Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/320588407

NeitherPhoebenorCinnamomum-thetetrasporangiatespeciesofAiouea(Lauraceae)

ArticleinTaxon·October2017

DOI:10.12705/665.6

CITATION

1

READS

167

7authors,including:

Someoftheauthorsofthispublicationarealsoworkingontheserelatedprojects:

StudiesonPteridiumfromSouthAmericaViewproject

REDS-IIViewproject

RandiRohde

UniversityofHamburg

1PUBLICATION1CITATION

SEEPROFILE

BarbaraRudolph

UniversityofHamburg

35PUBLICATIONS274CITATIONS

SEEPROFILE

PedroMoraes

SãoPauloStateUniversity

88PUBLICATIONS403CITATIONS

SEEPROFILE

JieLi

XishuangbannaTropicalBotanicalGarden

1,162PUBLICATIONS9,645CITATIONS

SEEPROFILE

AllcontentfollowingthispagewasuploadedbyRandiRohdeon28October2017.

Theuserhasrequestedenhancementofthedownloadedfile.

1085Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Received: 2 Dec 2016 | returned for (first) revision: 20 Jan 2017 | (last) revision received: 22 May 2017 | accepted: 22 May 2017 || publication date(s): online fast track, n/a; in print and online issues, 24 Oct 2017 || © International Association for Plant Taxonomy (IAPT) 2017

INTRODUCTION

The Lauraceae are the largest woody family of the Magnoliidae and are commonly found in moist tropical and subtropical forests of Central and South America, Africa, Madagascar, the Canary Islands, Asia, and Australia (Rohwer, 1993a). The family consists of about 50 genera and approxi-mately 2500 to 3500 species as estimated by Rohwer (1993a). In the past, morphology-based delimitations of genera appeared complicated and resulted in divergent classifications based on the importance of specific characters emphasized by differ-ent authors (Rohwer, 1993a; Van der Werff & Richter, 1996). Molecular studies, however, turned out to be largely congruent, and revealed that several traditional genera were polyphyletic

Neither Phoebe nor Cinnamomum – the tetrasporangiate species of Aiouea (Lauraceae)Randi Rohde,1 Barbara Rudolph,1 Kristina Ruthe,1 Francisco G. Lorea-Hernández,2 Pedro Luis Rodrigues de Moraes,3 Jie Li4 & Jens G. Rohwer1

1 Universität Hamburg, Biozentrum Klein Flottbek, Ohnhorststr. 18, 22609 Hamburg, Germany2 Instituto de Ecología, Apartado Postal 63, 91000 Xalapa, Veracruz, Mexico3 Universidade Estadual Paulista “Júlio de Mesquita Filho”, Departamento de Botânica, Av. 24 A 1515, Bela Vista, Rio Claro,

São Paulo, CEP 13506-900, Caixa Postal 199, Brazil4 Plant Phylogenetics and Conservation Group, Centre for Integrative Conservation, Xishuangbanna Tropical Botanical Garden,

Chinese Academy of Sciences, 88 Xuefu Rd., Kunming, Yunnan 650223, ChinaAuthor for correspondence: Jens G. Rohwer, Jens.Rohwer@uni-hamburg.deORCID JGR, http://orcid.org/0000-0001-8560-9015

DOI https://doi.org/10.12705/665.6

Abstract Cinnamomum is among the largest genera of the Lauraceae, including species from tropical to temperate Asia and from tropical to subtropical America. However, previous studies indicated that Cinnamomum might not be monophyletic in its current circumscription. We therefore re-investigated the genus and possible relatives with an increased taxon sample, particularly of the Neotropical species. Our results, based on sequences of the nuclear ITS region and the chloroplast spacers psbA-trnH and trnG-trnS, show that the Neotropical Cinnamomum species indeed do not form a monophyletic group with the Paleotropical species. Instead, the American species form a clade in which most species of the Neotropical genus Aiouea are nested within several subclades. According to the ITS data the Aiouea/Cinnamomum clade is sister to the likewise predominantly Neotropical Ocotea complex, rather than the two Paleotropical Cinnamomum clades. Therefore, Cinnamomum cannot be upheld in its cur-rent circumscription. As the type C. verum, is from Asia, the Neotropical species need to be placed in a different genus. We decided to transfer them to Aiouea here, because this is the oldest generic name in the Aiouea/Cinnamomum clade, and the only character separating Aiouea from Neotropical Cinnamomum is the number of pollen sacs per anther (di- vs. tetrasporangiate), a feature that is known to be variable within several other genera as well. This transfer requires 42 new combinations and two nomina nova. In addition, six species described in the unpublished Ph.D. thesis of one of the authors (FLH) are validated in Aiouea here, and the only species of the genus Mocinnodaphne is transferred to Aiouea as well.

Keywords Aiouea; Cinnamomum; cpDNA; ITS; Lauraceae; Mocinnodaphne; Neotropics; phylogeny; psbA-trnH; trnG-trnS

Supplementary Material Electronic Supplement (results of maximum parsimony, Bayesian inference, and maximum likeli-hood analyses of the ITS, cpDNA and combined datasets, and the full descriptions, paratype data and discussions of the newly described species) and DNA sequence alignments, are available in the Supplementary Data section of the online ver-sion of this article at http://ingentaconnect.com/content/iapt/tax

(Rohwer, 2000; Chanderbali & al., 2001; Chanderbali, 2004; Rohwer & al., 2009; Li & al., 2011). According to the results of Chanderbali & al. (2001), Groth (2003) and Huang & al. (2016), Cinnamomum Schaeff. appears to be one of those doubtfully delimited genera. As currently circumscribed (Kostermans, 1961; Rohwer, 1993a), it includes an Old World group, predomi-nantly distributed in subtropical to tropical Asia, plus a few spe-cies in Australia and the western Pacific area, as well as a New World group in Central and South America. Rohwer (1993a) estimated the total number of species to about 350, including about 60 American species. Lorea-Hernández (1996), however, recognized only 47 Neotropical species, and many names for Asian species have since been reduced to synonymy, especially by Li & al. (2008). The American species currently placed in

1086 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Cinnamomum had been included in Phoebe Nees by Nees (1836 – except Cinnamomum montanum (Sw.) Bercht. & J.Presl), Meissner (1864) and Mez (1889). Kostermans (1961) transferred them to Cinnamomum based on characters of the fruit. Already Nees (1836) had noted that there were two distinct groups in Phoebe (in his circumscription): in the Asian species (now Phoebe s.str.) the fruit does not have a cupule, and its base is clasped by enlarged, indurate tepals (Fig. 1A), whereas in the American species there is a cupule of variable size with or without remnants of the tepals on its margin, or at least a thickened and more or less fleshy pedicel (Fig. 1B). The latter characters are also found in the Asian species of Cinnamomum (Fig. 1C, D). In addition, the American and Asian species cur-rently placed in Cinnamomum share trimerous flowers with six equal tepals, nine fertile stamens, each with (mostly) four pollen sacks placed in two pairs above each other, and three internal staminodes with sagittate glandular heads. These floral characters, however, are likely to be plesiomorphic, as they are also found in the Persea group, the sister group of the core Lauraceae (Cinnamomeae, Laureae). Molecular studies (Rohwer, 2000; Chanderbali & al., 2001; Groth, 2003; Rohwer & al., 2009; Huang & al., 2016) confirmed that the American species do not belong to the genus Phoebe and are closer to

Cinnamomum, but at the same time raised doubts about the current circumscription of Cinnamomum. The Paleotropical and Neotropical species did not form a monophyletic group, but were rather placed in different clades consisting exclusively of either Paleotropical or Neotropical species. A few Neotropical Cinnamomum species appeared nested among Ocotea Aubl., whereas the majority formed a clade with species of Aiouea Aubl. and Mocinnodaphne Lorea-Hern. (Chanderbali & al., 2001; Groth, 2003), but the nodes separating these clades were only weakly supported.

Previous molecular studies including Cinnamomum were conducted using the internal transcribed spacer region (ITS) of nuclear ribosomal DNA (Chanderbali & al., 2001; Groth, 2003; Rohwer & al., 2009; Lee & al., 2010 [ITS2]) and chloro-plast markers such as matK, trnL-trnF, rpoB, rbcL and rpl16 (Rohwer, 2000; Chanderbali & al., 2001; Kuo & al., 2010; Sudmoon & al., 2014; Swetha & al., 2014). These markers, however, did not yield substantial support values for the nodes separating the main clades of Cinnamomum. Better support for some of the main clades was found in a recent study by Huang & al. (2016) using ITS as well as two low-copy nuclear gene regions, the second intron of the LEAFY gene and a part of the rpb2 gene. This study, however, was focused on the

Fig. 1. Fruits of Phoebe and Cinnamomum species. A, Phoebe sp., almost mature (Indonesia, Bogor Botanical Garden); B, Aiouea hirsuta (“Cinnamomum hirsutum”), immature (Brazil, São Paulo, Serra da Cantareira); C, Cinnamomum wilsonii, immature (sect. Cinnamomum; China, Kunming Botanical Garden); D, Cinnamomum glanduliferum, mature (sect. Camphora; China, yard of Kunming Institute of Botany). — Scales: A, Black and white squares 1 cm wide; B–D, scale bar = 1 cm. All photos by Jens G. Rohwer.

1087Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Asian species and did not include Neotropical Lauraceae other than species of Aiouea, Cinnamomum, and Mocinnodaphne. In addition, the nuclear gene regions are difficult to amplify from herbarium material and often need cloning to separate different copies. We were looking for an alternative that could be used more easily for material of different quality. As Dong & al. (2012) have shown, highly variable chloroplast markers such as the trnK intron and the intergenic spacers trnG-trnS, trnT-psbD, rps16-trnQ, and psbA-trnH are useful for evaluating plant phylogeny at low taxonomic levels. Nie & al. (2007) con-ducted a phylogenetic analysis of Sassafras J.Presl successfully using the spacer psbA-trnH (among other markers).

In the present study, we attempt to re-evaluate the results of Chanderbali & al. (2001), Groth (2003), and Huang & al. (2016) using sequences of the chloroplast spacer regions trnG-trnS and psbA-trnH and the nuclear ribosomal marker ITS with a considerably larger taxon sample. We intend to answer the following questions: (1) Is Cinnamomum monophyletic? (2) If not, how many separate Cinnamomum clades are there? (3) Do the Neotropical species of Cinnamomum form a monophy-letic group? (4) Can we confirm the results of Chanderbali & al. (2001) and Groth (2003), which indicate that most species of Aiouea are nested among the Neotropical Cinnamomum species?

MATERIALS AND METHODS

Taxon sampling. — A total of 101 taxa were sampled, in-cluding representatives of the Cinnamomum group, Aiouea, members of the Ocotea complex sensu Chanderbali & al. (2001), Sassafras, a few Laureae, plus four species of the Persea group (Appendix 1). As previous studies (Rohwer, 2000; Chanderbali & al., 2001; Groth, 2003; Huang & al., 2016) indicated that Cinnamomum might not be monophyletic, it seemed advisable to include a wide range of Cinnamomeae sensu Chanderbali & al. (2001), in order to evaluate this hypothesis. Sassafras and the Laureae were included because they appeared as successive sister groups to the Cinnamomeae in the unconstrained ITS analysis of Chanderbali & al. (2001). The taxa of the Persea group were selected as outgroup, based on the results of pre-vious molecular studies (Chanderbali & al., 2001; Rohwer & Rudolph, 2005; Nie & al., 2007; Rohwer & al., 2009, Huang & al., 2016). Taxon sampling was also guided by availability of plant material, date of collection, geographical distribution, and success in DNA amplification and sequencing. As far as possible, we checked determination in monographs or floris-tic treatments (Kubitzki & Renner, 1982; Kostermans, 1986; Rohwer, 1986, 1993b; Lorea-Hernández, 1996; Kurz, 2000; Chanderbali, 2004; Li & al., 2008). It should be noted, however, that many samples, especially in Cinnamomum s. str., were ster-ile material, so that the determinations have to be considered preliminary. The examined material, with voucher specimens and GenBank accession numbers, is listed in Appendix 1.

DNA extraction. — Total genomic DNA was extracted from silica-gel dried samples or herbarium specimens using the innuPREP Plant DNA Kit (Analytik Jena, Jena, Germany)

according to manufacturer’s instruction, with minor modifica-tions published by Trofimov & al. (2016).

PCR amplification and sequencing. — As far as the quality of the plant material allowed, we used the primers ITS-18-F (Käss & Wink, 1997; modified by Beyra-Matos & Lavin, 1999) and ITS-H-R (Rohwer & al., 2014) to amplify the entire ITS region (ITS-1, 5.8S rDNA, ITS-2). When the DNA was more degraded, as is often the case in herbarium material, it was nec-essary to amplify the ITS region in two fragments using several additional primers in the 5.8S region, most frequently ITS-C and ITS-D (Blattner, 1999). The chloroplast spacer regions were amplified with the primers trnG(ucc)-F and trnS(gcu)-R (Hamilton, 1999), and psbA-F and trnH-R (Sang & al., 1997) or the reverse trnH primers of Klak & al. (2013) as well as newly designed internal primers. All primers used in this study are listed in Table 1.

Amplification of the ITS region including the 5.8S rDNA was performed according to Rohwer & al. (2009) adjusted to the ABI 3500 Genetic Analyzer capillary sequencer (Applied Biosystems, Carlsbad, California, U.S.A.) as described in de-tail by Rohwer & al. (2014). Reaction and program conditions were as follows, with variations for trnG-trnS and psbA-trnH in brackets: The amplification mix was composed of 2.5 mM MgCl2, 1× buffer B2, 0.2 mM dNTP (all three from BioBudget, Krefeld, Germany), 2.0 µM (2,6 µM) of each forward and re-verse primer (Sigma-Aldrich, Taufkirchen, Germany), 0.25 U Hot Start Taq DNA polymerase (BioBudget), and 20 ng DNA in a final volume of 14 µl (12 µl) per reaction tube. In order to minimize problems with secondary structures in the rather GC-rich ITS region, 10% dimethyl sulfoxide (DMSO) was added for this marker (Buckler & Holtsford, 1996; Buckler & al., 1997). For trnG-trnS 0.1 mg/ml bovine serum albumin (Fermentas, St. Leon-Rot, Germany) was added to the reaction mix. The amplification program was run with an initial denaturation at 96°C for 14 min (95°C, 15 min), followed by 40 (30) cycles of 96°C (95°C) for 30 s, 50°C (trnG-trnS: 55°C) for 30 s, and 72°C for 1 min. The last elongation step was extended by an additional phase at 72°C for 8 min. All amplifications included negative controls to detect contamination.

The PCR products were purified according to Rohwer & al. (2014), with modifications as in Trofimov & al. (2016). Pure PCR products were sequenced forward and reverse and subsequently precipitated as described by Rohwer & al. (2014) and Trofimov & al. (2016). All reactions were performed with one of the amplification primers or any of the internal primers (Table 1), if necessary. The precipitation products were sepa-rated and detected with an ABI 3500 Genetic Analyzer capillary sequencer (Applied Biosystems) following the manufacturer s instructions as summarized in Rohwer & al. (2014).

Sequence analysis. — The sequence chromatograms were first edited manually, then aligned for each individual taxon with Sequencher v.4.8 (Gene Codes Corp., Ann Arbor, Michigan, U.S.A.). Consensus sequences were created by com-paring forward and reverse fragments, with a final manual correction if necessary. Complete consensus sequences were aligned in MEGA v.6 (Tamura & al., 2013). The automatic MUSCLE alignment was followed by manual adjustments

1088 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

concerning the positions of insertions /deletions (indels) as described by Rohwer & al. (2014). Potentially informative indels were coded in an indel matrix, largely following the rules of simple indel coding (Simmons & Ochoterena, 2000). However, if there were potentially informative sequence dif-ferences within a region affected by an indel, the individual variants were coded as a multistate character (e.g., 0 = gap, 1 = A, 2 = AC, 3 = C, 4 = AA, 5 = AG). Indels resulting from single nucleotide repeats of four or more bases were not con-sidered because of high variability among different individu-als of a species and (from seven identical bases onwards) an increased likelihood of PCR artifacts. For all taxa in our core study group (Aiouea, Cinnamomum) and most of the others, we obtained the sequences for all three genome regions from the same sample. However, in Laurus nobilis L. and Sassafras tzumu (Hemsl.) Hemsl. we composed our set of sequences from

different samples, some of them downloaded from GenBank. The NEXUS files of the ITS and cpDNA datasets can be found in the Supplementary Data.

Phylogenetic analysis. — For each dataset a maximum parsimony (MP) analysis was computed with PAUP* v.4.0b10 (Swofford, 2003), a maximum likelihood (ML) analysis with TREEFINDER, version of March 2011 (Jobb, 2011), and a Bayesian inference (BI) analysis with MrBayes v.3.3.2 (Ronquist & al., 2011). The two datasets, based on the ITS region and the chloroplast markers, were analysed separately in order to identify possible conflicts due to different genome histories, as well as concatenated, excluding the taxa identi-fied as the source of conflicts in the separate analyses. The cpDNA data included fewer taxa than the ITS dataset because no sequences of the trnG-trnS spacer are available in GenBank for Aiouea guianensis Aubl., Mocinnodaphne cinnamomoidea

Table 1. Sequences of ITS and cpDNA primers used in this study.

Primer Direction Sequence Author

ITS

ITS-1 F 5′-TCCGTAGGTGAACCTGCGG-3′ White & al., 1990

ITS-18 F 5′-GTCCACTGAACCTTATCATTTAGAGG-3′ Käss & Wink, 1997; Beyra-Matos & Lavin, 1999

ITS-3 F 5′-GCATCGATGAAGAACGCAGC-3′ White & al., 1990

ITS-D F 5′-CTCTCGGCAACGGATATCTCG-3′ Blattner, 1999

ITS-L400-F F 5′-CGACTCTCGGCAACGGATATCTC-3′ Trofimov & al., 2016

ITS-L442-F F 5′-GGTGTGAATTGCAGAATCCC-3′ Trofimov & al., 2016

ITS-26 R 5′-GCCGTTACTAAGGGAATCCTTGTTAG-3′ Käss & Wink, 1997

ITS-4 R 5′-TCCTCGCTTATTGATATGC-3′ White & al., 1990

ITS-B R 5′-CTTTTCCTCCGCTTATTGATATG-3′ Blattner, 1999

ITS-C R 5′-GCAATTCACACCAAGTATCGC-3′ Blattner, 1999

ITS-CL R 5′-GCAATTCACACCAMGTATCGC-3′ Trofimov & al., 2016

ITS-H R 5′- CGGTTCGCTCGCCGTTACTA -3′ Rohwer & al., 2014

ITS-L459-R R 5′-AAGACTCGATGGTTCACGGG-3′ Trofimov & al., 2016

trnG-trnS

trnG(UCC) F 5′-GAACGAATCACACTTTTACCAC-3′ Hamilton, 1999

trnG-342-F F 5′-TCTTATGAATTCCTTGTTCCAATG-3′ this study

trnG-351-F F 5′-TTCGGGTCGATTGGATCGAGTG-3′ this study

trnG-626-R R 5′- CCAGGCCATTCCTTGTTCCAATG-3′ this study

trnG-639-Cryp-R R 5′-CCATTCCTTGTTCCAATGAATCATAG-3′ this study

trnS(GCU) R 5′-GCCGCTTTAGTCCACTCAGC-3′ Hamilton, 1999

psbA-trnH

psbA-270-F F 5′-TCTGTACCAACCTGCAWTTTAT-3′ this study

psbA-400-F F 5′-CAATATCTGTATTTCAGCAGGAAGGAG-3′ this study

psbA-F F 5′-GTTATGCATGAACGTAATGCTC-3′ Sang & al., 1997

psbA-270-R R 5′-ATTAAWTGCAGGTTGGTACAGA-3′ this study

trnH-R R 5′-CGCGCATGGTGGATTCACAAA-3′ Sang & al., 1997

trnH A8.1-R R 5′-TGGATTCACAAATCCACTGC-3′ Klak & al., 2013

trnH-2 R 5′-CGCGCATGGTGGATTCACAATCC-3′ Tate & Simpson, 2003

1089Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Lorea-Hern., Ocotea guianensis Aubl. and O. insularis (Meisn.) Mez. The psbA-trnH spacer sequences of Aiouea guianensis and Ocotea guianensis are available in GenBank, therefore we performed separate MP and BI analyses based on the psbA-trnH spacer sequences only.

In the MP analysis, a heuristic search was conducted with equally weighted characters and 100 random addition sequence replicates, tree-bisection-reconnection (TBR) branch swap-ping, MulTrees on and collapse of zero-length branches. Gaps were treated as missing data, but potentially informative indels were included as an indel matrix (see above). As the analyses rapidly accumulated more than 50,000 equally parsimonious trees, we limited the number of trees saved per replicate to 1000 (nchuck = 1000, chuckscore = [minimum length found in first or second attempt]). Branch support was estimated by bootstrap analysis (Felsenstein, 1985). A full bootstrap, however, with unlimited TBR branch swapping and an unlimited number of trees saved, was not possible with our data, as it quickly ran into overflow. We therefore limited the number of branch exchanges to 1 million per bootstrap replicate (rearrlimit = 1000000).

For the ML and BI analyses the datasets were separated into three unlinked partitions each. In the ITS dataset, separate partitions were defined for the ribosomal DNA (mainly 5.8S rDNA, plus small parts of 18S and 26S rDNA, respectively), for the two transcribed spacer regions combined (ITS-1, ITS-2), and for the indel codes. In the chloroplast dataset, separate partitions were applied to the two chloroplast spacer regions, and a third partition to the chloroplast spacer indels. Best-fitting models of sequence evolution (according to the Bayesian information criterion) for each partition including DNA were determined with TREEFINDER and with MEGA, respectively. The ML analyses were performed with a search depth of 2 and 1000 replicates, using the default parameters and the models suggested by the program (see Results). In contrast to the MP and BI analyses, the indel characters could not be used in the ML analyses. In the BI analyses, two simultaneous runs of four stepwise heated Metropolis-coupled Monte Carlo Markov chains (MCMCMC) starting from random trees were run for 5 million generations, with the current tree saved every 500 generations. The likelihood values were inspected in Microsoft Excel (Redmond, Washington, U.S.A.), and the burn-in value was chosen well above the point of convergence and below the first 25% implemented as default value in MrBayes. The remaining trees were used for constructing 50% majority-rule consensus trees in PAUP*. The tree files from the two parallel runs for each dataset were combined into a single file prior to calculating the consensus tree.

RESULTS

Sequence characters. — The alignment length of the ITS dataset was 867 positions, of which 594 were constant, 107 were variable but parsimony uninformative, and 166 were parsimony informative. In addition, 36 informative indels were included in the analysis. The cpDNA dataset had 1437 aligned positions, 964 from the trnG-trnS and 473 from the

psbA-trnH region. In addition, we included 11 informative indels in the analysis, 7 from the trnG-trnS and 4 from the psbA-trnH region. Among the 1437 cpDNA characters, 1287 were constant, 85 were variable but parsimony uninformative, and 69 were parsimony informative. The modeltest options of TREEFINDER and of MEGA led to slightly different results. MEGA suggested a Jukes-Cantor model (JC) with discrete Gamma distribution for the rDNA (i.e., 18S, 5.8S, and 26S rDNA, excluding the spacer regions), possibly be-cause of the low number of informative characters (five, in the 5.8S region only), whereas a Hasegawa-Kishino-Yano model (HKY85) with discrete Gamma distribution was suggested by TREEFINDER. For each of the other three partitions (i.e., ITS-1+ ITS-2, trnG-trnS, psbA-trnH), a Tamura 3-parameter model (T92) with discrete Gamma distribution was suggested by MEGA, whereas TREEFINDER favored a Transversional model (TVM) for the ITS-1 and ITS-2 region, a Hasegawa-Kishino-Yano model for the trnG-trnS data and a Transitional model (TIM = J3) for the psbA-trnH data.

Maximum parsimony analysis. — The MP analysis of the ITS dataset (101 taxa, number of trees saved per replicate limited to 1000 by the NCHUCK option) resulted in 23,000 most parsimonious trees which were 843 steps long, with a consistency index (CI) of 0.497 and a retention index (RI) of 0.817. The MP analysis of the cpDNA dataset (97 taxa, number of trees saved per replicate limited to 1000 by the NCHUCK option) resulted in 95,000 most parsimonious trees with 237 steps, CI = 0.722, RI = 0.904. The analysis of the combined (ITS  +  trnG-trnS +  psbA-trnH) dataset comprised only 90 taxa, due to exclusion of taxa placed in well-supported conflicting positions in the ITS and cpDNA datasets (see below). Here it was not necessary to limit the number of trees saved per repli-cate. The analysis resulted in 34,688 most parsimonious trees (CI = 0.540, RI = 0.822). The MP bootstrap consensus trees were less resolved than the trees resulting from the Bayesian analyses, but largely compatible. Therefore, they are not shown separately here, but are available in the Electronic Supplement.

Bayesian analysis. — The topologies obtained from the BI analyses of the ITS and cpDNA datasets are shown in Figs. 2–5. The outgroup including Machilus grijsii Hance, M. zuihoensis Hayata, Persea americana Mill., and Phoebe sheareri (Hemsl.) Gamble is distinctly separated from the ingroup taxa in all three analyses (posterior probability, PP = 1/0.99/1 in ITS/cpDNA/combined analysis, respectively).

Within the ingroup, there are some differences between the ITS and the cpDNA analyses, but most of the main clades are found in both of them. Although the aligned cpDNA sequences have more positions in total than the ITS dataset, the number of parsimony-informative characters is significantly lower compared to those of the ITS sequences (cpDNA 76, ITS 202). Therefore, we describe the result of the ITS analysis first (Figs. 2, 3), and then the less informative cpDNA analysis (Figs. 4, 5).

In the ITS dataset (Figs. 2, 3), the Laureae (in this analy-sis Laurus nobilis, Lindera benzoin (L.) Blume, and Neolitsea sericea) form a well-supported monophyletic group (PP 1) that is sister to the remaining ingroup taxa (PP 1). Among these, Sassafras (PP 1) appears as sister to the rest of the taxa,

1090 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Fig. 2. Result of the ITS analysis, part 1. Bayesian posterior probabilities indicated above branches, maximum parsimony bootstrap support below, maximum likelihood bootstrap support to the right of the respective nodes. + below branches indicates no parsimony bootstrap support ≥ 50% but present in strict consensus tree, + to the right of the node indicates presence in the most likely ML tree. X indicates conflict with a different weakly supported clade in MP / ML bootstrap consensus. Types of genera underlined. Genus names abbreviated: Cinm. = Cinnamomum, Laur. = Laurus, Lind. = Lindera, Mach. = Machilus, Neol. = Neolitsea, Pers. = Persea, Phoe. = Phoebe, Sass. = Sassafras.

Fig. 3. Result of the ITS analysis, part 2. Bayesian posterior probabilities indicated above branches, maximum parsimony bootstrap support below, maximum likelihood bootstrap support to the right of the respective nodes. + below branches indicates no parsimony bootstrap support ≥ 50% but present in strict consensus tree, + to the right of the node indicates presence in the most likely ML tree. X indicates conflict with a different weakly supported clade in ML bootstrap consensus. Types of genera underlined. Neotropical species of Cinnamomum and Mocinnodaphne trans-ferred to Aiouea. Genus names abbreviated: Aiou. = Aiouea, Anib. = Aniba, Cinm. = Cinnamomum, Damb. = Damburneya, Endl. = Endlicheria, Lica. = Licaria, Moci. = Mocinnodaphne, Nect. = Nectandra, Ocot. = Ocotea. Abbreviation in quotes = species to be excluded from the genus.

Cinm. verum Ksn

Cinm. verum R162

Cinm. verum L41050

Cinm. cf. iners 2009G30

Cinm. iners L31089

Cinm. dictyoneuron

Cinm. paiei

Cinm. burmannii Lsn

Cinm. burmannii Jsn

Cinm. chekiangense

Cinm. tamala

Cinm. sp. ADA47

Cinm. loureiroi

Cinm. osmophloeum

Cinm. daphnoides Hsn

Cinm. cf. polderi

Cinm. insularimontanum KCSsn

Cinm. wilsonii

Cinm. pittosporoides

Cinm. bodinieri

Cinm. glanduliferum Nsn

Cinm. camphora Lsn

Cinm. glanduliferum Rsn

Cinm. camphora Rsn

Cinm. cf. camphora G06-1425

Cinm. parthenoxylon R178

Sass. albidum

Sass. tzumu

Laur. nobilis

Neol. sericea

Lind. benzoin

Mach. grijsii

Mach. zuihoensis

Phoe. sheareri

Pers. americana

1

0.87

0.99

0.91

1

1

1

1

10.68

to Aiouea and Ocotea complex (Fig. 3)

Pers

ea g

rp.

Cin

nam

omum

s.s

tr.

1

1

Cinm. burmannii LR2010-101

1

1

1

1

Laur

eae

sect

. Cam

phor

a

BG Bochum [Asia]

BG Bayreuth [Asia]

BG Regensburg [Asia]

BG Hamburg [Asia]

Malaysia, Borneo

Malaysia, Borneo

BG Berlin [Asia]

China, cultivated

BG Frankfurt [Asia]

BG Bayreuth [Asia]

Thailand

BG Cibodas [Asia]

BG Berlin [Asia]

BG Berlin [Asia]

BG Halle [Asia]

Indonesia, Sulawesi

Korea

BG Kunming [Asia]

China, Yunnan

BG Kunming [Asia]

BG Rostock [Asia]

BG Hamburg [Asia]

BG Berlin [Asia]

BG Hamburg [Asia]

BG Munich [Asia]

BG Bayreuth [Asia]

Malaysia, Borneo

BG Hamburg [N America]

BG Bonn [Asia]

BG Hamburg [Mediterranean]

BG Hamburg [Asia]

BG Hamburg [N America]

BG Hamburg [China]

BG Hamburg [China]

BG Hamburg [China]

BG Hamburg [C America]

0.89

97

61

61

0.77

0.53

100

63

72

97

81

Sass

.

1

+

Cinm. insularimontanum Rsn BG Hamburg [Asia]

Cinm. daphnoides Lsn BG Berlin [Asia]0.98

0.58

1X

94

0.62

0.95

0.68

1

53

100

99

73

79

94

74

83

97

100

0.88

100

+

+

0.9273

8264

95

74

70

100

100

X

97

97

5582

100

100

7753

71

66

82

95

67

100

68

86

58

––

–

–

–

–

+

+

–

–

95

–

◄

◄

1091Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

to Cinnamomum s.str. and outgroups (Fig. 2)

Aiou. acarodomatifera

Aiou. amoena (Cinm. amoenum)

Aiou. (Cinm.) pseudoglaziovii M1238Aiou. hirsuta (Cinm. hirsutum)

Aiou. sp. M3231Aiou. (Cinm.) sp. M3167

Aiou. (Cinm.) haussknechtii K83-35

Aiou. (Cinm.) sp. MsnAiou. cf. tomentosa (Cinm. cf. tomentulosum)

Aiou. (Cinm.) glaziovii

Aiou. salignaAiou. sp. M3236Aiou. sp. M3196Aiou. trinervis

Aiou. dubiaAiou. formicaria (Cinm. formicarium)

Aiou. (Cinm.) alainii

Aiou. chavarriana (Cinm. chavarrianum)Aiou. hammeliana (Cinm. hammelianum)

Aiou. (Cinm.) palaciosiiAiou. montana (Cinm. montanum)

Aiou. maya (Cinm. trinerve)

Anib. firmula

Ocot. aciphyllaOcot. ciliataOcot. elegansOcot. indecoraOcot. odoriferaOcot. porosa

Lica. bahiana

Endl. aff. szyszylowicziiEndl. pyriformis

Ocot. pulchellaNect. psammophilaOcot. porphyria

Endl. glomerata M3497

Ocot. sp. M6213Ocot. salvadorensis

Ocot. foetens

Ocot. malcomberiOcot. cf. gabonensis

1

0.64

0.990.95

1

0.92

0.971

0.56

1

1

0.67

0.79

10.62

1

1

1

0.95

1

Aiou. sellowiana (Cinm. sellowianum)

92

80

50

89

66

76

71

70

100

96

98

0.94

0.80

1

Lica. crassifolia

Ocot. quixos

81

1

0.87

Aiou. guianensis

Aiou. grandifoliaAiou. (Moci.) cinnamomoidea

“Aiou.” guatemalensis

“Aiou.” costaricensis J4116

Ocot. atirrensisOcot. pedalifolia

Ocot. insularis

Ocot. tenera

Aiou. myristicoides1

0.59

0.95

1

0.90

0.57

0.98

0.97

1

“Aiou.” vexatrix

Ocot. floccifera

1

1

10.93

Damb. coriacea1

0.57

“Aiou.” costaricensis G8241

Endl. glomerata M3187

Aiou. (Cinm.) pseudoglaziovii M3344

Aiou. (Cinm.) haussknechtii M02PAiou. (Cinm.) haussknechtii M3140

78100

87

93

86

87

77

84

59

98

6754

184

88

50

91

8886

53

100

94

7392

75

84

+

+

–98

88

95

82

78

71

9996

69

75

68

98

73

625492

+

Ocot. guianensis

Oco

tea

com

plex

Aio

uea

incl

. Neo

tropi

cal C

inna

mom

um

EcuadorEcuador

Hispaniola

Costa RicaCosta RicaSE Brazil [Neotropics]EcuadorGuatemala

GuyanaGuyana

SE BrazilSE BrazilBoliviaBoliviaEl Salvador

Tenerife

MadagascarGabon

SE Brazil

Guatemala

SE BrazilSE Brazil

SE Brazil

SE BrazilSE BrazilSE Brazil

Guayana

SE Brazil

SE BrazilSE Brazil

SE BrazilSE Brazil

Guyana

SE BrazilSE Brazil

SE Brazil

SE Brazil

SE Brazil

SE Brazil

SE BrazilSE Brazil

SE Brazil

SE Brazil

SE Brazil

SE Brazil

Ecuador

Brazil, Pará

MexicoPeru

Costa RicaPanamaCosta RicaPanamaEcuadorCosta Rica

Florida / Cuba

Costa Rica

Costa Rica

SE Brazil

SE BrazilSE Brazil

SE Brazil

Guyana1

55

53

+

–

–

–

–

–

92–

+

–

–

–

–

–

+

+

–

+

X

9752

+

–

–

–

+

++

1092 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

which form a scarcely supported clade (PP 0.77). The next split is then between Cinnamomum sect. Cinnamomum (PP 1, Cinnamomum s.str. in Fig. 2) and a weakly supported clade including all others (PP 0.88). The (Paleotropical) species of Cinnamomum sect. Camphora Meisn. (PP 1) appear as sister to a moderately supported group (PP 0.92) including all Neotropical taxa plus the three Old World species of Ocotea included in our analysis, O. foetens (Aiton) Baill. from the Canary Islands, O. cf. gabonensis Fouilloy from Central Africa, and O. malcomberi Van der Werff from Madagascar. As most of our samples of Asian Cinnamomum species (sect. Camphora and sect. Cinnamomum) are sterile material from botanical gardens, usually of unknown provenance, some of our determinations might contain uncertainties. Therefore, we prefer not to describe the topology among the Paleotropical Cinnamomum species in detail.

Within the mainly Neotropical clade, the species of the Ocotea complex (including species of Aniba Aubl., Damburneya Raf., Endlicheria Nees, Licaria Aubl., Nectandra Rol. ex Rottb., and Ocotea, plus a few Central American Aiouea species) form a strongly supported monophyletic group (PP 1), which is sister to an equally strongly supported clade comprising most species of Aiouea (including the type A. guia-nensis), Mocinnodaphne, and the Neotropical species currently placed in Cinnamomum. In the following, this latter clade will be called the Aiouea clade. The Ocotea complex is not the subject of this study, and therefore will not be discussed in detail here. It should be noted, however, that species currently referred to Aiouea, besides those nested among the Neotropical Cinnamomum species, occur in two different clades of the Ocotea complex.

Within the main Aiouea clade (i.e., the clade including the South American Aiouea species plus Neotropical Cinnamomum), a relatively well-sup-ported clade (PP 0.97) including Aiouea grandifolia Van der Werff from Peru and Cinnamomum alai-nii (C.K.Allen) Alain from Hispaniola is shown as sister to an unsupported group (PP 0.56) includ-ing the remaining taxa. Among the latter, there are two (relatively) well-supported clades. One of them (PP 0.98) consists mainly of samples from Central America, plus Cinnamomum montanum from south-eastern Brazil, whereas its sister group (PP 1) con-sists of South American species only. In the first group, Mocinnodaphne cinnamomoidea from Mexico appears as sister to five species of Cinnamomum. The support for this Cinnamomum clade is negligible (PP 0.57), but four of the five species do form a strongly supported clade (PP 1). Among the South American taxa, two species from Ecuador, C. formicarium Van der Werff & Lorea-Hern. and A. dubia (Kunth) Mez (PP 1), are sister to a clade (PP 0.90) consisting ex-clusively of samples from eastern South America,

Fig. 4. Result of the cpDNA analysis, part 1. Bayesian posterior probabilities indi-cated above branches, maximum parsimony bootstrap support below, maximum likelihood bootstrap support to the right of the respective nodes. + to the right of the node indicates presence in the most likely ML tree. Roman numbers (I, II) left of branches refer to clades mentioned in Results. Genus names abbreviated: Cinm. = Cinnamomum, Laur. = Laurus, Lind. = Lindera, Mach. = Machilus, Neol. = Neolitsea, Pers. = Persea, Phoe. = Phoebe, Sass. = Sassafras. Ca. in the bars on the right = Cinnamomum sect. Camphora, grp = group.

Mach. grijsii

Mach. zuihoensis

Phoe. sheareri

Pers. americana

10.98

to Aiouea and Ocotea complex (Fig. 5)

Per

sea

grou

p

0.99

10065

Cinm. bodinieri

Cinm. glanduliferum Nsn

Cinm. glanduliferum Rsn

Sass. albidum

Sass. tzumu

1

1

Cam

phor

aSa

ss.

93

95

1

76

Cinm. verum Ksn

Cinm. verum R162

Cinm. verum L41050

Cinm. cf. iners 2009G30

Cinm. iners L31089

Cinm. dictyoneuron

Cinm. paiei

Cinm. burmannii Lsn

Cinm. burmannii Jsn

Cinm. chekiangense

Cinm. tamala

Cinm. sp. ADA47

Cinm. loureiroi

Cinm. osmophloeum

Cinm. daphnoides Hsn

Cinm. cf. polderi

Cinm. insularimontanum KCSsn

Cinm. wilsonii

Cinm. pittosporoides

Cinm. camphora Lsn

Cinm. camphora Rsn

Cinm. cf. camphora G06-1425

Cinm. parthenoxylon R178

Laur. nobilis

Neol. sericea

Lind. benzoin

0.99

1

1

0.99

Cin

nam

omum

s.s

tr.

1

Cinm. burmannii R2010-10

1

Laur

eae

0.99

89

57

1

Cinm. insularimontanum Rsn

Cinm. daphnoides Lsn

1

0.91

63

0.83

1

61

75

9059

60

90

1

77

Cam

phor

aC

inm

. s.s

tr.C

inna

mom

um s

.str.

0.86

0.55

53

59

98

–

–

51

74

89

63

85

51

70

89

59

75

9975

89

++

94

91

66

100

55

–

–

Ca

II

I

1093Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

mainly from Southeast Brazil. Cinnamomum amoenum (Nees & Mart.) Kosterm. and the not yet formally published taxa “C. hirsutum” and “C. pseudo glaziovii ”, all from SE Brazil, form a strongly supported (PP 1) but unresolved clade as sister to the remaining taxa (likewise PP 1). The three lower nodes retrieved among these re-maining taxa are scarcely (PP 0.59) to substan-tially (PP 0.95) supported in the BI analysis only. Then there is a polytomy including the remaining Cinnamomum species from SE Brazil and a well-supported clade (PP 1) comprising the remaining Aiouea species. Among these, Aiouea guianen-sis (the type) from Guyana and A. myristicoides Mez from the nearby Brazilian state of Pará form a strongly supported clade (PP 1) as sister to a scarcely supported SE Brazilian clade (PP 0.64).

The result based on the cpDNA dataset (Figs. 4, 5) shows less resolution and differs consider-ably from that of the ITS dataset. Cinnamomum bodinieri H.Lév., C. glanduliferum (Wall.) Meisn. and Sassafras form a strongly supported clade (PP 1) that appears to be sister to all other in-group taxa. The clade including the latter, how-ever, is scarcely supported (PP 0.55) and poorly resolved at the base. Four well-supported clades, corresponding to (I) the Laureae (PP 0.99), (II) all Asian Cinnamomum species except C. bodi-nieri and C. glanduliferum (PP 1), (III) the Ocotea complex (PP 1), and (IV) the Aiouea clade (PP 0.99) are forming a polytomy. In the second clade (Asian Cinnamomum) the remaining species of Cinnamomum sect. Camphora (C. camphora (L.) J.Presl, C. parthenoxylon (Jack) Meisn.) are found in different, well-supported clades. Cinnamomum parthenoxylon is shown in an unresolved clade (PP 0.99) with C. dictyoneuron Kosterm. and C. paiei Kosterm., which in turn is part of a major clade (PP 1) including also C. iners Reinw. ex Blume and C. verum J.Presl (similar to the ITS result). Cinnamomum camphora, on the other hand, is placed in a clade (PP 1) with all other Asian spe-cies except C. pittosporoides Hand.-Mazz., which

Fig. 5. Result of the cpDNA analysis, part 2. Bayesian posterior probabilities indicated above branches, max-imum parsimony bootstrap support below. + below branches indicates no parsimony bootstrap support ≥ 50% but present in strict consensus tree, + to the right of the node indicates presence in the most likely ML tree. Roman numbers (III, IV) left of branches refer to clades mentioned in Results. Neotropical spe-cies of Cinnamomum transferred to Aiouea. Genus names abbreviated: Aiou. = Aiouea, Anib. = Aniba, Cinm. = Cinnamomum, Damb. = Damburneya, Endl. = Endlicheria, Lica. = Licaria, Moci. = Mocinnodaphne, Nect. = Nectandra, Ocot. = Ocotea. Abbreviation in quotes = species to be excluded from the genus.

Anib. firmula

Ocot. aciphylla

Ocot. ciliataOcot. elegansOcot. indecoraOcot. odoriferaOcot. porosa

Lica. bahiana

Endl. glomerata M3187

Endl. aff. szyszylowicziiEndl. pyriformis

Ocot. pulchella

Nect. psammophilaOcot. porphyria

Endl. glomerata M3497

Ocot. sp. M6213

Ocot. salvadorensis

Ocot. foetens

Ocot. malcomberi

Ocot. cf. gabonensis

0.60

1

0.93

to Cinnamomum s.str. and outgroups (Fig. 4)

67

57

65

620.98

0.97

0.54

1Licaria crassifolia

Ocot. quixos

+

78

56

62

1

56

“Aiou.” guatemalensis

Ocot. tenera

Damb. coriacea

Aiou. acarodomatifera

Aiou. amoena (Cinm. amoenum)

Aiou. (Cinm.) pseudoglaziovii M1238Aiou. hirsuta (Cinm. hirsutum)

Aiou. (Cinm.) pseudoglaziovii M3344

Aiou. sp. M3231

Aiou. (Cinm.) sp. M3167

Aiou. (Cinm.) haussknechtii K83-35Aiou. (Cinm.) haussknechtii M02PAiou. (Cinm.) haussknechtii M3140

Aiou. (Cinm.) sp. MsnAiou. cf. tomentosa (Cinm. cf. tomentulosum)

Aiou. (Cinm.) glaziovii

Aiou. saligna

Aiou. sp. M3236Aiou. sp. M3196

Aiou. trinervis

Aiou. dubiaAiou. formicaria (Cinm. formicarium)

Aiou. (Cinm.) alainiiAiou. chavarriana (Cinm. chavarrianum)Aiou. hammeliana (Cinm. hammelianum)

Aiou. (Cinm.) palaciosiiAiou. montana (Cinm. montanum)

Aiou. maya (Cinm. trinerve)

1

0.92

1

0.65

0.99

1

0.91

0.52

0.91

Oco

tea

com

plex

Aio

uea

incl

. Neo

tropi

cal C

inna

mom

um

93

Aiou. sellowiana (Cinm. sellowianum)

84

60

Aiou. grandifolia

“Aiou.” costaricensis J4116

Ocot. atirrensis

Ocot. pedalifolia

Aiou. myristicoides

“Aiou.” vexatrix

Ocot. floccifera

“Aiou.” costaricensis G8241

0.990.90

0.98

1

1

+

–

–

–

–

100

67

–

58

95

75

58

75+

75–

–

99

8560

51

–

–

76–

–

+

–

58

–

+ –III

IV

1094 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

is part of a basal trichotomy with the two major Cinnamomum clades. Since we suspected that this conflicting placement of the species of sect. Camphora was an error, we repeated our analyses with newly isolated and sequenced DNA from all individuals involved in conflicting clades, but this confirmed our previous results. The Ocotea complex as well as the Aiouea clade were retrieved in identical composition as in the ITS analysis. The internal topology of these clades is less resolved than in the ITS analysis, but most of the better supported groups are recognizable in both analyses. Congruence and conflict among the major clades retrieved from the ITS and cp DNA analyses are summarized in Fig. 6.

In the analyses based on the psbA-trnH spacer only, Aiouea guianensis and Ocotea guianensis, the types of their respec-tive genera, are placed in the same major groups as in the ITS analyses (Aiouea clade and Ocotea complex) in the MP 50% majority rule consensus and the Bayesian consensus tree, but the MP bootstrap consensus is almost completely collapsed.

The result of the BI analysis based on the combined ITS + psbA-trnH + trnG-trnS dataset excluding Cinnamomum sect. Camphora (shown in the Electronic Supplement) is largely compatible with the result based on the ITS data alone. All major clades, viz., the Persea group (= outgroup), the Laureae,

Cinnamomum sect. Cinnamomum, Sassafras, the Ocotea com-plex and the Aiouea clade including Neotropical Cinnamomum, receive posterior probabilities of 1. Their topology relative to one another is similar as well, except that Sassafras now appears as sister group to Cinnamomum sect. Cinnamomum (PP 0.90), rather than to all other Cinnamomeae. Minor dif-ferences are found within the major clades. In the Laureae, Lindera benzoin now appears as sister taxon to Laurus nobilis (PP 0.71). The only change in Cinnamomum sect. Cinnamomum is that C. chekiangense Nakai now appears as sister to the clade formed by C. burmannii (Nees & T.Nees) Blume and C. tamala (Buch.-Ham.) T.Nees & Nees (PP 0.90), followed by Cinnamomum spec., Arifiani DA47 (PP 0.99). There are more extensive topological changes in the Ocotea complex, but most of them involve only weakly supported clades. Nearly all clades with posterior probabilities ≥ 0.95 in the ITS analysis are also present in the combined analysis and vice versa. Conspicuous exceptions are that Ocotea pulchella (Nees & Mart.) Mez is no longer placed with the other dioecious taxa, and O. salva-dorensis (Lundell) Van der Werff is now strongly supported as sister to Aiouea guatemalensis (Lundell) S.S.Renner and Damburneya coriacea (Sw.) Trofimov & Rohwer (PP 1). More pronounced differences are found in the Aiouea clade, in the placement of the clades including Aiouea myristicoides, A. saligna Meisn. and A. trinervis Meisn. and two undeter-mined Aiouea species vs. Cinnamomum amoenum, “C. hirsu-tum” and “C. pseudoglaziovii ”.

Maximum likelihood analysis. — The results of the ML bootstrap analyses (shown in the Electronic Supplement) are poorly resolved at the base but largely compatible with those of the BI analyses. A few clades within the major groups were found to be conflicting in the analyses of the ITS data (indi-cated by an X to the right of the respective nodes in Figs. 2 and 3), but the conflicting clades are poorly supported (ML-BS 65% in Endlicheria, 55% in Cinnamomum s.str.). No conflict-ing clades were found in the ML bootstrap consensus based on the cpDNA data, even though the most likely tree derived from the ML analysis appears quite different.

DISCUSSION

Molecular phylogeny. — Phylogenetic analyses of both marker datasets (ITS, cpDNA) show a clear signal contradict-ing the traditional generic classification. The species currently included in Cinnamomum do not form a monophyletic group. Instead, species of Cinnamomum are placed in three differ-ent clades (Fig. 6, hatched). Two of them correspond to the Paleotropical sect. Camphora and sect. Cinnamomum, respec-tively, at least in the result of the ITS dataset (Fig. 2). Our study does not allow us to decide if these clades form a monophyletic group or not, as they are placed in conflicting topologies result-ing from the analyses of the separate ITS and cpDNA datasets (Figs. 2, 4). The third clade (Figs. 3, 5) comprises not only the Neotropical species currently placed in Cinnamomum, but also most species of the likewise Neotropical genus Aiouea exam-ined here, including the type, A. guianensis. The taxonomic

Fig. 6. Overview showing the major clades retrieved from the pres-ent analyses, ITS results on the left, cpDNA results on the right side. Dotted lines indicate posterior probabilities < 0.95. Cinm. = Cinnamomum.

Persea group

Laureae

Cinm. sect. Cinnamomum

Sassafras

Cinm. sect. Camphora

incl. sect.Camphora p.p.

Aiouea clade incl.Neotropical Cinnamomum

Ocotea complex

Cinm. sect. Camphora p.p.

Laureae

Sassafras

1095Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

consequences of this result will be discussed below. In the result based on the ITS data, the Aiouea clade (incl. Neotropical Cinnamomum) appears as sister to the Ocotea complex, which also consists predominantly of Neotropical taxa, although not quite significantly supported. Of course it is a matter of debate if it is permissible to delete the conflicting taxa (in this case the species of Cinnamomum sect. Camphora) and combine such conflicting datasets, but if we do so and concatenate the ITS and the cpDNA data, then the support for the monophyly of the Neotropical taxa (Ocotea complex plus Aiouea clade) increases to 81% MP-BS/PP 1/94% ML-BS (results in the Electronic Supplement). We therefore assume that the core Cinnamomeae (excl. Sassafras, discussed below) colonized the Americas only once. A few species currently placed in Aiouea (A. costaricen-sis (Mez) Kosterm., A. guatemalensis (Lundell) S.S.Renner, A. vexatrix Van der Werff) are placed among the species of the Ocotea complex in our results. For A. costaricensis, this posi-tion had already been observed by Chanderbali & al. (2001). These Central American species, however, have been consid-ered “anomalous” in Aiouea, because their flowers do not have staminodes with a conspicuous cordate to sagittate glandular head in the fourth androecial whorl, as the South American species (Van der Werff, 1987, 1988). In the discussion under A. costaricensis, Burger & Van der Werff (1990) mentioned that there was “an almost identical population of Ocotea in-sularis (O. tonduzii in a more narrow sense) at Monteverde with 4-thecous anthers. This near-identity makes it appear that A. costaricensis may be nothing more than a 2-thecous deriva-tive of some highland populations of O. insularis (in a wide sense).” In the analysis of Chanderbali & al. (2001) A. costari-censis did indeed appear as sister taxon to O. insularis, with 100% BS. In our analysis, we added a few more taxa which Rohwer (1986) considered to be synonyms of O. insularis (O. atirrensis Mez & Donn.Sm., O. floccifera Mez & Sodiro, O. pedalifolia Mez), and indeed these species form a monophy-letic group with A. costaricensis, O. insularis, and A. vexatrix in our results of both the ITS and the cpDNA datasets. In the description of A. vexatrix, Van der Werff (1988) considered the placement of this species in Aiouea provisional, and men-tioned that it was related to a group of Ocotea species including O. atirrensis and O. pedalifolia examined here. Our results thus confirm what has been concluded from morphology ear-lier. The third species of Aiouea placed in the Ocotea complex by our results, A. guatemalensis, had been considered closely related to A. costaricensis by Renner (in Kubitzki & Renner, 1982). In our analyses, it is not part of the O. insularis group but forms a well-supported clade with Damburneya coriacea Trofimov & Rohwer. With its medium-sized, somewhat glossy, finely reticulate leaves it is indeed strikingly similar to several species of Damburneya. Compared to most Damburneya spe-cies it has smaller flowers lacking the characteristic papillosity on the adaxial side of the tepals, but relatively small flowers with reduced papillosity are also known from D. patens (Sw.) Trofimov and D. purpurea (Sw.) Trofimov.

For Cinnamomum, a recent study conducted by Huang & al. (2016) showed largely compatible results: the Cinnamomeae formed a monophyletic group, as in our ITS data, and species

of Cinnamomum were placed in three distinct, well-supported clades corresponding to Cinnamomum sect. Cinnamomum, Cinnamomum sect. Camphora, and the Neotropical species. As in our chloroplast dataset, a few species of sect. Camphora appeared among the species of sect. Cinnamomum, but these were not the same species as in our data. Both Cinnamomum camphora and C. parthenoxylon are placed among the other species of sect. Camphora in the study of Huang & al. (2016). This may of course be due to the strong signal in the ITS data; if we combine the two datasets, we get the same results.

In accordance with previous results of Chanderbali & al. (2001), most species of Aiouea and Mocinnodaphne (like-wise from the Neotropics) were placed among the Neotropical Cinnamomum species. Huang & al. (2016), however, did not include any species of the Ocotea complex, except O. ikon-yokpe Van der Werff, which already had been recognized to be closer to Cinnamomum by Chanderbali & al. (2001). Therefore, Huang & al. (2016) were able to confirm the monophyly of the Cinnamomeae, but they could not evaluate if Cinnamomum was monophyletic in its current circumscription. It should be noted that in their study Cinnamomum sect. Cinnamomum and the mainly Neotropical taxa formed a well-supported monophyletic group. If this was confirmed, it would mean that even Asian Cinnamomum is not monophyletic and that sect. Camphora would deserve generic rank. We have never seen this topol-ogy during our work. Instead, our analysis of the ITS data (Figs. 2, 3) showed a moderately supported monophyletic group including the mainly Neotropical taxa and sect. Camphora. From a morphological point of view, such a grouping would appear plausible, as sect. Camphora and the Neotropical spe-cies (i.e., Aiouea, Neotropical Cinnamomum and the taxa of the Ocotea complex) share alternate, penninerved to moderately triplinerved leaves. These characters, however, are likely to be plesiomorphic in the Cinnamomeae.

The relationships of Cinnamomum sect. Camphora also need further study because some of its members show unex-pected affiliations in some analyses. As mentioned above, a few species of sect. Camphora (C. longipetiolatum H.W.Li, C. saxatile H.W.Li, and an undetermined species, all not ex-amined here) were placed among species of sect. Cinnamomum in the results of Huang & al. (2016). At this point, it is futile to speculate about possible reasons. In our study, C. bodinieri and C. glanduliferum of sect. Camphora were clearly placed with the remaining species of that section in the ITS analysis, but in the cpDNA data they formed a well-supported clade with Sassafras. Initially we suspected that samples might have been mixed up during lab work, but a repetition confirmed the results. Further analyses will be necessary to differenti-ate between possible explanations, such as chloroplast capture resulting from ancient hybridization vs. artefact due to the low number of informative characters in the cpDNA data. In the present analysis, we consider the result based on the ITS data to be more reliable, because the ITS dataset contained almost three times as many informative characters as the cpDNA da-taset. Nevertheless, the cpDNA data make an important contri-bution to the phylogenetic analysis, as they confirm the major clades found in the ITS analysis.

1096 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Sassafras had not been included in the dataset of Huang & al. (2016). In the analysis of Chanderbali & al. (2001) it was placed as sister to the remaining Cinnamomeae in the unconstrained ITS analysis, but a topology with Sassafras con-strained to the Laureae was just three steps longer. Chanderbali & al. (2001) preferred the latter placement because Sassafras albidum (Nutt.) Nees has introrse pollen sacs in the third stami-nal whorl and some kind of involucre around its inflorescences, both of which are characters of the Laureae. The position of the pollen sacs, however, is correlated with breeding system rather than phylogenetic affinity. The pollen sacs of the third staminal whorl are usually extrorse in bisexual flowers of Lauraceae, because the inner stamens are upright and appressed to the style during the male phase of flowering, so that there is no room to open toward the inside. This is true also for Sassafras ran-daiense (Hayata) Rehder (Chung & al., 2010). In male flowers with a small pistillode or none at all, on the other hand, they are often introrse, even within the Cinnamomeae (in Ocotea: Rohwer, 1986; Endlicheria: Chanderbali, 2004). In addition, the involucre of Sassafras is different from what is commonly found in the Laureae. As a deciduous tree, Sassafras produces botryoid inflorescences from the axils of spirally arranged bud scales and transitional leaves during budbreak in early spring, whereas most Laureae have pseudo-umbellate axillary inflo-rescences surrounded by decussate bracts.

In the studies of Chanderbali & al. (2001) and Huang & al. (2016) the American species of Cinnamomum plus a few Aiouea species – including the type A. guianensis – and the monotypic Mocinnodaphne appear in a single clade that is strongly sup-ported in the latter study. We used a different set of Aiouea spe-cies, but all species from South America appear nested among the Neotropical Cinnamomum species as well. Huang & al. (2016) found the main clade of the American species separated into a South American clade (including Aiouea) and a geo-graphically mixed clade (Central and South America; including Mocinnodaphne), compatible with the results of Chanderbali & al. (2001). In our analysis, a geographically mixed clade (Central and South America; including Mocinnodaphne and five species of Cinnamomum) is sister to the South American taxa (including several species of Cinnamomum and Aiouea). In addition, we found a clade consisting of A. grandifolia from Peru and C. alainii from Hispaniola as sister to all other species of the Aiouea clade, but the node separating it from the rest of the species is present in the result of the BI analysis only, and scarcely supported. Within the Aiouea clade, species of Aiouea appear nested among the Neotropical Cinnamomum species in at least three different clades, suggesting that the reduction of pollen sacs from four to two per anther occurred several times independently within the Aiouea clade. As a con-sequence, the genus Aiouea cannot be upheld in the traditional circumscription. Reductions of the number of pollen sacs in the third staminal whorl in several Neotropical Cinnamomum spe-cies have been described by Mez (1889, considered as Phoebe spp. then) and by Lorea-Hernández (1996); the former author even created Phoebe subg. Heteranthera Mez to accomodate the species with this feature. Reductions also in the outer whorls are known from Asian Cinnamomum (Kostermans,

1985, 1986; Soh, 2011), Persea Mill. (Kopp, 1966; Rohwer, 2014), and several smaller genera (Van der Werff & Richter, 1985; Rohwer, 1988; Rohwer & al., 1991). Already Gamble (1910) mentioned in the description of Cinnamomum gracili-florum Gamble that the anthers were sometimes 2-locular, and there is a drawing on the syntype specimen Scortechini 1228 (K barcode K000778634) showing that both 2- and 4-locular anthers were found even within this single collection. Rohwer & al. (1991) found flowers with tetrasporangiate and dispo-rangiate anthers in a single inflorescence of a species de-scribed both as Ocotea insularis and as Aiouea lundelliana C.K.Allen. Additional species of “Aiouea” belonging to the Ocotea insularis group have been discussed above. As the difference in the number of pollen sacs is the only criterion to distinguish Neotropical Cinnamomum from Aiouea, the sepa-ration between the two is no longer sustainable. Therefore, the American species of Cinnamomum will be transferred to Aiouea here. Aiouea was described by Aublet (1775), from French Guiana, with A. guianensis as the only species at that time. The name Cinnamomum is a nomen conservandum (McNeill & al. 2012: Appendix III), with the Asian C. verum as the type. It should be noted, however, that among the many Neotropical species ascribed to Cinnamomum (or to Phoebe by earlier authors, e.g., Meissner, 1864; Mez, 1889), only those recognized as Cinnamomum by Lorea-Hernández (1996) are members of the Aiouea clade. Most of the others have been transferred to the (admittedly polyphyletic) genus Ocotea already by other authors. Lorea-Hernández (1996) accepted only species with staminodia in the fourth androecial whorl showing a large, usually cordate to sagittate glandular head as Cinnamomum. The same character allows segregating the Central American species currently placed in Aiouea from the rest of that genus. The Central American species, not only those examined here but also A. inconspicua Van der Werff, A. obscura Van der Werff, A. parvissima (Lundell) S.S.Renner and A. talamancensis W.C.Burger, have either inconspicuous staminodes or mostly none at all. The South American Aiouea species, on the other hand, have conspicuous staminodes in the fourth androecial whorl; the only exception, A. lehmannii (O.C.Schmidt) S.S Renner from Colombia, needs to be re-examined. The collection Prance 3009 (HBG), cited by Renner (in Kubitzki & Renner, 1982), looks somewhat similar to Damburneya purpurea (Ruiz & Pav.) Trofimov, but we doubt that it is the same species as the type, Lehmann 4989 (K). Unfortunately, our attempts to amplify the ITS region from the herbarium material present in HBG failed so far. In the original description of A. inconspicua, Van der Werff (1987) compared it primarily to A. guatemalensis (see above), and we agree that it is similar. In a recent personal communica-tion about this manuscript (Dec 2016), he also suggested that it might be related to Damburneya. Unfortunately, we have not been able to obtain clean ITS-2 sequences of A. incon-spicua from herbarium material, but the ITS-1 sequences dif-fer by only a few base pairs from those of A. guatemalensis and most Damburneya species. It is therefore quite likely that A. inconspicua eventually will have to be transferred to Damburneya. Aiouea obscura is the only Central American

1097Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

species with subtriplinerved leaves. In the original descrip-tion, Van der Werff (1988) wrote “It resembles closely several other dark-drying Lauraceae with membranaceous leaves and lax inflorescences, such as Ocotea tenera Mez & J.D.Smith (known from Costa Rica) and Phoebe glabra Van der Werff (southern Mexico)”; the latter species is currently accepted as Ocotea vanderwerffii (Kosterm.) Van der Werff. This state-ment was the reason to add Ocotea tenera Mez & Donn.Sm. to our analysis. Unfortunately, our attempts to amplify the ITS region of A. obscura from herbarium material failed so far (as is often the case in dark drying material). Therefore, we can neither support nor refute such a relationship. In contrast to the other Central American species, A. parvissima does have staminodes in the fourth androecial whorl, but they are minute and clavate. With its somewhat glossy, finely reticulate leaves it is reminiscent of Damburneya. As in A. inconspicua, we have not been able to obtain clean ITS-2 sequences from herbarium material so far, but both the ITS-1 and the trnG-trnS sequences suggest that it may be related to Damburneya as well. In the original description of Aiouea talamancensis, Burger & Van der Werff (1990) mentioned that it strongly resembled Ocotea whitei Woodson, and “it may be that this species is a 2-thecous derivative of that species of Ocotea or one of its close allies”. Ocotea whitei has been ascribed to the O. insularis group by Rohwer (1986). As far as we can tell so far, based on a prelimi-nary ITS-1 sequence, this affinity may be correct.

Biogeographic history. — Huang & al. (2016) pre-sented a paleogeographic reconstruction of the evolution of Cinnamomum pointing to a most likely Laurasian origin, and of its subsequent dispersal, leading to the current disjunc-tion patterns. As we did not address this issue in our analy-sis, we can neither support nor refute their findings, but there is nothing in our results that would obviously conflict with them. It seems plausible that the Cinnamomeae separated from the Laureae in the Eocene. In contrast to previous stud-ies (Chanderbali & al., 2001; Nie & al., 2007), Huang & al. (2016) estimated the age when the Cinnamomeae split from the Laureae at about 55 Mya, which is roughly 15–10 Mya older than the estimates in the studies named above. It should be noted, however, that Chanderbali & al. (2001) constrained Cinnamomum to be monophyletic and the Laureae to include Sassafras, which may have influenced their estimate. Apart from these constraints, the succession of evolutionary steps is largely congruent in these three analyses and in ours. This was to be expected, as widely overlapping datasets have been used in all cases, with most informative characters derived from ITS sequences. Thus it is all the more surprising that in the previous studies the node separating Asian sect. Camphora from the remaining Cinnamomum group appeared older than the node showing the separation between Neotropical and Paleotropical Cinnamomeae species, whereas our ITS analysis would suggest that sect. Camphora was the sister group to the Neotropical species. The chloroplast data do not really help to elucidate the position of sect. Camphora; on the contrary, they point to an unresolved conflict between the different markers that needs to be investigated in more detail by multigene analysis or by whole (chloroplast) genome sequencing.

Taxonomic consequences. — As described above, our results very strongly suggest that the American species cur-rently placed in Cinnamomum are misplaced there. Instead, they form a monophyletic group with Aiouea, and probably also with other Neotropical genera, rather than with Paleotropical Cinnamomum. Neotropical Cinnamomum cannot be separated from Aiouea, because 4-locular vs. 2-locular anthers are the only criterion to distinguish the two. This character, however, is neither constant in many genera (including Paleotropical Cinnamomum), nor do the species with 4- and with 2-locular anthers form separate clades in our analyses. Since Aiouea (Aublet, 1775) is the oldest generic name in this alliance, we resolve this situation by transferring the Neotropical Cinnamomum species to Aiouea. Mocinnodaphne is likewise nested in the Aiouea clade. It differs by reduction of the outer androecial whorls (first and second), whereas reductions of the inner androecial whorls are well known from South American Aiouea (third whorl in A. guianensis, A. laevis (Mart.) Kosterm., A. maguireana (C.K.Allen) S.S.Renner, A. saligna and A. tri-nervis, second and third whorl in A. benthamiana Mez and A. myristicoides Mez, see Renner in Kubitzki & Renner, 1982). Therefore, also Mocinnodaphne will be transferred to Aiouea here. We are confident that Aiouea guatemalensis and A. incon-spicua eventually will have to be transferred to Damburneya, but that is beyond the scope of this paper. In contrast, it does not make sense to transfer A. costaricensis and A. vexatrix to Ocotea. Ocotea is polyphyletic in its current circumscription and will have to be split into monophyletic lineages in the near future. The species currently placed in Aiouea do not belong to the lineage including the type species of Ocotea, O. guianensis.

As a consequence of our study, 44 Neotropical species currently included in Cinnamomum and the only species of Mocinnodaphne are transferred to Aiouea here. For two of these species we propose nomina nova, because the respective epithets are already used in Aiouea, either as a formal combina-tion or an orthographic variant of an existing combination. In addition, we validate six species described in Cinnamomum by Lorea-Hernández (1996) but not yet validly published in Aiouea here. Full descriptions and paratypes of the newly described species as well as remarks on their habitat, distribution and affinities can be found in the supplementary materials.

Aiouea Aubl., Hist. Pl. Guiane 1: 310. t. 120. 1775 – Type: Aiouea guianensis Aubl., Hist. Pl. Guiane 1: 311. t. 120. 1775.Trees or shrubs; leaves alternate, triplinerved or penni-

nerved, often with domatia in the axils of veins; inflorescences thyrso-paniculate; flowers urceolate or subglobose, tepals obliquely erect at anthesis, not rotately spreading, fertile sta-mens 9, occasionally 6 or 3, anthers 4-locular or 2-locular, sta-minodes of the fourth whorl well-developed, with distinguish-able filament and cordate to sagittate glandular head (rarely sessile if second and third whorl sterile); fruiting hypanthium usually accrescent, gradually merging with the swollen pedi-cel, tepals in fruit wholly or partially persistent, less often deciduous.

1098 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

1. Aiouea alainii (C.K.Allen) R.Rohde, comb. nov. ≡ Phoebe alainii C.K.Allen in Mem. New York Bot. Gard. 21: 109, fig. 1. 1971 ≡ Cinnamomum alainii (C.K.Allen) Alain in Phytologia 50: 162. 1982 – Holotype: Dominican Republic. La Vega: Ridge E of Loma de la Sal, between Jaracoba and Constanza, 7–10 Aug 1968, Liogier 11993 (NY barcode 00074397!; isotypes: BM barcode BM000758817!, GH barcode 00026379!, NY barcode 00023507!, P barcode P00064870!, US barcode 00099167!).

2. Aiouea amoena (Nees & Mart.) R.Rohde, comb. nov. ≡ Oreodaphne amoena Nees & Mart. in Linnaea 8: 44. 1833 ≡ Phoebe amoena (Nees & Mart.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 207. 1889 ≡ Ocotea amoena (Nees) Herter in Revista Sudamer. Bot. 3: 153. 1936 ≡ Cinnamomum amoenum (Nees & Mart.) Kosterm. in Reinwardtia 6: 20. 1961 – Lectotype (designated by Moraes in Komarovia 6: 31. 2008): Uruguay. Montevideo, s.d., Sellow 3174 (B barcode B 10 0185027!; isolectotypes: B barcodes B 10 0185026! & B 10 0185028!, US barcode 00099199 [photo!]).

= Oreodaphne vesiculosa Nees & Mart. in Linnaea 8: 44. 1833 ≡ Phoebe vesiculosa (Nees & Mart) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 206. 1889 ≡ Cinnamomum vesiculosum (Nees & Mart.) Kosterm. in Reinwardtia 6: 24. 1961 – Lectotype (designated by Moraes in Komarovia 6: 31. 2008): Brazil. s.d., Sellow s.n. (GZU barcode GZU000249342!; isolectotypes: B barcodes B 10 0185024! & B 10 0185025!, BR barcode 000008762429!, E barcode E00259500 [photo!], G barcode G00074273!, HAL bar-code HAL0010485 [photo!], K barcode K000602104!).Additional syntypes of Oreodaphne amoena: Sellow

385 (LE barcode LE 00000190!); Sellow d1459 (B barcodes B 10 0185029! & B 10 0185030!, K barcode K000602103!); Sellow s.n. (BR barcode 000008762757!, G barcode G00074274!, G-DC barcode G00146974!, GZU barcode GZU000249347!, HAL barcode HAL0010510 [photo!], K barcodes K000602102! & K000602105!, KIEL!, L barcode L 0035687!; fragment F barcode v0061675F!, NY barcode 00355681!).

Additional syntype of Oreodaphne vesiculosa: Sellow 4597 (K barcode K000512681!, R barcode R 000177003!).

3. Aiouea amplexicaulis (Schltdl. & Cham.) R.Rohde, comb. nov. ≡ Persea amplexicaulis Schltdl. & Cham. in Lin-naea 5: 90. 1830 ≡ Phoebe amplexicaulis (Schltdl. & Cham.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 216. 1889 ≡ Cinnamomum amplexicaule (Schltdl. & Cham.) Kosterm. in Reinwardtia 6: 20. 1961 – Holotype: Mexico. Veracruz: Cerro Colorado, between Xalapa and vol-cano Cofre de Perote, Aug 1828, Schiede 87 (B barcode B 10 0185023!; isotype: HAL barcode HAL0098198 [photo!]); GZU barcode GZU000254386 [left fragment]!; probable isotype, labelled as Schiede 452: LE barcode LE 00000514!).

4. Aiouea ampullacea Lorea-Hern., sp. nov. – Holotype: Mexico. Chiapas: Mpo. Larrainzar, km 4 on the road

Xanaté–Bochil, 1860 m, 16 Apr 1993 (fl), González & al. 1910 (CH barcode CH0015967!; isotype: MO!).Frutices vel arbusculae. Folia lanceolata aut rarius anguste

elliptica, apice caudate-acuminato, triplinervia aut subtripliner-via, infra subglabra vel inconspicue pubescentia tricho matibus rectis, adpressis; domatiis praesentibus, plerumque ad axillas venarum secundariarum paris basalis tantum, pagina foliari ad domatia infra concava, supra ampullacea. Inflorescentia plerumque cyma solitaria constans, bracteis foliaceis desti-tuta. Flores extus omnino glabri, hypanthio intus glabrescente. Tepala in fructu omnino persistentia.

5. Aiouea areolata (Lundell) R.Rohde, comb. nov. ≡ Phoebe areolata Lundell in Contr. Univ. Michigan Herb. 7: 13–14. 1942 ≡ Cinnamomum areolatum (Lundell) Kosterm. in Reinwardtia 6: 20. 1961 – Holotype: Mexico. Chiapas: Sierra Madre, Saxchanal, 1 Jul 1941, Matuda 4296 (MICH barcode 1210252 [photo!]; isotypes: A barcode 00026421!, F!, LL barcodes 00370937 [photo!] & 00370938 [photo!], MEXU barcodes MEXU 00013642 [photo!] & MEXU 00080225 [photo!], MO barcode MO-247099!, NY bar-code 00355878!).

6. Aiouea bractefoliacea (Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum bractefoliaceum Lorea-Hern. in Acta Bot. Mex. 40: 4–6, fig. 1. 1997 – Holotype: Mexico. Querétaro: Mpo. Jalpan, aprox 4–5 km W to La Parada, 1400 m, tree 4–6 m., 23 Apr 1990 (fl), Servín 141 (IEB!; isotypes: MO No. 05019044 = barcode MO-247098!, XAL barcode XAL0106596!).

7. Aiouea breedlovei (Lundell) R.Rohde, comb. nov. ≡ Phoebe breedlovei Lundell in Wrightia 5(9): 341. 1977 (“Breedlovei”) ≡ Cinnamomum breedlovei (Lundell) Kosterm. in Reinwardtia 10: 442. 1988 – Holotype: Mexico. Chiapas: Mpo. Pueblo Nuevo de Solistahuacán, ridge above Pueblo Nuevo de Solistahuacán, elev. 6500 ft., 15 Aug 1967, Shilom Ton 2812 (LL barcode 00370941!; isotypes: DS barcode CAS0003979!, ENCB barcode ENCB008646!, MICH barcode 1104610!, NY barcode 00355882!).

8. Aiouea brenesii (Standl.) R.Rohde, comb. nov. ≡ Phoebe brenesii Standl. in Publ. Field Mus. Nat. Hist., Bot. Ser. 18(2): 459. 1937 ≡ Cinnamomum brenesii (Standl.) Kosterm. in Reinwardtia 6: 20. 1961 – Holotype: Costa Rica. Ajajuela: Entre San Miguel y La Palma de San Ramón, 14 Feb 1933, Brenes 17048 (F barcode v0061769F!; isotypes: NY barcode 00355883!; fragment A barcode 00026411!).The Mutis specimens in COL and MA available in JSTOR

under this name represent different species of Ocotea, most of them Ocotea sericea Kunth. The specimen MA barcode MA 665969 [photo!] appears to represent an Ocotea of the O. leucoxylon group, whereas COL barcode COL000005744 [photo!] is yet a different species.

1099Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

9. Aiouea chavarriana (Hammel) R.Rohde, comb. nov. ≡ Phoebe chavarriana Hammel in J. Arnold Arbor. 67: 131. 1986 ≡ Cinnamomum chavarrianum (Hammel) Kosterm. in Reinwardtia 10: 442. 1988 – Holotype: Costa Rica. Heredia: Finca La Selva, on Río Puerto Viejo just E of its junction with Río Sarapiquí, 2 May 1982, Hammel 11931 (DUKE barcode 10000039 [photo!]; isotypes: F barcode v0061770F!, MO barcodes MO-247096! & MO-247097!, NY barcode 00355884!).

10. Aiouea chiapensis (Lundell) R.Rohde, comb. nov. ≡ Phoebe chiapensis Lundell in Contr. Univ. Michigan Herb. 6: 21. 1941 ≡ Cinnamomum chiapense (Lundell) Kosterm. in Reinwardtia 6: 20. 1961 – Holotype: Mexico. Chiapas: Acacoyahua, Mt. Ovando, Dec 1937, Matuda 2064 (MICH barcode 1210253!; isotypes: A barcode 00026410!, CAS barcode CAS0003981 [photo!], F!, LL barcodes 00370942 [photo!] & 00370943!, MO barcodes MO-247095! & MO-247096!, MEXU barcodes MEXU 00013643 [photo!] & MEXU 00079568 [photo!], NY barcode 00355885!, U!).

11. Aiouea cinnamomoidea (Lorea-Hern.) R.Rohde & Lorea-Hern., comb. nov. ≡ Mocinnodaphne cinnamomoidea Lorea-Hern. in Acta Bot. Mex. 32: 26. 1995 – Holotype: Mexico. Guerrero: Mun. Atoyac de Alvarez, aprox. 1/2 km al N de El Molote, 1780 m, 17 May 1993, Lorea Hernández & Lozada 5534 (FCME; isotypes: F barcode v0360611F!, GH barcode 00404972!, MO barcodes MO-247449! & MO-247450!).The genus Mocinnodaphne was separated from Aiouea

mainly by the fact that only the third staminal whorl is fertile in this species. In Aiouea in the sense of Kubitzki & Renner (1982), either all three staminal whorls are fertile, or if there are fewer than nine fertile stamens, then the third whorl is sterile (in A. guianensis, A. laevis, A. maguireana, A. saligna, and A. trinervis), or even the second and the third whorl are sterile (in A. benthamiana and A. myristicoides). This, however, appears to be an independent reduction of the number of fertile whorls, proceeding from the outer ones, as Mocinnodaphne has been found to be nested among Neotropical Cinnamomum species by Chanderbali & al. (2001) and Huang & al. (2016).

12. Aiouea effusa (Meisn.) R.Rohde & Rohwer, comb. nov. ≡ Phoebe effusa Meisn. in Candolle, Prodr. 15(1): 33. 1864 ≡ Persea effusa (Meisn.) Hemsl., Biol. Cent.-Amer., Bot. 3: 71. 1882 ≡ Cinnamomum effusum (Meisn.) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated here): Mexico. Veracruz: “Rincón Faisán”, Mar 1839, Linden 78 (G barcode G00368845!; isolectotypes: BR barcode 000005113798!, FI barcode FI005193 [photo!], G barcode G00368846!, K barcodes K000602044! & K000602045! [both K specimens mounted with Galeotti 7009], LE bar-code LE 00000523! [mounted with Linden 19], MICH barcode 1210251!; fragments NY barcode 00355888! [mounted with Botteri 1039]).

= Phoebe effusa var. parvifolia Meisn. in Candolle, Prodr. 15(1): 33. 1864 – Lectotype (designated here): Mexico.

Veracruz: Orizaba, Jan 1855, Botteri 1044 (K barcode K000602040!; isolectotypes BM barcode BM000947199!, P barcode P00064879!).

= Phoebe barbeyana Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 209. 1889 ≡ Cinnamomum barbeyanum (Mez) Kosterm. in Reinwardtia 6: 20. 1961 – Lectotype (designated here): Mexico. Veracruz: Orizaba, 12 May 1866, Bourgeau 2436 (P barcode P00064868!; isolectotypes: B [prob-ably destroyed], G barcode G00368837!, K!, LE barcode LE 00000518!, P barcodes P00128478! & P00128479!; fragment and photo F barcode v0061767F!).Additional syntypes of Phoebe effusa: Mexico, Veracruz:

Xalapa, Apr 1838, Linden 13 (K barcode K000602042!). Mexico, Veracruz: Linden 14 (MO barcode MO-201782!).

Additional syntype of Phoebe effusa var. parvifolia: Mexico. Veracruz: Orizaba, Apr 1854, Botteri 1039 (BM barcode BM000947200!, G barcode G00368836!, K barcode K000602041!, NY barcode 00355887!, P barcode P00064878!).

Lorea-Hernández (1996) cited “holotype, B, n.v.” under Phoebe barbeyana, but there is no indication in the work of Mez (1889) that any of the type collections cited (from B, G, K, LE or P) was preferred over the others. As the collection has not been found in Berlin by any one of us and is not recorded in the Berlin Virtual Herbarium (Röpert, 2000–), we prefer to select a different lectotype.

The second variety of Phoebe effusa recognized by Meissner (1864), var. β areolata, based on the collection Linden 19, does not belong here. The only specimen that we found with this number, MICH barcode 1210254!, has been identified as Nectandra salicifolia (Kunth) Nees by Lorea-Hernández. Recently, this species has been transferred to Damburneya Raf., along with the other species of the Nectandra coriacea group (Trofimov & al., 2016).

13. Aiouea elegans (Van der Werff) Rohwer, comb. nov. ≡ Phoebe elegans Van der Werff in Ann. Missouri Bot. Gard. 75: 415, fig. 7. 1988 ≡ Cinnamomum concinnum Lorea-Hern. in Acta Bot. Mex. 40: 2–3. 1997 – Holotype: Mexico. Oaxaca: San Miguel Chimalapa, cima del Cerro Salomón, 11 Apr 1986, Ishiki 1501 (MO barcode MO-247094!; iso-types: CH barcode CH0019897 [photo!], CHAPA, LL, MEXU).This species has been called Cinnamomum concinnum

by Lorea-Hernández because the use of the epithet elegans in Cinnamomum was prevented by C. elegans Reinecke (1898).

14. Aiouea erythropus (Nees & Mart.) R.Rohde, comb. nov. ≡ Persea erythropus Nees & Mart. in Linnaea 8: 49. 1833 ≡ Phoebe erythropus (Nees & Mart.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 189. 1889 ≡ Cinnamomum erythro-pus (Nees & Mart.) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated by Moraes in Komarovia 6: 48. 2008): Brazil. Minas Gerais: Ouro Preto, “in ferruginosis ad Antonio Pereira”, Apr 1818, Martius Obs. 883 (GZU barcode GZU000249338! [fragment on the top, annotated by Nees]; isolectotypes: M barcodes M-0147194! & M-0147196! [“Persea erythropus M. Reise I. p. 401. (nomen)”]).

1100 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

= Phoebe oleifolia Mez in Arbeiten Königl. Bot. Gart. Breslau 1: 117. 1892 ≡ Cinnamomum oleifolium (Mez) Kosterm. in Reinwardtia 6: 22. 1961 – Lectotype (designated here): Brazil. Minas Gerais: Morro da Gloria, near Faria, 26 Jan 1891, Glaziou 18434 (C barcode C10013526!; isolecto-types: A barcode 00026372!, B barcode B 10 0247424!, BR barcode 000008763655!, F barcode v0061785F!, G barcode G00368847!, K barcode K000602099!, LE bar-code LE 00000528!, P barcodes P00128567!, P00128568! & P00128569!, US barcode 00099185!; photo of holotype, F neg. 3596 [photo!]; fragment and photo of holotype, F barcode v0061786F [photo!]).Additional syntypes of Persea erythropus: BRAZIL.

Minas Gerais, without locality, Martius s.n. (M barcode M-0147195!); Brazil, without locality, Sellow 1360 (B [prob-ably destroyed], F No. 619716; fragment ex B, F neg. 58035; Sellow s.n., GZU barcode GZU000265498! [fragment on the bottom, annotated by Nees, anonymous s.n.]). Type data from Moraes (2008) and Moraes & Falcade (2015). As pointed out by Moraes (2008), a different collection also labelled as Sellow 1360 is the type of Roupala adiantifolia Klotzsch (Proteaceae).

Mez (1892) indicated that Phoebe oleifolia was based on material in herbarium of Ignaz Urban, which is now in B. There is a photo of the holotype in F (F neg. 3596), but we could not locate this specimen in B, nor is it available in the Berlin Virtual Herbarium (Röpert, 2000–). Therefore, we assume that it has been destroyed. The specimen preserved in Berlin (B barcode B 10 0247424) cannot be the holotype, as it shows no indication that Mez has seen it (and very incomplete label data). Among the isotypes that have been annotated by Mez himself, the specimen in C appears to be the best preserved, and is therefore selected as lectotype here.

15. Aiouea floccosa (Van der Werff) R.Rohde, comb. nov. ≡ Cinnamomum floccosum Van der Werff in Novon 13: 337–339, fig. 1. 2003 – Holotype: Peru. Cajamarca: Prov. San Ignacio, Santuario Nacional Tabaconas-Namballe, Camino al Cerro Coyona, 2500–2600 m, 20 Nov 1998, Díaz, Sembrera & Adrianzen 10087 (MO barcode MO-104250 [photo!]; isotypes: HBG barcode HBG-509744!, K, NY barcode 00688329 [photo!]).

16. Aiouea formicaria (Van der Werff & Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum formicarium Van der Werff & Lorea-Hern. in Novon 19: 534–536, fig. 1. 2009 – Holotype: Ecuador. Bolívar: along rd. Chillanes-El Tambo, 1700–2300 m, 19 July 1991, Van der Werff, B. Gray & Tipas 12498 (MO barcode MO-289415!; isotypes: B! [without barcode], G barcode G00368851!, GH barcode 00549602!, MO barcodes MO-289417! & MO-289418!, NY barcode 232373!, QCNE barcode QCNE286!).

17. Aiouea glaziovii (Mez) R.Rohde, comb. nov. ≡ Phoebe glaziovii Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 216. 1889 ≡ Cinnamomum glaziovii (Mez) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated here): Brazil. Rio de Janeiro: Petrópolis, margem do Piabanha, 25

Oct 1883, Glaziou 15368 (K barcode K000602101!; isolec-totypes: B [probably destroyed], C barcodes C10013531! & C10013532!, G barcode G00368849!, LE barcode LE 00000524!, P barcode P 00128561!, RB barcodes 0039286! & 00547514!; photo of B specimen, F neg. 3592 [photo!]).Additional syntypes of Phoebe glaziovii: Brazil, without lo-

cality, Binot 22 (BR barcodes 000008762337!, 000008762665!, 000008762993! & 000008764614!, P barcode P02009372!); Brazil, Rio de Janeiro, Petrópolis, 9 Sep 1873, Glaziou 6668 (BR barcode 000008762009!, C barcodes C10013527! & C10013528!, G barcode G00368848!, K barcode K000602100 [photo!], LE barcode LE 00000525 !, MPU barcode MPU018758 [photo!], P barcodes P00128559! & P00128560!); Brazil, Rio de Janeiro: Petrópolis, 28 Oct 1875, Glaziou 8097 (BR barcode 000008763327!, C barcodes C10013529! & C10013530!, G bar-code G00368850!, LE barcode LE 00000526!, NY barcode 00355907!, P barcodes P00128556!, P00128557! & P00128558!).

Lorea-Hernández (1996) proposed a specimen of Glaziou 15368 in B as the lectotype, without having seen it. We have not been able to locate this specimen, nor is it available in the Berlin Virtual Herbarium (Röpert, 2000–). It may have been destroyed in World War II. Therefore, we prefer to propose a specimen in K, annotated and cited by Mez, as the lectotype.

18. Aiouea glossophylla (Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum glossophyllum Lorea-Hern. in Acta Bot. Mex. 40: 6–8, fig, 2. 1997 – Holotype: Mexico. Nayarit: mpio. Nayar, 12 km N of Linda Vista on the road to Santa Teresa, 2250 m, 3 Aug 1990, Flores 2198 (MEXU; iso-types: FCME, MEXU barcode MEXU 01007842!, MO barcodes MO-247093! & MO-337695!).

19. Aiouea grisebachii (Lorea-Hern.) Rohwer, comb. nov. ≡ Phoebe triplinervis Griseb., Pl. Wright.: 187–188. 1860 ≡ Phoebe grisebachiana Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 215. 1889 ≡ Cinnamomum grisebachii Lorea-Hern. in Acta Bot. Mex. 40: 2–3. 1997 – Holotype: Cuba. Guantánamo: “in sylvis prope villam Monte Verde dictam”, Jan–Jul 1859, Wright 1400 (GOET barcode GOET004720!; isotypes [?]: BR barcode 000005115198!, G barcodes G00368852! & G00368853!, GH barcode 00026377!, K barcode K000602113 [photo!], LE barcode LE 00000540 [photo!], MO barcode MO-277507!, P barcode P00064866!, PH barcode 00029691 [photo!]).When Grisebach (1860) published the name Phoebe tri-

plinervis, it was legitimate for this species. Mez (1889), how-ever, preferred to use the same name for a closely related species based on a different type, first described as Laurus triplinervis by Ruiz & Pavón (1804–1813, see below). Under our current rules of nomenclature (McNeill & al., 2012), the combination made by Mez was a younger homonym and thus illegitimate, as was the new name Phoebe grisebachiana cre-ated by Mez for this species (superfluous renaming). We are transferring both of these species to Aiouea, and there is a still older name (Laurus montana) available for the other entity. Therefore, it would be correct according to the Code (McNeill

1101Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

& al., 2012) to call this species Aiouea triplinervis. This, how-ever, would create considerable confusion, because the other, far more frequent and widespread species has been known as Cinnamomum triplinerve (Ruiz & Pav.) Kosterm. for the last decades. Therefore, we prefer to take up the nomen novum created by Lorea-Hernández (1997) for this species. Meissner (1864) had placed the type of Phoebe triplinervis Griseb. in Phoebe antillana var. cubensis, along with several other col-lections (see below, under Aiouea montana).

20. Aiouea hammeliana (W.C.Burger) R.Rohde, comb. nov. ≡ Phoebe hammeliana W.C.Burger in Fieldiana, Bot., n.s., 23, fig. 12: 113. 1990 ≡ Cinnamomum hammelianum (W.Burger) Lorea-Hern. ex J.Á.González & Hammel in Monogr. Syst. Bot. Missouri Bot. Gard. 111: 108. 2007 – Holotype: Costa Rica. San José: 0.9 km above La Chonta, 11 May 1969, Lent 1678 (CR; isotypes: DUKE barcode DUKE10000040 [photo!], F barcode v0061771F!, NY bar-code 00355890!).

21. Aiouea hartmanii (I.M.Johnst.) R.Rohde, comb. nov. ≡ Persea hartmanii I.M.Johnst. in Contr. Gray Herb., n.s., 70: 69. 1924 ≡ Cinnamomum hartmanii (I.M.Johnst.) Kosterm. in Reinwardtia 10: 444. 1988 (“hartmannii”) – Holotype: Mexico. Chihuahua: Batopilas, Apr 1892, Hartman 1029 (GH barcode 00055539 [photo!]; isotypes: A barcode 00055538 [photo!], MO barcode MO-247092!, UC bar-code UC 702643 [photo!], US barcode 00099120 [photo!]).

22. Aiouea hatschbachii (Vattimo-Gil) R.Rohde, comb. nov. ≡ Cinnamomum hatschbachii Vattimo-Gil in Arch. Jard. Bot. Rio de Janeiro 17: 222. 1962 – Holotype: Brazil. Paraná: Guaratuba, Serra de Araçatuba, 31 Jan 1960, Hatschbach 6682 (RB barcode 00539176!; isotypes: HB!, MBM barcode MBM23288!, NY barcode 00354955!, US barcode 00051082!).

23. Aiouea haussknechtii (Mez) R.Rohde, comb. nov. ≡ Phoebe haussknechtii Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 186. 1889 ≡ Cinnamomum haussknechtii (Mez) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated by Moraes in Komarovia 6: 52. 2008): Brazil. Without local-ity, s.d., Sellow 1082 (B barcode B 10 0185193!; fragm. F barcode v0061784F [photo!]; photo F neg. 3593 [photo!]).

24. Aiouea heteranthera (Ruiz & Pav.) R.Rohde, comb. nov. ≡ Laurus heteranthera Ruiz & Pav., Fl. Peruv. 4: t. 364. 1804–1813 ≡ Phoebe ruiziana Nees in Linnaea 21: 489. 1848 (“Ruiziana”) ≡ Phoebe heteranthera (Ruiz & Pav.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 185. 1889 ≡ Cinnamomum heterantherum (Ruiz & Pav.) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated here): Peru. Huánuco, Chacahuasi, Sep 1787, Pavon s.n., Ruiz & Pavón s.n. (MA barcode MA 811829 [photo!]; isolecto-types B barcode B 10 0247428!, BC barcode BC-873012 [photo!], BM barcode BM000947201! [left specimen only], F barcode v0040281F!, FI barcode FI005196 [photo!],

HAL barcode HAL0103813, MA barcode MA 811828 [photo!]; fragm. F barcode v0040282F!, NY barcode 00355161 [photo!]).The plates of the fourth volume of the Flora Peruviana et

Chilensis have been ready for distribution in late 1803 or early 1804 (Alvarez López, 1955), but until recently it remained un-clear when they actually had been distributed. A letter from Pavón to J.E. Smith in the collection of the Linnean Society of London (http://linnean-online.org/62228/) informs us that Pavón sent the plates to the Linnean Society in 1813, which can be regarded as an effective publication in the sense of Art. 30.4./30.5. of the Code (McNeill & al., 2012). Plate 364 showing Laurus heteranthera was undoubtedly based on collections by Ruiz & Pavón, of which duplicates are preserved in the herbaria indicated above.

A specimen in G with a label of Laurus heteranthera in the handwriting of Pavón, G barcode G00368854, does not agree with the illustration of the type, but rather is an Ocotea of the minarum group. A branch from the same collection is mounted on the right side of the specimen BM barcode BM000947201.

25. Aiouea hirsuta Lorea-Hern., sp. nov. – Holotype: Brazil. São Paulo, Serra da Cantareira, 20 Mar 1969, Braga 36 (SPSF; isotypes: FCME, MO barcode MO-247129!).Arbores. Folia obovata vel oblanceolata, apice acutato vel

acuminato, triplinervia aut subtriplinervia, infra hirsuta tri-chomatibus subrectis, erectis; domatiis praesentibus ad axil-las nonnullas venarum secundariarum et tertiariarum, saepe inconspicuis, pagina foliari ad domatia infra subplana, supra leviter prominens. Inflorescentia thyrsoidea, bracteis foliaceis destituta. Flores extus omnino tomentosi, hypanthio intus pu-bescente. Tepala in fructu omnino persistentia.

26. Aiouea kruseana (O.Téllez & Villaseñor) R.Rohde, comb. nov. ≡ Cinnamomum kruseanum O.Téllez & Villaseñor in Novon 3: 208, fig. 1. 1993 – Holotype: Mexico. Guerrero: Agua de Obispo, Puente el Mosco, falda este del cerro, alt. 850–900 m, 4 Mar 1961, Kruse 620 (MEXU; isotypes: ENCB, GH barcode 00055176 [photo!], IBUG barcode IBUG0133770 [photo!], MEXU, MO barcode MO-2116067 [photo!], XAL).

27. Aiouea lanigera (Van der Werff) R.Rohde, comb. nov. ≡ Cinnamomum lanigerum Van der Werff in Novon 19: 536–538, fig. 2. 2009 – Holotype: Ecuador, Carchi: Espejo, Faldas del Cerro Golondrinas Hembra, 00°51′ N, 78°07′ W, 2300–2400 m, 20 Aug 1994, Palacios 12721 (MO barcode MO-2176156!; isotypes: AAU, HBG!, NY, QCNE barcode QCNE99148 [photo!], US, XAL barcode XAL0005319!).

28. Aiouea leptophylla (Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum leptophyllum Lorea-Hern. in Acta Bot. Mex. 40: 8–10, fig. 3. 1997 – Holotype: Mexico. Veracruz: Mpio. Atzalan, Ranchito El Caballo, 1000 m, 7 May 1976, Ventura 12740 (ENCB!; isotypes: FCME, MO barcode MO-2116068!).

1102 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

29. Aiouea longipes (I.M.Johnst.) R.Rohde, comb. nov. ≡ Phoebe longipes I.M.Johnst. in Contr. Gray Herb. 70: 69. 1924 ≡ Cinnamomum longipes (I.M.Johnst.) Kosterm. in Reinwardtia 6: 21. 1961 – Holotype: Mexico. Hidalgo: Acaxochitlán, Barranca Trinidad, below Honey Station, 6 May 1904, Pringle 8829 (GH!; isotypes: CAS barcode CAS0003983 [photo!], F!, LL barcode 00370946!, LSU barcode LSU00113012 [photo!], MICH barcode 1104614!, MO barcode MO-2116326!, NY barcode 00355892 [photo!], OKLA barcode 100160 [photo!], SD barcode SD00000223 [photo!], S No. S-G-4805 [photo!], TEX barcode 00370945!, UC barcode UC 1168210 [photo!], UCR barcode UCR0000060 [photo!], US barcode 00099179!, US barcode 00930678 [photo!], WIS barcode v0255275WIS [photo!]).In 1977, Kostermans annotated the specimen Poilane 3523

from Vietnam (L barcode L0035857) as type of Cinnamomum longipes Kostermans. Apparently he had not been aware any more that he had used this name already for a different species.

30. Aiouea maya Lorea-Hern., nom. nov. ≡ Phoebe trinervis Lundell in Phytologia 12: 245. 1965. ≡ Cinnamomum tri-nerve (Lundell) Kosterm. in Reinwardtia 10: 453. 1988 – Holotype: Guatemala. Petén: Tikal National Park, 29 Jan 1964, Lundell 17591 (LL barcode 00370960!; isotypes: F barcode v0061778F!, GH!, LL barcode 00370959!, MO barcode MO-042264!, NY barcode 00355903 [photo!], S Nos. S-R-4437! & S12-16597!, US barcode 00099193!).Aiouea trinervis Meisn. (Meisner, 1864) prevents making

this combination for the present species.

31. Aiouea montana (Sw.) R.Rohde, comb. nov. ≡ Laurus montana Sw., Prodr.: 65. 1788 ≡ Phoebe montana (Sw.) Griseb. in Mem. Amer. Acad. Arts, ser. 2, 8: 187. 1860 ≡ Cinnamomum montanum (Sw.) J.Presl in Berchtold & Presl, Přir. Rostlin 2: 36. 1823–1825 – Lectotype (first-step designated by Imkhanitskaya in Novosti Sist. Vyssh. Rast. 11: 206. 1974; second-step, designated by Rohwer in Greuter & Rankin Rodríguez, Fl. Rep. Cuba, fasc. 19(2): 25. 2014): Jamaica, s.d., Swartz s.n. (S No. S-R-3167 [photo!]; isolectotypes: BM barcode BM000758823!, LD barcode 1263405 [photo!], S No. S-R-3168 [photo!], SBT barcode SBT11581 [photo!]).

= Laurus triplinervis Ruiz & Pav., Fl. Peruv. 4: t. 363. 1804–1813 ≡ Phoebe peruviana Meisn. in Candolle, Prodr. 15(1): 32. 1864, nom. illeg. ≡ Cinnamomum triplinerve (Ruiz & Pav.) Kosterm. in Reinwardtia 6: 24. 1961 ≡ Cinnamomum peruvianum (Meisn.) Kosterm. in Reinwardtia 10: 448. 1988 – Lectotype (designated by Rohwer in Greuter & Rankin Rodríguez, Fl. Rep. Cuba, fasc. 19(2): 25. 2014): Peru. Huánuco: Cuchero, labelled as Ruiz & Pavón s.n. or Ruiz s.n. or Pavón s.n. or Dombey s.n. (MA barcode MA 811832 [photo!; erroneously labelled as “Laurus pur-purea”]; isolectotypes(?), BC barcode BC-873076 [photo!], F barcodes v0040297F! & v0040298F!, FI barcode FI005222 [photo!], HAL barcode HAL0103814 [photo!], MA barcodes MA 811830 [photo!], MA 811831 [photo!], MA 811833 [photo!], MA 817667 [photo!], MA 817668

[photo!], MA 818055 [photo!], MA 818056 [photo!] & MA 818057 [photo!], MO barcode MO-247261!, P barcodes P00128489!, P00128490!, P00128491! & P00128492!; fragm. NY barcode 00355168 [photo!; mounted with frag-ment of the type of Phoebe cinnamomifolia]).

= Persea cinnamomifolia Kunth in Humboldt & al., Nov. Gen. Sp. 2: 127 [folio ed.] or 160 [quarto ed.]. 1817 ≡ Phoebe cinnamomifolia (Kunth) Nees in Linnaea 21: 488. 1848 ≡ Phoebe granatensis Meisn. in Candolle, Prodr. 15(1): 32. 1864, nom. illeg. ≡ Cinnamomum cinnamomifolium (Kunth) Kosterm. in Reinwardtia 6: 20. 1961 – Lectotype (designated by Rohwer in Greuter & Rankin Rodríguez, Fl. Rep. Cuba, fasc. 19(2): 26. 2014): Colombia, Tolima: Mariquita, July 1805, Bonpland 1801 (P barcode P00128542!; isolectotypes: NY barcode 00355821 [photo!], P barcodes P00128543! & P00128544!).

= Phoebe elongata Nees, Syst. Laur.: 116–117. 1836 ≡ Cinnamomum elongatum (Nees) Kosterm. in Reinwardtia 6: 21. 1961, nom. illeg., non Cinnamomum elongatum Saporta in Ann. Sci. Nat., Bot.,ser. 7, 10: 1–192. 1889 nec Cinnamomum elongatum Usnadze, Sak. SSR Metsnier. Akad. Geol. Inst. Shrom., Ser. Akhali 5(10): 275–311. 1949 ≡ Cinnamomum phoebe Doweld in Phytotaxa 243: 190–192. 2016 – Lectotype (implicitly designated by Meissner in Candolle, Prodr. 15(1): 33. 1864, by using the second syntype, Poeppig 1311, as type of Phoebe poeppigii; explicitly designated by Imkhanitskaya in Novosti Sist. Vyssh. Rast. 11: 205. 1974): no locality or date indicated, herb. Vahl s.n. (B -W 07780 -01 0 [photo!]).

= Phoebe maynensis Nees, Syst. Laur.: 118–119. 1836 ≡ Phoebe peruviana var. glabriflora Meisn. in Candolle, Prodr. 15(1): 32. 1864 ≡ Cinnamomum maynense (Nees) Kosterm. in Reinwardtia 6: 22. 1961 – Lectotype (designated here): Peru. Loreto: near Yurimaguas and Maynas [= Iquitos?], Poeppig 2305 (B barcode B 10 0247426!; isolectotypes: F barcode v0040360F!, HAL barcode HAL0103815 [photo!], LE barcodes LE 00000534! & LE 00000535!, P barcodes P00128565! & P00128566!, US barcode 00099180!; prob-able isolectotype: BM barcode BM000947204!).

= Phoebe cubensis Nees, Syst. Laur.: 120. 1836 ≡ Phoebe an-tillana var. cubensis (Nees) Meisn. in Candolle, Prodr. 15(1): 31. 1864 ≡ Cinnamomum cubense (Nees) Kosterm. in Reinwardtia 6: 21. 1961 (“cubensis”) – Lectotype (desig-nated by Rohwer in Greuter & Rankin Rodríguez, Fl. Rep. Cuba, fasc. 19(2): 26. 2014): Cuba, without locality, Poeppig s.n. (B barcode B 10 0086118!; possible isolectotypes: B barcode B 10 0086122!, BR barcodes 00005114931! & 000005115914!, G barcode G00368817!, LE barcode LE 00000515 !, M barcode M-0147197!, MO barcodes MO-277505! & MO-277506!, P barcode P00267918!).

= Oreodaphne alba A.Rich. in Sagra, Hist. Fís. Cuba, Bot. 11: 189–190. 1850 – Holotype: Cuba, without locality, s.d., Sagra 269 (P barcode P00267917!; isotype: NY barcode 00074398!).

= Phoebe valenzuelana A.Rich. in Sagra, Hist. Fís. Cuba, Bot. 11: 185. 1850 – Holotype: Cuba, Pinar del Río, s.d., Valenzuela for Sagra s.n. (P barcode P00064871!).

1103Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

= Phoebe mexicana Meisn. in Candolle, Prodr. 15(1): 31–32. 1864 ≡ Persea mexicana (Meisn.) Hemsl., Biol. Cent.-Amer., Bot. 3(14): 72. 1882 ≡ Cinnamomum mexicanum (Meisn.) Kosterm. in Reinwardtia 6: 22. 1961 – Lectotype (designated here): Mexico, Veracruz, near Xalapa, alt. 3000 ft., 1840, Galeotti 7026 (K barcode K000602037 [photo!]; isolectotypes: BR!, K barcode K000602038 [photo!], LE barcode LE 00000527!).

= Phoebe poeppigii Meisn. in Candolle, Prodr. 15(1): 33. 1864 – Lectotype (designated here): Peru. Huánuco: [San Juan de] Cuchero, Poeppig 1311 (NY barcode 00355911!; isolectotypes: BM barcode BM000947202!, F barcode v0040355F!, G barcode G00368815!, GOET, LE bar-codes LE 00000531!, LE 00000532!, LE 00000533! & LE 00000535!, MO barcode MO-264558!, P barcodes P00128493! & P00128494!, W No. W1889-104379!).

= Phoebe brasiliensis Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 198–199. 1889 ≡ Cinnamomum brasiliense (Mez) Kosterm. in Reinwardtia 6: 20. 1961 (“brasiliensis”) – Lectotype (designated here): Brazil. Rio de Janeiro: between Lagoa dos Peixes and Rio Bonito, 22 Sep 1881, Glaziou 13153 (B barcode B 10 0185019!; isolectotypes: BR barcode 000008762962!, C barcode C10013520!, G bar-code G00368823!, LE barcode LE 00000567!, P barcodes P00128539!, P00128540! & P00128541!).

= Phoebe mexicana var. bourgeauana Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 214. 1889 – Lectotype (designated here): Mexico. Veracruz: valley of Córdoba, 20 Apr 1866, Bourgeau 2302 (S No. S-G-4808 [photo!]; isolectotypes: F!, P barcodes P00064873!, P00128487! & P00128488!).

= Phoebe heterotepala Mez in Repert. Spec. Nov. Regni Veg. 3: 67–68. 1906 ≡ Cinnamomum heterotepalum (Mez) Kosterm. in Reinwardtia 6: 210. 1961 – Lectotype (des-ignated here): Peru. Huánuco: Monzón, 1200–1300 m, 2 Aug 1903, Weberbauer 3487 (B barcode B 10 0247427; isolectotype: G barcode 00368814!; fragm. F barcode v0040358F!).

= Phoebe paraguariensis Hassl. in Annuaire Conserv. Jard. Bot. Genève 21: 79–80. 1919 ≡ Cinnamomum paraguar-iense (Hassl.) Kosterm. in Reinwardtia 6: 22. 1961 (“para-guariensis”) – Lectotype (designated here): Paraguay. Amambay: Santo Tomás, Sierra de Amambay, Aug 1912, Hassler 11305 (G barcode G00228251!; isolectotypes: A barcode 00026370!, BM barcode BM000947203!, F bar-code v0061787F!, G barcodes G00228252!, G00228253! & G00228254!, K barcode K000602097 [photo!], MPU barcode MPU018761 [photo!], NY barcode 00355909!, P barcodes P00128570! & P00128571!, S No. S-R-4436!).

= Ocotea flavescens Rusby, Descr. S. Amer. Pl.: 20–21. 1920 – Holotype: Colombia, Magdalena: Sierra de Santa Marta, near Valparaiso, alt. 4000–5500 ft., Smith 1762 (NY bar-code 00355603 [photo!]; isotypes: A barcode 00042095 [photo!], BM barcode BM000993965 [photo!], BR barcode 000005119028!, CM barcode 0647 [photo!], DAO barcode 000001602 [photo!], F barcode v0061596F [photo!], G bar-codes G00368820! & G00368821!, GH barcode 00026375!, K barcode K000602093!, L barcode L 0036048 [photo!],

MICH barcode 1104592!, MO barcode MO-247125!, MPU barcode MPU018760 [photo!], P barcodes P00756878! & P00756879!, PH barcode 00019562 [photo!], S No. S-R-7150 [photo!]; probable isotypes: MO barcode MO-247296 [photo!], U barcode U 0002945 [photo!], US barcodes 00099213! & 01095200!).

= Phoebe pichisensis A.C.Sm. in Bull. Torrey Bot. Club 58: 103–104. 1931 ≡ Cinnamomum pichisense (A.C.Sm.) Kosterm. in Reinwardtia 6: 23. 1961 (“pichisensis”) – Holotype: Peru. Junín: km 3–10, on Pichis trail, alt. 900 m, 28 Jun 1929, Killip & Smith 25430 (NY barcode 00355910!; isotypes: F barcode v0040354F!, US barcode 00099187!).

= Phoebe johnstonii C.K.Allen in J. Arnold. Arbor. 26: 433. 1945 ≡ Cinnamomum johnstonii (C.K.Allen) Kosterm. in Reinwardtia 6: 21. 1961 – Holotype: Panama. San José Island, Perlas archipelago, 11 Apr 1945, Johnston 697 (A barcode 00026405!; isotypes: A barcode 00026406!, FI barcode FI005371 [photo!], MO barcode MO-247130 [photo!], US barcode 00099178!).

= Cinnamomum australe Vattimo-Gil in Arch. Jard. Bot. Rio de Janeiro 17: 224. 1962 – Holotype: Brazil. Santa Catarina, Reitz & Klein 3690 (RB barcode 00539171!; isotypes: B barcode B 10 0185018!, BR barcode 000008762634!, FLOR, G barcode G00368816!, L barcode L 0308434 [photo!], MBM barcode MBM0023289!, NY barcode 00023051!, US barcode 00099073!).

= Cinnamomum chana Vattimo-Gil in Arch. Jard. Bot. Rio de Janeiro 17: 223–224. 1962 – Holotype: Brazil. Paraíba, Areia, Escola de Agronomia do Nordeste, J.M. Vasconcellos 124 (RB barcode 00539174!; isotypes: CEPEC [2 sheets], NY barcode 01131930!, RB barcodes 00571115! & 00571271!, SP barcode SP000821!).

= Cinnamomum xinguense Vattimo-Gil in Arch. Jard. Bot. Rio de Janeiro 17: 224. 1962 – Holotype: Brazil. Pará: Xingu, Vitoria a Ponte Nova, 7 Aug 1918, A. Ducke s.n. (RB barcode 00539181!).

= Phoebe filamentosa C.K.Allen in Mem. New York Bot. Gard. 15: 69–71, fig. 5. 1966 – Holoype: Venezuela. Mérida: along Río Onia, near Bolero, north of Mesa Bolívar, alt. 545–915 m, 23 May 1944, Steyermark 56740 (F barcode v0061782F!; isotypes: F barcode v0061783F!, MO barcode MO-247126!, VEN barcode 62546!).

= Cinnamomum portosecurianum Vattimo-Gil in Anais Congr. Soc. Bot. Brasil 15: 170. 1967 – Holotype: Brazil. Bahia: Pôrto Seguro, km 18 ramal da BR 5, Nov 1963, Duarte 8044 (RB barcode 00539178!; isotypes: B barcode B 10 0345997!, CEPEC, F barcode v0092295F!, HUEFS barcode HUEFS000002277!, JE barcode JE00010188!, K barcode K000815961!, MBM barcode MBM0353488!, MBML No. 38955!, NY barcode 01104793!, RB barcodes 00571103! & 00571105!, SP barcode SP000822!, US bar-code 01049632!).

= Phoebe pickelii Coe-Teix. in Hoehnea 1: 187–188. 1971 ≡ Cinnamomum pickelii (Coe-Teix.) Kosterm. in Reinwardtia 10: 448. 1988 – Lectotype (designated here): Brazil. São Paulo: Vicinity of São Paulo, Chácara dos Morrinhos, 11 Oct 1941, B. Pickel s.n., originally cited as “Pickel 4442”

1104 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

(SPSF No. 4442 [branch on the upper right of, with a can-celled stamp of SP 99677]; isolectotypes: IPA No. 9330, PEUFR No. 642, SP No. 41789).

= Phoebe fruticosa Lundell in Wrightia 5: 342–343. 1977 ≡ Cinnamomum fruticosum (Lundell) Kosterm. in Rein-wardtia 10: 443. 1988 – Holotype: Mexico. Chiapas: Mun. Tuxtla Gutiérrez, at El Sumidero 22 km. N of Tuxtla Gutiérrez, elev. 4500 ft., 02 Jul 1965, Breedlove 10671 (LL barcode 00370944!; isotypes: DS barcode CAS0003982!, ENCB barcode ENCB008647!, MICH barcode 1104612!, NY barcode 00355889!).The holotype of Persea cinnamomifolia is a sterile speci-

men bearing several labels. One of them reads “juillet 1805. Mariquita. no. Laurus hundensis. Persea cinnamomifolia mihi”. A different hand added “(Kunth scrips.)” to the latter name. Below it is a label reading “Laurus hundense. foliis oblongis acutis coriaceis supra nitidis subtus subtriplinervio-venosis, [word not recognized] racemis axillaribus, folio brevioribus.” Here a comment “Bonpland scrpt.” was added later. The third label reads “Phoebe granatensis”, and the fourth, written in the same handwriting as the comments added to the first two labels, reads “Persea cinnamomifolia Kunth.! in H & Bonpl. Laurus hundensis Bonpl.! mns. Amérique équatle no. 1801.” The three isotypes all show somewhat malformed fruits, at least with strongly curved pedicels. In NY00355821 and P00128544, the locality is given as „Hunda“ (= Honda, Prov. Tolima).

Two different species have been distributed as Laurus elon-gata Vahl. The specimens B -W 07780 -01 0, B -W 07780 -02 0 and P00662846 represent Aiouea montana, but S-R-7281 rep-resents Damburneya patens (Sw.) Trofimov. The labels on the specimens in the Willdenow herbarium show that Nees had considered the two specimens to represent different species, and he explicitly included only “Fol.1” in his description of Phoebe elongata (Nees 1836). The lectotypification by Rohwer (2014) is therefore erroneous. The second syntype of Phoebe elongata Nees, Poeppig 1311, has been used by Meissner (1864) as type of Phoebe poeppigii, whereby he effectively lectotypi-fied the species.

The second syntype of Phoebe mexicana, Linden 20 is preserved in FI (barcode FI005197). Both collectors and their numbers are indicated on the same sheet in a specimen at K (barcode K000602039). The two collections are so similar to each other that it is difficult to tell which one it is.

In his description of Phoebe poeppigii, Meissner (1864) cited the herbaria “DC., Boiss.” These are now incorporated in G, but the G specimen cited above is from the herbarium Delessert, and it does not bear Meissner’s handwriting. Therefore, we designate the specimen from Meissner’s per-sonal herbarium (now in NY) as the lectotype.

For Phoebe mexicana var. bourgeauviana, Mez cited the herbaria “Boiss.-Barbey., Holm., Paris.” Among the speci-mens available in JSTOR, only the one from S is bearing an original determination label of Mez. Therefore, we select it as lectotype here.

The two other syntypes of Phoebe brasiliensis are: Brazil. Glaziou 11459 (C barcode C10013521, P barcode P01959312!); Brazil. Rio de Janeiro: between Jerecino and Realengo, 29

Aug 1880, Glaziou 12132 (C barcode C10013550!, G bar-code G00368822!, LE barcode LE 00000522!, NY bar-code 00355905!, P barcode P00752515!; fragm. F barcodes v0061781F! & v0061791F!);

We did not find the second syntype of Phoebe heterote-pala, Weberbauer 3496, except for a specimen in which frag-ments of both syntypes are mixed (F barcode v0040357F).

The typification of Phoebe pickelii is somewhat compli-cated. Coe-Teixeira (1971) wrote “Typus: B. Pickel 4442 (SP). Brasil: São Paulo.” Lorea-Hernández (1996) cited “Pickel 4422” as the type number. Coe-Teixeira had also cited this number, but only under “Material estudado”, along with no. 4444. The only specimen bearing the number 4442 (although as herbarium number, not as collector’s number) as well as a label saying “Phoebe bentoi nov. spec. Coe-Teixeira” in her handwriting is the one designated as lectotype above. “Bento” is the first name of the collector. Pickel collected material (presumably from the same tree) twice, a flowering branch 11 Oct 1941, and a fruiting branch 26 Dec 1941. Both are mounted on the same sheet. Therefore, we designated one of them as lectotype. The isolectotypes cited above agree with the branch on the upper right. There are also duplicates of the fruiting branch: IPA 9336 and SP 41803, to which the number 4444 appears to have been added later, and probably also IPA 9331, even though the number on the label is given as 4422.

32. Aiouea napoensis (Van der Werff) R.Rohde, comb. nov. ≡ Cinnamomum napoense Van der Werff in Ann. Missouri Bot. Gard. 78: 411, fig. 2B. 1991 – Holotype: Ecuador. Napo: Estación Biológica Jatun Sacha, 8 km al este de Misahuallí, 01°08′ S, 77°30′ W, 450 m, 2–5 Sep 1988, Palacios 2886 (MO barcode MO-289413!; isotypes: AAU, F barcode v0061376F [photo!], G barcode G00368855!, HBG barcode HBG-509753!, NY barcode 00354956!, QAME, QCNE barcode QCNE287 [photo!], QRS barcodes QRS98861 [photo!] & QRS98862 [photo!], US barcode 00386076!).

33. Aiouea neurophylla (Mez & Pittier) R.Rohde, comb. nov. ≡ Phoebe neurophylla Mez & Pittier in Bull. Herb. Boissier, sér. 2, 3: 231. 1903 ≡ Cinnamomum neurophyllum (Mez & Pittier) Kosterm. in Reinwardtia 6: 22. 1961 – Holotype: Costa Rica. Puntarenas, Diquís valley, alt. 800 m, 15 Mar 1898, Pittier in herb. inst. phys.-geogr. Costar. 12054 (“Herb. Mez”, B barcode B 10 0247425; isotypes: G bar-code G00368808!, P barcode P00064869!, US barcode 00099184!).

34. Aiouea pachypoda (Nees) R.Rohde, comb. nov. ≡ Persea pachypoda Nees in Linnaea 21: 490. 1848 ≡ Phoebe pachy-poda (Nees) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 196. 1889 ≡ Cinnamomum pachypodum (Nees) Kosterm. in Reinwardtia 10: 447. 1988 – Lectotype (designated here): Mexico. Hidalgo: near El Banco, between Apulco and San Cornelio, Ehrenberg 942 (B barcode B 10 0247423!; fragm. F barcode v0061722F!, GZU barcode GZU000254410!).

= Oreodaphne benthamiana Nees in Linnaea 21: 521. 1848 ≡ Phoebe hartwegii Meisn. in Candolle, Prodr. 15(1): 30.

1105Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

1864, nom. illeg. ≡ Persea hartwegii (Meisn.) Hemsl., Biol. Cent.-Amer., Bot. 3(14): 72. 1882, nom. illeg. ≡ Phoebe benthamiana (Nees) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 195. 1889 – Holotype: Mexico. Guanajuato: near Guanajuato, Mar–Apr 1837, Hartweg 84 (B barcode B 10 0247468!; isotypes: BM barcodes BM000795442! & BM000795443!, E barcode E00259428 [photo!], FI barcode FI005194 [photo!], G barcodes G00368838! & G00368839!, GH barcode 00042143 [photo!], K barcodes K000602159! & K000602160!, LD barcode 1216395 [photo!], P barcode P00064867!; fragm. F barcode v0061668F!, NY barcode 00355673 [photo!]).

= Phoebe ehrenbergii Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 201. 1889 ≡ Cinnamomum ehrenbergii (Mez) Kosterm. in Reinwardtia 6: 21. 1961 – Holotype: Mexico. México: Temascaltepec, Ehrenberg 712 (B [probably destroyed]; fragm. F, photo of holotype, MO barcode MO-042284).

= Phoebe arsenei C.K.Allen in J. Arnold Arbor. 26: 312. 1945 ≡ Cinnamomum arsenei (C.K.Allen) Kosterm. in Reinwardtia 6: 20. 1961 – Holotype: Mexico. Michoacán: Morelia, near El Rincón, 1950 m, 11 Apr 1909, Arsène 2448 (GH!; isotypes: EBUM barcode EBUM0000817 [photo!], MEXU barcodes MEXU 00185626 [photo!] & MEXU 00088029 [photo!], MO barcode MO-247091!, NY bar-code 00355879!, P barcodes P00064881! & P00064882!, US barcode 00099171!).The only complete specimen of Ehrenberg 942 that we

could locate (B barcode B 10 0247423) cannot be the holotype of Persea pachypoda Nees as it does not bear Nees’ handwriting. Still we selected it as lectotype, because the specimen in the Nees herbarium (GZU barcode GZU000254410) is rather frag-mentary. We also could not locate any specimen of Ehrenberg 712, type of Phoebe ehrenbergii Mez, except for a fragment in F.

35. Aiouea padiformis (Standl. & Steyerm.) R.Rohde, comb. nov. ≡ Phoebe padiformis Standl. & Steyerm. in Publ. Field Mus. Nat. Hist., Bot. Ser. 23(3): 117. 1944 ≡ Cinnamomum padiforme (Standl. & Steyerm.) Kosterm. in Reinwardtia 6: 22. 1961 – Holotype: Guatemala: Dept. Quezaltenango: Colomba, alt. 575 m, October, 1934, A.F. Skutch 1367 (F!; isotypes: A barcodes 00026391! & 00026392!, BM bar-code BM000795444!, G barcode G00368809!, NY barcode 00023532!, US barcode 00099186!).

36. Aiouea palaciosii (Van der Werff) R.Rohde, comb. nov. ≡ Cinnamomum palaciosii Van der Werff in Ann. Missouri Bot. Gard. 78: 415, fig. 2A, 4C–F. 1991 – Holotype: Ecuador. Imbabura: forest remnant along road Apuela-Otovalo near Apuela, elev. 2000 m, 14 Feb 1989, Van der Werff & Palacios 10575 (MO barcode MO-289414!; isotypes: AAU, F barcode v0061377F!, G barcode G00368810!, GB barcode GB-0047888 [photo!], K, L barcode L 0539770 [photo!], MEXU barcode MEXU 00526051 [photo!], MICH barcode 1104537 [photo!], NY barcode 00232375!, QAME, QCNE barcode QCNE288 [photo!], QRS barcode QRS101472 [photo!], RSA barcode RSA0004029 [photo!], U barcode U 0002661!, US).

37. Aiouea paratriplinervis Lorea-Hern., sp. nov. – Holotype: Costa Rica. Puntarenas: Monteverde, Santa Elena, 1400 m, 2 Mar 1989, Bello 589 (CR barcode CR0001596105!; iso-types: MO barcodes MO-247131! & MO-247132!).Arbores. Folia plerumque elliptica vel anguste elliptica,

apice acuminato vel longe acuminato, triplinervia aut subtripli-nervia, infra sparsim et inconspicue pubescentia trichomatibus rectis, adpressis; domatiis interdum praesentibus ad axillas venarum secundariarum paris basalis tantum, pagina foli-ari utrinque ad domatia subplana. Inflorescentia thyrsoidea, bracteis foliaceis nonnunquam praesentibus, satis deciduis. Flores tepalis extus glabris, pedicello glabro vel glabrato, hy-panthio intus glabrescente. Tepala in fructu partim persistentia.

38. Aiouea pittieri Rohwer, nom. nov. ≡ Phoebe costaricana Mez & Pittier in Bull. Herb. Boissier, sér. 2, 3: 230. 1903 ≡ Cinnamomum costaricanum (Mez & Pittier) Kosterm. in Reinwardtia 6: 21. 1961 – Lectotype (designated here): Costa Rica. Near Cañas Gordas, alt. 1100 m, Pittier in herb. inst. phys.-geogr. Costar. 11107 (US barcode 00099174!; isolectotypes: BR barcode 000005175345!, CR, GH bar-code 00026408!, K barcode K000602036!, NY barcode 00355886!, US barcode 00099175!).The senior author of this paper (JGR) prefers to propose

a nomen novum for this species, in order to avoid confusion with Aiouea costaricensis (Mez) Kosterm., especially since the label on many of the isotypes reads “Phoebe costaricen-sis Mez & Pittier”. Lorea-Hernández (1996) wrote “holotype, CR, n.v.”, but Mez (1903) had cited “Herb. Mez” as the loca-tion of the type, and it appears unlikely that this sheet from Mez’s personal herbarium should have found its way to Costa Rica. Many Lauraceae specimens from the Mez herbarium are now in B, but this collection could not be located there by the senior author, nor is it available in the Berlin Virtual Herbarium (Röpert, 2000–). According to Stafleu & Cowan (1981), some material is now at WRSL, but this Pittier collec-tion could not be located there (Krzysztof Świerkosz, pers. comm., January 2017). As none of the known specimens bears Mez’s handwriting, we decided to select the most complete specimen as the lectotype.

Aiouea pittieri is a member of the Aiouea montana com-plex, and it remains to be examined with additional collections if the taxa of this complex are separable at all. Lorea-Hernández (1996) noted that “C. costaricanum and C. neurophyllum are morphologically very close” and “C. grisebachianum is barely different from C. costaricanum.” William C. Burger, who published the Lauraceae treatment for the Flora Costaricensis (1990) together with Henk van der Werff, annotated the US specimens as “Phoebe mexicana Meisner” in 1985, and added “a variety or ssp. of Phoebe cinnamomifolia” to the label of US 00099174 in 1987. In the same year he placed a note on the NY specimen, saying “Phoebe costaricana appears to be a distinctive highland element of the Ph. cinnamomifolia com-plex, closely related to Ph. neurophylla.” In the final publica-tion (Burger & Van der Werff, 1990), Phoebe costaricana was treated as a synonym of Phoebe cinnamomifolia.

1106 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

39. Aiouea pseudoglaziovii Lorea-Hern., sp. nov. – Holotype: Brazil: Santa Catarina: São Miguel, Porto União, 800 m, flowers, 9 Dec 1962, Klein 3627 (MBM barcode MBM0023285!; isotypes: B barcode B 10 0185020!, G barcode G00368812!, HBR!, RB barcode 00128466!, UC barcode UC 1325736).Arbores. Folia plerumque obovata vel oblanceolata, apice

acuminato, triplinervia, infra plus minusve pubescentia tri-chomatibus undulatis vel crispis, adpressis; domatiis prae-sentibus ad axillas nonnullas venarum secundariarum, saepe praesentibus ad axillas infimas venarum tertiariarum, pagina foliari utrinque ad domatia subplana. Inflorescentia thyrsoi-dea, bracteis foliaceis destituta. Flores tepalis extus glabratis aut plus minusve pubescentibus, pedicello glabro, hypanthio intus dense vel sparsim pubescente. Tepala in fructu partim persistentia.

40. Aiouea rubrinervia Lorea-Hern., sp. nov. – Holotype: Brazil. Minas Gereais: Pedra Azul, divisa da Bahia, (fl), 21 Sep 1965, Duarte & Pereira 9295 (RB barcode 00539179!; isotypes: HUEFS, K barcode K000815956!, MBM barcode MBM0353487!, MO barcode MO-247128!, RB barcode 00571112!).Frutices aut arbusculae. Folia elliptica vel anguste elliptica,

apice acuminato aut acuto, triplinervia vel subtriplinervia, in-fra dense pubescentia, pagina trichomatibus crispis, adpressis vel patulis occulta, venas usque ordinem quartum trichoma-tibus atrorubris tectas; absque domatiis (aut inconspicuis?). Inflorescentia thyrsoidea, bracteis foliaceis nonnunquam prae-sentibus, satis deciduis. Flores tepalis extus glabratis, pedicello glabro, hypanthio intus pubescente vel glabrescente. Fructus ignotus.

41. Aiouea salicifolia (Nees) R.Rohde, comb. nov. ≡ Phoebe salicifolia Nees in Linnaea 21: 488. 1848 ≡ Persea salici-folia (Nees) Hemsl., Biol. Cent.-Amer., Bot. 3: 72. 1882, nom. illeg., non Persea salicifolia (Kunth) Spreng., Syst. Veg. 2: 270. 1825 ≡ Cinnamomum salicifolium (Nees) Kosterm. in Reinwardtia 6: 23. 1961 – Lectotype (des-ignated here): Mexico. Hidalgo: Huasca, near Regla, s.d., Ehrenberg 875 (MEXU barcode MEXU 00013645!; fragm. A barcode 00026388!, F barcode v0061775F!).The holotype of this species, which presumably had been

in B, has not been found by anyone of us. Therefore, we assume that it has been destroyed in World War II, and select the only complete specimen known, MEXU 00013645, as the lectotype.

42. Aiouea sellowiana (Nees & Mart.) R.Rohde, comb. nov. ≡ Persea sellowiana Nees & Mart. in Linnaea 8: 50. 1833 ≡ Phoebe sellowii Meisn. in Candolle, Prodr. 15(1): 30. 1864, nom. illeg. ≡ Cinnamomum sellowianum (Nees & Mart.) Kosterm. in Reinwardtia 6: 23. 1961 – Lectotype (designated by Moraes in Komarovia 6: 51. 2008): Brazil. Paraná, without precise locality, Sellow 4783 (B barcode B 10 0185191!; isolectotype: K barcode K000512717!; fragm. F barcode v0061764F!; probable isolectotypes without collector’s number: B barcode B 10 0185192!, BR

barcode 000008763624!, G barcode G00020749!, G-DC barcode G00135219!, HAL barcode HAL0103840!, LE bar-code LE 00000499!, TUB barcode TUB-019046!; fragm. F barcode v0061763F!, NY barcode 00355851 [photo!]).

43. Aiouea stenophylla (Meisn.) R.Rohde, comb. nov. ≡ Persea stenophylla Meisn. in Candolle, Prodr. 15(1): 55. 1864 ≡ Phoebe stenophylla (Meisn.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 190. 1889 ≡ Cinnamomum stenophyllum (Meisn.) Vattimo-Gil in Rodriguésia 31(49): 8. 1979 – Holotype: Brazil. São Paulo: Mogi das Cruzes, “in sylvis montosis pr. Mugy,” Nov 1833, Riedel 1587 (LE barcode LE 00000510 !; isotypes: C barcode C10013538!, FI barcode FI005283 [photo!], G barcode G00368813!, K!, LE barcode LE 00000509!, NY barcode 00355861 [photo!], P barcode P00128581 [photo!], US barcode 00099149 [photo!]).

44. Aiouea subsessilis (Meisn.) R.Rohde, comb. nov. ≡ Persea subsessilis Meisn. in Candolle, Prodr. 15(1): 54. 1864 ≡ Phoebe subsessilis (Meisn.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 183. 1889 ≡ Cinnamomum subsessile (Meisn.) Kosterm. in Reinwardtia 6: 23. 1961 – Holotype: Peru. Amazonas: Prov. Bongará, San Carlos, Mathews 1434 (K!; isotypes: BM barcode BM000993940 [photo!], E barcodes E00259478 [photo!] & E00259485 [photo!]).

45. Aiouea taubertiana (Mez & Schwacke) R.Rohde, comb. nov. ≡ Phoebe taubertiana Mez & Schwacke in Bot. Jahrb. Syst. 21: 427–428. 1896 ≡ Cinnamomum taubertianum (Mez & Schwacke) Kosterm. in Reinwardtia 6: 24. 1961 – Lectotype (designated here): Brazil. Goiás: Serra dos Veadeiros, Pouso Alto, 1700 m, Sep 1892, Ule 3044 = 54 (HBG barcode HBG-506633! [both numbers on the same label; “54” appears to be the original number]; isolecto-types: P barcodes P00128482! & P00128483!, R No. 2156!).Additional syntype: Sena in herb. Schwacke 10761 (n.v.).The original type material of this species probably had

been deposited in B, but we have not been able to locate it there. We therefore assume that it has been destroyed in World War II. Among the specimens that we have found, the one in HBG is the only one bearing the number cited in the original description, and it is the largest twig. We therefore select it as lectotype here.

46. Aiouea tetragona (Meisn.) R.Rohde, comb. nov. ≡ Oreodaphne tetragona Meisn. in Vidensk. Meddel. Dansk Naturhist. Foren. Kjøbenhavn 8–11: 137. 1870 ≡ Phoebe tetragona (Meisn.) Mez in Jahrb. Königl. Bot. Gart. Berlin 5: 184. 1889 ≡ Cinnamomum quadrangulum Kosterm. in Reinwardtia 6: 24. 1961 – Holotype: Brazil. Minas Gerais: Serra da Piedade, Jan–Feb 1866, Warming 693 (C barcode C10013535!).

47. Aiouea tomentosa (Meisn.) R.Rohde, comb. nov. ≡ Phoebe tomentosa Meisn. in Candolle, Prodr. 15(1): 30. 1864 ≡ Cinnamomum tomentosum (Meisn.) Vattimo-Gil in Arch. Jard. Bot. Rio de Janeiro 17: 222. 1962, nom. illeg., non

1107Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Cinnamomum tomentosum D.Don, Prodr. Fl. Nepal.: 66. 1825 ≡ Cinnamomum tomentulosum Kosterm. in Reinwardtia 6: 24: 1961 – Holotype: Brazil. Minas Gerais: Serra do Caraça, “in monte Carassa”, Sep 1824, Riedel 522 (LE barcode LE 00000537!; isotypes: LE barcode LE 00000538!, NY barcodes 00355913! & 00355914!, US barcode 00099192!).

= Phoebe tomentosa var. minor Meisn. in Candolle, Prodr. 15(1): 30. 1864 – Holotype: Brazil. Minas Gerais, “in col-libus siccis prope Penha,” 19 Sep 1824, Riedel 522 dup-lius (LE barcode LE 00000539 !; isotype: NY barcode 00355915!).

= Persea erythropus var. ovata Meisn. in Candolle, Prodr. 15(1): 55. 1864 ≡ Persea erythropus var. triplinervia Meisn. in Martius, Fl. Bras. 5(2): 162. 1866, nom. illeg. – Lectotype (designated here): Brazil. Minas Gerais: “in camp. inter Rio das Velhas et R. Paranahyba”, Aug 1834, Riedel 2462 (LE barcode LE 00000484 !; isolecto types BR barcode 000008763297!, G!, K barcode K000602111 [photo!], LE barcode LE 00000483 !, NY barcode 00355829 [photo!]).

= Cinnamomum duarteanum Vattimo-Gil in Anais Congr. Soc. Bot. Brasil 15: 169–170. 1967 – Holotype: Brazil. Minas Gerais: Serra da Catiára, 1150 m, 29 Aug 1950, Duarte 3028 (RB barcode 00539175!; isotypes: K barcode K000815702!, MBM barcode MBM0353189!, NY barcode 01131928!).The second syntype of Persea erythropus Nees & Mart.

var. ovata Meisn., Langsdorff s.n., is found in K (barcode K000602112 [photo!]).

48. Aiouea tonduzii (Mez) R.Rohde, comb. nov. ≡ Phoebe tonduzii Mez in Bot. Jahrb. Syst. 30, Beibl. 67: 15–16. 1901 ≡ Cinnamomum tonduzii Kosterm. in Reinwardtia 6: 24. 1961 – Holotype: Costa Rica, Copey, 1800 m, Feb 1898, Tonduz 11735 (B barcode B 10 0247417; isotypes: B barcode B 10 0247467, BM barcode BM000795473!, BR barcodes 000005115792! & 000005116072!, F bar-code v0061776F!, MICH barcode 1104619!, NY bar-codes 00355901! & 00355902!, P barcodes P00064877! & P00128484!, S No. S08-7374 [photo!], US barcodes 00048602! & 00997602!; fragm. A barcode 00026382!, F barcode v0061777F [photo!]).

49. Aiouea uninervia Lorea-Hern., sp. nov. – Holotype: Brazil. Minas Gerais: Gouveia, Serra do Barro Preto, km 66 on road Curvelo–Diamantina, (fl, fr), 9 Apr 1982, Furlan & al. 3230 (SPF barcode SPF00023437; isotypes: FCME, MEXU, MO barcode MO-255229!).Frutices parvi. Folia anguste elliptica, apice obtuso vel

acutato, pinnatinervia (vel subtriplinervia?), infra glabra, ve-nis secundariis et minoribus inconspicuis; absque domatiis. Inflorescentia thyrsoidea, bracteis foliaceis destituta. Flores extus omnino glabri, hypanthio intus glabro. Tepala in fructu omnino persistentia (interdum partim persistentia?).

50. Aiouea velveti (Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum velveti Lorea-Hern. in Acta Bot. Mex. 40:

10–13, fig. 4. 1997 – Holotype: Mexico. Guerrero: Mun. Mochitlán, Cerro de La Vaca, approx. 2.5 km W of Agua de Obispo, 1000–1500 m, 6 May 1987, Rodríguez 59 (FCME; isotype: MO barcode MO-247133!).

51. Aiouea zapatae (Lorea-Hern.) R.Rohde, comb. nov. ≡ Cinnamomum zapatae Lorea-Hern. in Acta Bot. Mex. 40: 13–15, fig. 5. 1997 – Holotype: Mexico. Guerrero: Mun. Chichihualco (Leonardo Bravo), 3 km NE of Cruz de Ocote, between Filo de Caballos and Puerto El Gallo, 2250 m, 14 Jan 1988, Lorea 4172 (FCME; isotypes: FCME, GH barcode 00404969!, MO barcodes MO-264105! & MO-264107!).

Species excluded from Aiouea

“Aiouea” costaricensis (Mez) Kosterm. in Recueil Trav. Bot. Néerl. 35: 73–75. 1938 = “Ocotea” insularis (Meisn.) Mez, s.l.

“Aiouea” guatemalensis (Lundell) S.S.Renner in Fl. Neotrop. Monogr. 31: 93. 1982 = probably Damburneya sp.

“Aiouea” inconspicua Van der Werff in Ann. Missouri Bot. Gard. 74: 401, fig. 1. 1987 = probably Damburneya sp.

“Aiouea” lundelliana C.K.Allen in J. Arnold Arbor. 26: 419–420. 1945 = “Ocotea” insularis (Meisn.) Mez, s.l.

“Aiouea” obscura Van der Werff in Ann. Missouri Bot. Gard. 75: 402, fig. 1. 1988 = “Ocotea” sp.

“Aiouea” lehmannii (O.C.Schmidt) S.S.Renner in Fl. Neotrop. Monogr. 31: 93. 1982 = “Ocotea” sp.

“Aiouea” parvissima (Lundell) S.S.Renner in Fl. Neotrop. Monogr. 31: 96. 1982 = probably Damburneya sp.

“Aiouea” talamancensis W.C.Burger in Fieldiana, Bot., n.s., 23: 37, fig. 4. 1990 = “Ocotea”, a species of the O. insularis group.

“Aiouea” vexatrix Van der Werff, Ann. Missouri Bot. Gard. 75: 404–407, fig. 2A–G. 1988 = “Ocotea” insularis (Meisn.) Mez, s.l.

NOTE ADDED IN PROOF

While this paper was in review and production, two additional species have been published in Neotropical Cin-namomum, viz., C. baitelloanum Van der Werff & P.L.R. Moraes (Moraes & al., 2017) and C. bladenense S.W.Brewer & G.L.Stott (Brewer, & Stott, 2017). A paratype of the first species (Moraes 3167) has been examined in this paper; it is a member of the Aiouea clade. We therefore transfer also this species to Aiouea here:

Aiouea baitelloana (Van der Werff & P.L.R.Moraes) Van der Werff & P.L.R.Moraes, comb. nov. ≡ Cinnamomum bai-tel loanum Van der Werff & P.L.R.Moraes in Phytotaxa 316(2): 150. 2017 – Holoype: Brazil. Espírito Santo: Linhares, Reserva Natural Vale, estrada Flamengo, ao lado da parcela de Jequitibá-rosa, 20 Feb 2006, fl., D.A Folli 5188 (CVRD!; isotypes HRCB!, HUEFS!, MO!).

1108 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Alvarez López, E. 1955. Comentario sobre “Laurus”, de Ruiz y Pavón, con notas de Dombey acerca de algunas de sus especies. Anales Inst. Bot. Cavanilles 13: 71–78. https://dialnet.unirioja.es/descarga/articulo/2977945.pdf

We have not seen any material of C. bladenense yet, but from the description and illustration it appears to be a member of the Aiouea montana alliance. As there are numerous names available in this complex already, we therefore prefer not to create a new combination for this species at this point.

Brewer, S.W. & Stott, G.L. 2017. A new species of Cinnamomum (Lauraceae) from the Bladen Nature Reserve, southern Belize. Phytokeys 81: 1–10. https://doi.org/10.3897/phytokeys.81.13256

Moraes, P.L.R. de, Vergne, M.C. & Van der Werff, H. 2017. Three new species of Lauraceae from the Atlantic rainforest of Brazil. Phytotaxa 316(2): 149–160. https://doi.org/10.11646/phytotaxa.316.2.4

ACKNOWLEDGMENTS

This work is mainly based on material from two sources, the Herbarium Hamburgense (HBG) and the collections by one of us (Pedro Moraes) in Brazil, mainly preserved in HRCB. We thank the former curators of HBG, Hans-Helmut Poppendieck and Tassilo Feuerer, as well as the current curator, Matthias Schultz, for allow-ing DNA extraction from numerous specimens. Field work of Pedro Moraes in Brazil was supported by a grant of CNPq (Chamada 10/2012, Proc. No. 304985/2012-0) and PROPG-UNESP (Internacionalização dos Programas de Pós-Graduação, Edital 02/2011). The work of Jie Li in China was supported by a grant of the National Natural Science Foundation of China (No. 31370245). Jim Solomon of the Missouri Botanical Garden is gratefully acknowledged for providing material from the MO DNA bank, collected by D. Neill, H. van der Werff, and G. Walters (vouchers in MO). We also thank David Clarke, now University of North Carolina at Asheville, for providing silica material of some collections made during his time as resident plant collector in Guyana for the Smithsonian Institution (vouchers in US). The former curator of the herbarium AAU, Henrik Balslev, is gratefully acknowl-edged for allowing the senior author to remove fragments from some specimens in the 1990s. We also thank the curator of the herbarium JE, Hans-Joachim Zündorf, for allowing the senior author to remove fragments from a few recent collections from Cuba for DNA extrac-tion. One DNA extract was provided by the Kew DNA bank (http://apps.kew.org/dnabank/homepage.html, voucher at K). João Baitello (SPSF) kindly provided images of several collections by Bento Pickel, and his comments helped to resolve the typification of Phoebe pickelii. We also wish to acknowledge that detailed comments by the reviewers on an earlier version of this manuscript, especially by Henk van der Werff, greatly helped to improve this paper. The lab work would not have been possible without the skillful assistance of our technicians, Andrea Jounais and Anna Maria Vogt, who also supervised several student assistants (Imke Bodendieck, Kolja Dudas, Torsten Hoche, Katharina Kleinpeter, Dimitrij Trofimov, Anja zur Loye) contributing to this study over the past few years.

LITERATURE CITED

Aublet, F. 1775. Histoire des plantes de la Guiane Francoise, vol. 1. Londres & Paris [London & Paris]: chez Pierre-François Didot. https://doi.org/10.5962/bhl.title.674

Beyra-Matos, A. & Lavin, M. 1999. A monograph of Pictetia (Legu-minosae-Papilionoideae) and review of the Aeschynomeneae. Syst. Bot. Monogr. 56: 1–93. https://doi.org/110.2307/25096650

Blattner, F.R. 1999. Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. Biotechniques 27: 1180–1186.

Buckler, E.S., 4th & Holtsford, T.P. 1996. Zea systematics: Ribosomal ITS evidence. Molec. Biol. Evol. 13: 612–622.https://doi.org/10.1093/oxfordjournals.molbev.a025621

Buckler, E.S., Ippolito, A. & Holtsford, T.P. 1997. The evolution of ribosomal DNA: Divergent paralogues and phylogenetic implica-tions. Genetics 145: 821–832.

Burger, W.C. & Van der Werff, H. 1990. Flora Costaricensis, family #80 Lauraceae. Fieldiana, Bot., n.s., 23: 1–129.

Chanderbali, A.S. 2004. Flora Neotropica Monographs, vol. 91, Endlicheria (Lauraceae). New York: New York Botanical Garden.

Chanderbali, A.S., Van der Werff, H. & Renner, S.S. 2001. Phylogeny and historical biography of Lauraceae: Evidence from the chloro-plast and nuclear genomes. Ann. Missouri Bot. Gard. 88: 104–134.https://doi.org/10.2307/2666133

Chung, K.F., Van der Werff, H. & Peng, C.L. 2010. Observations on the morphology of Sassafras randaiense (Lauraceae). Mem. New York Bot. Gard. 14: 1–117. https://doi.org/10.3417/2008029

Coe-Teixeira, B. 1971. Lauráceas do estado de São Paulo – IV: Phoebe. Hoehnea 1: 179–193.

Dong, W., Liu, J., Yu, J., Wang, L. & Zhou S. 2012. Highly vari-able chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA Barcoding. PLoS ONE 7: e35071.https://doi.org/10.1371/journal.pone.0035071

Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: 783–791.http://statweb.stanford.edu/~nzhang/Stat366/Felsenstein85.pdf

Gamble, J.S. 1910. New Lauraceae from the Malayan region. II. Bull. Misc. Inform. Kew 1910: 218–228. https://doi.org/10.2307/4111848

Grisebach, A. 1860. Plantae Wrightianae e Cuba Orientali, pars 1, (Polypetalae et Apetalae). Cantabrigae Nov. Angl. [Cambridge, Boston]. [Preprinted from Mem. Amer. Acad. Arts, n.s., 8: 153–192. 1861] https://doi.org/10.5962/bhl.title.708

Groth, K. 2003. Molecular systematic studies on the genus Cin na-momum Schaeffer (Lauraceae). Diploma thesis, University of Hamburg, Hamburg, Germany.

Hamilton M. 1999. Four primer pairs for the amplification of chloro-plast intergenic regions with intraspecific variation. Molec. Ecol. 8: 521–523.

Huang, J.F., Li, L., Van der Werff, H., Li, H.W., Rohwer, J.G. & Crayn, D.M. 2016. Origins and evolution of cinnamon and cam-phor: A phylogenetic and historical biogeographical analysis of the Cinnamomum group (Lauraceae). Molec. Phylogen. Evol. 96: 33–44. https://doi.org/10.1016/j.ympev.2015.12.007

Jobb, G. 2011. TREEFINDER, version of March 2011. Distributed by the author at http://www.treefinder.de

Käss, E. & Wink, M. 1997. Molecular phylogeny and phylogeography of the genus Lupinus (family Leguminosae) inferred from nucleo-tide sequences of the rbcL gene and ITS 1+2 sequences of rDNA. Pl. Syst. Evol. 208: 139–167. https://doi.org/10.1016/j.ympev.2013.05.030

Klak, C., Bruyns, P.V. & Hanáček, P. 2013. A phylogenetic hypoth-esis for the recently diversified Ruschieae (Aizoaceae) in southern Africa. Molec. Phylogen. Evol. 69: 1005–1020. https://doi.org/10.1016/j.ympev.2013.05.030

Kopp, L.E. 1966. A taxonomic revision of the genus Persea in the Western Hemisphere (Perseae-Lauraceae). Mem. New York Bot. Gard. 14: 1–120.

1109Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Kostermans, A.J.G.H. 1961. The New World species of Cinnamomum Trew (Lauraceae). Reinwardtia 6: 17–24.https://doi.org/10.14203/reinwardtia.v6i1.211

Kostermans, A.J.G.H. 1985 (“1983”). The South Indian species of Cinnamomum Schaeffer (Lauraceae). Bull. Bot. Surv. India 25: 90–133.

Kostermans, A.J.G.H. 1986. A monograph of the genus Cinnamomum Schaeff. (Lauraceae). Part I. Ginkgoana 6: 1–184.

Kubitzki, K. & Renner, S. 1982. Flora Neotropica Monographs, vol 31, Lauraceae I (Aniba and Aiouea). New York: New York Botanical Garden.

Kuo, D., Lin, C., Ho, K., Cheng, Y., Hwang, S. & Lin, T. 2010. Two genetic divergence centers revealed by chloroplastic DNA variation in populations of Cinnamomum kanehirae Hay. Conserv. Genet. 11: 803–812. https://doi.org/10.1007/s10592-009-9901-5

Kurz, H.W. 2000. Revision der Gattung Licaria (Lauraceae). Mitt. Inst. Allg. Bot. Hamburg 28: 89–221.

Lee, S., Lee, C., Lin, M. & Ho, K. 2010. Genetic identification of Cinnamomum species based on partial internal transcribed spacer 2 of ribosomal DNA. J. Food Drug Analysis 18: 225–231.http://ir.lib.pccu.edu.tw/handle/987654321/20944

Li, L., Li, J., Rohwer, J.G., Van der Werff, H., Wang, Z.-H. & Li, H.-W. 2011. Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical Amphi-Pacific disjunctions. Amer. J. Bot. 98: 1520–1536. https://doi.org/10.3732/ajb.1100006

Li, X.W., Li, J. & Van der Werff, H. 2008. 10. Cinnamomum Schaeffer. In: Li, S., Li, X.W., Li, J., Huang, P., Wei, F.N., Cui, H. & Van der Werff, H., eFloras.org, Flora of China, vol. 7, Lauraceae. http://www.efloras.org/florataxon.aspx?flora_id=2&taxon_id=107109

Lorea-Hernández, F.G. 1996. A systematic revision of the Neotropical species of Cinnamomum Schaeffer (Lauraceae). Dissertation, University of Missouri, St. Louis, Missouri, U.S.A.https://doi.org/10.5962/bhl.title.10824

Lorea-Hernández, F.G. 1997. On Cinnamomum (Lauraceae) in Mexico. Acta Bot. Mex. 20: 1–18. 1997. https://doi.org/10.21829/abm40.1997.778

McNeill, J., Barrie, F.R., Buck, W.R., Demoulin, V., Greuter, W., Hawksworth, D.L., Herendeen, P.S., Knapp, S., Marhold, K., Prado, J. Prud’homme van Reine, W.F., Smith, G.F., Wiersema, J.H. & Turland, N.J. 2012. International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). Regnum Vegetabile 154. Königstein: Koeltz Scientific Books.

Meissner, C.D.F. 1864. Ordo CLXII. Lauraceae. Pp. 1–260, 503–516 in: Candolle, A.L.P.P. de (ed.), Prodromus systematis naturalis regni vegetabilis, vol. 15. Parisiis [Paris]: Victoris Masson et Filii.https://doi.org/10.5962/bhl.title.286

Mez, C.C. 1889. Lauraceae americanae: Monographice describsit. Jahrb. Königl. Bot. Gart. Berlin 5: 1–556.https://doi.org/10.5962/bhl.title.15443 [1963 reprint]

Moraes, P.L.R. de 2008. The lauraceous collections of Friedrich Sellow. Komarovia 6: 1–67.

Moraes, P.L.R. de & Falcade, A. 2015. The lauraceous collections of Carl Friedrich Philipp von Martius in the Flora Brasiliensis. Harvard Pap. Bot. 20: 167–197.

Nees von Esenbeck, C.D.G. 1836. Systema Laurinarum. Berolini [Berlin]: sumtibus Veitii et Sociorum.https://doi.org/10.5962/bhl.title.422

Nie, Z.-L., Wen, J. & Sun, H. 2007. Phylogeny and biogeography of Sassafras (Lauraceae) disjunct between eastern Asia and eastern North America. Pl. Syst. Evol. 267: 191–203.https://doi.org/10.1007/s00606-007-0550-1

Reinecke, F. 1898. Die Flora der Samoa-Inseln. II. Teil: Siphonogamen. Bot. Jahrb. Syst. 25: 578–708.

Rohwer, J.G. 1986. Prodromus einer Monographie der Gattung Ocotea Aubl. (Lauraceae), sensu lato. Mitt. Inst. Allg. Bot. Hamburg 20: 3–278.

Rohwer, J.G. 1988. The genera Dicypellium, Phyllostemonodaphne, Systemonodaphne, and Urbanodendron (Lauraceae). Bot. Jahrb. Syst. 110: 157–171.

Rohwer, J.G. 1993a. Lauraceae. Pp. 366–391 in: Kubitzki, K., Rohwer, J.G. & Bittrich, V. (eds.), The families and genera of vascular plants, vol. 2. Berlin, etc.: Springer.

Rohwer, J.G. 1993b. Flora Neotropica Monographs, vol. 60, Lauraceae: Nectandra. New York: New York Botanical Garden.https://doi.org/10.1007/978-3-662-02899-5_46

Rohwer, J.G. 2000. Toward a phylogenetic classification of the Laur-aceae: Evidence from matK sequences. Syst. Bot. 25: 60–71.https://doi.org/10.2307/2666673

Rohwer, J.G. 2014. Lauraceae (Ocotea con Sabrina A. Schmidt). In: Greuter, W. & Rankin Rodríguez, R. (eds.), Flora de la República de Cuba, vol. 19(2). Königstein: Koeltz Scientific Books.

Rohwer, J.G. & Rudolph, B. 2005. Jumping genera: The phyloge-netic positions of Cassytha, Hypodaphnis, and Neocinnamomum (Lauraceae) based on different analyses of trnK intron sequences. Ann. Missouri Bot. Gard. 92: 153–178. http://www.jstor.org/stable/3298512

Rohwer, J.G., Richter, H.G. & Van der Werff, H. 1991. Two new gen-era of Neotropical Lauraceae, and critical remarks on the generic delimitation. Ann. Missouri Bot. Gard. 78: 388–400.https://doi.org/10.2307/2399568

Rohwer, J.G., Li, J., Rudolph, B., Schmidt, S.A., Van der Werff, H. & Li, H.W. 2009. Is Persea (Lauraceae) monophyletic? Evidence from nuclear ribosomal ITS sequences. Taxon 58: 1153–1167.http://www.jstor.org/stable/27757009

Rohwer, J.G., Moraes, P.L.R. de, Rudolph, B. & Van der Werff, H. 2014. A phylogenetic analysis of the Cryptocarya group (Lauraceae), and relationships of Dahlgrenodendron, Sinopora, Triadodaphne, and Yasunia. Phytotaxa 158: 111–132. https://doi.org/10.11646/phytotaxa.158.2.1

Ronquist, F., Huelsenbeck, J.P. & Teslenko, M. 2011. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bio-informatics 19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180

Röpert, D. (ed.) 2000– (continuously updated). Digital specimen images at the Herbarium Berolinense. http://ww2.bgbm.org/herbarium (accessed 1 Nov 2016).

Sang, T., Crawford, D.J. & Stuessy, T.F. 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Amer. J. Bot. 84: 1120–1136. http://www.amjbot.org/content/84/8/1120.full.pdf+html

Simmons, M.P. & Ochoterena, H. 2000. Gaps as characters in sequence-based phylogenetic analyses. Syst. Biol. 49: 369–381.https://doi.org/10.1093/sysbio/49.2.369

Soh, W. 2011. Taxonomic revision of Cinnamomum (Lauraceae) in Borneo. Blumea 56: 241–264.https://doi.org/10.3767/000651911X615168

Stafleu, F.A. & Cowan, R.S. 1981. Taxonomic literature, ed. 2, vol. 3. Utrecht: Bohn, Scheltema & Holkema.https://doi.org/10.5962/bhl.title.48631http://www.sil.si.edu/DigitalCollections/tl-2/index.cfm

Sudmoon, R., Chaveerach, A., Sanubol, A., Monkheang, P., Kwanda, N., Aungkapattamagul, S., Tanee, T., Noikotr, K., Chuachan, C. & Kaewdoungdee, N. 2014. Identifying efficiency in herbal medicine Cinnamomum species (Lauraceae) using banding pat-terns and sequence alignments of rpoB, rbcL and matK regions. J. Med. Case Rep. 41: 1094–1108.

Swetha, V.P., Parvathy, V.A., Sheeja, T.E. & Sasikumar, B. 2014. Isolation and amplification of genomic DNA from barks of Cinnamomum spp. Turkish J. Biol. 38: 151–155.https://doi.org/10.3906/biy-1308-5

Swofford, D.L. 2003. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sunderland, Massachusetts: Sinauer.

1110 Version of Record

TAXON 66 (5) • October 2017: 1085–1111Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

Appendix 1. Material examined. Taxon, origin, voucher information and GenBank/NCBI accession numbers.The Neotropical Cinnamomum species transferred to Aiouea here are listed under their new name in Aiouea, followed by their previous name in Cinnamomum. Names in parentheses refer to Lorea-Hernández (1996) and have not been validly published before, but are validated in Aiouea here. The name Aiouea in quotes denotes species that will be transferred to a different genus in a later publication. Accession numbers beginning with AF are from Chanderbali & al. (2001); with FM are from Rohwer & al. (2009); with KX are from Trofimov & al. (2016); numbers beginning with MF are new sequences. The first number is the nuclear ITS sequence, the second is the chloroplast trnG-trnS spacer sequence, and the third is the chloroplast psbA-trnH spacer sequence.Aiouea acarodomatifera Kosterm., Brazil, São Paulo, 22 Jan 2013, Moraes s.n. (HRCB), MF110006, MF137829, MF137926; Aiouea alainii (C.K.Allen) R.Rohde ≡ Cinnamomum alainii (C.K.Allen) Alain, Dominican Republic, Santo Domingo, 11 Nov 1929, Ekman H.11506 (HBG), MF110007, MF137830, MF137927; Aiouea amoena (Nees & Mart.) R.Rohde ≡ Cinnamomum amoenum (Nees & Mart.) Kosterm., Brazil, Paraná, 30 Jan 1996, Ribas 1072 (HBG), MF110008, MF137831, MF137928; Aiouea chavarriana (Hammel) R.Rohde ≡ Cinnamomum chavarrianum (Hammel) Kosterm., Costa Rica, Province and date not indicated, Gomez-Laurito s.n. (HBG), MF110009, MF137832, MF137929; Aiouea cinnamomoidea (Lorea-Hern.) R.Rohde & Lorea-Hern. ≡ Mocinnodaphne cinnamomoidea Lorea-Hern., Mexico, Guerrero, 17 May 1993, Lorea-Hernández 5536 (MO), AF272288, – , –; “Aiouea” costaricensis (Mez) Kosterm., Costa Rica, Heredía, 3 Apr 1987, Grayum 8241 (HBG), MF110010, MF137833, MF137930; “Aiouea” costaricensis (Mez) Kosterm., Costa Rica, Alajuela, 20 Sep 1966, Jiménez 4116 (HBG), MF110011, MF137834, MF137931; Aiouea dubia (Kunth) Mez, Ecuador, Loja, 10 Apr 1994, Jorgensen 19 (AAU), MF110012, MF137835, MF137932; Aiouea formicaria (Van der Werff & Lorea-Hern.) R.Rohde ≡ Cinnamomum formicarium Van der Werff & Lorea-Hern., Ecuador, Bolívar, 19 Jul 1991, Van der Werff 12498 (HBG), KX509823, MF137836, KX509883; Aiouea glaziovii (Mez) R.Rohde ≡ Cinnamomum glaziovii (Mez) Kosterm., Brazil, Espírito Santo, 10 Sep 2011, Moraes 3229 (HRCB), MF110013, MF137837, MF137933; Aiouea grandifolia Van der Werff, Ecuador, Loja, 12 Mar 2007, Valenzuela 9297 (HBG), MF110014, MF137838, MF137934; “Aiouea” guatemalensis (Lundell) S.S.Renner, Guatemala, Izabal, 10 Sep 1970, Contreras 10251 (HBG), MF110015, MF137839, MF137935; Aiouea guianensis Aubl., Guyana, West Demerara, 20 May 1997, Taylor 12080 (MO), AF272251, –, AF268780 [collection no. 12085 in Chanderbali & al. (2001) is a typo; that collection is Ocotea schomburgkiana (Nees) Mez]; Aiouea hammeliana (W.C.Burger) R.Rohde ≡ Cinnamomum hammelianum (W.C.Burger) Lorea-Hern. ex J.Á.González & Hammel, Costa Rica, Alajuela, 2 Jul 1985, Hammel 14091 (HBG), MF110016, MF137840, MF137936; Aiouea cf. haussknechtii (Mez) R.Rohde ≡ Cinnamomum cf. haussknechtii (Mez) Kosterm., Brazil, Minas Gerais, 8 Mar 1983, Kubitzki 83-35 (HBG), MF110017, MF137841, MF137937; Aiouea haussknechtii (Mez) R.Rohde ≡ Cinnamomum haussknechtii (Mez) Kosterm., Brazil, Bahia, 8 Dec 2010, Moraes 02P (HRCB), MF110018, MF137842, MF137938; Aiouea haussknechtii (Mez) R.Rohde ≡ Cinnamomum haussknechtii (Mez) Kosterm., Brazil, Bahia, 8 Dec 2010, Moraes 3140 (HRCB), MF110019, MF137843, MF137939; Aiouea hirsuta Lorea-Hern. (≡ “Cinnamomum hirsutum Lorea-Hern.”), Brazil, São Paulo, 25 Aug 2011, Baitello 2555 (SPSF), KX509824, MF137844, KX509884; Aiouea maya Lorea-Hern. ≡ Cinnamomum trinerve (Lundell) Kosterm., Guatemala, Alta Verapaz, 27 Jul 1975, Lundell 19564 (HBG), MF110020, MF137845, MF137940; Aiouea montana (Sw.) R.Rohde ≡ Cinnamomum montanum (Sw.) J.Presl, Brazil, Espírito Santo, 13 Dec 2012, Moraes 3538 (HRCB), MF110021, MF137846, MF137941; Aiouea myristicoides Mez, Brazil, Pará, 17 Oct 1968, Silva 1241 (HBG), MF110022, MF137847, MF137942; Aiouea palaciosii (Van der Werff) R.Rohde ≡ Cinnamomum palaciosii Van der Werff, Ecuador, Imbabura, 3 Jul 1991, Van der Werff 12177 (HBG), MF110023, MF137848, MF137943; Aiouea pseudoglaziovii Lorea-Hern. (≡ “Cinnamomum pseudoglaziovii Lorea-Hern.”), Brazil, São Paulo, 22 Dec 1995, Moraes 1238 (HRCB), MF110024, MF137849, MF137944; Aiouea pseudoglaziovii Lorea-Hern. (≡ “Cinnamomum pseudoglaziovii Lorea-Hern.”), Brazil, São Paulo, 2 Sep 2011, Moraes 3344 (HRCB), KX509826, MF137850, KX509886; Aiouea saligna Meisn., Brazil, Espírito Santo, 5 Sep 2011, Moraes 3165 (HRCB), KX509821, MF137851, KX509881; Aiouea sellowiana (Nees & Mart.) R.Rohde ≡ Cinnamomum sellowianum (Nees & Mart.) Kosterm., Brazil, Paraná, 13 Feb 1997, Ribas 1811 (HBG), MF110025, MF137852, MF137945; Aiouea sp. ≡ Cinnamomum sp., Brazil, Minas Gerais, 15 Oct 2012, Moraes s.n. (HRCB), MF110026, MF137853, MF137946; Aiouea sp. ≡ Cinnamomum sp., Brazil, Espírito Santo, 6 Sep 2011, Moraes 3167 (HRCB), MF110027, MF137854, MF137947; Aiouea sp., Brazil, Espírito Santo, 7 Sep 2011, Moraes 3196 (HRCB), MF110028, MF137855, MF137948; Aiouea sp., Brazil, Espírito Santo, 10 Sep 2011, Moraes 3231 (HRCB), MF110029, MF137856, MF137949; Aiouea sp., Brazil, Espírito Santo, 10 Sep 2011, Moraes 3236 (HRCB), MF110030, MF137857, MF137950; Aiouea cf. tomentosa (Meisn.) R.Rohde ≡ Cinnamomum cf. tomentulosum Kosterm., Brazil, Bahia, 23 Aug 2009, Moraes 2896 (HUEFS), MF110031, MF137858, MF137951; Aiouea trinervis Meisn., Brazil, Bahia, 20 Oct 2010, Moraes 3079 (HRCB), MF110032, MF137859, MF137952; “Aiouea” vexatrix Van der Werff, Panama, Panamá, 10 Sep 1970, Croat 12153 (HBG), MF110033, MF137860, MF137953; Aniba firmula (Nees & Mart.) Mez, Brazil, São Paulo, 1 Sep 2011, Moraes 3356 (HRCB), MF110034, MF137861, MF137954; Cinnamomum bodinieri H.Lév., China, Yunnan, BG Kunming, 2 Sep 2010, Li & Rohwer 2010-04 (HBG), MF110035, MF137862, MF137955; Cinnamomum burmannii (Nees & T.Nees) Blume, Germany, Palmengarten Frankfurt, 5 Oct 2010, Jakobi s.n. (HBG), MF110036, MF137863, MF137956; Cinnamomum burmannii (Nees & T.Nees) Blume, Germany, Berlin Bot. Gard., Jan 2002, Leuenberger s.n. (HBG), MF110037, MF137864, MF137957; Cinnamomum burmannii (Nees & T.Nees) Blume, China, Yunnan, 3 Sep 2010, Li & Rohwer 2010-10 (HBG), MF110038, MF137865, MF137958; Cinnamomum cf. camphora (L.) J.Presl, Germany, Munich Bot. Gard., Nov 2010, Gerlach 06/1425 (HBG), MF110039, MF137866, MF137959; Cinnamomum camphora (L.) J.Presl, Germany, Berlin Bot. Gard., Jan 2002, Leuenberger s.n. (HBG), MF110040, MF137867, MF137960; Cinnamomum camphora (L.) J.Presl, Germany, Hamburg Bot. Gard., 18 Mar 2009, Rohwer s.n., (HBG), KX509822, MF137868, KX509882; Cinnamomum chekiangense Nakai, Germany, Bayreuth Bot. Gard., Oct 2010, Lauerer WB462 (HBG), MF110041, MF137869, MF137961; Cinnamomum daphnoides Siebold & Zucc., Germany, Halle Bot. Gard., 29 Jan 2015, Hoffmann s.n. (HBG), MF110042, MF137870, MF137962; Cinnamomum daphnoides Siebold & Zucc., Germany, Berlin Bot. Gard., Jan 2002, Leuenberger s.n. (HBG), MF110043, MF137871, MF137963; Cinnamomum dictyoneuron Kosterm., Malaysia, Sabah, date not indicated, Lugas 885 (K), MF110044, MF137872, MF137964; Cinnamomum glanduliferum (Wall.) Meisn., Germany, Rostock Bot. Gard., 25 Jan 2002, Nauenburg s.n. (HBG), MF110045, MF137873, MF137965; Cinnamomum glanduliferum (Wall.) Meisn., Germany, Hamburg Bot. Gard., 21 Oct 2014, Rohwer s.n. (HBG), MF110046, MF137874, MF137966; Cinnamomum iners Reinw. ex Blume, Germany, Bayreuth Bot. Gard., Oct 2010, Lauerer 31089 (HBG), MF110047, MF137875,

Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molec. Biol. Evol. 30: 2725–2729.https://doi.org/10.1093/molbev/mst197

Tate, J.A. & Simpson, B.B. 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 28: 723–737. http://www.bioone.org/doi/full/10.1043/02-64.1

Trofimov, D., Rudolph, B. & Rohwer, J.G. 2016. Phylogenetic study of the genus Nectandra (Lauraceae), and reinstatement of Damburneya. Taxon 65: 980–996. https://doi.org/10.12705/655.3.

Van der Werff, H. 1987. Six new species of Neotropical Lauraceae. Ann. Missouri Bot. Gard. 74: 401–412.https://doi.org/10.2307/2399408

Van der Werff, H. 1988. Eight new species and one new combination

of Neotropical Lauraceae. Ann. Missouri Bot. Gard. 75: 402–419.https://doi.org/10.2307/2399431

Van der Werff, H. & Richter, H.G. 1985. Caryodaphnopsis Airy Shaw (Lauraceae), a genus new to the Neotropics. Syst. Bot. 10: 166–173.https://doi.org/10.2307/2418342

Van der Werff, H. & Richter, H.G. 1996. Toward an improved clas-sification of Lauraceae. Ann. Missouri Bot. Gard. 83: 409–418.https://doi.org/10.2307/2399870

White, T.J., Bruns, T., Lee, S. & Taylor, J.W. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phy-logenetics. Pp. 315–322 in: Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T.J. (eds.), PCR protocols: A guide to methods and applications. New York: Academic Press.https://doi.org/10.1016/B978-0-12-372180-8.50042-1

1111Version of Record

TAXON 66 (5) • October 2017: 1085–1111 Rohde & al. • Transfer of Neotropical “Cinnamomum” to Aiouea (Lauraceae)

MF137967; Cinnamomum cf. iners Reinw. ex Blume, Germany, Hamburg Bot. Gard. no. 2009-G-30, 20 Jan 2010, Rohwer s.n. (HBG), MF110048, MF137876, MF137968; Cinnamomum insularimontanum Hayata, Korea, Cheju, Hanra Bot Gard., 14 Oct 1998, Kim Chang Suk s.n. (HBG), MF110049, MF137877, MF137969; Cinnamomum insularimontanum Hayata, Germany, Hamburg Bot. Gard., 10 Jan 2013, Rohwer s.n. (HBG), MF110050, MF137878, MF137970; Cinnamomum loureiroi Nees, Germany, Berlin Bot. Gard., Jan 2002, Leuenberger s.n. (HBG), MF110051, MF137879, MF137971; Cinnamomum osmophloeum Kaneh., Germany, Berlin Bot. Gard., Nov 2010, Dürbye s.n. (HBG), MF110052, MF137880, MF137972; Cinnamomum paiei Kosterm., Malaysia, Sarawak, 26 Feb 1993, Christensen 1237 (AAU), MF110053, MF137881, MF137973; Cinnamomum parthenoxylon (Jack) Meisn., Malaysia, Sabah, 29 Jul 1998, Rohwer 178 (MJG), MF110054, MF137882, MF137974; Cinnamomum pittosporoides Hand.-Mazz., China, Yunnan, 6 Sep 2010, Li & Rohwer 2010-11 (HBG), MF110055, MF137883, MF137975; Cinnamomum cf. polderi Kosterm., Indonesia, Sulawesi, 26 Feb–7 Mar 2012, Brambach 1574 (HBG), MF110056, MF137884, MF137976; Cinnamomum sp., Indonesia, Java, Cibodas Bot. Gard., Mar 2000, Arifiani DA47 (HBG), MF110057, MF137885, MF137977; Cinnamomum tamala (Buch.-Ham.) T.Nees & Nees, Thailand, Chiang Mai, 12 Mar 1968, Hansen 12882 (AAU), MF110058, MF137886, MF137978; Cinnamomum verum J.Presl, Germany, Bochum Bot. Gard., Feb 2002, Kirchner s.n. (HBG), MF110059, MF137887, MF137979; Cinnamomum verum J.Presl, Germany, Bayreuth Bot. Gard., Oct 2010, Lauerer 41050 (HBG), MF110060, MF137888, MF137980; Cinnamomum verum J.Presl, Germany, Regensburg Bot. Gard., 8 Jul 1997, Rohwer 162 (MJG), MF110061, MF137889, MF137981; Cinnamomum wilsonii Gamble, China, Yunnan, Kunming Bot. Gard., 2 Sep 2010, Li & Rohwer 2010-06 (HBG), MF110062, MF137890, MF137982; Damburneya coriacea (Sw.) Trofimov & Rohwer, Cuba, Pinar del Río, 23 Feb 2001, Hellwig s.n. (JE), MF110063, MF137891, MF137983; Endlicheria glomerata Mez, Brazil, Espírito Santo, 7 Sep 2011, Moraes 3187 (HRCB), MF110064, MF137892, MF137984; Endlicheria glomerata Mez, Brazil, Minas Gerais, 13 Oct 2012, Moraes 3497 (HRCB), MF110065, MF137893, MF137985; Endlicheria pyriformis (Nees) Mez, Guyana, Upper Takutu-Upper Essequibo, 31 Aug 1999, H.D.Clarke 8070 (US), MF110066, MF137894, MF137986; Endlicheria aff. szyszylowiczii Mez, Guyana, Upper Takutu-Upper Essequibo, 10 Sep 1999, H.D.Clarke 8397 (US), MF110067, MF137895, MF137987; Laurus nobilis L., U.S.A., Missouri Bot. Gard., 2 Oct 2000, Chanderbali 327 (MO), –, –, AF268785; Laurus nobilis L., Germany, Hamburg Bot. Gard., date not indicated, Rohwer s.n. (HBG), FM957808, MF137896, –; Licaria bahiana H.W.Kurz, Brazil, Espírito Santo, 6 Sep 2011, Moraes 3166 (HRCB), MF110068, MF137897, MF137988; Licaria crassifolia (Poir.) P.L.R.Moraes, Guyana, Upper Takutu-Upper Essequibo, 5 Sep 1999, H.D. Clarke 8248 (US), MF110069, MF137898, MF137989; Lindera benzoin (L.) Blume, Germany, Hamburg Bot. Gard., 13 Sep 2006, Rohwer s.n. (HBG), FM957809, MF137899, MF137990; Machilus grijsii Hance, Germany, Hamburg Bot. Gard., 23 Jan 2014, Rohwer s.n. (HBG), FM957810, MF137900, MF137991; Machilus zuihoensis Hayata, Germany, Hamburg Bot. Gard., 1 Aug 2006, Rohwer s.n. (HBG), FM957815, MF137901, MF137992; Nectandra psammophila Nees & Mart., Brazil, Espírito Santo, 15 Dec 2012, Moraes 3540 (HRCB), MF110070, MF137902, KX509924; Neolitsea sericea (Blume) Koidz., Germany, Hamburg Bot. Gard., 22 Oct 2015, Rohwer s.n. (HBG), FM957815, MF137903, MF137993; Ocotea aciphylla (Nees & Mart.) Mez, Brazil, Espírito Santo, 9 Sep 2011, Moraes 3210 (HRCB), KX509866, MF137904, MF137994; Ocotea atirrensis Mez & Donn.Sm., Costa Rica, Limón, 28 Aug 1991, Jiménez 1014 (HBG), MF110071, MF137905, MF137995; Ocotea ciliata L.C.S.Assis & Mello-Silva, Brazil, Espírito Santo, 6 Sep 2011, Moraes 3171 (HRCB), MF110072, MF137906, MF137996; Ocotea elegans Mez, Brazil, São Paulo, 22 Jan 2013, Moraes s.n. (HRCB), MF110073, MF137907, MF137997; Ocotea floccifera Mez & Sodiro, Ecuador, Esmeraldas, 20 Aug 1989, Palacios 4370 (HBG), MF110074, MF137908, MF137998; Ocotea foetens (Aiton) Baill., Spain, Tenerife, 10 Mar 2005, Rohwer 5 (HBG), KX509869, MF137909, MF137999; Ocotea cf. gabonensis Fouilloy, Gabon, Nyanga, 13 May 2001, Walters 654 (MO), MF110075, MF137910, MF138000; Ocotea guianensis Aubl., Guyana, Demerara, 3 Jun 1997, Chanderbali 232 (MO), AF272302, –, AF268761 [acc. no. AF268762 in Chanderbali & al. (2001) is a typo]; Ocotea indecora (Schott) Mez, Brazil, Espírito Santo, 18 Dec 2012, Moraes 3548 (HRCB), MF110076, MF137911, MF138001; Ocotea insularis (Meisn.) Mez, Costa Rica, Puntarenas, 27 Jun 1997, Rojas 3682 (MO), AF272306, –, –; Ocotea malcomberi Van der Werff, Madagascar, Toliara, 17–20 Oct 1992, Van der Werff 12576 (MO), AF272307, MF137912, AF268779; Ocotea odorifera Rohwer, Brazil, São Paulo, 22 Jan 2013, Moraes s.n. (HRCB), KX509871, MF137913, KX509933; Ocotea pedalifolia Mez, Panama, Canal Zone, 5 Jan 1972, Dwyer 9514 (HBG), MF110077, MF137914, MF138002; Ocotea porosa (Nees & Mart.) Barroso, Brazil, São Paulo, 29 Sep 2011, Moraes 3375 (HRCB), MF110078, MF137915, MF138003; Ocotea porphyria (Griseb.) Van der Werff, Bolivia, Tarija, 4 Oct 2005, Gallegos 31 (HBG), MF110079, MF137916, MF138004; Ocotea pulchella (Nees & Mart.) Mez, Brazil, São Paulo, 28 Aug 2011, Moraes 3154 (HRCB), KX509873, MF137917, KX509935; Ocotea quixos (Lam.) Kosterm., Ecuador, Napo, 23 Nov 1990, Neill 9487 (MO), MF110080, MF137918, KX509937; Ocotea salvadorensis (Lundell) Van der Werff, El Salvador, Santa Ana, 25 Sep 1988, Reyna 1414 (HBG), KX509875, MF137919, KX509938; Ocotea sp., Bolivia, La Paz, 17 Sep 1997, Müller & Heinrichs 6213 (HBG), MF110081, MF137920, MF138005; Ocotea tenera Mez & Donn.Sm., Costa Rica, Puntarenas, 15 Dec 1985, Haber 3677 (HBG), MF110082, MF137921, MF138006; Persea americana Mill., Germany, Hamburg Bot. Gard., 16 Oct 2003, Rohwer s.n. (HBG), KX509877, MF137922, MF138007; Phoebe sheareri (Hemsl.) Gamble, Germany, Hamburg Bot. Gard., 7 Jan 2014, Rohwer s.n. (HBG), KX509940, MF137923, KX509878; Sassafras albidum (Nutt.) Nees, Germany, Hamburg Bot. Gard., 24 Sep 2002, Rohwer s.n. (HBG), FM957850, MF137924, MF138008; Sassafras tzumu (Hemsl.) Hemsl., China, Hunan, date not indicated, Luo 1242 (MO), AF272336, –, –; Sassafras tzumu (Hemsl.) Hemsl., Germany, Bonn Bot. Gard. no. 3991, 2 Jul 1997, Rohwer 160 (MJG), –, MF137925, MF138009.

Appendix 1. Continued.

View publication statsView publication stats