Di Giovanni et al.

In vivo and in vitro characterization of novel neuronal plasticity factors identified

following spinal cord injury

Simone Di Giovanni1, 2∗, Andrea De Biase2∗, Alexander Yakovlev1, Tom Finn1, Jeanette

Beers1, Eric P. Hoffman2, Alan I. Faden1

∗These authors equally contributed to this work

Abbreviated Title: Neuronal plasticity after spinal cord injury

1Department of Neuroscience Georgetown University Medical Center Washington DC 20057 Telephone: (202) 687-0492

2Center for Genetic Medicine Children’s National Medical Center Washington DC 20010 Telephone: (202) 884-6011

Correspondence: Alan I. Faden, MD, or Simone Di Giovanni, MD Department of Neuroscience Georgetown University School of Medicine 3900 Reservoir Road, NW Washington, DC 20057 e.mail: fadena@georgetown.edu or sd69@georgetown.edu Number of figures and tables: 10 Number of pages: 33 Keywords: spinal cord, microarray, plasticity, coronin 1b, rab13, ninjurin Acknowledgments: This work was supported by the National Institute of Health contract NIH-NINDS-01 (NS-1-2339) (to AIF and EPH), and an NIH Programs in Genomic Applications grant U01 HL66614 HOPGENE (to EPH). We would like to thank Bogdan Stoica for assistance using confocal microscope.

1

JBC Papers in Press. Published on November 1, 2004 as Manuscript M411975200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

SUMMARY Following spinal cord injury, there are numerous changes in gene expression that appear

to contribute to either neurodegeneration or reparative processes. We utilized high

density oligonucleotide microarrays to examine temporal gene profile changes after

spinal cord injury in rats with the goal of identifying novel factors involved in neural

plasticity. By comparing mRNA changes that were coordinately regulated over time with

genes previously implicated in nerve regeneration or plasticity, we found a gene cluster

whose members are involved in cell adhesion processes, synaptic plasticity and/or

cytoskeleton remodeling. This group, which included the small GTPase rab13 and actin

binding protein coronin 1b, showed significantly increased mRNA expression from 7 - 28

days after trauma. Over-expression in vitro using PC-12, neuroblastoma, and DRG

neurons demonstrated that these genes enhance neurite outgrowth. Moreover, RNAi

gene silencing for coronin1b or rab13 in NGF treated PC-12 cells markedly reduced

neurite outgrowth. Coronin 1b and rab13 proteins were expressed in cultured DRG

neurons at the cortical cytoskeleton, and at growth cones along with the pro-

plasticity/regeneration protein GAP-43. Finally, coronin 1b and rab13 were induced in

the injured spinal cord, where they were also co-expressed with GAP-43 in neurons, and

axons. Modulation of these proteins may provide novel targets for facilitating restorative

processes after spinal cord injury.

2

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

INTRODUCTION

Traumatic injury to the spinal cord induces delayed biochemical responses that affect

both cell loss and subsequent repair. Modulation of reparative processes includes factors

involved in either facilitating or inhibiting neurite outgrowth, which are often regulated at

the gene and protein levels after injury. Collectively, these factors likely determine in part

the degree of anatomical and functional recovery after injury.

“Regeneration-associated proteins” (RAGs) appear to play a role in plasticity and

regeneration following SCI. These include transcription factors (c-jun), cytoskeletal

components (Tα1), microtubule associated proteins, growth associated proteins (GAP-43,

CAP-23), cell adhesion molecules (N-CAM, L1, TAG1), neurotrophic factors, cytokines

and extracellular matrix components (SNAP25, munc13, and cpg15/neuritin) (1-10). In

some cases, these factors share common molecular pathways. GAP-43 and CAP-23 bind

downstream to the cofactor PI(4,5)P(2), at plasmalemmal rafts, contributing to the

regulation of actin and modulating neurite outgrowth in neuronal-like cell lines (11, 12).

In other instances, a common downstream effector, such as neurotrophin dependent

intracellular cAMP, may serve to facilitate axonal regeneration by overcoming inhibition

from factors such as myelin associated glycoprotein (MAG) (13-15).

Microarray technology provides a powerful tool for identifying molecular

pathways involved in either endogenous neurotoxicity or regeneration/plasticity after SCI

(16-19). It allows concurrent analysis of thousands of genes and the identification of

clusters of coordinately regulated transcripts sharing similar functions.

Previously we reported early changes following spinal cord injury in rats,

showing induction of specific cell cycle genes (gadd45a, c-myc, cyclin D1 and cdk4,

3

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

pcna, cyclin G, Rb, and E2F5) that were closely associated with post-traumatic apoptosis

(18). Here, we focused on later time points to identify genes potentially associated with

neuronal plasticity and neurite outgrowth after SCI, by evaluating temporal gene profiles

that were coordinately regulated with expression profiles of known pro-plasticity factors.

A stringent temporal correlation analysis of the profiles and subsequent functional

classification allowed identification of 6 genes belonging to a specific gene cluster, which

was over-expressed between 7 and 28 days after injury, and whose members are involved

in neuronal plasticity, neurite outgrowth, and synaptogenesis. Over-expression of these

genes in PC-12, SH-SY5 neuroblastoma cell lines, or DRG neurons in vitro significantly

promoted neurite outgrowth. Novel members of this cluster: coronin 1b and rab13, were

further characterized in vivo, and in vitro, and their role in neuronal differentiation and

neurite outgrowth was studied using RNAi gene silencing. Based upon these in vitro and

in vivo observations, we propose a role for these genes in neuronal plasticity after injury.

EXPERIMENTAL METHODS

Experimental spinal cord injury and expression profiling

Mild contusion spinal cord injury was performed in rats, as previously described

(18). Briefly, male Sprague-Dawley rats (275-325 gm) were anesthetized with sodium

pentobarbital (65mg/Kg, i.p.). Injury was induced using a weight drop method (10 g

dropped from 17.5 mm). Animals with this injury level show mild motor impairment on

the Basso, Beattie, Breshnahan scale, averaging 12±1, 14±1, and 17±1 respectively at 7,

14, and 28 days after injury. Animals were fully anesthetized with sodium pentobarbital

(67 mg/Kg) during the operative procedures and experiments complied fully with the

4

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

principles set forth in the “Guide for the Care and Use of Laboratory Animals” prepared

by the Committee on Care and Use of Laboratory Animals of the Institute of Laboratory

Resources, National Research Council (DHEW Pub. No. (NIH) 85-23, 2985).

A 1 cm section of the spinal cord, centered at T-9, was dissected, and immediately

frozen in liquid nitrogen. Spinal cords were collected from 4 injured and 2 sham-operated

rats (receiving only laminectomy) for each time point (4 hours, 24 hours, 7, 14, and 28

days (3 animals) and two naïve controls (rats that did not undergo any surgical procedure)

for a total of 31 animals. Seven micrograms of total RNA was used for complementary

DNA (cDNA) and biotinylated complementary RNA (cRNA) synthesis. Expression

profiling analysis was performed using the Affymetrix rat U34 A, B, and C arrays. Each

genechip was used for a single hybridization with RNA isolated from one spinal cord

sample from a single animal. Total of samples was 31.

Expression profiling was performed as described previously (18). Briefly, RNA

was extracted from each cord sample individually using TRIzol reagent (Invitrogen) and

processed for chip hybridization using the manufacturers protocol (Affymetrix).

Microarray (genechip) quality control and normalizations

We employed stringent quality control methods as previously published and

detailed on our Web site: (http://pepr.cnmcresearch.org/browse.do). Expression profiles

utilized for analysis fulfilled all quality control measures as detailed in previous papers

(18, 21). We used two normalization processes: one for chip-chip comparisons (scaling

factors), and one for temporal analysis (normalization to the average of the naïve signal

intensities for each gene). The scaling factors determinations were done using default

5

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Affymetrix algorithms (MAS 5) with a target intensity of chip sector fluorescence to 800.

Both pre-amplification (s1) and post –amplification with streptavidin/phycoerythrin (s2)

scans were done, and the scans compared by scatter plots and correlation coefficients.

Those probe sets showing evidence of saturation of the PMT in s2 were flagged.

Data scrubbing and statistical analysis

We have recently shown that use of Affymetrix MAS 5.0 signal intensity values,

together with a “present call” noise filter achieves an excellent signal/noise balance

relative to other probe set analysis methods (dchip, RMA) (39) . Data analyses were

limited to probe sets that showed 1 or more “present” (P “calls”) in the 79 genechip

profiles in our complete dataset. Experiment normalization was performed by

normalizing gene chips from injured and sham controls to the mean of the two chips from

naïve animals considered as the baseline gene expression level. Normalized data were

then compared for differential gene expression analysis across time points between sham

and injured groups. Genes that showed a Welch ANOVA t-test p value < 0.05 between

sham and injured groups for at least one time point were retained for further analysis.

Initial data analysis also included a fold change filter of >1.5 (50% difference) increase or

decrease relative to sham operated animals (Affymetrix MAS 5.0). While a p value of

<0.05 alone would give many false positives, the combination of present call filters, fold

change thresholds, and p values thresholds, eliminates most false positives that are

obtained with only p<0.05.

6

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Real time-RT-Multiplex-PCR

We studied selected transcripts by real time PCR using cDNAs extracted from cords of

rats subject to spinal cord trauma and sham controls in parallel experiments, at the time

point 14 days, to validate our microarrays findings. Fluorophore-labeled LUX primers

(forward) and their unlabeled counterparts (reverse) were provided by Invitrogen. LUX

primers were designed matching the probe sets sequences for ninjurin, rap1b, rab13 and

coronin 1b and all primers were designed using the software called LUX Designer

(Invitrogen, www.invitrogen.com/lux). Each primer was chosen matching the target

probe set sequence for the gene of interest. More in detail, primer sequences were:

ninjurin (forward: caccttTCCTGTTCACAGCCCAAGG5G), reverse:

(TCTTCATGGCTTTGCATCCAG), rab13 (forward:

cacactgAGACAAGTGCCAAATCCAGTG5G), (reverse:

TCAGTGCTTGAGGGCTTGCT), rap1b (forward: cacgaCTCCCTTGCTTGCTCG5G),

(reverse: TTCCCACATTCACATCCACA), and coronin 1b (forward:

caccaTAGAGGACTGCACTGTCATGG5G), (reverse: GCACATTTCGGGCTGTGG).

We performed multiplex PCR using each experimental gene with the housekeeping gene

GAPDH. For each sample, as previously detailed, 50 µl PCR contained 2 µl cDNA,

10 µM of each gene-specific primer (two pairs for multiplex PCR) and 1X Platinum

Quantitative PCR SuperMix-UDG (Invitrogen). Reactions containing fluorogenic LUX

primers included 1X SuperMix and were incubated at 25°C for 2 min, 95°C for 2min, and

then cycled (45×) using 95 C for 15s, 55 C for 30s, and 72 C for 30s, and reactions were

incubated at 40°C for 1min and then ramped to 95°C over a period of 19min followed by

incubation at 25°C for 2min (ramp for melting-curve analysis). Reactions were conducted

7

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

in a 96-well spectrofluorometric thermal cycler (ABI PRISM 7700 Sequence detector

system, Applied Biosystems). Fluorescence was monitored during every PCR cycle at the

annealing or extension step and during the post-PCR temperature ramp. Fold changes

were calculated following manufacture instructions (Invitrogen).

Immunoblotting

Cords used for immunoblotting included samples from three injured and two

sham spinal cords at the time points 7 and 14 days after injury. For E14 DRGs, 500-600

DRG were isolated for each time point, and cultured in six well plates. Frozen tissues

were washed once with ice-cold phosphate-buffered saline and lysed on ice in a solution

containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EGTA, 1 mM PMSF, 0.5%

NP-40, 0.25% sodium deoxycholate (SDS), leupeptin (5 µg/ml), and aprotinin (5 µg/ml).

After removal of cell debris by centrifugation, the protein concentration of the cell lysate

was determined with the BioRad protein assay reagent. A portion of the lysate (30-50 µg

of protein) was then resolved by SDS-polyacrylamide gel electrophoresis (PAGE), and

the separated proteins were transferred to a nitrocellulose filter. The filter was stained with

Ponceau S to confirm equal loading and transfer of samples, and was then probed with

specific antibodies. Immune complexes were detected with appropriate secondary antibodies

and chemiluminescence reagents (Pierce). β-Actin protein abundance was used as controls

for gel loading and transfer.

The following primary antibodies were used: rabbit polyclonal anti-coronin 1b (1:1000,

custom antibody from Betyl Laboratories), and rabbit polyclonal anti-Rab13 (1:1000,

custom antibody from Betyl Laboratories). Omission of the primary antibodies or their

replacement by pre-immune sera was used for control experiments. Immunocomplexes

8

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

were visualized with ECL chemiluminescence (Amersham).

Immunocytochemistry

Spinal cords

12 µm frozen sections from three injured and two sham spinal cords were

collected between 0.4 and 0.5 cm below or above the injury site epicenter, as previously

reported (18). Sections were incubated under the same coverslip and processed for

immunocytochemistry. They were first dried at room temperature, fixed in 4%

paraformaldehyde, rinsed in PBS and incubated with 10% normal serum and 0.2% Triton

X in PBS (goat or rabbit depending on the secondary antibodies used) for 60 min to mask

non-specific adsorption sites. Sections were then incubated overnight at 4° C with one or

more of the following primary antibodies: rabbit polyclonal anti-coronin 1b (1:100,

custom antibody from Betyl Laboratories), and rabbit polyclonal anti-Rab13 (1:100,

custom antibody from Betyl Laboratories).

Omission of the primary antibodies or their replacement by pre-immune sera was

used for control experiments. After several rinses in PBS, the sections were incubated

with the appropriate rhodamine – Alexa 488, 568 or 647-coupled secondary antibodies

(goat anti-mouse or goat anti-rabbit) for 1 hour at room temperature, and washed in PBS

before mounting the slides with aqueous medium. Double labeling was also performed

combining mouse monoclonal anti-rat neuN (1:100, Chemicon, Temecula, CA), mouse

monoclonal anti-rat beta III tubulin (1:200, Promega, Madison, WI), or mouse

monoclonal or rabbit polyclonal anti-GFAP (1:200, Chemicon, Temecula, CA); mouse

monoclonal anti-rat Myelin/Oligodendrocyte O4 (1:100, US Biological); mouse anti-rat

9

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

CD11b (1:100, Serotec, Oxford, UK), and mouse monoclonal or rabbit polyclonal anti-

GAP-43 (1:200, Chemicon, Temecula, CA), with each of the above antibodies.

Immunofluorescence was detected using confocal microscopy (Zeiss Inc.)

Dorsal Root Ganglia neurons

E14 dorsal root ganglia cells cultured in Neurobasal medium onto glass coverslips

(circular, 13 mm in diameter) coated with poly-D-lysine and laminin (Biomedical

Technologies Inc.) in 24-well plates at a density of 2.5 × 104 cells/well, were fixed after

three, five, seven, nine and fourteen days in culture, and processed for

immuncytochemistry as described above for spinal cord tissue.

Primary antibodies used included coronin 1b, and rab13, (same dilutions as

above). Each one of them was combined in double immunostaining experiments with

either mouse monoclonal or rabbit polyclonal GAP-43, or with Alexa Fluor 568

phalloidin for detection of F-actin (Molecular Probes, OR). The same secondary

antibodies used for spinal cord sections were employed in these experiments.

Immunofluorescence was detected using deconvolution microscopy (Zeiss Inc.). Clones and transfection experiments

Ninjurin, rab13, rap1b, synaptogyrin, synaptotagmin, and coronin 1b, full length

cDNA expression constructs in pCMV SPORT6 were purchased from Invitrogen Inc.

(respectively IMAGE LLAM clones #2596463; 3908502; 6150381; 5173992; and

GATEWAY Human clones #CSODG004YH12; CSODD003YH09).

PC-12 and SH-SY5 neuroblastoma cells were cultured in DMEM plus 10% FBS.

10

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Embryonic day 14 DRG neurons were removed and dissociated as previously described

(40). Briefly, E14 embryos were collected and placed in cold L-15 medium, the head and

tail removed, and skin overlaying the spinal cord cut. The spinal cord with DRG attached

was removed using fine curved forceps, the ganglia isolated, and excess meninges

trimmed. Ganglia were suspended in L-15 medium containing 0.25% trypsin and

incubated at 37 degrees for 15 minutes, fetal bovine serum was added to 10% final

concentration, washed, then dissociated by titration with a fire polished pipette. DRG

neurons were cultured in Neurobasal medium (Gibco-BRL) supplemented with B-27, 2

mM L-glutamine, 50 units penicillin-streptomycin, and 50 µg/ml of NT3. Some cultures

were treated with 1 x 10-5 flurodeoxyuridine-1 x 10-5 uridine 24 hours after plating for 2

days to reduce non-neuronal cells. Cells were transfected after 7 days in culture. For

transfection, cells were seeded onto glass coverslips (circular, 13 mm in diameter) coated

with poly-D-lysine and laminin (Biomedical Technologies Inc.) in 24-well plates at a

density of 2.5 × 104 cells/well and cultured for 72 h. Transfection experiments were

performed using the NeuroPORTER Transfection Kit (Sigma) for DRGs, and using

Lipofectomine 2000 for PC-12 and SH-SY5 cells (Invitrogen). Recombinant plasmid

DNA encoding GFP was included in transfections to monitor transfected cells. Cells were

stained with both beta III tubulin and GAP-43 (Chemicon, Temecula, California)

antibodies to identify both cell body and processes of neurons undergoing plasticity.

Neurite outgrowth was evaluated measuring the neurite length of the longest neurite per

cell counting only processes positive for GFP, beta III tubulin and GAP-43 for DRGs,

and measuring the number of PC-12 and SH-SY5 cells with neurites at least 2 times the

length cell body. Measurements were conducted in three different experiments by two

11

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

different operators. Cells were viewed using a CCD camera and analyzed with image

analysis software AxioVision 3.1 (Zeiss).

RNA interference experiments

Complementary hairpin oligonucleotides were designed using the "siRNA

Converter" Internet tool (Ambion), annealed, and cloned between BamHI and HindIII

restriction sites in pSilencerTM 3.1-H1/neo (Ambion) according to the manufacturer's

recommendations. The oligonucleotide sequences were as follows (sense and antisense,

respectively): rat coronin 1b 5'-

GATCCCAAGTTGTGCGGCAGAGCAATTCAAGAGATTGCTCTGCCGCACAACT

TTTTTTTGGAAA A-3' and 5'-

GCTTTTCCAAAAAAAAGTTGTGCGGCAGAGCAATCTCTTGAATTGCTCTGCCG

CACAACTTGG -3'; and rat rab13 5'-

GATCCCGATCCGAACTGTGGAAATATTCAAGAGATATTTCCACAGTTCGGAT

CTTTTTTGGAAA-3', and 5'-

AGCTTTTCCAAAAAAGATCCGAACTGTGGAAATATCTCTTGAATATTTCCACA

GTTCGGATCGG-3'. Oligonucletides were transfected along with eGFP plasmid DNA

using Lipofectomine 2000 (Invitrogen) for experimental samples, and with eGFP plus

naked DNA for control cells. We also employed scrambled siRNA sequences to control

for the specificity of the silencing effect (data not shown, Silencer™ Negative Control,

Ambion). Inhibitory effect of RNA interference on expression of coronin 1b was tested in

transiently transfected PC-12 cells during NGF treatment (50 ng/ml) by Western blotting

and immunofluorescence staining using anti-rat coronin antibodies (custom antibodies,

12

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Betyl Laboratories). Cells positive for eGFP and negative for coronin or rab13 staining

were compared to control cells positive for both eGFP and coronin or rab13, and were

selected for evaluation of neurite outgrowth, measuring the length of the longest neurite

per cell as detailed in previous section.

13

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

RESULTS Identification of putative pro-plasticity gene cluster induced between 7 and 28 days

following SCI

Approximately 24,000 probe sets were examined using Affymetrix high density

oligonucleotides arrays (U34 A, B, and C chips) at 4 hrs, 24 hrs, 7 days, 14 days, or 28

days after SCI. We applied a “present call” noise filter (1 in 79 arrays), fold change

thresholds (>1.5), and p value of less than 0.05 as our initial data set for preliminary

analysis and pathway identification. This analysis led to further consideration of about

6000 transcripts, of which 5% would be expected to be false positives. Files from all 79

arrays are available from our website, including .dat, .cel, and .txt files

(http://pepr.cnmcresearch.org/browse.do). This website includes an on-line time series

query tool of this data set (http://pepr.cnmcresearch.org/jsp/searchForm.jsp). The

spreadsheets showing all genes profiling preliminary analysis criteria is also available on

the website. A more complete analysis of the global gene changes have also been

previously reported by us (18).

Among the significantly altered transcripts, we searched for transcripts previously

implicated in neuronal-axonal repair and plasticity after injury. We identified a transcript

corresponding to ninjurin (nerve injury-induced protein), a cell adhesion molecule that is

up-regulated after axotomy in neurons and in Schwann cells surrounding the distal nerve

segment, and promotes neurite extension of dorsal root ganglion neurons in vitro (20).

We then used ninjurin as “anchor gene” to fish out a cluster of temporally correlated

genes that could potentially have a similar function that is involved in neuronal plasticity

after SCI. We used the gene array analysis software GeneSpring (as previously detailed,

14

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

18, 21) that allows identification of gene profiles with similar temporal regulation, and

identified a cluster of temporally correlated genes (correlation coefficient, R2=0.98) over-

expressed between 7 and 28 days after injury, that included 20 transcripts. Functional

classification showed that this group of genes was variably associated with immune

response, cell adhesion, axon migration, polarity, growth, guidance, dendrite elaboration,

plasticity and synapse formation (table 1). To further narrow the field to identify a more

specific group of temporally correlated transcripts, we performed a more stringent

correlation analysis using both Standard and Pearson correlation (R2=0.99), which

identified 5 genes other than ninjurin: coronin 1b, rab13, synaptogyrin, and

synaptotagmin (figure 1). Synaptic vesicles associated proteins synaptotagmin and

synaptogyrin have been localized at the synaptic terminals in several neuronal types and

in PC-12 cells, and play a role in synaptic plasticity, neurotransmitter release and neurite

outgrowth (for review, 22-24). Rap1 is a small GTPase involved in several signal

transduction pathways, and is induced by NGF in PC12 cells and is necessary for neurite

outgrowth (25, 26). Coronin 1b is an actin binding protein involved in cytoskeleton

remodeling (for review, 27), rab13 is another small GTPase, belonging to the rab family

of proteins, which plays a role also in cytoskeleton dynamics and vesicle transport (for

review, 28). Analogs of coronin 1b (cilpin C) and a rab family member (Rab8) have also

been localized at cellular protrusions, and neurite tips in PC-12 and SH-SY5 cells (29,

30). Therefore, based upon their temporal co-regulation with the other members of the

cluster, and upon their known or putative biological function, coronin1b, and rab13

appeared to be factors involved in neurite outgrowth and differentiation.

15

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Real time PCR confirmed microarray results

Real time PCR experiments using cDNAs from a parallel set of animals at 14

days after SCI was performed on several members of the gene cluster to validate results

obtained by microarrays. The transcripts included ninjurin, rap1b, synaptotagmin,

coronin1b, and rab13. PCR experiments confirmed that all mRNAs were increased after

injury (table 2). Gene changes ranged between about 1.5 to 2.6 fold changes in

microarray experiments, while a wider range of changes was present after real time PCR,

due to the extreme sensibility of this technique, from about 2 to 7.6 fold changes.

In vitro overexpression of selected gene cluster members in PC-12, SH-SY5

neuroblastoma and DRG cells promotes neurite outgrowth

In order to evaluate whether gene cluster members ninjurin, rap1b, synaptogyrin,

synaptotagmin, coronin 1b, and rab13 were involved in neuronal plasticity, we tested

them using in vitro assays. We transfected plasmid cDNAs for each gene and

overexpressed them in the neuronal like cell lines PC-12, and SH-SY5 neuroblastoma

cells, as well as in rat primary dorsal root ganglia cells (DRGs), evaluating neurite

outgrowth by measuring the longest neurite per cell, and the number of neurite branches.

Percentage of cells with neurites lengths at least two times the cell bodies were evaluated

in PC-12 and SH-SY5 neuroblastoma cells. Neurite length as percentage of length in

control cells was measured in DRGs transfected cells. Transfected genes promoted

neurite outgrowth in the two cell lines (figure 2, A, and B), as well as in DRGs (figure 2,

C). These data confirmed and extended previous findings for ninjurin, rap1,

synaptotagmin and synaptogyrin, which suggested a possible role for these factors in

16

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

neurite extension and neuronal differentiation; they also suggested a novel function for

coronin 1b, and rab13 in neurite outgrowth. The greatest effect on neurite outgrowth was

achieved with ninjurin, rab13, and coronin 1b. Ninjurin increased the number of cells

with extended neurites by 2.3 fold in PC-12 cells and by 5.2 fold in SH-SY5

neuroblastoma cells. Rab13 overexpression resulted in 2.7 and 9 fold increase

respectively in PC-12 and SH cells. Coronin 1b induced a 2.4 fold increase in PC-12 and

5.4 in SH cells. Experiments in primary neuronal cells, such as DRGs, also confirmed the

significant effect of these genes on neurite outgrowth. Ninjurin increased neurite length

by 52%, rab13 by 54%, and coronin 1b by 63% (figure 2). The number of neurite

branches was not affected by transfections.

Expression of rab13 and coronin 1b in cultured DRG neurons

Further in vitro and in vivo experiments were conducted for coronin 1b and rab13,

whose role in the nervous system is still largely unknown. To verify if coronin 1b and

rab13 protein expression were regulated during neurite outgrowth in cultured DRG

neurons, we performed immunoblotting experiments in E14 DRG cells from days one to

seven. Coronin 1b and rab13 expression were strongly induced between one and three

days (figure 3). Immunofluorescence experiments at days one, three, five, seven, nine and

fourteen in culture showed expression for coronin 1b and rab13 in the cytoplasm, and in

particular at the cortical cytoskeleton as shown by co-localization with F-actin (data not

shown); they were also found at the neurite terminals and growth cone, where staining

pattern suggested co-localization with the pro-plasticity / regeneration marker GAP-43

(figure 4). Consistent with immunoblot experiments, an increased immunofluorescence

17

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

signal was detected for both proteins between day one and three. No difference in the

intensity of the staining was observed beyond day three (data not shown).

RNA interference experiments show that coronin 1b and rab13 repression inhibit

neurite extension in PC-12 cells after NGF

To examine whether members of this gene cluster were involved in neurite

outgrowth during differentiation, we performed gene silencing experiments using RNAi

(RNA interference) for coronin 1b and rab13 in PC-12 cells treated with NGF. Coronin

1b and rab13 RNAi gene silencing, which resulted in strong reduction of protein

expression (figure 5, panel A, and C), significantly reduced the extent of neurite

outgrowth in PC-12 cells after NGF treatment, by 53% and 44% respectively (figure 5,

panel B, and D).

Coronin 1b, and rab13 protein expression is induced after SCI preferentially in

neurons and axons undergoing plasticity

The combination of the gene expression changes in vivo and the findings from the

experiments in vitro suggested that these genes and proteins may modulate neural

plasticity in the spinal cord after injury. In accordance with gene array experiments, we

examined changes in protein expression by immunoblotting for coronin 1b and rab13 in

injured spinal cord at 7 and 14 days post-trauma and compared them to corresponding

sham samples. Both proteins were similarly increased after injury at these time points

(figure 6). We then studied expression of these proteins at the cellular level by

immunofluorescence in sham and injured spinal cords 14 days after injury. The proteins

18

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

were co-examined with cell specific markers for neurons (anti-NeuN, and anti beta III

tubulin antibody), astrocytes (anti-GFAP), oligodendrocytes (anti-O2), and microglia

(anti-CD11). Increased expression for coronin 1b and rab13 were found after injury

(figure 7, panels A, and B), primarily in the cell membrane and cytoplasm, and showed a

preferential localization in neurons. Only weak expression was detected in astrocytes or

in microglial cells (data not shown).

To study the possible involvement of these proteins in neuronal and axonal

plasticity, we examined the degree of coronin 1b, and rab13 co-expression and co-

localization with the well established pro-plasticity /regeneration protein GAP-43. Using

confocal microscopy, immunofluorescence experiments showed that the proteins were

highly expressed in GAP-43 positive neurons and axons after injury, including expression

in dorsal root ganglia, and each likely co-localized with GAP-43 (figure 8).

19

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

DISCUSSION

Using a hypothesis driven approach, combined with specific bioinformatics tools

to analyze coordinated gene expression profiles, we have identified a cluster of genes

induced between 7 and 28 days after experimental rat SCI, which appear to play a role in

neuronal plasticity and neurite outgrowth. These genes include ninjurin, coronin 1b,

rab13, synaptogyrin, synaptotagmin 1, and rap1b (Figure 1), which can be classified into

several functional classes: cytoskeleton remodeling, growth cone formation, axonal

plasticity, cell adhesion activity, and synaptogenesis. We have validated and quantified

the mRNA levels for a subset of these genes (ninjurin, rab13, Coronin 1b, rap1b, and

synaptogyrin) by real time RT-PCR in vivo at 14 days after injury, confirming microarray

results (table 2).

Certain of these genes - ninjurin, synaptotagmin, synaptogyrin, and rap1b -have

already been partially characterized in vitro and/or in vivo, and have been implicated in

axonal outgrowth, synaptic plasticity, and regeneration (20, 22-26, 33). Synaptotagmin,

and synaptogyrin are active throughout the entire synapse formation process- being

involved in vesicle docking, exocytosis, and endocytosis of synaptic vesicles- and

contribute to neurite extension (22, 33). Rap1b is a small GTPase belonging to Ras

superfamily of proteins, whose members may be involved in growth cone elongation, are

induced by NGF, and can promote neurite outgrowth (34). Rap1 itself plays a role in the

activation of the NGF dependent ERK pathway, leading to axonal elongation in PC-12

cells (26). The cell adhesion molecule ninjurin has also been reported to be induced by

peripheral nerve injury, and promotes axonal and neurite outgrowth in sciatic nerve and

DRG neurons following injury (20, 35).

20

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Neither coronin 1b nor Rab13 have been studied in the nervous system, nor have

they been implicated in plasticity or neurite sprouting. Rab13 is a small GTPase, a ras

superfamily member, which regulates intracellular vesicle trafficking to and from the

plasma membrane, and mediates exocytosis within the trans-Golgi network (TGN) (28).

Interestingly, rab 8, an analog to rab13, also belonging to TGN network, has been found

on cellular protrusions at the cortical cytoskeleton, and is co-localized with actin

filaments (30). Coronin 1b is an actin binding protein, belonging to the coronin family,

and may bind also to tubulin (27). It is important in cytoskeleton remodeling,

lamellipodia extensions and mitosis; moreover, coronin 1b and is localized to the cortical

cytoskeleton, where it is co-localized with F-actin (36, 37). It is known that cytoskeletal

organization and remodeling are essential cellular modifications during sprouting and

axonal elongation (for review, 38). Importantly, cilpin C, a human coronin-like homolog

protein, which is highly expressed in brain, has been identified in stress fibers and neurite

tips in SH-SY5 neuronal cells during neurite outgrowth (29).

Based upon these functional features of the identified gene cluster, transfection

experiments were performed in PC-12, SH neuroblastoma neuronal like cell lines, as well

as in DRG neurons, in order to examine whether expression of these genes promote

neurite elongation or sprouting. While expression of each of these genes enhanced

neurite outgrowth, ninjurin, rab13, and coronin 1b were most effective. Moreover,

coronin 1b, and rab13 RNAi experiments in PC-12 cells showed that inhibition of

coronin 1b, and rab13 protein expression reduced neurite outgrowth after NGF treatment.

While rab13 gene knock out has never been reported before, previous work in

Dictyostelium discoideum, showed that mutant cells lacking coronin grow and migrate

21

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

more slowly than wild-type cells, probably by affecting cytokinesis (31). Also, in

vertebrate cells coronin expression at lamellipodia was disrupted by overexpression of

truncated mutants, inhibiting cell spreading and locomotion (32).

In cultured DRG neurons, coronin 1b, and rab13 were also co-expressed with

GAP-43 at neurite terminals and growth cones, and their expression increased during the

first days in culture along with the increase in neurite outgrowth. Parallel studies in vivo

demonstrated that coronin 1b, and rab13 protein expression were increased at both 7 and

14 days after rat SCI. They were primarily expressed in neurons, although low level of

expression was also present in astrocytes. Moreover, they were co-expressed and likely

co-localized with the pro-regeneration marker GAP-43 in neurons and axonal membranes

throughout the spinal cord, as well as in DRGs. The possible functional relationship

between cytoskeleton and membrane bound proteins coronin 1b, rab13 with GAP-43 is

also supported by the fact that GAP-43 itself accumulates in the pseudopods of spreading

cells and interacts with cortical actin-containing filaments and the cell membrane at the

growth cones (11).

Taken together, these data support a role for coronin 1b and rab13 in neuronal and

axonal plasticity. For most effective regeneration to occur after injury, multiple molecular

pathways may need to operate together in a coordinated fashion. These include the ability

of the damaged axons to extend the growth cone, to make cell-contacts with the extra-

cellular matrix (guidance), to form connections with nearby cells, and to achieve

functional synapses. The genes and proteins in the gene cluster here described play a

known or putative role in several of the above mechanisms; together their coordinated

action may induce more effective plasticity and regeneration than that resulting from

22

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

expression of a single protein.

23

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

REFERENCES

1. Aigner L, Caroni P (1993) Depletion of 43-kD growth-associated protein in

primary sensory neurons leads to diminished formation and spreading of growth

cones. J Cell Biol. 23 (2):417-29.

2. Ernfors P, Rosario CM, Merlio JP, Grant G, Aldskogius H, Persson H. (1993)

Expression of mRNAs for neurotrophin receptors in the dorsal root ganglion and

spinal cord during development and following peripheral or central axotomy.

Brain Res Mol Brain Res. Mar;17(3-4):217-26.

3. Gloster A, Wu W, Speelman A, Weiss S, Causing C, Pozniak C, Reynolds B,

Chang E, Toma JG, Miller FD (1994) The T alpha 1 alpha-tubulin promoter

specifies gene expression as a function of neuronal growth and regeneration in

transgenic mice. J Neurosci. 14(12):7319-30.

4. Koliatsos VE, Cayouette MH, Berkemeier LR, Clatterbuck RE, Price DL,

Rosenthal A (1994) Neurotrophin 4/5 is a trophic factor for mammalian facial

motor neurons. Proc Natl Acad Sci U S A. 91(8):3304-8.

5. Aigner L, Arber S, Kapfhammer JP, Laux T, Schneider C, Botteri F, Brenner HR,

Caroni P (1995) Overexpression of the neural growth-associated protein GAP-43

induces nerve sprouting in the adult nervous system of transgenic mice. Cell

83(2):269-78.

6. Murphy PG, Grondin J, Altares M, Richardson PM (1995) Induction of

interleukin-6 in axotomized sensory neurons. J Neurosci. 7:5130-8.

7. Herdegen T, Skene P, Bahr M (1997) The c-Jun transcription factor--bipotential

mediator of neuronal death, survival and regeneration. Trends Neurosci.

24

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

20(5):227-31.

8. Jung M, Petrausch B, Stuermer CA (1997) Axon-regenerating retinal ganglion

cells in adult rats synthesize the cell adhesion molecule L1 but not TAG-1 or SC-

1. Mol Cell Neurosci. 9(2):116-31.

9. Diaz E, Ge Y, Yang YH, Loh KC, Serafini TA, Okazaki Y, Hayashizaki Y, Speed

TP, Ngai J, Scheiffele P (2002) Molecular analysis of gene expression in the

developing pontocerebellar projection system. Neuron. 36(3):417-34.

10. Li S, and Strittmatter SM (2003) Delayed systemic Nogo-66 receptor antagonist

promotes recovery from spinal cord injury. J Neurosci. 23(10):4219-27.

11. Laux T, Fukami K, Thelen M, Golub T, Frey D, Caroni P. (2000) GAP43,

MARCKS, and CAP23 modulate PI(4,5)P(2) at plasmalemmal rafts, and regulate

cell cortex actin dynamics through a common mechanism. J Cell Biol. Jun

26;149(7):1455-72.

12. Caroni P (2001) New EMBO members' review: actin cytoskeleton regulation

through modulation of PI(4,5)P(2) rafts. EMBO J. 20(16):4332-6.

13. Cai D, Deng K, Mellado W, Lee J, Ratan RR, Filbin MT (2002) Arginase I and

polyamines act downstream from cyclic AMP in overcoming inhibition of axonal

growth MAG and myelin in vitro. Neuron. 35(4):711-9.

14. Qiu J, Cai D, Dai H, McAtee M, Hoffman PN, Bregman BS, Filbin MT (2002)

Spinal axon regeneration induced by elevation of cyclic AMP. Neuron. 34(6):895-

903.

15. Snider WD, Zhou FQ, Zhong J, Markus A (2002) Signaling the pathway to

regeneration. Neuron. 35(1):13-6.

25

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

16. Carmel JB, Galante A, Soteropoulos P, Tolias P, Recce M, Young W, Hart RP

(2001) Gene expression profiling of acute spinal cord injury reveals spreading

inflammatory signals and neuron loss. Physiol Genomics. 7(2):201-13.

17. Song G, Cechvala C, Resnick DK, Dempsey RJ, Rao VL (2001) GeneChip

analysis after acute spinal cord injury in rat. J Neurochem. 79(4):804-15.

18. Di Giovanni S, Knoblach SM, Brandoli C, Aden SA, Hoffman EP, and Faden AI

(2003). Gene profiling in spinal cord injury shows role of cell cycle genes in

neuronal death. Ann Neurol. 53, 454-468

19. Bareyre FM, Schwab ME (2003) Inflammation, degeneration and regeneration in

the injured spinal cord: insights from DNA microarrays. Trends Neurosci.

26(10):555-63.

20. Araki T, Milbrandt J (1996) Ninjurin, a novel adhesion molecule, is induced by

nerve injury and promotes axonal growth. Neuron. 7 (2):353-61.

21. Di Giovanni S, Molon A, Broccolini A, Melcon G, Mirabella M, Hoffman EP,

Servidei S (2004) Constitutive activation of MAPK cascade in acute quadriplegic

myopathy. Ann Neurol. 5(2):195-206.

22. Sudhof TC (2004) The synaptic vesicle cycle. Annu Rev Neurosci. 27:509-47.

23. Fukuda M, Mikoshiba K (2000) Expression of synaptotagmin I or II promotes

neurite outgrowth in PC12 cells. Neurosci Lett. 295(1-2):33-6.

24. Janz R, Sudhof TC, Hammer RE, Unni V, Siegelbaum SA, Bolshakov VY (1999)

Essential roles in synaptic plasticity for synaptogyrin I and synaptophysin I.

Neuron. 24 (3):687-700.

25. Lu L, Anneren C, Reedquist KA, Bos JL, Welsh M (2000) NGF-Dependent

26

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

neurite outgrowth in PC12 cells overexpressing the Src homology 2-domain

protein shb requires activation of the Rap1 pathway. Exp Cell Res. 259(2):370-7.

26. Anneren C, Reedquist KA, Bos JL, Welsh M (2000) GTK, a Src-related tyrosine

kinase, induces nerve growth factor-independent neurite outgrowth in PC12 cells

through activation of the Rap1 pathway. Relationship to Shb tyrosine

phosphorylation and elevated levels of focal adhesion kinase. J Biol Chem.

275(37):29153-61.

27. de Hostos EL (1999) The coronin family of actin-associated proteins. Trends Cell

Biol. 9(9):345-50

28. Tang BL (2001) Protein trafficking mechanisms associated with neurite

outgrowth and polarized sorting in neurons. J Neurochem. 79(5):923-30.

29. Nakamura T, Takeuchi K, Muraoka S, Takezoe H, Takahashi N, Mori N (1999)

A neurally enriched coronin-like protein, ClipinC, is a novel candidate for an

actin cytoskeleton-cortical membrane-linking protein. J Biol Chem.

274(19):13322-7

30. Hattula K, Furuhjelm J, Arffman A, Peranen J (2002) A Rab8-specific GDP/GTP

exchange factor is involved in actin remodeling and polarized membrane

transport. Mol Biol Cell. 13(9):3268-80.

31. de Hostos EL, Rehfuess C, Bradtke B, Waddell DR, Albrecht R, Murphy J,

Gerisch G (1993) Dictyostelium mutants lacking the cytoskeletal protein coronin

are defective in cytokinesis and cell motility. J Cell Biol. 120(1):163-73.

32. . Mishima M, and Nishida E (1999) Coronin localizes to leading edges and is

involved in cell spreading and lamellipodium extension in vertebrate cells. J Cell

27

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Sci. 112:2833-42.

33. Detrait E R, Yoo, S., Eddleman C S, Fukuda M, Bittner, G D, and Fishman H.M

(2000) Plasmalemmal repair of severed neurites of PC12 cells requires Ca(2+)

and synaptotagmin. J Neurosci Res. 62: 566-573.

34. Mochizuki N, Yamashita S, Kurokawa K, Ohba Y, Nagai T, Miyawaki A, and

Matsuda M (2001) Spatio-temporal images of growth-factor-induced activation of

Ras and Rap1. Nature. 411: 1065-1068.

35. Long, K E, and Lemmon V (2000) Dynamic regulation of cell adhesion molecules

during axon outgrowth. J Neurobiol. 44: 230-245.

36. Humphries CL, Balcer HI, D'Agostino JL, Winsor B, Drubin DG, Barnes G,

Andrews BJ, Goode BL (2002) Direct regulation of Arp2/3 complex activity and

function by the actin binding protein coronin. J Cell Biol. 159(6):993-1004.

37. Oku T, Itoh S, Okano M, Suzuki A, Suzuki K, Nakajin S, Tsuji T, Nauseef WM,

Toyoshima S (2003) Two regions responsible for the actin binding of p57, a

mammalian coronin family actin-binding protein. Biol Pharm Bull. 26(4):409-16.

38. Dent EW, Gertler FB (2003) Cytoskeletal dynamics and transport in growth cone

motility and axon guidance. Neuron. 40(2):209-27.

39. Seo J, Bakay M, Chen YW, Hilmer S, Shneiderman B, Hoffman EP (2004)

Optimizing signal/noise ratios in expression profiling: project-specific algorithm

selection and detection p value weighting in affymetrix microarrays.

Bioinformatics. Apr 29 [Epub ahead of print]

40. Fedoroff S, and Richardson A (2001). Protocols for Neural Cell Culture, 3rd

edition. Humana Press, pages 95-100.

28

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

FIGURE LEGENDS

Table 1. Table showing comparison of expression levels between sham and injured

cords for ninjurin cluster transcripts induced 14 days after SCI. These transcripts

represent genes that are temporally co-regulated with ninjurin gene based upon a

Standard correlation coefficient R2: 0.98. Genebank, gene names, fold changes and p

values are reported for each transcript.

Figure 1. Dendogram showing temporally co-regulated transcripts induced between

7 and 28 days after SCI.

Shown is a dendogram (gene tree) obtained using ninjurin as anchor gene to

nucleate co-regulated transcripts based upon a correlation coefficient R2: 0.99 (both

Standard and Pearson correlation). Expression levels in sham and injured cords at

different time points after SCI are represented with a specific color code. Bar graph on

the right shows the color code for gene expression level from low (blue) to high (red).

These transcripts are up-regulated between 7 and 28 days after SCI (asterix indicates a

Welch t test p value <0.05 between sham and injured at the corresponding time point).

Table 2. Table shows comparison of mRNA changes by Affymetrix and real time

RT-PCR for several transcripts up-regulated 14 days following SCI.

Figure 2. Over-expression of ninjurin cluster members in PC-12, neuroblastoma SH-

SY5 cells and DRG neurons promotes neurite outgrowth.

29

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Shown are bar graphs documenting increased neurite length of eGFP positive

cells after co-transfection with eGFP, and respectively with ninjurin; rab13; coronin 1b;

rap1b; synaptogyrin; synaptotagmin in PC-12 cells (panel A), in SH-SY5 neuroblastoma

cells (panel B), and DRG neurons (panel C). Bar graphs show difference in neurite

outgrowth between cells transfected with eGFP plus naked DNA, and eGFP plus each

experimental gene 72 hours after transfection (panel A-C). Number of transfected cells

with neurites at least 2X the diameter of the cell body is reported for PC-12 (panel A),

and SH-SY5 neuroblastoma cells (panel B). Length of the longest neurite per cell was

measured for DRG neurons and neurite length in ninjurin, coronin, and rab13 transfected

cells was compared to control GFP transfected cells and expressed as percentage of

control (panel C). For all experiments asterix represents significant t test p values <0.01.

Figure 3. DRG neurons time course shows increased neurite outgrowth and

increased protein expression from day one to three, and seven for coronin 1b and

rab13.

Panels A, B, C. Phase contrast images of representative DRG neurons in culture at day

one, three, and seven. Shown is increased neurite outgrowth in DRG neurons from day

one, to day three and seven.

Panel D. Shown is immunoblotting for coronin 1b and rab13 in E14 DRG neurons in

culture in the time course 1, 3, and 7 days.

Expression for coronin 1b and rab13 is strongly increased by day 3 in culture in DRG

neurons. Thirty micrograms of proteins were run on a 12% polyacrilamide gel for each

sample. Beta-actin is shown as loading control.

30

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Figure 4. Immunocytochemistry shows expression and localization of rab13 and

coronin 1b in GAP-43 positive cultured DRG neurons.

Shown is co-localization for coronin 1b (A, D) with GAP-43 (B, E), merged (C,

F), and for rab 13 (G, J) with GAP-43 (H, K), merged (I, L) in 7 days old DRG neurons

in culture. Staining for both coronin 1b, rab 13 and GAP-43 shows cytoplasmic

localization in the cell body, and expression in neurites, including at the growth cone

(labeled with G: A-C, and G-I). Panels D-F, and J-L are magnification of the growth cone

(G) from panels A-C, and G-I. Visible is the typical dotted staining at the growth cone for

GAP-43, as well as for coronin 1b and rab13. Original magnification: 400x (A-C, G-I);

850x (D-F, G-L)

Figure 5. RNA interference shows reduction of coronin 1b and rab13 protein levels,

and inhibition of neurite outgrowth in PC-12 after NGF.

Shown is the effect of coronin 1b and rab13 RNAi upon coronin and rab13

protein expression and neurite elongation in PC-12 cells after NGF.

Immunoblotting shows strong reduction of coronin 1b (panel A), and rab13 (panel

C) expression after siRNA delivery in PC-12 cells. β-actin is shown for protein

normalization.

Bar graphs show the inhibitory effect of coronin 1b (panel B), and rab13 (panel D)

siRNA delivery upon neurite length during NGF treatment (72 hours). Bar graphs

represent neurite length (measuring the length of the longest neurite per cell) expressed as

percentage of neurite length in control transfected cells (eGFP). Experimental cells were

31

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

transfected with either coronin or rab13 siRNA and eGFP. Cells considered in the

measurements were cells positive for GFP, and with no immunoreactivity for coronin 1b

or rab13 staining, due the gene silencing effect, compared to control cells positive for

GFP and either coronin 1b or rab13 (asterix, t test p values <0.01). Neurite lenghts are

reduced to 53% of control in coronin 1b silenced cells, and to 44% in rab13 RNAi

experiments.

Figure 6. Immunoblotting shows induction of coronin 1b, and rab13 protein

expression at 7 and 14 days following SCI.

Immunoblotting at 7 and 14 days after SCI in sham and injured cords in duplicate

shows increased expression for coronin 1b, rab13 and ninjurin in injured cords. Fifty

micrograms of protein were loaded on a 12% polyacrilamide gel for each sample. β-actin

is shown for protein normalization.

Figure 7. Immunocytochemistry shows induction of coronin 1b, and rab 13 protein

expression in neurons at 7 and 14 days following SCI.

Double immunofluorescence in cross sections of spinal cord (ventral horns, 0,4-

0.5 cm below the injury site epicenter ) shows staining for coronin 1b (panel A), and rab

13 (panel B), and neuronal marker NeuN. Coronin 1b, and rab 13 (B, E) co-localize with

NeuN (A, D), merged (C, F) in sham (A-C) and injured cords (D-E) 14 days after SCI.

Coronin 1b, and rab 13 expression in neurons is much more intense in injured than in

sham cords. Original magnification: 125x

32

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Figure 8. Immunocytochemistry shows co-localization of coronin 1b, and rab13 with

GAP-43 in neurons and axons in dorsal root ganglia and dorsal horns in injured

cords 14 days after SCI.

Confocal microscopy immunofluorescence images show expression of coronin 1b

and rab13 along with pro-plasticity marker GAP-43 in dorsal root ganglia, and dorsal

horns of spinal cord 14 days following SCI (0.4-0.5 cm below the injury site epicenter).

Panel A. Cross sections of dorsal root ganglia fibers are positively stained for

coronin 1b (A), and for GAP-43 (B), and show membrane co-localization in all fibers

(merged, C). Cross sections of spinal cord (dorsal horns) show expression of coronin 1b

plus NeuN (D, red nuclear staining for NeuN and green cytoplasmic and membrane

staining for coronin 1b), GAP-43 (E), and coronin 1b plus GAP-43 (merged, F). Coronin

1b, and GAP-43 co-expression and co-localization is shown in neurons (arrowhead, F)

and axons (arrows, F) in cytoplasm and membrane. Immunostaining for neuronal

membrane specific marker beta III tubulin was also performed, and showed an identical

ring-like expression pattern (F, arrows) in the same cross sections (not shown).

Panel B. Cross sections of dorsal root ganglia fibers are positively stained for

rab13 (A), and for GAP-43 (B), and merged (C). Rab13 shows membrane co-localization

with GAP-43 in fibers (arrows, C), and cytoplasmic and membrane co-expression in a

cell body (arrowhead, C). Cross sections of spinal cord (dorsal horns) show expression of

rab13 plus NeuN (D, red nuclear staining for NeuN and green cytoplasmic and membrane

staining for rab13), GAP-43 (E), and rab13 plus GAP-43 (merged, F). Rab13, and GAP-

43 co-expression and co-localization are shown in neurons (arrowhead, F) and axons

(arrows, F) in cytoplasm and membrane. Original magnification: 400x

33

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

34

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

35

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

36

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

37

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

38

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

39

Figure 4

A B C

G G G

D E F

G H I

G G G

J K L

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

40

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

41

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

42

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Di Giovanni et al.

Figure 8

A.

B C A

B.

F E D

A B C

F E D

43

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Eric P. Hoffman and Alan I. FadenSimone Di Giovanni, Andrea De Biase, Alexander Yakovlev, Tom Finn, Jeanette Beers,

following spinal cord injuryIn vivo and in vitro characterization of novel neuronal plasticity factors identified

published online November 1, 2004J. Biol. Chem. 

  10.1074/jbc.M411975200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 12, 2020http://w

ww

.jbc.org/D

ownloaded from