Name:  ___________________________________________  Per.:  _______  Date:  ______________________  Assignment  #:  _________  Central  Dogma  Notes  Part  B  

 Recall:  The  central  dogma  of  molecular  biology  shows  the  flow  of  information  in  cells    

 Translation  

• Translation  =  _________________________________________________________________________________________________  

• To  do  this,  mRNA  nucleotide  bases  (A,  U,  G,  C)  must  be  translated  into  amino  acids  

• To  translate  something  means  to  write  something  in  a  __________________________________________________  

• Why  do  we  need  to  translate  RNA?    

o RNA  is  made  of  __________________________________  

o Proteins  are  made  of  __________________________________  

 Leaving  the  Nucleus  

• mRNA  leaves  the  nucleus  and  heads  to  the  ___________________________________  

 Reading  mRNA  

• The  ribosome  must  read  and  translate  the  mRNA  

• mRNA  is  “read”  as  sequences  of  ___________  nitrogenous  bases,  called  ______________________________.      

• Each  codon  codes  for  an  ______________________________________.      

 The  Genetic  Code  

• How  do  we  know  what  amino  acids  will  be  used?      

• Each  codon  codes  for  a  specific  amino  acid!  

 • The  _______________________________________shows  how  each  set  of  3  bases  will  convert  into  an  amino  

acid  (AA).      

• Ex  1:  What  AA  will  CUU  translate  to?      Answer:  _____________________________________________________  

• Ex  2:  What  AA  will  CAC  translate  to?      Answer:  _____________________________________________________  

• Ex  3:  What  codons  translate  to  Pro  (proline)?      Answer:  _________________________________________________  

• Ex  4:  What  will  the  amino  acid  sequence  be  for  the  given  mRNA  strand:  CCAGUACAG  

o Step  1:  separate  into  codons  (3’s):                      ___________________________________________________________  

o Step  2:  Use  the  chart  to  translate:                      __________________________________________________________  

• Ex  5:  What  will  the  amino  acid  sequence  be  for  the  given  mRNA  strand:  AAUCGGGUU  

o Step  1:  separate  into  codons:                                          _________________________________________________________  

o Step  2:  Use  the  chart  to  translate:                        _________________________________________________________  

• The  genetic  code  is  _____________________________________  =  it  is  the  same  for  ALL  living  organisms!  

Start  and  Stop  Codons  

 • Translation  will  look  for  and  start  at  the  codon  ______________,  which  translates  to  _________________.      

• AUG  =  the  __________________________________  

• Example  

o Translate  the  following  mRNA  strand:  CCAGUAAUGGGCAGACCAGAC  

o Answer:    

Step  1:  ___________  -­‐  ____________  -­‐  ____________  -­‐  ___________  -­‐______________  

Step  2:  ___________  -­‐  ____________  -­‐  ____________  -­‐  ___________  -­‐______________  

• When  does  translation  end?      

o Translation  will  stop  when  it  encounters  a    _______________________________________________________  

• Example    

o Translate  the  following  mRNA  strand:  GCACAUGCAGACGUAGGACCA  

o Step  1:  ________________________________________________________________________________________________  

o Step  2:  ________________________________________________________________________________________________  

Finally  

• Once  I  have  my  amino  acid  polypeptide,  it  will  eventually  fold  into  a  protein!