National PH TB DST Reference Center pdated May 1 22...National PHL TB DST Reference Center Updated May 1, 2020 Page 2 of 18. Drug Loci. Results. RIF . rpoB (170) 170 (GTC > TTC, Val

Page Number PSQ for Rifampin 2-6 Comparison table for rpoB Codon Numbering 2 mutation list (rpoB) 3-5

interpretations 6

PSQ for Isoniazid 7-12 mutation list (katG, inhA, ahpC and fabG1 ) 7-8 interpretations 9-12

PSQ for Injectable Drugs (Amikacin, Capreomycin and Kanamycin) 13 mutation list (rrs) and interpretations 13

PSQ for Quinolones 14-16 mutation list (gyrA ) 14 interpretations 15-16

PSQ for Detection of MTBC 17

PSQ Additional Comments 18

Revision Date7/24/2018

3/15/20195/1/2020 Addition of PSQ results and interpretation for gyrA and rrs

National PHL TB DST Reference CenterPSQ Reporting Language

Table of ContentsDocument

Status and Description

Modified Comparison Table for rpoB to add figure, modified PSQ results for rpoB and INH

Document Revision History

Document Created

National PHL TB DST Reference Center Updated May 1, 2020

Page 1 of 18

Old (E. coli numbering) New (MTB numbering) 176 (GTC > TTC, Val > Phe) 170 (GTC > TTC, Val > Phe)

514 (TTC > TTT, Phe > Phe) 433 (TTC > TTT, Phe > Phe)

516 (GAC > GTC, Asp > Val) 435 (GAC > GTC, Asp > Val)

526 (CAC > GAC, His > Asp) 445 (CAC > GAC, His > Asp)

526 (CAC > TAC, His > Tyr) 445 (CAC > TAC, His > Tyr)

531 (TCG > TTG, Ser > Leu) 450 (TCG > TTG, Ser > Leu)

507/426 521/440

508/427 522/441

509/423 523/442

510/429 524/443

511/430 525/444

512/431 526/445

513/432 527/446

514/433 528/447

515/434 529/448

516/435 530/449

517/436 531/450

518/437 532/451

519/438 533/452

520/439 534/453

National PHL TB DST Reference CenterComparison Table for rpoB mutations

Historically, mutations in the rpoB gene of MTBC have been referenced by a numbering system based on

the E. coli genome. Mutations in rpoB are now numbered using the Mycobacterium tuberculosis (H37Rv)

reference genome codon system. By subtracting 81 from the old codon number, it will be converted to the

new codon number for M. tuberculosis or adding 81 to the new codon number, it will be converted to the

old E. coli numbering.

Most Common

Mutations

rpoB Codons (E.coli numbering/MTB numbering)


Page 2 of 18

Drug Loci ResultsRIF rpoB (170) 170 (GTC > TTC, Val > Phe) RIF rpoB (170) No mutationRIF rpoB (170) No sequenceRIF rpoB (170) PendingRIF rpoB (170) See commentsRIF rpoB (170) Not reproducibleRIF rpoB (170) Not testedRIF rpoB (426-440) 426 (GGC > GGA, Gly > Gly) RIF rpoB (426-440) 426 (GGC > GGT, Gly > Gly) RIF rpoB (426-440) 427 (ACC > GCC, Thr > Ala) RIF rpoB (426-440) 427 (ACC > ATC, Thr > Ile) RIF rpoB (426-440) 426-427 deletion (ACCAGC deletion)RIF rpoB (426-440) 427-430 deletion (ACCAGCCAGCTG deletion)RIF rpoB (426-440) 428 (AGC > CGC, Ser > Arg) RIF rpoB (426-440) 429 (AGC > AGG, Ser > Arg) RIF rpoB (426-440) 429 (CAG > CTG, Gln > Leu) RIF rpoB (426-440) 429 (CAG > CAT, Gln > His) RIF rpoB (426-440) 429 (CAG > CTG, Gln > Leu) and 435 (GAC > GTC, Asp > Val)RIF rpoB (426-440) 430 (CTG > CCG, Leu > Pro) RIF rpoB (426-440) 430 (CTG > CGG, Leu > Arg) RIF rpoB (426-440) 430 (CTG > CGG, Leu > Arg) and 435 (GAC > TAC, Asp > Tyr)RIF rpoB (426-440) 430 (CTG > CCG, Leu > Pro) and 435 (GAC > TAC, Asp > Tyr)RIF rpoB (426-440) 430 (CTG > CCG, Leu > Pro) and 435 (GAC > GGC, Asp > Gly)

RIF rpoB (426-440)430 (CTG > CCG, Leu > Pro), 431 (AGC > ACC, Ser >Thr) and 435 (GAC >TAC, Asp > Tyr)

RIF rpoB (426-440) 431 (AGC > ACC, Ser > Thr)RIF rpoB (426-440) 432 (CAA > CTA, Gln > Leu) RIF rpoB (426-440) 432 (CAA > AAA, Gln > Lys) RIF rpoB (426-440) 432 (CAA > GAA, Gln > Glu) RIF rpoB (426-440) 432 (CAA > CCA, Gln > Pro) RIF rpoB (426-440) 432 (CAA > CAC, Gln > His) RIF rpoB (426-440) 432 (CAA > CAG, Gln > Gln) RIF rpoB (426-440) 432-434 deletion (CAATTCATG deletion)

RIF rpoB (426-440)432-434 deletion (CAATTCATG deletion) and 435 (GAC > TAC, Asp >Tyr)

RIF rpoB (426-440) 433 (TTC > TTT, Phe > Phe) RIF rpoB (426-440) 443 (An Insertion of TTC after 433)RIF rpoB (426-440) 434 (ATG > ATA, Met > Ile) RIF rpoB (426-440) 434 (ATG > GTG, Met > Val) RIF rpoB (426-440) 434-440 deletion (ATGGACCAGAACAACCCGCTG deletion)

National PHL TB DST Reference CenterPSQ Reporting Language: rpoB for Rifampin


Page 3 of 18

Drug Loci ResultsRIF rpoB (426-440) 435 (GAC > GCC, Asp > Ala)RIF rpoB (426-440) 435 (GAC > TAC, Asp > Tyr) RIF rpoB (426-440) 435 (GAC > GGC, Asp > Gly) RIF rpoB (426-440) 435 (GAC > GTC, Asp > Val) RIF rpoB (426-440) 435 (GAC > GAG, Asp > Glu) RIF rpoB (426-440) 435 (GAC > TTC, Asp > Phe) RIF rpoB (426-440) 435-439 deletion (GACCAGAACAACCCG deletion)RIF rpoB (426-440) 436 (CAG > CAA, Gln > Gln) RIF rpoB (426-440) 436 deletion (CAG deletion) RIF rpoB (426-440) 437 deletion (AAC deletion) RIF rpoB (426-440) 436-437 deletion (CAGAAC deletion)RIF rpoB (426-440) 438 (AAC > AAA, Asn > Lys) RIF rpoB (426-440) 438 (AAC > AAG, Asn > Lys) RIF rpoB (426-440) 438 (AAC > AGG, Asn > Arg) RIF rpoB (426-440) 440 (CTG > TTG, Leu > Leu) RIF rpoB (426-440) No mutationRIF rpoB (426-440) No sequenceRIF rpoB (426-440) PendingRIF rpoB (426-440) See commentsRIF rpoB (426-440) Not reproducibleRIF rpoB (426-440) Not testedRIF rpoB (441-452) 441 (TCG > TTG, Ser > Leu) RIF rpoB (441-452) 441 (TCG > ACC, Ser > Thr) RIF rpoB (441-452) 441 (TCG > ACG, Ser > Thr) RIF rpoB (441-452) 441 (TCG > TTG, Ser > Leu) and 446 (AAG > AGG, Lys > Arg)RIF rpoB (441-452) 444(ACC > ACG, Thr > Thr)

RIF rpoB (441-452)444 (ACC > ACG, Thr > Thr), 445 (CAC > ACC, His > Thr) and 446 (AAG > CAG, Lys > Gln)

RIF rpoB (441-452) 445 (CAC > TAC, His > Tyr) RIF rpoB (441-452) 445 (CAC > GCC, His > Ala) RIF rpoB (441-452) 445 (CAC > CTC, His > Leu) RIF rpoB (441-452) 445 (CAC > GAC, His > Asp) RIF rpoB (441-452) 445 (CAC > CAA, His > Gln) RIF rpoB (441-452) 445 (CAC > CAG, His > Gln) RIF rpoB (441-452) 445 (CAC > TGC, His > Cys) RIF rpoB (441-452) 445 (CAC > AAC, His > Asn) RIF rpoB (441-452) 445 (CAC > AGC, His > Ser) RIF rpoB (441-452) 445 (CAC > CGC, His > Arg) RIF rpoB (441-452) 445 (CAC > CCC, His > Pro) RIF rpoB (441-452) 445 (CAC > GGC, His > Gly)



Page 4 of 18

Drug Loci ResultsRIF rpoB (441-452) 445 (CAC > TCC, His > Ser) RIF rpoB (441-452) 445 (CAC > ACC, His >Thr)RIF rpoB (441-452) 445 (CAC > TCC, His > Ser) and 446 (AAG > CGG, (Lys > Arg)RIF rpoB (441-452) 445 (CAC > TCC, His > Ser) and 446 (AAG > CAG, (Lys > Gln)RIF rpoB (441-452) 445 (CAC > CAG, His > Gln) and 452 (CTG > CCG, (Leu > Pro)RIF rpoB (441-452) 446 (AAG > AAA, Lys > Lys) RIF rpoB (441-452) 446 (AAG > AGG, Lys > Arg) RIF rpoB (441-452) 447 (CGC > CGT, Arg > Arg) RIF rpoB (441-452) 447 (CGC > CGA, Arg > Arg) RIF rpoB (441-452) 447 (CGC > CGG, Arg > Arg) RIF rpoB (441-452) 448 (CGA > CCA, Arg > Pro) RIF rpoB (441-452) 450 (TCG > TTG, Ser > Leu) RIF rpoB (441-452) 450 (TCG > TTC, Ser > Phe) RIF rpoB (441-452) 450 (TCG > TGG, Ser > Trp) RIF rpoB (441-452) 450 (TCG > TGT, Ser > Cys) RIF rpoB (441-452) 450 (TCG > CAG, Ser > Gln) RIF rpoB (441-452) 452 (CTG > CCG, Leu > Pro) RIF rpoB (441-452) 452 (CTG > GAG, Leu > Glu) RIF rpoB (441-452) No mutationRIF rpoB (441-452) No sequenceRIF rpoB (441-452) PendingRIF rpoB (441-452) See commentsRIF rpoB (441-452) Not reproducibleRIF rpoB (441-452) Not tested

PSQ Reporting Language: rpoB for RifampinNational PHL TB DST Reference Center


Page 5 of 18

Scenario InterpretationNo mutations Probably susceptible to RIF.Ser450Leu (TCG > TTG), and others including Val170Phe (GTC>TTC) RIF resistant.Prelim Report: If all 3 of the loci don't have results or any combination of rpoB (426-440) & rpoB (441-452) are missing results Will re-test.If Requires Re-Testing and Comments Will re-test and see comments.Final Report Requires Comments See comments.Prelim report: rpoB (426-440) & rpoB (441-452) have results but no results for rpoB (170)

Suggest susceptibility to RIF. Will re-test codon 170 of rpoB . Sensitivity for detecting RIF resistance increases 0.25% when mutations in codon 170 are detected.

Final Report: rpoB (426-440) & rpoB(441-452) have results but no results for rpoB(170)

Suggest susceptibility to RIF, despite no results for codon 170 of rpoB . Sensitivity for detecting RIF resistance increases 0.25% when mutations in codon 170 are detected.

Final Report: Both rpoB (426-440) & rpoB (441-452) or either one has no results, but rpoB (170) has results Unable to predict RIF results due to unsuccessful sequencing.

Final Report: No results for rpoB (426-440), rpoB (441-452) or rpoB (170).

Unsuccessful rpoB sequencing may be due to low DNA concentration of M. tuberculosis complex. Unable to predict RIF results.

Final Report: Phe433Phe (TTC >TTT) This is a silent mutation, not associated with RIF resistance.

Final Report: Leu533Pro (CTG > CCG)

Low level, but probably clinically relevant RIF resistance has been associated with this rpoB mutation in the literature. Isolates with this mutation may test RIF susceptible by culture-based techniques. Treatment consultation is available at TB Centers of Excellence https://www.cdc.gov/tb/education/tb_coe/default.htm

New mutations, association with resistance unknown.

This rpoB mutation has not been detected previously in our laboratory. Unable to predict RIF results.

New mutation to MDL, associated with resistance in the literature

This rpoB mutation has not been detected previously in our laboratory. It has been associated with RIF resistance in the literature.



Page 6 of 18

Drug Loci Results INH katG No mutation

INH katG No sequence

INH katG Pending

INH katG See comments

INH katG Not reproducible

INH katG Not tested

INH katG 314 (ACC > GCC, Thr > Ala)

INH katG 315 (AGC > ACC, Ser>Thr)

INH katG 315 (AGC > ACA, Ser > Thr)

INH katG 315 (AGC > ACG, Ser > Thr)

INH katG 315 (AGC > ACT, Ser > Thr)

INH katG 315 (AGC > AAC, Ser > Asn)

INH katG 315 (AGC > AGG, Ser > Arg)

INH katG 315 (AGC > GGC, Ser > Gly)

INH katG 315 (AGC > ATC, Ser > Ile)

INH katG 316 (GGC > AGC, Gly > Ser)

INH inhA No mutation

INH inhA No sequence

INH inhA Pending

INH inhA See comments

INH inhA Not reproducible

INH inhA Not tested

INH inhA -17 (G > T)

INH inhA -16 (A > G)

INH inhA -15 (C > T)

INH inhA -9 (G > T)

INH inhA -8 (T > C)

INH inhA -8 (T > G)

INH inhA -8 (T > A)

INH ahpC No mutation

PSQ Reporting Language: katG, inhA, ahpC, fabG1 for IsoniazidNational PHL TB DST Reference Center


Page 7 of 18

Drug Loci Results INH ahpC No sequence

INH ahpC Pending

INH ahpC See comments

INH ahpC Not reproducible

INH ahpC Not tested

INH ahpC -57 (C > T)



INH ahpC -52 (C > G)

INH ahpC -52 (C > A)

INH ahpC -51 (G > A)

INH ahpC -49 (T > C)

INH ahpC -48 (G > A)

INH ahpC -46 (T insertion after -46)

INH fabG1 No mutation

INH fabG1 No sequence

INH fabG1 Pending

INH fabG1 See comments

INH fabG1 Not reproducible

INH fabG1 Not tested

INH fabG1 203 (CTG > CTA, Leu > Leu)

National PHL TB DST Reference CenterPSQ Reporting Language: katG, inhA, ahpC, fabG1 for Isoniazid


Page 8 of 18

Scenario No ResultsMutations Detected

Interpretation

No mutations detected in katG, inhA, ahpC , or fabG1

N/A None Suggests susceptibility to INH.

Mutation(s) detected in katG only

N/A katG INH Resistant

Mutation(s) detected in ahpC only

N/A ahpC Associated with INH resistance.

Mutation(s) detected in inhA only

N/A inhA

INH resistant. May also be associated with ethionamide resistance. Isolates with this mutation may test INH susceptible by some culture-based techniques.

Mutation(s) detected in fabG1 only

N/A fabG1

INH resistant. May also be associated with ethionamide resistance. Isolates with this mutation may test INH susceptible by some culture-based techniques.

No sequence in any of the 4 INH locus, but at least one of the 8 PSQ loci tested has sequence from cultures or sediments with AFB smear ≤ 2+.

katG, inhA, ahpC, or fabG1

N/A Will re-test.

No sequence in all 8 loci on sediments with AFB smear 3+ to 4+.


N/A Will re-test.

No sequence in any of the 4 INH loci and conditions require free-text comments.


N/A Will re-test; see comments.

Conditions require free-text comments.

N/A N/A See comments.

National PHL TB DST Reference CenterPSQ Reporting Language: katG , inhA , ahpC , fabG1 for Isoniazid


Page 9 of 18


Interpretation

Final Report: No sequence was obtained from all 4 INH loci (INH Components), but MTBC was detected and at least one other locus yielded valid results.


N/A

Unable to predict INH result because of unsuccessful sequencing, possibly due to low M. tuberculosis complex DNAconcentration.

Final Report: No results for katG , no mutations in rpoB and with or without any results for inhA, ahpC or fabG1

katG None Unable to predict INH results.

Final Report: No results for inhA and no mutations in ahpC, fabG1, katG or rpoB .

inhA None

Possibly INH susceptible because of no katG mutation, but the interpretation is less clear because there are no results for INH and 13% of INH resistance is due to inhA mutations.

Final Report: No results for ahpC and no mutations in inhA, katG, fabG1 and rpoB.

ahpC None

Suggests susceptibility to INH, because only ahpC was not successfully sequenced. INH resistance due to mutations in ahpC is rare.

Final Report: No results for fabG1 and no mutations in inhA, ahpC, katG and rpoB.

fabG1 None

Suggests susceptibility to INH, because only fabG1 was not successfully sequenced. INH resistance due to mutations in fabG1 is rare.

Final Report: No results for inhA and ahpC and no mutations in katG, fabG1 or rpoB

inhA, ahpC None

Possibly INH susceptible because of no katG mutation, but the interpretation is less clear due to no results for inhA and ahpC, and 15% of INH resistance is due to mutations in inhA and ahpC .

National PHL DST Reference CenterPSQ Reporting Language: katG , inhA , ahpC , fabG1 for Isoniazid


Page 10 of 18


Interpretation

Final Report: No results for inhA or fabG1 and no mutations in katG, ahpC or rpoB .

inhA, fabG1

None

Possibly INH susceptible because of no katG mutation, but the interpretation is less clear due to no results for inhA and fabG1 , and 14% of INH resistance is due to mutations in inhA and fabG1 .

Final Report: No results for inhA , ahpC or fabG1 and no mutations in katG or rpoB .

inhA, ahpC, fabG1

None

Possibly INH susceptible because of no katG mutation, but the interpretation is less clear due to no results for inhA , aphC and fabG1 , and 16% of INH resistance is due to mutations in these three loci.

Final Report: No results for ahpC or fabG1 and no mutations in inhA, katG or rpoB .

ahpC, fabG1

None

Suggests susceptibility to INH because of no katG or inhA mutations, but sensitivity for INH resistance detection may be reduced by 2-3% because of no results for ahpC and fabG1 .

Final Report: INH Testing not requested

N/A N/A Test not requested

Final Report: No Mutations detected in 4 INH loci but an rpoB mutation (excluding silent mutations) is detected

N/ArpoB

(nonsynonymous)

No mutations detected in the four INH loci suggest susceptibility to INH, but the possibility of INH-resistance is increased due to the presence of a nonsynonymous rpoB mutation.

Final Report: Any of the 4 INH loci yielded no sequence, and a nonsynonymous mutation in rpoB was detected.

At least 1 loci

rpoB (nonsynony

mous)

Unable to predict INH results, but the possibility of INH-resistance is increased due to the presence of a nonsynonymous rpoB mutation.



Page 11 of 18


Interpretation

Final Report: When a mutation new to MDL is detected

N/A Any INH Loci

This mutation has not been detected previously at MDL, but its association with INH resistance has been reported in the literature.

Final Report: When a mutation new to the literature is detected

N/A Any INH LociThis is a new mutation; its association with INH resistance is unknown.



Page 12 of 18

Drug Loci ResultsInjectable Drugs rrs (nt 1397-1406) 1401 (A>G)Injectable Drugs rrs (nt 1397-1406) 1402 (C>T)

Scenario

No mutations

Prelim Report: PendingPrelim Report: No sequenceIf Requires Re-Testing and CommentsPrelim or Final Report Requires Comments.

Final Report: No results for rrs

Final Report: No results for rrs and Requires Comments

Final Report: 1401 (A>G)

Final Report: 1402 (C>T)

New mutation, association with resistance unknown.

New mutation, association with resistance in the literature

National PHL TB DST Reference CenterPSQ Reporting Language: rrs for Injectable Drugs

Interpretation

This rrs mutation has not been detected previously in our laboratory. It has been associated with resistance to amikacin, capreomycin and kanamycin in the literature.

This rrs mutation has not been detected previously in our laboratory. Unable to predict results for amikacin, capreomycin and kanamycin.

Capreomycin resistant. This mutation is rarely detected at our laboratory. Its association with amikacin and kanamycin resistance is variable in the literature. Treatment consultation is available at Centers of Excellence (https://www.cdc.gov/tb/education/tb_coe/default.htm).

Amikacin and kanamycin resistant, and frequently associated with capreomycin resistance (46-89%).Treatment consultation is available at Centers of Excellence (https://www.cdc.gov/tb/education/tb_coe/default.htm).

Unable to predict results for injectable drugs because no sequence was generated. See comments.

Unable to predict results for injectable drugs because no sequence was generated.

See comments.Will retest and see comments.Will retest.rrs sequencing will be performed in next run.

Suggests susceptibility to amikacin, capreomycin and kanamycin.


Page 13 of 18

Drug Loci ResultsQuinolones gyrA (88-95) Asp94Gly (GAC>GGC)Quinolones gyrA (88-95) Ala90Val (GCG>GTG)Quinolones gyrA (88-95) Gly88Cys (GGC>TGC)Quinolones gyrA (88-95) Ala90Lys (GCG>AAG)Quinolones gyrA (88-95) Ser91Pro (TCG>CCG)Quinolones gyrA (88-95) Asp94His (GAC>CAC)Quinolones gyrA (88-95) Asp94Ala (GAC>GCC)Quinolones gyrA (88-95) Asp94Tyr (GAC>TAC)Quinolones gyrA (88-95) Asp94Phe (GAC>TTC)

National PHL TB DST Reference CenterPSQ Reporting Language: gyrA for Quinolones


Page 14 of 18

Scenario InterpretationNo mutations Suggests susceptibility to quinolones.Pending gyrA sequencing will be performed in next run.Prelim Report: No sequence Will retest.If Requires Re-Testing and Comments Will retest. See comments.Prelim or Final Report Requires Comments. See comments

No results for gyrAUnable to predict quinolone results because no sequence was generated.

Final Report: No results for gyrA and Requires Comments

Unable to predict quinolone results because no sequence was generated. See comments.

Most common mutations

Final Report: Asp94Gly (GAC>GGC)Quinolone resistant. Moxifloxacin MIC testing will be performed when a pure culture is available. Treatment consultation is available at Centers of Excellence https://www.cdc.gov/tb/education/tb_coe/default.htm.

Final Report: Ala90Val (GCG>GTG)

Associated with ofloxacin and levofloxacin resistance, but moxifloxacin may still contribute to therapy. Moxifloxacin MIC testing will be performed when a pure culture is available. Treatment consultation is available at Centers of Excellence https://www.cdc.gov/tb/education/tb_coe/default.htm.

Less common mutations

Final Report Gly88Cys (GGC>TGC)Associated with quinolone resistance. Moxifloxacin MIC testing will be performed when a pure culture is available. Treatment consultation is available at Centers of Excellence (https://www.cdc.gov/tb/education/tb_coe/default.htm).

Final Report: Ala90Lys (GCG>AAG)

Associated with quinolone resistance. Moxifloxacin may still contribute to therapy. Moxifloxacin MIC testing will be performed when a pure culture is available. Treatment consultation is available at Centers of Excellence https://www.cdc.gov/tb/education/tb_coe/default.htm.

Final Report: Ser91Pro (TCG>CCG)


Final Report: Asp94His (GAC>CAC)


Final Report: Asp94Ala (GAC>GCC)




Page 15 of 18

Scenario Interpretation

Final Report: Asp94Tyr (GAC>TAC)


Final Report: Asp94Phe (GAC>TTC)


New Mutation, association with resistance unknown

This gyrA mutation has not been detected previously in ourlaboratory. Unable to predict quinolone resistance. Moxifloxacin MIC testing will be performed when a pure culture is available.

New Mutation, association with resistance in the literature

This gyrA mutation has not been detected previously in ourlaboratory. It has been associated with quinolone resistance in the literature. Moxifloxacin MIC testing will be performed when a pure culture is available.



Page 16 of 18

Loci Result Interpretation Comments

pncAMTBC sequence detected (not M. bovis)

DNA of M. tuberculosis complex detected (not M. bovis ).

pncAMTBC sequence detected (M. bovis)

DNA of M. bovis detected. M. bovis is resistant to PZA and is a species in the M. tuberculosis complex.

IS6110 MTBC sequence detected DNA of M. tuberculosis complex detected.pncA locus is the primary target to use; when pncA yields no sequence, IS6110 is used. IS6110 cannot distinguish M. bovis from other members in MTBC.

pncA No sequence

DNA of M. tuberculosis complex not detected. May be due to lack of or insufficient DNA of M. tuberculosis complex or presence of inhibitory substances.

When tested on sediments and DNA not purified.

pncA No sequenceDNA of M. tuberculosis complex not detected. May be due to lack of or insufficient DNA of M. tuberculosis complex.

When tested on cultures, or purified DNA. (DNA purification is performed on sediments with smear results >2+.)

pncA No sequence Will re-test.pncA No sequence Will re-test. See comments.

pncA See comments See comments.

pnCA and IS6110 No sequence

Some strains of M. tuberculosis complex do not contain IS6110. Failure to detect IS6110 does not rule out presence of M. tuberculosis complex.

When smear is of low-positive. Both pncA and IS6110 yielded no sequences, but two or more drug loci have valid results. pncA is less sensitive than IS6110.

pncA Not reproducibleDetection of M. tuberculosis complex is inclusive.

pncA Pending N/A

pncA Not tested N/A

National PHL DST Reference Center

PSQ Reporting Language: Detection of MTBC


Page 17 of 18

Canned comments ApplicationPlease submit a sediment of higher smear positivity with a volume of 0.5 ml or greater or a positive culture for PSQ. when PSQ yielded no resultsLess than 0.5 ml sediment received. Test results may be compromised due to insufficient volume.

When PSQ yielded no results, and report says "see comments"

PSQ was not requested but performed due to mixed culture with Non-TB mycobacteria.

PSQ was not requested but performed due to culture contaminated with non-AFB bacteria.

PSQ was not requested but performed to confirm INH resistance detected by MGIT 960

PSQ was not requested but performed to confirm RIF resistance detected by MGIT 960.PSQ was not requested but performed to confirm INH and RIF resistance detected by MGIT 960.The submitting laboratory informed MDL that no mutations in rpoB were detected by GeneXpert.

This may be useful when rpoB sequencing by PSQ is not successful.

The rpoB mutation, 450 (TCG > TTG, Ser > Leu), now named using the MTBC codon system, is the same as 531 (TCG > TTG, Ser > Leu), named previously using the E. coli codon system.

The rpoB mutation, 445 (CAC > TAC, His > Tyr) , now named using the MTBC codon system, is the same as 526 (CAC > TAC, His > Tyr), named previously using the E. coli codon system.

The rpoB mutation, 445 (CAC > GAC, His > Asp) , now named using the MTBC codon system, is the same as 526 (CAC > GAC, His > Asp), named previously using the E. coli codon system.

The rpoB mutation, 435 (GAC > GTC, Asp > Val) , now named using the MTBC codon system, is the same as 516 (GAC > GTC, Asp > Val) , named previously using the E. coli codon system.

The rpoB mutation, 433 (TTC > TTT, Phe > Phe), now named using the MTBC codon system, is the same as 514 (TTC > TTT, Phe > Phe), named previously using the E. coli codon system.The rpoB mutation is now named using the MTBC codon system. By adding 81 to the new codon number, it will be converted to the codon number previously named using the E. coli codon system.

The rpoB mutation, 170 (GTC > TTC, Val > Phe), now named using the MTBC codon system, is the same as 176 (GTC > TTC, Val > Phe) , named previously using the E. coli codon system.

PSQ Reporting Language: Additional CommentsNational PHL DST Reference Center


Page 18 of 18

Documents

National PH TB DST Reference Center pdated May 1 22...National PHL TB DST Reference Center Updated May 1, 2020 Page 2 of 18. Drug Loci. Results. RIF . rpoB (170) 170 (GTC > TTC, Val