Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
Name: ___________________________________________ Per.: _______ Date: ______________________ Assignment #: _________ Central Dogma Notes Part B
Recall: The central dogma of molecular biology shows the flow of information in cells
Translation
• Translation = _________________________________________________________________________________________________
• To do this, mRNA nucleotide bases (A, U, G, C) must be translated into amino acids
• To translate something means to write something in a __________________________________________________
• Why do we need to translate RNA?
o RNA is made of __________________________________
o Proteins are made of __________________________________
Leaving the Nucleus
• mRNA leaves the nucleus and heads to the ___________________________________
Reading mRNA
• The ribosome must read and translate the mRNA
• mRNA is “read” as sequences of ___________ nitrogenous bases, called ______________________________.
• Each codon codes for an ______________________________________.
The Genetic Code
• How do we know what amino acids will be used?
• Each codon codes for a specific amino acid!
• The _______________________________________shows how each set of 3 bases will convert into an amino
acid (AA).
• Ex 1: What AA will CUU translate to? Answer: _____________________________________________________
• Ex 2: What AA will CAC translate to? Answer: _____________________________________________________
• Ex 3: What codons translate to Pro (proline)? Answer: _________________________________________________
• Ex 4: What will the amino acid sequence be for the given mRNA strand: CCAGUACAG
o Step 1: separate into codons (3’s): ___________________________________________________________
o Step 2: Use the chart to translate: __________________________________________________________
• Ex 5: What will the amino acid sequence be for the given mRNA strand: AAUCGGGUU
o Step 1: separate into codons: _________________________________________________________
o Step 2: Use the chart to translate: _________________________________________________________
• The genetic code is _____________________________________ = it is the same for ALL living organisms!
Start and Stop Codons
• Translation will look for and start at the codon ______________, which translates to _________________.
• AUG = the __________________________________
• Example
o Translate the following mRNA strand: CCAGUAAUGGGCAGACCAGAC
o Answer:
Step 1: ___________ -‐ ____________ -‐ ____________ -‐ ___________ -‐______________
Step 2: ___________ -‐ ____________ -‐ ____________ -‐ ___________ -‐______________
• When does translation end?
o Translation will stop when it encounters a _______________________________________________________
• Example
o Translate the following mRNA strand: GCACAUGCAGACGUAGGACCA
o Step 1: ________________________________________________________________________________________________
o Step 2: ________________________________________________________________________________________________
Finally
• Once I have my amino acid polypeptide, it will eventually fold into a protein!