [107].

Surgically induced brain injury in the mouse mimicsthe damage inflicted on the brain during neurosurgicalprocedures, such as excision of brain tumors or removalof epileptic foci, as previously described [43, 45, 50,52, 53]. Similar to TBI and stroke, the injury site ischaracterized by an infiltration of astrocytes, invasion ofactivated microglia, formation of a glial scar, apoptosisof neurons and an expanding lesion volume over time[52, 108]. Since AF-GDNF/PGA implants demonstrateda significant neuroprotective effect in vitro, we alsoexamined the injured cortex to assess neuronal loss,reactive astrocytes (gliosis) and infiltration of activatedmicroglia in the peri-lesion area. The lack of increasedgliosis following transplantation of the PGA and AF-GDNF/PGA implants in the peri-lesion area suggeststhat the PGA itself (or its hydrolysis) did not elicit anenhanced inflammatory response, a property previouslydescribed for PGA [38].

Although AF-GDNF/PGA implants did not significantlyattenuate neuronal loss they did activate the MAPK/ERKsignaling pathway in host cells, which has been shown topromote neuronal survival [109]. Recent reports provide evi-dence that GDNF exerts its neuroprotective effects throughthe activation of the MAPK/ERK signaling pathway [110,111]. In the context of brain injury, the neuroprotective effectof GDNF has been shown to involve the activation of ERKsignaling in cortical neurons and astrocytes [110]. The AF-GDNF mediated increase in ERK phosphorylation in hosttissue, observed in the present study, suggests that corticalneurons and astrocytes respond to exogenous GDNF by acti-vating the MAPK/ERK signaling cascade. Although ERKsignaling is multifaceted in modulating neuronal survival

[112], it has been shown that ERK directly phosphorylatespro-Caspase9, which inhibits Caspase9 processing and subse-quent Caspase3 activation, thereby blocking the Caspase cas-cade during apoptosis [113]. Interestingly, we also observed atransient AF-DsRed mediated increase in ERK phosphoryla-tion at 3 days post-implantation. This finding suggests thateven in the absence of GDNF secretion, trophic factors re-leased from AF cells are able to activate the MAPK/ERKpathway in host cells. More specifically, VEGF, a factor thatis secreted in AF-conditioned media [26] has been shown toprotect cortical neurons following traumatic brain injury (TBI)by activating the ERK pathway [81]. Thus, AF cells secrete anumber of factors that could potentially enhance endogenousregeneration and neuroprotection [114, 115]. The synergisticeffect of GDNF and these factors on brain repair remains to beelucidated.

The finding that AF-GDNF/PGA implants activated anendogenous neuroprotective signaling cascade after brain in-jury in vivo is promising, but the lack of significant behav-ioural improvement in AF-GDNF treated mice indicates thatthe response may have been insufficient. Following infection,we achieved GDNF secretion levels of 1.5 ng/ml from AF-GDNF/PGA implants, similar to the neuroprotective dosageof recombinant GDNF used in vitro and that reported byMinnich et al. [107]. Although GDNF secretion levels werehigh at 3 days post-transplantation, we observed a gradualdecrease in GDNF levels over time that might explain the lackof neuroprotective efficacy. In fact, the neuroprotective effectof GDNF has been shown to be dose dependent [116].For instance, using adenoviral delivery of GDNF,Schmeer et al. demonstrated a dose-dependent rescue ofaxotomized rat ganglion cells where a higher dosage ofGDNF increased the number of surviving cells [117].Accordingly, had GDNF expression been sustained atthe therapeutic dosage during the entire 7 day period,behavioural and histological improvements may havebeen enhanced and this remains to be investigated. How-ever, it is important to note that higher GDNF concen-trations can also be associated with neuronal and synap-tic toxicity [116] and hence an appropriate dosing regimewill need to be clearly defined in future studies.

In this study, we demonstrate that AF cells represent a newpotential human cell source for the delivery of neurotrophicfactors to the injured brain. Since GDNF shows neuroprotec-tive effects in vitro, enhances the survival of grafted AF cells,and modulates a known neuroprotective signaling pathway inperi-lesion cortex in a model of surgically induced braininjury, the use of AF-GDNF/PGA implants as a neuroprotec-tive strategy in brain injury models merits further investiga-tion. Methods to boost the effective dose of GDNF from AF-GDNF implants should be explored, and longer-term studiesare required to determine whether any benefits of GDNFtreatment are maintained beyond the first week post-injury.


Acknowledgments The authors would like to thank Dr. BernardMassie for supplying the lentivector, Jacques Dufour for producing thePGA scaffolds, Sandhya Gangaraju for providing technical assistancewith viral production and Dr. Robert Monette for providing technicalassistance with confocal microscopy and image analysis. The authorswould also like to thank Amy Aylsworth, Dao Ly and Brandon Smith fordiscussions and technical assistance. Anna Jezierski is funded by theQueen Elizabeth II Graduate Scholarship in Science and Technology.

Disclosures The authors indicate no potential conflicts of interest.

References

1. Wieloch, T., &Nikolich, K. (2006).Mechanisms of neural plasticityfollowing brain injury. Current Opinion in Neurobiology, 16(3),258–264.

2. Bjorklund, A., & Lindvall, O. (2000). Cell replacement therapies forcentral nervous system disorders. Nature Neuroscience, 3(6), 537–544.

3. Schouten, J. W., et al. (2004). A review and rationale for the use ofcellular transplantation as a therapeutic strategy for traumatic braininjury. Journal of Neurotrauma, 21(11), 1501–1538.

4. Brodhun, M., Bauer, R., & Patt, S. (2004). Potential stem celltherapy and application in neurotrauma. Experimental andToxicological Pathology, 56(1–2), 103–112.

5. Burns, T. C., Verfaillie, C. M., & Low, W. C. (2009). Stem cells forischemic brain injury: a critical review. Journal of ComparativeNeurology, 515(1), 125–144.

6. Kulbatski, I., et al. (2005). Endogenous and exogenous CNS de-rived stem/progenitor cell approaches for neurotrauma. CurrentDrug Targets, 6(1), 111–126.

7. De Coppi, P., et al. (2007). Isolation of amniotic stem cell lines withpotential for therapy. Nature Biotechnology, 25(1), 100–106.

8. Akle, C. A., et al. (1981). Immunogenicity of human amnioticepithelial cells after transplantation into volunteers. Lancet,2(8254), 1003–1005.

9. Manuelpillai, U., et al. (2010). Transplantation of human amnionepithelial cells reduces hepatic fibrosis in immunocompetentCCl(4)-treated mice. Cell Transplantation, 19(9), 1157–1168.

10. Sankar, V., & Muthusamy, R. (2003). Role of human amnioticepithelial cell transplantation in spinal cord injury repair research.Neuroscience, 118(1), 11–17.

11. Zhang, D., Jiang, M., & Miao, D. (2011). Transplanted humanamniotic membrane-derived mesenchymal stem cells amelioratecarbon tetrachloride-induced liver cirrhosis in mouse. PLoS One,6(2), e16789.

12. Dionigi, B., & Fauza, D. (2012). Autologous approaches to tissueengineering. Harvard Stem Cell Institute, Cambridge: StemBook.

13. Kaviani, A., et al. (2001). The amniotic fluid as a source of cells forfetal tissue engineering. Journal of Pediatric Surgery, 36 (11),1662–1665.

14. Joo, S., et al. (2012). Amniotic fluid-derived stem cells in regener-ative medicine research. Archives of Pharmacal Research, 35(2),271–280.

15. Klemmt, P. A., Vafaizadeh, V., &Groner, B. (2011). The potential ofamniotic fluid stem cells for cellular therapy and tissue engineering.Expert Opinion on Biological Therapy, 11(10), 1297–1314.

16. Parolini, O., et al. (2009). Amniotic membrane and amniotic fluid-derived cells: potential tools for regenerative medicine?Regenerative Medicine, 4(2), 275–291.

17. Turner, C.G., et al. (2013). Intra-amniotic delivery of amniotic-derived neural stem cells in a syngeneic model of spina bifida.Fetal Diagnosis and Therapy, 34(1), 38–43

18. Bigini, P., et al. (2012). Longitudinal tracking of human fetal cellslabeled with super paramagnetic iron oxide nanoparticles in thebrain of mice with motor neuron disease. PLoS One, 7(2), e32326.

19. Cipriani, S., et al. (2007). Mesenchymal cells from human amnioticfluid survive and migrate after transplantation into adult rat brain.Cell Biology International, 31(8), 845–850.

20. De Coppi, P., et al. (2007). Amniotic fluid and bone marrow derivedmesenchymal stem cells can be converted to smooth muscle cells inthe cryo-injured rat bladder and prevent compensatory hypertrophyof surviving smooth muscle cells. The Journal of Urology, 177(1),369–376.

21. Donaldson, A. E., et al. (2009). Human amniotic fluid stem cells donot differentiate into dopamine neurons in vitro or after transplan-tation in vivo. Stem Cells and Development, 18(7), 1003–1012.

22. Pan, H. C., et al. (2007). Post-injury regeneration in rat sciatic nervefacilitated by neurotrophic factors secreted by amniotic fluid mes-enchymal stem cells. Journal of Clinical Neuroscience, 14(11),1089–1098.

23. Pan, H. C., et al. (2006). Enhanced regeneration in injured sciaticnerve by human amniotic mesenchymal stem cell. Journal ofClinical Neuroscience, 13(5), 570–575.

24. Prasongchean, W., et al. (2012). Amniotic fluid stem cells increaseembryo survival following injury. Stem Cells and Development,21(5), 675–688.

25. Rehni, A. K., et al. (2007). Amniotic fluid derived stem cells amelio-rate focal cerebral ischaemia-reperfusion injury induced behaviouraldeficits in mice. Behavioural Brain Research, 183(1), 95–100.

26. Rota, C., et al. (2012). Human amniotic fluid stem cell precondi-tioning improves their regenerative potential. Stem Cells andDevelopment, 21(11), 1911–1923.

27. Abe, K. (2000). Therapeutic potential of neurotrophic factors andneural stem cells against ischemic brain injury. Journal of CerebralBlood Flow and Metabolism, 20(10), 1393–1408.

28. Benn, S. C., & Woolf, C. J. (2004). Adult neuron survival strategies–slamming on the brakes.Nature ReviewsNeuroscience, 5(9), 686–700.

29. Yan, Z. J., et al. (2013). Neural stem-like cells derived from humanamnion tissue are effective in treating traumatic brain injury in rat.Neurochemical Research, 38(5), 1022–1033.

30. Duarte, E. P., et al. (2012). Neuroprotection by GDNF in theischemic brain. Growth Factors, 30(4), 242–257.

31. Kitagawa, H., et al. (1998). Reduction of ischemic brain injury bytopical application of glial cell line-derived neurotrophic factor afterpermanent middle cerebral artery occlusion in rats. Stroke, 29(7),1417–1422.

32. Kitagawa, H., et al. (1999). Adenovirus-mediated gene transfer ofglial cell line-derived neurotrophic factor prevents ischemic braininjury after transient middle cerebral artery occlusion in rats. Journalof Cerebral Blood Flow and Metabolism, 19(12), 1336–1344.

33. Bakshi, A., et al. (2006). Neural progenitor cells engineered tosecrete GDNF show enhanced survival, neuronal differentiationand improve cognitive function following traumatic brain injury.European Journal of Neuroscience, 23(8), 2119–2134.

34. Gao, J., et al. (2006). Transplantation of primed human fetal neuralstem cells improves cognitive function in rats after traumatic braininjury. Experimental Neurology, 201(2), 281–292.

35. Lee, H. J., et al. (2010). Human neural stem cells geneticallymodified to overexpress brain-derived neurotrophic factor promotefunctional recovery and neuroprotection in a mouse stroke model.Journal of Neuroscience Research, 88(15), 3282–3294.

36. Cheng, F. C., et al. (2010). Enhancement of regeneration with gliacell line-derived neurotrophic factor-transduced human amnioticfluid mesenchymal stem cells after sciatic nerve crush injury.Journal of Neurosurgery, 112(4), 868–879.

37. Liu, T., et al. (2008). Human amniotic epithelial cells amelioratebehavioral dysfunction and reduce infarct size in the rat middlecerebral artery occlusion model. Shock, 29(5), 603–611.


38. Park, K. I., Teng, Y. D., & Snyder, E. Y. (2002). The injured braininteracts reciprocally with neural stem cells supported by scaffolds toreconstitute lost tissue. Nature Biotechnology, 20(11), 1111–1117.

39. Cao, H., Liu, T., & Chew, S. Y. (2009). The application ofnanofibrous scaffolds in neural tissue engineering. AdvancedDrug Delivery Reviews, 61(12), 1055–1064.

40. Zhong, Y., & Bellamkonda, R. V. (2008). Biomaterials for the centralnervous system. Journal of the Royal Society Interface, 5(26), 957–975.

41. Kim, B. S., &Mooney, D. J. (1998). Development of biocompatiblesynthetic extracellular matrices for tissue engineering. Trends inBiotechnology, 16(5), 224–230.

42. Nerem, R. M., & Sambanis, A. (1995). Tissue engineering: frombiology to biological substitutes. Tissue Engineering, 1(1), 3–13.

43. Bani-Yaghoub, M., et al. (2008). Neuroregenerative strategies in thebrain: emerging significance of bone morphogenetic protein 7(BMP7). Biochemistry and Cell Biology, 86(5), 361–369.

44. Jezierski, A., et al. (2010). Probing stemness and neural commit-ment in human amniotic fluid cells. Stem Cell Reviews, 6(2), 199–214.

45. Jezierski, A., et al. (2012). Human amniotic fluid cells form func-tional gap junctions with cortical cells. Stem Cells International,2012, 607161.

46. Bani-Yaghoub, M., et al. (2006). Role of Sox2 in the developmentof the mouse neocortex. Developmental Biology, 295(1), 52–66.

47. Rozen, S., & Skaletsky, H. (2000). Primer3 on the WWW forgeneral users and for biologist programmers. Methods inMolecular Biology, 132 , 365–386.

48. Broussau, S., et al. (2008). Inducible packaging cells for large-scaleproduction of lentiviral vectors in serum-free suspension culture.Molecular Therapy, 16(3), 500–507.

49. Chitty, D. W., et al. (2012). Development of BMP7-producinghuman cells, using a third generation lentiviral gene delivery sys-tem. Journal of Neuroscience Methods, 205(1), 17–27.

50. Tay, L. L., et al. (2011). Detection of acute brain injury by Ramanspectral signature. Analyst, 136(8), 1620–1626.

51. Paxinos, G., & Franklin, K. B. G. (2001). The mouse brain instereotaxic coordinates . San Diego: Academic Press.

52. Frontczak-Baniewicz, M., Chrapusta, S. J., & Sulejczak, D. (2011).Long-term consequences of surgical brain injury - characteristics ofthe neurovascular unit and formation and demise of the glial scar ina rat model. Folia Neuropathologica, 49(3), 204–218.

53. Jadhav, V., et al. (2007). Neuroprotection against surgically inducedbrain injury. Surgical Neurology, 67(1), 15–20. discussion 20.

54. Whittemore, E. R., Loo, D. T., & Cotman, C. W. (1994). Exposureto hydrogen peroxide induces cell death via apoptosis in cultured ratcortical neurons. Neuroreport, 5(12), 1485–1488.

55. Moppett, I. K. (2007). Traumatic brain injury: assessment, resuscita-tion and early management. British Journal of Anaesthesia, 99(1),18–31.

56. Mocchetti, I., &Wrathall, J. R. (1995). Neurotrophic factors in centralnervous system trauma. Journal of Neurotrauma, 12(5), 853–870.

57. Clarkson, E. D., Zawada, W. M., & Freed, C. R. (1997). GDNFimproves survival and reduces apoptosis in human embryonic do-paminergic neurons in vitro. Cell and Tissue Research, 289(2),207–210.

58. Ghribi, O., et al. (2001). GDNF protects against aluminum-inducedapoptosis in rabbits by upregulating Bcl-2 and Bcl-XL andinhibiting mitochondrial Bax translocation. Neurobiology ofDisease, 8(5), 764–773.

59. Koeberle, P. D., & Ball, A. K. (1998). Effects of GDNF on retinalganglion cell survival following axotomy. Vision Research, 38(10),1505–1515.

60. Oppenheim, R.W., et al. (1995). Developingmotor neurons rescuedfrom programmed and axotomy-induced cell death by GDNF.Nature, 373(6512), 344–346.

61. Smith, M. P., & Cass, W. A. (2007). GDNF reduces oxidative stressin a 6-hydroxydopamine model of Parkinson's disease.Neuroscience Letters, 412(3), 259–263.

62. Dempsey, R. J., et al. (2003). Stroke-induced progenitor cell prolifer-ation in adult spontaneously hypertensive rat brain: effect of exoge-nous IGF-1 and GDNF. Journal of Neurochemistry, 87(3), 586–597.

63. Tomac, A. C., et al. (2000). Glial cell line-derived neurotrophicfactor receptor alpha1 availability regulates glial cell line-derivedneurotrophic factor signaling: evidence from mice carrying one ortwo mutated alleles. Neuroscience, 95(4), 1011–1023.

64. Wang, Y., et al. (1997). Glial cell line-derived neurotrophic factorprotects against ischemia-induced injury in the cerebral cortex. TheJournal of Neuroscience, 17(11), 4341–4348.

65. Abe, K., Hayashi, T., & Itoyama, Y. (1997). Amelioration of brainedema by topical application of glial cell line-derived neurotrophicfactor in reperfused rat brain. Neuroscience Letters, 231(1), 37–40.

66. Jin, G., et al. (2003). Protection against ischemic brain damage byGDNF affecting cell survival and death signals. NeurologicalResearch, 25(3), 249–253.

67. Shang, J., et al. (2010). Antiapoptotic and antiautophagic effects ofglial cell line-derived neurotrophic factor and hepatocyte growthfactor after transient middle cerebral artery occlusion in rats.Journal of Neuroscience Research, 88(10), 2197–2206.

68. Zhang, W. R., et al. (2001). Time dependent amelioration againstischemic brain damage by glial cell line-derived neurotrophic factorafter transient middle cerebral artery occlusion in rat. BrainResearch, 903(1–2), 253–256.

69. Harvey, B. K., et al. (2003). HSV amplicon delivery of glial cellline-derived neurotrophic factor is neuroprotective against ischemicinjury. Experimental Neurology, 183(1), 47–55.

70. Hermann, D. M., et al. (2001). Adenovirus-mediated GDNF andCNTF pretreatment protects against striatal injury following tran-sient middle cerebral artery occlusion in mice. Neurobiology ofDisease, 8(4), 655–666.

71. Iwai, M., et al. (2001). Gene therapy with adenovirus-mediated glialcell line-derived neurotrophic factor and neural stem cells activationafter ischemic brain injury. Human Cell, 14(1), 27–38.

72. Tsai, T. H., et al. (2000). Recombinant adeno-associated virus vectorexpressing glial cell line-derived neurotrophic factor reduces ischemia-induced damage. Experimental Neurology, 166(2), 266–275.

73. Tsai, T. H., et al. (2002). Gene therapy for treatment of cerebralischemia using defective recombinant adeno-associated virus vec-tors. Methods, 28(2), 253–258.

74. Chen, B., et al. (2009). Neuroprotective effect of grafting GDNFgene-modified neural stem cells on cerebral ischemia in rats. BrainResearch, 1284, 1–11.

75. Horita, Y., et al. (2006). Intravenous administration of glial cell line-derived neurotrophic factor gene-modified human mesenchymalstem cells protects against injury in a cerebral ischemia model inthe adult rat. Journal of Neuroscience Research, 84(7), 1495–1504.

76. Kameda, M., et al. (2007). Adult neural stem and progenitor cellsmodified to secrete GDNF can protect, migrate and integrate afterintracerebral transplantation in rats with transient forebrain ische-mia. European Journal of Neuroscience, 26(6), 1462–1478.

77. Katsuragi, S., et al. (2005). Grafting of glial cell line-derived neuro-trophic factor secreting cells for hypoxic-ischemic encephalopathy inneonatal rats. American Journal of Obstetrics and Gynecology,192(4), 1137–1145.

78. Ou, Y., et al. (2010). Intravenous infusion of GDNF gene-modifiedhuman umbilical cord blood CD34+ cells protects against cerebralischemic injury in spontaneously hypertensive rats. Brain Research,1366, 217–225.

79. Hermann, D. M., et al. (2001). Adenovirus-mediated glial cell line-derived neurotrophic factor (GDNF) expression protects againstsubsequent cortical cold injury in rats. Neurobiology of Disease,8(6), 964–973.


80. Nielsen, J., et al. (2009). Role of glial cell line-derivedneurotrophic factor (GDNF)-neural cell adhesion molecule(NCAM) interactions in induction of neurite outgrowth andidentification of a binding site for NCAM in the heel region ofGDNF. The Journal of Neuroscience, 29(36), 11360–11376.

81. Ma, Y., et al. (2011). VEGF protects rat cortical neuronsfrom mechanical trauma injury induced apoptosis via theMEK/ERK pathway. Brain Research Bulletin, 86 (5–6),441–446.

82. Moidunny, S., et al. (2010). Interleukin-6-type cytokines inneuroprotection and neuromodulation: oncostatin M, but notleukemia inhibitory factor, requires neuronal adenosine A1receptor function. Journal of Neurochemistry, 114 (6), 1667–1677.

83. Shyu, W. C., et al. (2008). Stromal cell-derived factor-1 alphapromotes neuroprotection, angiogenesis, and mobilization/homing of bone marrow-derived cells in stroke rats. TheJournal of Pharmacology and Experimental Therapeutics,324 (2), 834–849.

84. Zheng, W. H., et al. (2000). Insulin-like growth factor-1 (IGF-1): aneuroprotective trophic factor acting via the Akt kinase pathway.Journal of Neural Transmission, Supplement, 60, 261–272.

85. Brundin, P., et al. (1985). Survival of intracerebrally grafted ratdopamine neurons previously cultured in vitro. NeuroscienceLetters, 61(1–2), 79–84.

86. Zawada, W. M., et al. (1998). Growth factors improve immediatesurvival of embryonic dopamine neurons after transplantation intorats. Brain Research, 786(1–2), 96–103.

87. Biella, G., et al. (2007). Differentiating embryonic stem-derivedneural stem cells show a maturation-dependent pattern of voltage-gated sodium current expression and graded action potentials.Neuroscience, 149(1), 38–52.

88. Haider, H., & Ashraf, M. (2010). Preconditioning and stem cellsurvival. Journal of Cardiovascular Translational Research, 3(2),89–102.

89. Mehta, V., et al. (1998). Enhancement of graft survival and senso-rimotor behavioral recovery in rats undergoing transplantation withdopaminergic cells exposed to glial cell line-derived neurotrophicfactor. Journal of Neurosurgery, 88(6), 1088–1095.

90. van der Woude, F. J., Schnuelle, P., & Yard, B. A. (2004).Preconditioning strategies to limit graft immunogenicity and coldischemic organ injury. Journal of Investigative Medicine, 52(5),323–329.

91. Yau, T. M., et al. (2005). Increasing transplanted cell survival withcell-based angiogenic gene therapy. Annals of Thoracic Surgery,80(5), 1779–1786.

92. Hebb, A. O., et al. (2003). Glial cell line-derived neurotrophicfactor-supplemented hibernation of fetal ventral mesencephalic neu-rons for transplantation in Parkinson disease: long-term storage.Journal of Neurosurgery, 98(5), 1078–1083.

93. Apostolides, C., et al. (1998). Glial cell line-derived neurotrophicfactor improves intrastriatal graft survival of stored dopaminergiccells. Neuroscience, 83(2), 363–372.

94. Granholm, A. C., et al. (1997). Glial cell line-derived neurotrophicfactor improves survival of ventral mesencephalic grafts to the 6-hydroxydopamine lesioned striatum. Experimental Brain Research,116(1), 29–38.

95. Kastin, A. J., Akerstrom, V., & Pan, W. (2003). Glial cell line-derived neurotrophic factor does not enter normal mouse brain.Neuroscience Letters, 340(3), 239–241.

96. Kirik, D., Georgievska, B., & Bjorklund, A. (2004). Localizedstriatal delivery of GDNF as a treatment for Parkinson disease.Nature Neuroscience, 7(2), 105–110.

97. Gill, S. S., et al. (2003). Direct brain infusion of glial cell line-derived neurotrophic factor in Parkinson disease. Nature Medicine,9(5), 589–595.

98. Lang, A. E., et al. (2006). Randomized controlled trial ofintraputamenal glial cell line-derived neurotrophic factor infusionin Parkinson disease. Annals of Neurology, 59(3), 459–466.

99. Nutt, J. G., et al. (2003). Randomized, double-blind trial of glial cellline-derived neurotrophic factor (GDNF) in PD. Neurology, 60(1),69–73.

100. Patel, N. K., et al. (2005). Intraputamenal infusion of glial cell line-derived neurotrophic factor in PD: a two-year outcome study.Annals of Neurology, 57(2), 298–302.

101. Salvatore, M. F., et al. (2006). Point source concentration of GDNFmay explain failure of phase II clinical trial. ExperimentalNeurology, 202(2), 497–505.

102. Barnes, C. P., et al. (2007). Nanofiber technology: designing thenext generation of tissue engineering scaffolds. Advanced DrugDelivery Reviews, 59(14), 1413–1433.

103. Schlosshauer, B., et al. (2006). Synthetic nerve guide implants inhumans: a comprehensive survey. Neurosurgery, 59(4), 740–747.discussion 747-8.

104. Walker, P. A., et al. (2009). Advances in progenitor cell therapyusing scaffolding constructs for central nervous system injury. StemCell Reviews, 5(3), 283–300.

105. Hamm, R. J., et al. (1994). The rotarod test: an evaluation of itseffectiveness in assessing motor deficits following traumatic braininjury. Journal of Neurotrauma, 11(2), 187–196.

106. Jones, B. J., & Roberts, D. J. (1968). The quantiative measurementof motor inco-ordination in naive mice using an acelerating rotarod.The Journal of Pharmacy and Pharmacology, 20(4), 302–304.

107. Minnich, J. E., et al. (2010). Glial cell line-derived neurotrophicfactor (GDNF) gene delivery protects cortical neurons from dyingfollowing a traumatic brain injury. Restorative Neurology andNeuroscience, 28(3), 293–309.

108. Sulejczak, D., et al. (2008). Apoptotic death of cortical neuronsfollowing surgical brain injury. Folia Neuropathologica, 46(3),213–219.

109. Boscia, F., et al. (2009). GDNF selectively induces microglialactivation and neuronal survival in CA1/CA3 hippocampal regionsexposed to NMDA insult through Ret/ERK signalling. PLoS One,4(8), e6486.

110. Nicole, O., et al. (2001). Neuroprotection mediated by glial cellline-derived neurotrophic factor: involvement of a reduction ofNMDA-induced calcium influx by the mitogen-activated pro-tein kinase pathway. The Journal of Neuroscience, 21 (9),3024–3033.

111. Treanor, J. J., et al. (1996). Characterization of a multicomponentreceptor for GDNF. Nature, 382(6586), 80–83.

112. Cheung, E. C., & Slack, R. S. (2004). Emerging role for ERK as akey regulator of neuronal apoptosis. Science's STKE, 2004(251),PE45.

113. Allan, L. A., et al. (2003). Inhibition of caspase-9 through phos-phorylation at Thr 125 by ERK MAPK. Nature Cell Biology, 5(7),647–654.

114. Yoon, B. S., et al. (2010). Secretory profiles and wound healingeffects of human amniotic fluid-derived mesenchymal stem cells.Stem Cells and Development, 19(6), 887–902.

115. Mirabella, T., et al. (2011). Amniotic liquid derived stem cells asreservoir of secreted angiogenic factors capable of stimulating neo-arteriogenesis in an ischemic model. Biomaterials, 32(15), 3689–3699.

116. Taylor, H., et al. (2013). Clearance and toxicity of recombinantmethionyl human glial cell line-derived neurotrophic factor(r-metHu GDNF) following acute convection-enhanced deliveryinto the striatum. PLoS One, 8(3), e56186.

117. Schmeer, C., et al. (2002). Dose-dependent rescue of axotomized ratretinal ganglion cells by adenovirus-mediated expression of glialcell-line derived neurotrophic factor in vivo. European Journal ofNeuroscience, 15(4), 637–643.


Documents

Neuroprotective Effects of GDNF-expressing Human Amniotic Fluid Cells